Fengycin high-yield strain LPB-18N and breeding and application thereof
A LPB-18N, LPB-18 technology, applied in the field of microorganisms, can solve the problems of low fengycin yield, restricting the industrial production and large-scale application of fengycin, and high cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] A strain code-named LPB-18 was isolated and screened from earthworm breeding soil in Huai’an, Jiangsu Province. It is a probiotic with good biological control function. μm, about 0.6-0.9 μm in width; it grows well on solid LB plates, and the colonies are round, milky white and opaque.
[0033]The 16S rDNA sequencing sequence of the strain LPB-18 was amplified by molecular biology methods and sequenced. The LPB-18 16S rDNA sequence obtained by PCR amplification, as shown in SEQ ID No.6, was found by comparison on the genebank , the results showed that the homology between strain LPB-18 and Bacillus amyloliquefaciens (Bacillus amyloliquefaciens B10 and Bacillus amyloliquefaciens HYM32) recently reached 98.41%. Combined with the morphological and physiological and biochemical characteristics, the strain LPB-18 was initially identified as Bacillus amyloliquefaciens (Bacillus amyloliquefaciens), named Bacillus amyloliquefaciens LPB-18. Send the bacterial strain Bacillus amy...
Embodiment 2
[0035] Through bioinformatics analysis, target gene analysis was carried out on the transcriptome data of Bacillus amyloliquefaciens LPB-18, and a non-coding RNA (sRNA) fragment with a length of 355 bp having a base complementary relationship with Bacillus amyloliquefaciens fengycin synthetase was obtained. The fragment is named FenSr3, and the nucleotide sequence of the gene FenSr3 is shown in SEQID NO.1.
[0036] SEQ ID NO.1
[0037] GGAGCTGTGTACGCGGTTTGAAGCGCGAGCTCCGGTTCGGGCAGATTTTTCCGATCCAATTTACCGTTCGGCGTAAGCGGCAGCTTCTCAAGTTCCATCATATAGGCCGGGACCATGTAATTCGGCAGTTGCTTAGAAAGTGATGAACGCACTTTTTCTGTATCCATGTCCGTCTGCAGACTCATATATGCGATCAGTTCTTTATTGCCGGACTGCCCGGTTCTGACTGACACGGCAGCTTCTTTCACGCCGTCCAGGCTCCTTAGTGCGGCTTCAATCTCTCCCAGCTCGACCCGATAACCGCGGATTTTCACTTGATCATCCATCCGTCCGGCATATTCGATCGTTCCGTCCG
Embodiment 3
[0039] 1. Construction of sRNA gene knockout vector
[0040] The 520bp sequences of the upstream and downstream of the FenSr3 gene were designed to knock out the primers constructed by the vector:
[0041] L-FenSr3-F: (SEQ ID NO.2)
[0042] atcgatgcatgccat ggtacc CCAAGTATCTGTCTCAGAC (KpnⅠ)
[0043] L-FenSr3-R: (SEQ ID NO.3)
[0044] GTTCTTCAAGCTCATTGCGGGCAGCCAGCGGGCTA
[0045] R-FenSr3-F: (SEQ ID NO.4)
[0046] GATTTAGCCCGCTGGCTGCCCGCAATGAGCTTGAA
[0047] R-FenSr3-R: (SEQ ID NO.5)
[0048] gcgtcgggcgatatc agatct TTATATGTAAGTGACCAGG (BglⅡ)
[0049] (1) Amplification of upstream and downstream sequences of sRNA gene
[0050] Using LPB-18 genomic DNA as a template, primers L-FenSr3-F / R and R-FenSr3-F / R were used to amplify the homology arm sequences between upstream and downstream genes of sRNA, respectively.
[0051] PCR reaction system (50 μL): 2×Phanta Master Mix 25 μL, upstream primer 2 μL, downstream primer 2 μL, template DNA 1 μL, ddH 2 O 20 μL; PCR amplificati...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


