A base editing tool and its application
A base editing and tool technology, applied in the field of gene editing, can solve the problems of insufficient editing efficiency, small editing window, and low recognition efficiency, and achieve increased window and accuracy, high base editing accuracy, and targeted highly specific effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0056] 1. Construction of BE-PLUS System Plasmid
[0057] 10 copies of the GCN4 sequence (10XGCN4) were synthesized by Jinweizhi Biotechnology Co., Ltd. and cloned into the pUC57 vector to obtain the pUC57-10XGCN4 vector, which was diluted to 10 μM as a PCR template. Design forward primer with NheI restriction site GCTGGCTAGCACCATGGGACCCAAGAAAAAACGCAAGGTGGAAG, reverse primer with XbaI restriction site GTCTCTAGACACCTTGCGCTTCTTCTTGGGTCC, add water to dissolve to 10 μM. The 10XGCN4 sequence fragment was amplified using the Novozyme High-Fidelity Enzyme Kit (Vazyme, p501-d2). The amplification system and PCR reaction conditions are as follows:
[0058]
[0059]
[0060] The PCR amplification product was purified and recovered by AxyPrep PCR Clean-up Kit (Axygen, AP-PCR-500G), and then 1 μg was taken, digested with NheI (NEB, R0131S) and XbaI (NEB, R0145S), and incubated at 37°C for 2h . Another 1 μg of pST1374-N-NLS-flag-linker-Cas9-D10A (Addgene#51130) vector was taken, ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


