Check patentability & draft patents in minutes with Patsnap Eureka AI!

A kind of lentiviral recombinant vector comprising e4bp4 gene and preparation method and application thereof

A technology of lentiviral vectors and recombinant vectors, which is applied in the field of lentiviral recombinant vectors containing E4BP4 gene and its preparation, can solve the problems such as the unclear mechanism of Tfh cells, and achieve the effect of meeting clinical needs and having therapeutic activity

Active Publication Date: 2020-11-06
THE SECOND XIANGYA HOSPITAL OF CENT SOUTH UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Studies have shown that the abnormal expression of Tfh cells is closely related to autoimmune diseases, but the mechanism of action of Tfh cells in diseases is still unclear. Whether autoimmune diseases can be treated by inhibiting the abnormal expression of Tfh cells and blocking their effector molecules remains to be seen. further research

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of lentiviral recombinant vector comprising e4bp4 gene and preparation method and application thereof
  • A kind of lentiviral recombinant vector comprising e4bp4 gene and preparation method and application thereof
  • A kind of lentiviral recombinant vector comprising e4bp4 gene and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0029] The present invention also provides a method for preparing the lentiviral recombinant vector containing the E4BP4 gene, comprising the following steps: 1) obtaining the E4BP4 gene fragment by PCR amplification; Double enzyme digestion to obtain the digested E4BP4 gene fragment and the digested GV358 lentiviral vector; 3) Ligate the digested E4BP4 gene fragment described in step 2) and the digested GV358 lentiviral vector to obtain an enzyme containing E4BP4 gene lentiviral recombinant vector.

[0030] In the present invention, when preparing the lentiviral recombinant vector containing the E4BP4 gene, the E4BP4 gene fragment is firstly amplified by PCR. In the present invention, the template of the PCR amplification is the DNA containing the E4BP4 gene, preferably the artificially synthesized DNA whose sequence is shown in SEQ ID No.1; in the specific implementation process of the present invention, the artificially synthesized The DNA whose sequence is shown as SEQID ...

Embodiment 1

[0043] Construction of lentiviral recombinant vector containing E4BP4 gene.

[0044] First synthesize the E4BP4 (as shown in SEQ ID No.1) gene (provided by Shanghai Jikai Gene Co., Ltd.), and then subclone it into: lentiviral vector GV358-Ubi-MCS-3FLAG- SV40-EGFP-IRES-puromycin (provided by Shanghai Jikai Genomics Co., Ltd.) to obtain GV358-Ubi-E4BP4-3FLAG-SV40-EGFP-IRES-puromycin recombinant lentiviral vector. The specific construction process is as follows:

[0045] PCR amplification of E4BP4 gene fragment

[0046] Using the synthesized E4BP4 gene sequence as a template, design the following primers for PCR amplification, so that the two ends of the sequence have AgeI restriction sites and BamH I restriction sites, and the primers are as follows: upstream primer E4BP4-F: gaggatccccgggtaccggtcgccaccatgcagctgagaaaaatgcagac; downstream Primer E4BP4-R: tccttgtagtccatacccccagagtctgaagcagagattg

[0047] The PCR amplification system is shown in Table 1.

[0048] Table 1 PCR amp...

Embodiment 2

[0076] Lentiviral Particles of Lentiviral Recombinant Vector Containing E4BP4 Gene

[0077] 24 hours before transfection, digest 293T cells in the logarithmic growth phase with trypsin, and adjust the cell density to 5X10 with DMEM high-glucose medium containing 10% FBS fetal bovine serum. 6 Cells / 15ml, seeded in a six-well plate, cultured in a 37°C, 5% CO2 incubator. After 24 hours, the cells can be used for transfection when the cell density reaches 70-80%. The cell state is crucial for virus packaging, so it is necessary to ensure good cell state and less passage times;

[0078] Replace the cell culture medium with serum-free medium 2 hours before transfection;

[0079] Add the prepared DNA solutions (20 μg of lentiviral recombinant vector containing E4BP4 gene, 15 μg of pHelper1.0 vector plasmid, and 10 μg of pHelper2.0 vector plasmid) to a sterilized centrifuge tube, and mix with the corresponding volume of Genechem transfection reagent Evenly, adjust the total volume ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a lentiviral recombinant vector comprising an E4BP4 gene, belonging to the technical field of genetic engineering. The lentiviral recombinant vector comprising the E4BP4 gene comprises an E4BP4 gene and a GV358 lentiviral vector. The nucleotide sequence of the E4BP4 gene is shown in SEQ ID No.1. The lentiviral recombinant vector comprising the E4BP4 gene can be used for inhibiting activation and differentiation of TFH cells, and provide a new convenient and controllable way to enhance the effect of clinically activated TFH cells to enhance immunotherapy. Compared with the inhibition of TFH cell activation and the lentiviral recombinant vector containing E4BP4 gene provided by the invention is more rapid and reversible compared with the traditional medicine for inhibiting the activation and differentiation of TFH cells. In addition, the lentiviral recombinant vector containing the E4BP4 gene provided by the invention is safe and innocuous, has therapeutic activity, and can meet clinical requirements.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a lentiviral recombinant vector containing E4BP4 gene and its preparation method and application. Background technique [0002] Lentivirus vector is a gene therapy vector developed on the basis of human immunodeficiency virus (HIV). It has the ability to infect both dividing cells and non-dividing cells, and can be expressed in vivo for a long time with high safety. The lentivirus is a "suicide" virus, that is, after the virus infects the target cell, it will not infect other cells, nor will it use the host cell to produce new virus particles. The virulence gene in the lentivirus has been knocked out and replaced by an exogenous target gene, which is a pseudotyped virus. [0003] Follicular helper T lymphocytes (Tfh) are mainly responsible for helping B cells to produce antibodies against CD4 + T cell subsets localized to lymphoid follicles immunophenoty...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/867C12N15/66C12N7/01A61K48/00A61P37/02
CPCA61K48/005A61P37/02C07K14/47C12N7/00C12N15/66C12N15/86C12N2740/15021C12N2740/15043
Inventor 陆前进王子君赵明
Owner THE SECOND XIANGYA HOSPITAL OF CENT SOUTH UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com