Streptococcus thermophilus jmcc0030, its separation and purification method and application
A technology of streptococcus thermophilus and strains, applied in the field of bioengineering, can solve the problems of slow absorption of calcium and other nutrients, failure to replenish nutrients in time, and achieve the effect of improving osteoporosis, increasing viscosity, and good aroma
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Example 1 Streptococcus thermophilus JMCC0030
[0041] This example is a Streptococcus thermophilus JMCC0030, which was isolated and screened from traditional fermented products in Xinjiang, and is preserved in the Culture Collection Center, Institute of Microbiology, Chinese Academy of Sciences, and the preservation address is No. 1, Beichen West Road, Chaoyang District, Beijing. No. 3, No. 3, the preservation number is CGMCC NO.19075.
[0042] Its 16S rDNA sequence is as follows:
[0043] AAGGTTACCTCACCGACTTCGGGTGTTACAAACTCTCGTGGTGTGACGGGCGGTGTGTACAAGGCCCGGGAAC GTATTCACCGCGGCGTGCTGATCCGCGATTACTAGCGATTCCGACTTCATGTAGGCGAGTTGCAGCCTACAAT CCGAACTGAGATTGGCTTTAAGAGATTAGCTCGCCGTCACCGACTCGCAACTCGTTGTACCAACCATTGTAGCACGTGTGTAGCCCAGGTCATAAGGGGCATGATGATTTGACGTCATCCCCACCTTCCTCCGGTTTATTACCGGC AGTCTCGCTAGAGTGCCCAACTGAATGATGGCAACTAACAATAGGGGTTGCGCTCGTTGCGGGACTTAACCCA ACATCTCACGACACGAGCTGACGACAACCATGCACCACCTGTCACCGATGTACCGAAGTAACTTTCTATCTCT AGAAATAGCATCGGGATGTCAAGACCTGGTAAGGTTCTTCGCGTT...
Embodiment 2
[0046] Embodiment 2 A kind of separation and purification method of Streptococcus thermophilus JMCC0030
[0047] This embodiment is a kind of separation and purification method of Streptococcus thermophilus JMCC0030, and the separation and purification method is carried out according to the following sequence of steps:
[0048] ① Sample collection
[0049] Take 25 mL of Xinjiang traditional fermented products (taken from Kashgar, Xinjiang, traditional fermented dairy products made by herdsmen), add it to 225 mL of normal saline, and mix thoroughly to obtain sample A;
[0050] ② Sample enrichment
[0051] Take 2 mL of sample A, add it to 100 mL of MRS liquid medium, and cultivate at 37°C for 72 hours to obtain culture solution B;
[0052] ③Strain isolation and screening
[0053] Take 1 mL of culture solution B and dilute it with a 10-fold gradient of sterile normal saline with a concentration of 0.9%. -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 times to obtain bacterial suspensi...
Embodiment 3～6
[0064] Embodiment 3~6 The separation and purification method of streptococcus thermophilus JMCC0030
[0065] Embodiments 3 to 6 respectively provide a method for separation and purification of Streptococcus thermophilus JMCC0030, which is basically the same as the method in Example 2, except that the technical parameters of the separation and purification process are different, and the specific parameters are shown in Table 1:
[0066] Table 1 embodiment 3-6 separation and purification process and parameters
[0067]
[0068]
[0069] Wherein, other parameters are the same as in Example 2.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More