Supercharge Your Innovation With Domain-Expert AI Agents!

A kind of lipase extraction method

An extraction method and lipase technology, applied in the field of recombinant lipase production and extraction, can solve the problems of limited production capacity, complex downstream purification process, and difficulty in expanding production scale, and achieve the effect of reducing production costs

Active Publication Date: 2020-06-16
ZHEJIANG UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] At present, industrial lipase is mainly obtained by microbial fermentation. The production process and downstream purification process of microbial fermentation are complicated, and there are strict requirements for production equipment, transportation and storage. It is difficult to expand the production scale. Therefore, the production cost of lipase is high and the production capacity is limited.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of lipase extraction method
  • A kind of lipase extraction method
  • A kind of lipase extraction method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1: Construction of rice transformation T-DNA vector pCAMB1300-GT1-rCalB

[0024] Lipoprotein, protein-linked peptide and lipase are connected in turn to form a recombinant lipase, which is artificially synthesized by Shanghai Sangong Co., Ltd. (Shanghai, China) containing a recombinant lipase gene (the amino acid sequence of the encoded protein is shown in SEQ ID NO.1, Wherein the 1st-117th amino acid is oil body protein, the 118-157th amino acid is a protein linking peptide, the 158-474th amino acid is lipase) and the nucleotide of the 35S terminator, and its sequence is shown in SEQ ID NO.2 .

[0025] Using PCR primer GT1-F (5' AAGCTT GAGATTCATCAATATGAGAA

[0026] AAC, the underline is the HindⅢ site); and GT1-R (5' TCTAGA CTGGGCTAGGGAGCCATCGCAC, the underline is the XbaI site) a rice endosperm-specific promoter was amplified from rice (Oryza sativa japonica L.) genomic DNA, 908 bp in length, and the nucleotide sequence is shown in SEQ ID NO.3.

[0027] ...

Embodiment 2

[0029] Example 2: Obtaining of transgenic rice containing recombinant lipase gene

[0030] The method for obtaining transgenic rice is to adopt the Agrobacterium infection method, transform according to the method and medium formula reported by Zhao et al. Seeds of "Xiushui 134" were dehulled, and callus was induced as transformation material. Take the Agrobacterium containing the T-DNA vector pCAMB1300-GT1-rCalB of Example 1 and streak culture on the YEP plate containing 50 mg / mL kana resistance, pick a single colony and inoculate it into the YEP liquid medium, and cultivate it at 28°C until the OD660 is 0.5. Put the rice callus to be transformed into OD660 of 0.5 containing 40mg / mL acetosyringone Agrobacterium liquid, 28 ℃, 120rpm vibration on a horizontal shaker for 1 hour, allowing Agrobacterium to bind to the callus surface, and then The callus was transferred to the co-culture medium and co-cultivated at 26°C for 2-3 days. The transformed callus was rinsed with steril...

Embodiment 3

[0031] Embodiment 3: Extraction of recombinant lipase in rice seeds

[0032] Dehull the transgenic rice seeds obtained in Example 2, take 5 g of the dehulled seeds and add them to 100 mL pH8.0, 20 mM Tris-HCl buffer solution for homogenization treatment, shake and extract for 2 hours after homogenization, and take the supernatant after standing solution, add 10mL rapeseed oil to 100ml supernatant, mix thoroughly, and collect the oil layer to be the extract containing immobilized recombinant lipase.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a lipase extraction method. According to the method, recombinant lipase fused with rice oleosin, protein linker peptide and lipase is expressed in paddy rice seeds by a rice specific promoter. An end N of the recombinant lipase produced by the invention is connected with the rice oleosin, so that the recombinant lipase can be anchored in an oil body, and purification and recycling of the recombinant lipase are facilitated. According to the method disclosed by the invention, the oleosin is connected with the lipase by the protein linker peptide, so that the influence of oleosin on the structure of the lipase is lowered, and the recombinant lipase can maintain high activity. According to the method disclosed by the invention, a large number of high-activity lipase can be produced with low cost, and the obtained lipase is easily purified and recycled, so as to be beneficial for the reduction of application cost of the lipase.

Description

[0001] (1) Technical field [0002] The invention relates to the production and extraction of a recombinant lipase which is easy to purify and recover. [0003] (2) Background technology [0004] Lipase, the full name of triacylglycerol hydrolase, can catalyze the hydrolysis of ester bonds on the lipid-water interface, and can catalyze the hydrolysis, alcoholysis, esterification, transesterification and Reverse synthesis of esters. Lipase widely exists in animals, plants and microorganisms. Due to the variety of microorganisms, wide distribution, strong adaptability and rapid evolution, lipases in microorganisms often have a wider range of action temperature, pH and bottom than lipases derived from animals and plants. Specificity and other advantages. Microorganisms are the main source of lipase for industrial use. [0005] Lipase is widely used in industrial production. For example, in the food industry, lipase is used for meat degreasing, flour improvement, oil modificati...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/20
CPCC12N9/20C12Y301/01003
Inventor 林朝阳沈志成
Owner ZHEJIANG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com