Unlock instant, AI-driven research and patent intelligence for your innovation.

DLase (dermatan sulfates lyase) and application thereof

A technology of dermatan sulfate and lyase, applied in the field of genetic engineering, can solve the problems of scarcity of species, low specific enzyme activity, etc., and achieve the effect of good pH and temperature stability

Active Publication Date: 2020-08-28
SHANDONG UNIV
View PDF8 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The present invention aims at the deficiencies of the prior art, especially the problem that the existing dermatan sulfate-specific degrading enzymes are rare in number and low in specific enzyme activity, which is unfavorable for large-scale production and application. The present invention provides dermatan sulfate lyase and its application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • DLase (dermatan sulfates lyase) and application thereof
  • DLase (dermatan sulfates lyase) and application thereof
  • DLase (dermatan sulfates lyase) and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1. Acquisition and sequence analysis of candidate genes for dermatan sulfate lyase.

[0037] Dermatan sulfate lyase candidate genes were identified by NCBI (National Center for Biotechnology Information, http: / / www.ncb1.nlm.nih.gov / ) analysis software Basic Local AlignmentSearch Tool (BLAST, http: / / blast.ncb1.nlm.nih.gov / Blast.cgi ) analysis obtained. Dermatan sulfate lyase DLase 1 comes from Pseudopedobacter saltans, the gene coding region is 1539bp long (NCBI registration number: AAO78455), its nucleotide sequence is shown in SEQ ID NO.1, and the reported dermatan sulfate lyase CSase B The coding gene cslB (AAC83384.1) gene has only 57% homology. Dermatan sulfate lyase DLase 2 comes from uncultured Bacteroides, the gene coding region length is 1461bp (NCBI registration number: SCH13530.1), its nucleotide sequence is shown in SEQ ID NO.2, and the reported dermatan sulfate lyase The cslB (AAC83384.1) gene encoding CSase B has only 43% homology.

[0038] T...

Embodiment 2

[0040] Example 2. Recombinant expression of DLase 1 gene and DLase 2 gene in Escherichia coli.

[0041] The nucleotide sequences shown in SEQ ID No.1 and SEQ ID No.1 were respectively used as PCR templates. The PCR templates were synthesized by Huada Gene for PCR amplification. The primers were as follows:

[0042] Forward primer rDLase 1-F:G CATATG AAGCATATTCTGGTGGCGAGCG;

[0043] Reverse primer rDLase 1-R:G CTCGAG GTTGTTGCGATCACGTGCCAGC;

[0044] Forward primer rDLase 2-F:G CATATG GAAAATATTACCGTGGGCACCACC;

[0045] Reverse primer rDLase 2-R:G CTCGAG CTGTGCAAAGATACCAGTCTCGGC.

[0046] In the forward and reverse primers, the underlined base sequences are the restriction endonucleases NdeI and XhoI respectively. Primerstar HS DNA polymerase was purchased from Bao Biological Company, and the PCR reaction system was operated according to the product instructions provided by the company.

[0047] PCR reaction conditions: pre-denaturation at 94°C for 5 min; denaturation...

Embodiment 3

[0051] Example 3, Analysis of Enzymatic Properties of Recombinant Dermatan Sulfate Lyase DLase 1 and DLase 2

[0052] 1. The effect of pH on enzyme activity

[0053] Mix 3 mg / mL dermatan sulfate, reaction buffer, DLase 1 or DLase 2, and deionized water in a ratio of 10:10:3:7 (volume ratio), and the reaction buffer is 150 mM NaAc-HAc (pH5. 0-6.0), 150mM NaH 2 PO 4 -Na 2 HPO 4 (pH6.0-8.0), 150mM Tris-HCl (pH7.0-10.0). React at 30°C for 10 minutes. After the reaction, measure the enzyme activity by UV spectrophotometry. The test results are as follows: image 3 As shown in A, the recombinant dermatan sulfate lyase DLase 1 reached the maximum activity at Tris-HCl (pH 10.0), followed by NaAc-HAc (pH 6.0), but considering the stability of subsequent metal ions at too high a pH Finally, NaAc-HAc (pH 6.0) was selected as the reaction pH of subsequent experiments; recombinant dermatan sulfate lyase DLase 2 reached its maximum activity in Tris-HCl (pH 9.0) ( image 3 B), so the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to DLase (dermatan sulfates lyase) and application thereof. The enzyme activity of the DLase provided by the invention for degrading dermatan sulfates is 800 to 1800 U / mg. The nucleotide sequence of a coded gene is as shown by SEQ ID NO.1 or SEQ ID NO.2, and the amino acid sequence is as shown by SEQ ID NO.3 or SEQ ID NO.4. The DLase related by the invention has higher dermatan sulfates degradation activity, and solves the problems that in the prior art, a specific degrading enzyme for the dermatan sulfates has low enzyme activity and is unfavorable for large-scale production; and meanwhile, higher temperature stability is realized. The DLase is an incision enzyme, and can be used for specific analysis of DS composition structures in CS / DS related samples, selective degradation removal of DS ingredients, preparation of DS oligosaccharides, quality control analysis of related products and the like.

Description

technical field [0001] The invention relates to dermatan sulfate lyase and application thereof, belonging to the technical field of genetic engineering. Background technique [0002] Chondroitin sulfates (Chondroitin sulfates, CS) / dermatan sulfates (Dermatan sulfates, DS) are a major type of glycosaminoglycans (Glycosaminoglycans, GAGs), they are linked by the sequence (-GlcUA-Gal-Gal-Xyl-O -Ser) is covalently linked to the core protein to form proteoglycans (Groteoglycans, PGs) (Lindahl, U.1965), which are widely distributed on the cell surface and in the extracellular matrix, and participate in various physiological and pathological processes of cells, including the nervous system Development (Faissner, A.1994, Clement, A.M.1998), damage repair (Trowbridge, J.M.2002), cell division and growth, intercellular signal transduction and other processes (Nandi, S.2006, Taylor, K.R.2006). These diverse functions are attributed to the diversity of CS / DS structures. CS is compos...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/88C12N15/60C12P19/26C12Q1/527
CPCC12N9/88C12Y402/02C12P19/26C12Q1/527
Inventor 李福川焦润苗韩乃寒
Owner SHANDONG UNIV