Application of long non-coding RNA NONMMUT002009 and its overexpression plasmid in the diagnosis and treatment of skeletal system diseases
A long-chain non-coding and non-coding technology, applied in bone diseases, medical preparations containing active ingredients, biochemical equipment and methods, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] The application of long-chain non-coding RNA NONMMUT002009 in the diagnosis of osteoporosis comprises the following steps:
[0029] Step 1, design and prepare the specific primers of NONMMUT002009, the specific primer sequence of RNA ONMMUT002009 is shown in Table 1; wherein, the genome base sequence of RNA ONMMUT002009 is:
[0030]GCCCAGTGCCATCCTCTCTCCTCACTAACTTTAGCAATCAGGAAATATGGGGAGCTGTTTGTGAGCTGGAAGTGACCAGGGAAAGCCTCACTGGGAGCCATCTTTGTGGAGCCTCCCCCCACCATGTGCTCTGTATCCCCGATTTCCACAGTCCCAGTGCTTTGGGAATTGTCCGCTGGAAGGAAGAGCTCATGGGCCACTTTAATTTCAGAATTGACCAGCAGCTGGAGATGACTCAGGTCTCAGGGGGAACTATTCCAGGAAACTGGCTTTTCACTTCTGGAACCTTCTCTAGTTGAGTCAGCAACCAGCACTGGCATCTGGAGTCAGCTCCACTTAAACCCACCTATGGCCTTACAGGGAATGTGGAATGTCAGAGACCTGCTCAGTCAGACGCAGTGGCTGCAGATATAGCACAGGAGTCCGGGGATCCCTGCCAGGGCACACAGTTTTGTTTTACTTCTAAGTAGTAACTCTAGGAGAGGTTACTGGGAGAGACAGTAAGGAGGTAGACAAACTGATACAAGATCTGTCTACTTAGGATGAGTTTTTCTCTCACACCTGAAAGCCAGCAAAGACGGTAACTTTTCCTTGGGCTGTGAGATGCCGTGGCCGCTCGCTTTCACGATTCTGTGGCGGCACACATGGTTTT...
Embodiment 2
[0048] The application of the long-chain non-coding RNA NONMMUT002009 overexpression plasmid in the treatment of osteoporosis comprises the following steps:
[0049] Step 1, design and prepare NONMMUT002009 overexpression plasmid
[0050] According to the NONMMUT002009 gene sequence, the target gene was cloned, and the recombinant expression vector was constructed with pEX-3 as the carrier and XhoI / EcoRI as the cloning site; cells were transfected with the recombinant vector, and positive clones were selected and identified; sufficient amount of NONMMUT002009 was extracted Overexpression plasmids were stored at -20°C.
[0051] Step 2, Transfection
[0052] The experiment was divided into two groups, namely: (1) transfection control group: transfection with empty plasmid vector; (2) transfection overexpression plasmid group: transfection with NONMMUT002009 overexpression plasmid.
[0053] For the configuration of each well, take the pre-osteoblast MC3T3-E1, and take 1×10 6 T...
Embodiment 3
[0059] The above-mentioned NONMMUT002009 overexpression plasmid was used to test and analyze the expression levels of osteogenic differentiation marker genes Runx2 and ALP in pre-osteoblasts, as follows:
[0060] The grouping, transfection and RNA extraction of pre-osteoblasts were the same as in Example 2, and then the cDNA of each group was taken as a template, and GAPDH was used as an internal reference to detect the expression of osteogenic differentiation marker genes Runx2 and ALP by qPCR. The primer sequences of GAPDH, Runx2 and ALP used are shown in Table 2:
[0061] Table 2 GAPDH, Runx2 and ALP primer sequences
[0062]
[0063] Test results such as image 3 As shown, the results show that the NONMMUT002009 overexpression plasmid can effectively promote the expression of MC3T3-E1 osteogenic differentiation marker genes Runx2 and ALP, indicating that the NONMMUT002009 overexpression plasmid can be used as a drug target for the treatment of osteoporosis and other sk...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


