Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for determining small nucleic acid sequence set and application thereof

A nucleic acid sequence and small nucleic acid technology, applied in the field of bioinformatics, can solve the problem that the accuracy of results depends on the integrity of the genome, and achieve the effects of improving accuracy and sensitivity, comprehensive results, and reducing dependence on structural features

Pending Publication Date: 2021-05-21
BGI TECH SOLUTIONS
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, the main small RNA prediction software can only predict a few types of small RNAs such as miRNA, siRNA, and piRNA, and the accuracy of the results largely depends on the integrity of the genome

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for determining small nucleic acid sequence set and application thereof
  • Method for determining small nucleic acid sequence set and application thereof
  • Method for determining small nucleic acid sequence set and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0061] In this example, 200 small RNA sequences were randomly selected from a small RNA sequencing data, and some sequence files are shown in Table 1.

[0062] Table 1: small RNA sequences

[0063] name sequence t2_33221_25926 GGTTAAGTGACTAAGCGTACATGGTGGATGCCTTGGC t43_9407_8664 GATGTCTACTAGCCGTTGGG t115983_54_50 TATGGTTAAGTGACTAAGCGTAC t20_12754_11131 TGGACAAAGACTGACGCTCAGGT t24_11745_10234 GCCTTGACATGTCTGGAATCC … …

[0064] 1) Input a randomly selected small RNA sequencing data for processing, convert all characters into uppercase and convert non-ATCGN characters into N;

[0065] 2) Divide the file in 1) into files containing at most the set number of files (default 500, generally the value is too large or too small, and the running time will be longer). The file after segmentation is recorded as A 1 , A 2 ,...,A n , merged according to step 3 respectively;

[0066] 3) Suppose A i contains S 1 , S 2 ,…,S n bar sequenc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for determining a small nucleic acid sequence set. The method comprises: (1) dividing a sequencing result formed by a plurality of sequencing reads into a plurality of sequencing read sets, wherein the sequencing result is obtained based on a nucleic acid sample containing small RNA molecules; (2) combining each of the plurality of sequencing read sets based on comparison processing so as to obtain a plurality of combined sequencing read sets; and (3) based on comparison processing, combining the plurality of combined sequencing read sets so as to obtain a candidate small nucleic acid sequence set.

Description

technical field [0001] The present invention relates to the field of biological information, specifically, the present invention relates to a method for determining a set of small nucleic acid sequences and its application, more specifically, the present invention relates to a method for determining a set of small nucleic acid sequences, a computer-readable storage medium, an electronic device, and a method for determining a set of small nucleic acid sequences. A system for collections of nucleic acid sequences. Background technique [0002] The current small RNA prediction method is mainly based on its structural characteristics, such as predicting potential miRNAs through the secondary structure of the miRNA precursor, through the almost complete complementarity of the positive and negative strands and the sticky ends of 1 to 2 bases To predict potential siRNAs and predict piRNAs based on transposon sequences, these methods are all for specific types of small RNA molecules...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G16B30/10
CPCG16B30/10
Inventor 朱欠华杨林峰
Owner BGI TECH SOLUTIONS
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com