Unlock instant, AI-driven research and patent intelligence for your innovation.

Primer and probe for detecting porcine pseudorabies viruses, fluorescent quantitative PCR (polymerase chain reaction) kit, method and application

A porcine pseudorabies virus and fluorescence quantitative technology, applied in the field of virus PCR detection, can solve the problems of insufficient specificity, sensitivity and timeliness, and achieve the effect of simple and reliable technical tools, good repeatability and high sensitivity

Inactive Publication Date: 2018-03-23
SHANDONG NEW HOPE LIUHE GROUP
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These conventional methods have shortcomings in specificity, sensitivity and timeliness when used in the detection of wild PRV infection, especially in the early diagnosis of viral infection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer and probe for detecting porcine pseudorabies viruses, fluorescent quantitative PCR (polymerase chain reaction) kit, method and application
  • Primer and probe for detecting porcine pseudorabies viruses, fluorescent quantitative PCR (polymerase chain reaction) kit, method and application
  • Primer and probe for detecting porcine pseudorabies viruses, fluorescent quantitative PCR (polymerase chain reaction) kit, method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1 Primers and Probes

[0046] The embodiment of the present invention provides a kind of primer and probe for the specific detection of porcine pseudorabies virus field virus, wherein:

[0047] The nucleotide sequence of the primer is as follows:

[0048] Upstream primer: 5' CGGCTTCGACGTCTGGTT 3',

[0049] Downstream primer: 5' GCCATAGTTGGGTCCATTCG 3';

[0050] The probe sequence is as follows:

[0051] 5' FAM-CCGGAGAAACCGGAAG-MGB 3';

Embodiment 2

[0052] Example 2 Fluorescent quantitative PCR detection reagent

[0053] An embodiment of the present invention provides a fluorescent quantitative PCR detection reagent for detecting wild virus of porcine pseudorabies virus. Primers and probes; where,

[0054] The nucleotide sequences of the primers are as follows:

[0055] Upstream primer: 5' CGGCTTCGACGTCTGGTT 3',

[0056] Downstream primer: 5' GCCATAGTTGGGTCCATTCG 3';

[0057] The probe sequence is as follows:

[0058] 5' FAM-CCGGAGAAACCGGAAG-MGB 3'.

[0059] The reaction mixture was Premix Ex Taq (Probe qPCR) produced by TaKaRa Company; the water was RNase-free Water produced by TaKaRa Company.

Embodiment 3

[0060] Example 3 Fluorescent quantitative PCR kit

[0061] The embodiment of the present invention provides a fluorescent quantitative PCR kit for preparing and detecting wild virus of porcine pseudorabies virus, specifically a kit containing the fluorescent quantitative PCR detection reagent of Example 2.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer and a probe for detecting porcine pseudorabies viruses, a fluorescent quantitative PCR (polymerase chain reaction) kit, a method and an application. The nucleotide sequence of an upstream primer of the primer is 5' CGGCTTCGACGTCTGGTT 3', the nucleotide sequence of a downstream primer of the primer is 5' GCCATAGTTGGGTCCATTCG 3', and the sequence of the probe is 5' FAM-CCGGAGAAACCGGAAG-MGB 3'. The fluorescent quantitative PCR detection method built by the primer and the probe has the advantages of strong specificity, high sensitivity, good repeatability and the like, and a rapid, simple, convenient and reliable technical tool is provided for early rapid detection of PRV (pseudorabies viruses), epidemiological survey and prevention and control of Chinese PRV prevalence.

Description

technical field [0001] The invention relates to the technical field of virus PCR detection, in particular to a primer and a probe for detecting porcine pseudorabies virus, a fluorescent quantitative PCR kit, a method and an application. Background technique [0002] Porcine pseudorabies (Pseudorabies, PR) is a severe infectious disease caused by PR virus (PRV). Pigs are the only natural host and long-term storage and excretion of the virus. PRV can infect pigs of all ages, mainly causing abortion, stillbirth, mummification in pregnant sows, high mortality in suckling piglets and infertility in breeding pigs. The disease is widely distributed in the world. With the application of vaccines such as Bartha-K61 and differential diagnosis methods, PRV has been purified in some European and American countries. However, since 2011, PR outbreaks have occurred in pig farms immunized with Bartha-K61 vaccine in several provinces of my country, causing serious economic losses to my coun...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/6851C12N15/11C12R1/93
CPCC12Q1/6851C12Q1/705C12Q2531/113C12Q2561/101
Inventor 李晓菲秦立廷陈婷魏笑笑
Owner SHANDONG NEW HOPE LIUHE GROUP