Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of long non-coding RNA NONMMUT002009 and its overexpression plasmid in the diagnosis and treatment of skeletal system diseases

A long-chain non-coding and non-coding technology, applied in bone diseases, medical preparations containing active ingredients, biochemical equipment and methods, etc.

Active Publication Date: 2021-08-03
FOURTH MILITARY MEDICAL UNIVERSITY
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The long-chain non-coding RNA NONMMUT002009 molecule is located on mouse chromosome 1 chr1: 90837274-90839133, for its role in osteoblast differentiation and bone formation, as well as its role in osteoporosis, inflammatory bone loss and other skeletal systems The role in the diagnosis and treatment of diseases has not been studied and reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of long non-coding RNA NONMMUT002009 and its overexpression plasmid in the diagnosis and treatment of skeletal system diseases
  • Application of long non-coding RNA NONMMUT002009 and its overexpression plasmid in the diagnosis and treatment of skeletal system diseases
  • Application of long non-coding RNA NONMMUT002009 and its overexpression plasmid in the diagnosis and treatment of skeletal system diseases

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] The application of long-chain non-coding RNA NONMMUT002009 in the diagnosis of osteoporosis comprises the following steps:

[0029] Step 1, design and prepare the specific primers of NONMMUT002009, the specific primer sequence of RNA ONMMUT002009 is shown in Table 1; wherein, the genome base sequence of RNA ONMMUT002009 is:

[0030]GCCCAGTGCCATCCTCTCTCCTCACTAACTTTAGCAATCAGGAAATATGGGGAGCTGTTTGTGAGCTGGAAGTGACCAGGGAAAGCCTCACTGGGAGCCATCTTTGTGGAGCCTCCCCCCACCATGTGCTCTGTATCCCCGATTTCCACAGTCCCAGTGCTTTGGGAATTGTCCGCTGGAAGGAAGAGCTCATGGGCCACTTTAATTTCAGAATTGACCAGCAGCTGGAGATGACTCAGGTCTCAGGGGGAACTATTCCAGGAAACTGGCTTTTCACTTCTGGAACCTTCTCTAGTTGAGTCAGCAACCAGCACTGGCATCTGGAGTCAGCTCCACTTAAACCCACCTATGGCCTTACAGGGAATGTGGAATGTCAGAGACCTGCTCAGTCAGACGCAGTGGCTGCAGATATAGCACAGGAGTCCGGGGATCCCTGCCAGGGCACACAGTTTTGTTTTACTTCTAAGTAGTAACTCTAGGAGAGGTTACTGGGAGAGACAGTAAGGAGGTAGACAAACTGATACAAGATCTGTCTACTTAGGATGAGTTTTTCTCTCACACCTGAAAGCCAGCAAAGACGGTAACTTTTCCTTGGGCTGTGAGATGCCGTGGCCGCTCGCTTTCACGATTCTGTGGCGGCACACATGGTTTT...

Embodiment 2

[0048] The application of the long-chain non-coding RNA NONMMUT002009 overexpression plasmid in the treatment of osteoporosis comprises the following steps:

[0049] Step 1, design and prepare NONMMUT002009 overexpression plasmid

[0050] According to the NONMMUT002009 gene sequence, the target gene was cloned, and the recombinant expression vector was constructed with pEX-3 as the carrier and XhoI / EcoRI as the cloning site; cells were transfected with the recombinant vector, and positive clones were selected and identified; sufficient amount of NONMMUT002009 was extracted Overexpression plasmids were stored at -20°C.

[0051] Step 2, Transfection

[0052] The experiment was divided into two groups, namely: (1) transfection control group: transfection with empty plasmid vector; (2) transfection overexpression plasmid group: transfection with NONMMUT002009 overexpression plasmid.

[0053] For the configuration of each well, take the pre-osteoblast MC3T3-E1, and take 1×10 6 T...

Embodiment 3

[0059] The above-mentioned NONMMUT002009 overexpression plasmid was used to test and analyze the expression levels of osteogenic differentiation marker genes Runx2 and ALP in pre-osteoblasts, as follows:

[0060] The grouping, transfection and RNA extraction of pre-osteoblasts were the same as in Example 2, and then the cDNA of each group was taken as a template, and GAPDH was used as an internal reference to detect the expression of osteogenic differentiation marker genes Runx2 and ALP by qPCR. The primer sequences of GAPDH, Runx2 and ALP used are shown in Table 2:

[0061] Table 2 GAPDH, Runx2 and ALP primer sequences

[0062]

[0063] Test results such as image 3 As shown, the results show that the NONMMUT002009 overexpression plasmid can effectively promote the expression of MC3T3-E1 osteogenic differentiation marker genes Runx2 and ALP, indicating that the NONMMUT002009 overexpression plasmid can be used as a drug target for the treatment of osteoporosis and other sk...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses the application of a long-chain non-coding RNA NONMMUT002009 and its overexpression plasmid in the diagnosis and treatment of skeletal system diseases. The long-chain non-coding RNA NONMMUT002009 can be used to prepare drugs for diagnosing skeletal system diseases; The overexpression plasmid can be used in the treatment and diagnosis of skeletal system diseases. The long non-coding RNA NONMMUT002009 overexpression plasmid can specifically bind to miR‑139‑3p and inhibit the expression of miR‑139‑3p, thereby achieving the goal of treating skeletal system diseases Purpose. Diseases of the skeletal system include osteoporosis, inflammatory bone loss, joint degeneration, or femoral head necrosis.

Description

technical field [0001] The invention relates to the field of molecular biomedicine, in particular to the application of long-chain non-coding RNA NONMMUT 002009 and its overexpression plasmid in the diagnosis and treatment of skeletal system diseases. Background technique [0002] Osteoporosis is a systemic bone disease characterized by decreased bone mass, destruction of bone tissue microstructure, increased bone fragility, and susceptibility to fracture. With the increasing aging trend of the world population, the incidence of osteoporosis is increasing. According to the sixth census, the elderly over 65 years old account for 7.5% of the total population in China. It is estimated that by 2020, there will be more than 250 million osteoporosis patients in my country, accounting for more than half of the osteoporosis patients in the world. The World Health Organization has listed osteoporosis, diabetes, and cardiovascular disease as the three major killers that endanger the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6883A61K31/7105A61P19/10A61P19/08A61P19/02
CPCA61K31/7105C12Q1/6883C12Q2600/158C12Q2600/178
Inventor 王艺璇张舒石菲王可胡泽兵周骅曹新生张丽君
Owner FOURTH MILITARY MEDICAL UNIVERSITY