Unlock instant, AI-driven research and patent intelligence for your innovation.

Fengycin high-yield strain LPB-18N and breeding and application thereof

A LPB-18N, LPB-18 technology, applied in the field of microorganisms, can solve the problems of low fengycin yield, restricting the industrial production and large-scale application of fengycin, and high cost

Active Publication Date: 2020-04-03
HUAIYIN INSTITUTE OF TECHNOLOGY
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Due to the lack of modification of the existing wild strains at the molecular level, the yield of fengycin is low, its cost is high, and the price is expensive, which greatly limits the industrial production and production of fengycin large scale application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fengycin high-yield strain LPB-18N and breeding and application thereof
  • Fengycin high-yield strain LPB-18N and breeding and application thereof
  • Fengycin high-yield strain LPB-18N and breeding and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] A strain code-named LPB-18 was isolated and screened from earthworm breeding soil in Huai’an, Jiangsu Province. It is a probiotic with good biological control function. μm, about 0.6-0.9 μm in width; it grows well on solid LB plates, and the colonies are round, milky white and opaque.

[0033]The 16S rDNA sequencing sequence of the strain LPB-18 was amplified by molecular biology methods and sequenced. The LPB-18 16S rDNA sequence obtained by PCR amplification, as shown in SEQ ID No.6, was found by comparison on the genebank , the results showed that the homology between strain LPB-18 and Bacillus amyloliquefaciens (Bacillus amyloliquefaciens B10 and Bacillus amyloliquefaciens HYM32) recently reached 98.41%. Combined with the morphological and physiological and biochemical characteristics, the strain LPB-18 was initially identified as Bacillus amyloliquefaciens (Bacillus amyloliquefaciens), named Bacillus amyloliquefaciens LPB-18. Send the bacterial strain Bacillus amy...

Embodiment 2

[0035] Through bioinformatics analysis, target gene analysis was carried out on the transcriptome data of Bacillus amyloliquefaciens LPB-18, and a non-coding RNA (sRNA) fragment with a length of 355 bp having a base complementary relationship with Bacillus amyloliquefaciens fengycin synthetase was obtained. The fragment is named FenSr3, and the nucleotide sequence of the gene FenSr3 is shown in SEQID NO.1.

[0036] SEQ ID NO.1

[0037] GGAGCTGTGTACGCGGTTTGAAGCGCGAGCTCCGGTTCGGGCAGATTTTTCCGATCCAATTTACCGTTCGGCGTAAGCGGCAGCTTCTCAAGTTCCATCATATAGGCCGGGACCATGTAATTCGGCAGTTGCTTAGAAAGTGATGAACGCACTTTTTCTGTATCCATGTCCGTCTGCAGACTCATATATGCGATCAGTTCTTTATTGCCGGACTGCCCGGTTCTGACTGACACGGCAGCTTCTTTCACGCCGTCCAGGCTCCTTAGTGCGGCTTCAATCTCTCCCAGCTCGACCCGATAACCGCGGATTTTCACTTGATCATCCATCCGTCCGGCATATTCGATCGTTCCGTCCG

Embodiment 3

[0039] 1. Construction of sRNA gene knockout vector

[0040] The 520bp sequences of the upstream and downstream of the FenSr3 gene were designed to knock out the primers constructed by the vector:

[0041] L-FenSr3-F: (SEQ ID NO.2)

[0042] atcgatgcatgccat ggtacc CCAAGTATCTGTCTCAGAC (KpnⅠ)

[0043] L-FenSr3-R: (SEQ ID NO.3)

[0044] GTTCTTCAAGCTCATTGCGGGCAGCCAGCGGGCTA

[0045] R-FenSr3-F: (SEQ ID NO.4)

[0046] GATTTAGCCCGCTGGCTGCCCGCAATGAGCTTGAA

[0047] R-FenSr3-R: (SEQ ID NO.5)

[0048] gcgtcgggcgatatc agatct TTATATGTAAGTGACCAGG (BglⅡ)

[0049] (1) Amplification of upstream and downstream sequences of sRNA gene

[0050] Using LPB-18 genomic DNA as a template, primers L-FenSr3-F / R and R-FenSr3-F / R were used to amplify the homology arm sequences between upstream and downstream genes of sRNA, respectively.

[0051] PCR reaction system (50 μL): 2×Phanta Master Mix 25 μL, upstream primer 2 μL, downstream primer 2 μL, template DNA 1 μL, ddH 2 O 20 μL; PCR amplificati...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a fengycin high-yield strain LPB-18N and a breeding and an application thereof. The strain is identified as bacillus amyloliquefaciens and preserved in the China General Microbiological Culture Collection Center, preservation date is October 22, 2019 and preservation number is CGMCC NO.18720. The fengycin high-yield strain LPB-18N can effectively produce large amounts of fengycin, also save costs, and increases industrialized production and commercial potential. The produced fengycin has broad microorganism-inhibiting spectrum, is not liable to produce drug resistance, safe and degradable, etc. and widely used in the field of food, and has huge economic benefits and the potential to develop into new food preservatives.

Description

technical field [0001] The invention belongs to the technical field of microbes, and relates to a high-yield fengyuansu strain LPB-18N and its selection and application. Background technique [0002] Fengycin is a non-ribosome-synthesized antibacterial cyclic lipopeptide produced by the metabolism of Bacillus amyloliquefaciens and composed of 10 amino acids and β-hydroxy fatty acids containing 14-18 C. Fengycin, as a new type of biologically derived antibacterial substance, has been proven to have a strong inhibitory effect on filamentous fungi, and can be used in biological control of plant diseases and other aspects; in addition, fengycin has a broad antibacterial spectrum, is not easy to produce drug resistance, is safe and degradable, etc. It has good effects in the prevention and control of food pathogens, food processing, and medicine. As a secondary metabolite, since fengycin is a synthesis process catalyzed by intracellular enzymes, there are many factors and factor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12P21/02C07K14/32C07K7/64C12N15/75C12R1/07
CPCC07K14/32C07K7/64C12P21/02C12N15/75
Inventor 卢河东周振赵立张淇涵耿程欣陈卫王朝宇赵希荣王晓莉
Owner HUAIYIN INSTITUTE OF TECHNOLOGY