Unlock instant, AI-driven research and patent intelligence for your innovation.

Streptococcus thermophilus JMCC0030 as well as separation and purification method and application thereof

A Streptococcus thermophilus, separation and purification technology, applied to Streptococcus thermophilus JMCC0030, its screening method and application field can solve the problems of inability to supplement nutrients in time, slow absorption of calcium and other nutrients, and improve viscosity, improve Osteoporosis, the effect of promoting intestinal calcium absorption

Active Publication Date: 2021-05-14
JUNLEBAO DAIRY GRP CO LTD
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the factors that cause osteoporosis also include the imbalance of hormones in the body, which leads to slow absorption of calcium and other nutrients, so that the nutrients lost in the metabolic process cannot be replenished in time, thus causing osteoporosis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Streptococcus thermophilus JMCC0030 as well as separation and purification method and application thereof
  • Streptococcus thermophilus JMCC0030 as well as separation and purification method and application thereof
  • Streptococcus thermophilus JMCC0030 as well as separation and purification method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Embodiment 1 Streptococcus thermophilus JMCC0030

[0041] This example is a Streptococcus thermophilus JMCC0030, which was isolated and screened from traditional fermented products in Xinjiang, and preserved in the Culture Collection Center of the Institute of Microbiology, Chinese Academy of Sciences. The preservation address is Beichen West Road 1, Chaoyang District, Beijing No. 3 Courtyard, the preservation number is CGMCC NO.19075.

[0042] Its 16SrDNA sequence is as follows:

[0043] AAGGTTACCTCACCGACTTCGGGTGTTACAAACTCTCGTGGTGTGACGGGCGGTGTGTACAAGGCCCGGGAAC GTATTCACCGCGGCGTGCTGATCCGCGATTACTAGCGATTCCGACTTCATGTAGGCGAGTTGCAGCCTACAAT CCGAACTGAGATTGGCTTTAAGAGATTAGCTCGCCGTCACCGACTCGCAACTCGTTGTACCAACCATTGTAGCACGTGTGTAGCCCAGGTCATAAGGGGCATGATGATTTGACGTCATCCCCACCTTCCTCCGGTTTATTACCGGC AGTCTCGCTAGAGTGCCCAACTGAATGATGGCAACTAACAATAGGGGTTGCGCTCGTTGCGGGACTTAACCCA ACATCTCACGACACGAGCTGACGACAACCATGCACCACCTGTCACCGATGTACCGAAGTAACTTTCTATCTCT AGAAATAGCATCGGGATGTCAAGACCTGGTAAGGTTCTTCGCGTTGC...

Embodiment 2

[0046] Embodiment 2 A kind of separation and purification method of Streptococcus thermophilus JMCC0030

[0047] This embodiment is a method for separation and purification of Streptococcus thermophilus JMCC0030, which is carried out in accordance with the following sequence of steps:

[0048] ① Sample collection

[0049] Take 25mL of Xinjiang traditional fermented product (taken from the Kashgar area of ​​Xinjiang, a traditional fermented milk product made by herdsmen), add it to 225mL of normal saline, and mix well to obtain sample A;

[0050] ② Sample enrichment

[0051] Take 2 mL of sample A, add it to 100 mL of MRS liquid medium, and incubate at 37°C for 72 hours to obtain culture medium B;

[0052] ③Isolation and screening of bacterial strains

[0053] Take 1mL of culture solution B and dilute it 10 times with 0.9% sterile normal saline, and the serial dilutions are 10 -1 、10 -2 、10 -3 、10 -4 、10 -5 times to obtain bacterial suspension C1-C5;

[0054] Take the M...

Embodiment 3～6

[0064] The separation and purification method of embodiment 3~6 Streptococcus thermophilus JMCC0030

[0065] Embodiments 3 to 6 respectively provide a separation and purification method of Streptococcus thermophilus JMCC0030, which is basically the same as the method in Example 2, except that the technical parameters of the separation and purification process are different, and the specific parameters are as shown in Table 1:

[0066] Table 1 Example 3-6 separation and purification process and parameters

[0067]

[0068]

[0069] Wherein, other parameters are all identical with embodiment 2.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of bioengineering, and discloses streptococcus thermophilus JMCC0030 as well as a separation and purification method and an application thereof. The strain is screened out after being collected, separated and purified from traditional fermented products in Xinjiang, and is preserved in the strain preservation center of the Institute of Microbiology of Chinese Academy of Sciences at present, and the preservation number is CGMCC NO.19075. After being compounded with lactobacillus bulgaricus JMCC0018, the streptococcus thermophilus JMCC0030 provided by the invention is used for preparing the fermented milk, and the obtained fermented milk has good fragrance and viscosity, and meanwhile, the osteoporosis is remarkably improved. The method is suitable for separation, purification and application of bacterial strains, and is particularly suitable for separation, purification and application of streptococcus thermophilus JMCC0030.

Description

technical field [0001] The invention belongs to the field of bioengineering, and relates to a bacterial strain, a screening method and application, in particular to a Streptococcus thermophilus JMCC0030, a screening method and application thereof. Background technique [0002] Streptococcus thermophilus is one of the most widely used fermentation strains in industrial production, and its development and utilization in dairy products has always been highly valued by domestic and foreign dairy industries. Streptococcus thermophilus, as a key strain in the production of food industry, is considered as a "generally recognized as safe (GRAS)" ingredient. It can not only be used to prepare many fermented dairy products (such as yogurt, cheese), but also can Active (such as producing exopolysaccharides, bacteriocins, etc.), as potential beneficial bacteria to prepare functional products. However, at present, my country's dairy companies still rely on imports for starters and strai...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/20C12N1/02A23C9/123C12R1/46
CPCC12N1/20C12N1/02A23C9/1238A23V2400/123A23V2400/249
Inventor 王世杰冯丽莉刘尧尧袁庆彬张栋魏立华薛玉玲荀一萍封肖颖
Owner JUNLEBAO DAIRY GRP CO LTD