Check patentability & draft patents in minutes with Patsnap Eureka AI!

A fluorescent sensor and detection method for quencher detection

A fluorescence sensor and detection method technology, applied in the field of fluorescence sensors, can solve the problems of increasing the stabilization time, increasing the complexity of the system, etc., and achieve the effects of convenient use, excellent biocompatibility, and great application prospects.

Active Publication Date: 2021-07-27
TECHNICAL INST OF PHYSICS & CHEMISTRY - CHINESE ACAD OF SCI +1
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this method utilizes another DNA auxiliary strand, which increases the complexity of the system and increases the stability time during detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A fluorescent sensor and detection method for quencher detection
  • A fluorescent sensor and detection method for quencher detection
  • A fluorescent sensor and detection method for quencher detection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0067] 1) Design and prepare Cu aptamer-modified 6-FAM, TAMRA, and ROX fluorescent sensors, which are respectively marked as Cu-ADFs, Cu-TA-ADFs, and Cu-RO-ADFs, and their basic structures are: 6-FAM - ATCGCGATATTTTCTGTAGCGATTCTTGTTTGAGCGCTCGGTACGAACAGA; TAMRA - ATCGCGATATTTTCTGTAGCGATTCTTGTTTGAGCGCTCGGTACGAACAGA;

[0068] 2) Accurately configure Cu with a standard concentration of 5mM 2+ solution for calibration of the standard curve. Configure 25mM HEPES, 100mM NaCl, 1mM MgCl 2 The buffer solution system (PH=7.0) is used as the detection solution system of Cu-ADFs. Configure 100mM NaCl, 1mM MgCl 2The ultrapure aqueous solution system is used as the detection solution system of Cu-TA-ADFs and Cu-RO-ADFs. Select FL-4600 fluorescence spectrometer (Hitachi) as the detection instrument, select 485nm as the excitation wavelength of Cu-ADFs, select 560nm as the excitation wavelength of Cu-TA-ADFs, select 585nm as the excitation wavelength of Cu-RO-ADFs, and collect the maximum ...

Embodiment 2

[0073] 1) Design and prepare the Ag aptamer-modified 6-FAM fluorescent sensor, which is labeled as Ag-ADFs, and its basic structure is: 6-FAM-CTCTCTTCTCTTCATTTTTCAACACAACACAC.

[0074] 2) Accurately configure Ag with a standard concentration of 0.05mM + solution for calibration of the standard curve. A 25mM HEPES buffer solution system (PH=7.0) was prepared to be used as the detection solution system of Ag-ADFs. FL-4600 fluorescence spectrometer (Hitachi) was selected as the detection instrument, and 485nm was selected as the excitation wavelength of Ag-ADFs, and the fluorescence intensity at the maximum emission peak was collected for normalization. The operation of normalization processing is to mark the maximum emission peak fluorescence intensity of the detection solution system that does not contain a quencher as F 0 , mark the maximum emission peak fluorescence intensity of the detection solution system containing different quencher concentrations (concentrations are m...

Embodiment 3

[0077] 1) Design and prepare the Hg aptamer-modified 6-FAM fluorescent sensor, which is labeled as Hg-ADFs, and its basic structure is: 6-FAM-TTCTTTCTTCCCCTTTGTTTGTT.

[0078] 2) Accurately configure Hg with a standard concentration of 0.5mM 2+ solution for calibration of the standard curve. Configure 25mM HEPES as the detection solution system of Hg-ADFs. The FL-4600 fluorescence spectrometer (Hitachi) was selected as the detection instrument, and 485nm was selected as the excitation wavelength of Hg-ADFs, and the fluorescence intensity at the maximum emission peak was collected for normalization. The operation of normalization processing is to mark the maximum emission peak fluorescence intensity of the detection solution system that does not contain a quencher as F 0 , mark the maximum emission peak fluorescence intensity of the detection solution system containing different quencher concentrations (concentrations are marked as x) as Fx, expressed as Fx / F 0 Values ​​were...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a fluorescence sensor and a detection method for quencher detection, and relates to the technical field of fluorescence sensors. The fluorescent sensor is composed of an aptamer chain segment of a quencher and a fluorophore; wherein, the fluorophore is modified at the 3' end or 5' end of the aptamer chain segment. The fluorescent sensor provided by the invention can detect the quencher concentration in an unknown solution, has high sensitivity and selectivity, and is convenient and quick to operate, and has good biocompatibility, and has comparative advantages in the fields of biological detection and medical diagnosis. Great application prospects.

Description

technical field [0001] The invention relates to the technical field of fluorescence sensors. More specifically, it relates to a fluorescence sensor and a detection method for quencher detection. Background technique [0002] As a new kind of biological material, aptamer has the characteristics of strong specificity, good biocompatibility and easy modification, and has a wide range of applications in biosensing and medical research. Aptamers are used in the field of sensing, mainly using the signal change caused by the change of the configuration of the aptamer chain segment caused by the analyte. The common aptasensor consists of three parts, fluorophore, aptamer chain and quencher group, but little consideration is given to the characteristics of the detection substance itself. Among the detected substances, metal ions such as Cu 2+ , small biological molecules such as ATP have a certain ability to quench fluorescence. [0003] At present, the construction of organic mo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): G01N21/64
Inventor 师文生梅明亮穆丽璇
Owner TECHNICAL INST OF PHYSICS & CHEMISTRY - CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com