Primer and probe for detecting porcine pseudorabies viruses, fluorescent quantitative PCR (polymerase chain reaction) kit, method and application
A porcine pseudorabies virus and fluorescence quantitative technology, applied in the field of virus PCR detection, can solve the problems of insufficient specificity, sensitivity and timeliness, and achieve the effect of simple and reliable technical tools, good repeatability and high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] Example 1 Primers and Probes
[0046] The embodiment of the present invention provides a kind of primer and probe for the specific detection of porcine pseudorabies virus field virus, wherein:
[0047] The nucleotide sequence of the primer is as follows:
[0048] Upstream primer: 5' CGGCTTCGACGTCTGGTT 3',
[0049] Downstream primer: 5' GCCATAGTTGGGTCCATTCG 3';
[0050] The probe sequence is as follows:
[0051] 5' FAM-CCGGAGAAACCGGAAG-MGB 3';
Embodiment 2
[0052] Example 2 Fluorescent quantitative PCR detection reagent
[0053] An embodiment of the present invention provides a fluorescent quantitative PCR detection reagent for detecting wild virus of porcine pseudorabies virus. Primers and probes; where,
[0054] The nucleotide sequences of the primers are as follows:
[0055] Upstream primer: 5' CGGCTTCGACGTCTGGTT 3',
[0056] Downstream primer: 5' GCCATAGTTGGGTCCATTCG 3';
[0057] The probe sequence is as follows:
[0058] 5' FAM-CCGGAGAAACCGGAAG-MGB 3'.
[0059] The reaction mixture was Premix Ex Taq (Probe qPCR) produced by TaKaRa Company; the water was RNase-free Water produced by TaKaRa Company.
Embodiment 3
[0060] Example 3 Fluorescent quantitative PCR kit
[0061] The embodiment of the present invention provides a fluorescent quantitative PCR kit for preparing and detecting wild virus of porcine pseudorabies virus, specifically a kit containing the fluorescent quantitative PCR detection reagent of Example 2.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


