A kind of tobacco drought response gene nttify and its cloning method and application
A tobacco and gene technology, applied in the field of genetic engineering, can solve the problems of decreased antioxidant protection enzyme activity, research, reduced seed germination and seedling survival, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0047] Example 1: Drought Response Genes NTIFY discovery
[0048] After the K326 seeds were germinated in hydroponics at 24°C, they were cultured in a light culture room with a temperature of 24-26°C, a humidity of 60%, and a light-dark cycle of 12h / 12h. When the seedlings grow to four leaves and one heart (about 14 days), the whole plant is taken out, the water is sucked up, and the air is dried and the drought is forced to deal with the experiment. The treatment time was 0.5, 1, 2, 4, 8, 16, and 24 hours respectively; the tobacco seedlings without drought stress treatment were used as the control group, and chip detection was performed. The result is as figure 1 Shown: In the case of drought treatment, NTIFY The gene expression was down-regulated, indicating that the gene was regulated by drought.
Embodiment 2
[0049] Example 2: Cloning NTIFY Gene
[0050] Tobacco leaf cDNA was used as a template, and primers were designed according to the tobacco genome database information, and the NTIFY PCR amplification of the gene to obtain the PCR amplification product. Design primers as follows:
[0051] Forward primer: 5'- ATGGCATCATCGGAGATGGTG -3';
[0052] Reverse primer: 5'- CTAGAATTGCTCAGTTTTCACTG -3'.
[0053] The PCR reaction system and amplification conditions are shown in Table 1.
[0054] Table 1 PCR reaction system and amplification conditions
[0055]
[0056] The amplified PCR product was electrophoresed on a 0.8% agarose gel, and the gel electrophoresis results were as follows: figure 2 shown. After electrophoresis, the PCR product purification kit from Qiagen was used to recover and purify the PCR product according to the product instructions, and sent to Invitrogen for sequencing to verify the sequence results.
Embodiment 3
[0057] Example 3: Construction of overexpression and RNAi interference recombinant vectors
[0058] (1) In Example 2 NTIFY The full-length fragment was used as a template, and the primers containing the gateway adapter sequence were used for PCR amplification. After the PCR product was purified, the amplified product was inserted into the pDONR-Zeocin (Figure 4) vector of Invitrogen Company through BP reaction. The constructed BP reaction carrier will be converted to NTIFY The fragments were replaced into the PB2GW7 (Figure 5) vector. Gateway reaction primer sequences are as follows:
[0059] NtTIFY_F: 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTGCATGGCATCATCGGAGATGGTG-3';
[0060] NtTIFY_R: 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTCCTAGAATTGCTCAGTTTTCACTG-3'.
[0061] In Example 2 NTIFY The full-length fragment was used as a template, and PCR amplification was performed with RNAi interference carrier primers containing the gateway linker sequence. After purification of the PCR product, the a...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More