Nucleotide for reducing PCR non-specific amplification as well as design method and application thereof
A non-specific, design method technology, applied in the field of bioengineering, can solve the problems of reducing the signal-to-noise ratio of the detection result, reducing the specific signal intensity, etc., to achieve the effect of reducing primer dimers
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Embodiment 1: A kind of design method of reducing the nucleotide of PCR non-specific amplification
[0029] The present embodiment provides a kind of design method that reduces the nucleotide of PCR non-specific amplification, comprises the following parts:
[0030] 1. Cloning and analysis of the full-length nucleotides that reduce PCR non-specific amplification
[0031] (1) Design nucleotides that reduce PCR non-specific amplification: the nucleotides that reduce PCR non-specific amplification include sequence A and sequence B, the sequence A includes at least 6 nucleotides, and the sequence Nucleotides in A select three bases from A, T, C and G as their constituents. The sequence B can form a three-dimensional structure except the hairpin structure, the sequence B includes at least 4 nucleotides, and the nucleotides of the sequence B can be any base.
[0032] In this embodiment, the sequence A is ATGAGTATGAATTGG (SEQ ID NO: 1), and the sequence B is CCTGGGGGAGTATTGC...
Embodiment 2
[0035] Embodiment 2: A kind of design method of reducing the nucleotide of PCR non-specific amplification
[0036] This example provides a method for designing nucleotides to reduce non-specific PCR amplification. The difference from Example 1 is that the sequence A is ACGAGCACGAACCGG (SEQ ID NO: 3), and the sequence B is GGGUUGGGAAGAAAACUGUGGCACUUCGGUGCCAGCAACCC ( SEQ ID NO: 4).
[0037]The processing method of the synthesized nucleotides is as follows: add the synthesized nucleotide sequence into buffer R, heat to 65-85°C, keep it warm for 5 minutes, then cool it to 0-40°C, keep it warm for 20-30 minutes, and obtain Reduce the full length of the nucleotide sequence of PCR non-specific amplification; wherein, the components of buffer R are: 300 mM NaCl, 5 mM MgCl2, 20 mM Tris (pH 7.6).
[0038] Through the analysis of X-ray single crystal diffraction data, determine the structure of the nucleotide partial sequence, such as figure 2 shown.
Embodiment 3
[0039] Embodiment 3: A kind of design method of reducing the nucleotide of PCR non-specific amplification
[0040] This example provides a method for designing nucleotides to reduce non-specific PCR amplification. The difference from Example 1 is that the sequence A is TCGTGC (SEQ ID NO: 5), and the sequence B is CCGG ( SEQ ID NO: 6).
[0041] The processing method of the synthesized nucleotides is as follows: add the synthesized nucleotide sequence into buffer R, heat to 65-85°C, keep it warm for 5 minutes, then cool it to 0-40°C, keep it warm for 20-30 minutes, and obtain Reduce the full length of the nucleotide sequence of PCR non-specific amplification; wherein, the components of buffer R are: 300 mM NaCl, 5 mM MgCl2, 20 mM Tris (pH 7.6).
[0042] Through the analysis of X-ray single crystal diffraction data, determine the structure of the nucleotide partial sequence, such as image 3 shown.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More