Method for detecting REV by using NASBA, and reagent set used therein
A reagent and a complete set of technologies, applied in the field of complete sets of reagents, can solve the problems of limited promotion and use, high price, low sensitivity, etc., and achieve the effects of great promotion value, simple detection method and high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0071] Embodiment 1, the screening of detection REV complete set of reagents and the preparation of detection REV kit
[0072] 1. Preparation of reagent kit for detection of REV
[0073] According to the nucleotide sequence of the REV env gene (Genebank: MG471384), the inventors of the present invention designed and prepared five REV detection kits, which are REV detection kit 1, REV detection kit 2, and REV detection kit 3 , Detection of REV set of reagents 4 and detection of REV set of reagents 5.
[0074] REV Detection Kit 1 consists of primer pair 1 and probe set 1. Primer pair 1 consists of an upstream primer: 5′-CACCAACTCCCTCGATTGCG-3′ and a downstream primer: 5′- AATTCTAATACGACTCACTATAGGGAGA TCATAACAGGTGGAATGCA-3' (the underline is the promoter sequence recognized by T7 RNA polymerase). Probe set 1 consisted of an upstream probe: 5'-TTCACCGCCUAC-FAM-3' and a downstream probe: 5'-TAMRA-TTACGGGUCU-3'.
[0075] REV Detection Kit 2 consists of primer pair 2 and probe s...
Embodiment 2
[0100] Embodiment 2, sensitivity test and specificity test
[0101] 1. Preparation of RNA nucleic acid
[0102] A, preparation of REV-env gene RNA nucleic acid
[0103] 1. Take the plasmid containing the REV-env gene and digest it with the restriction endonuclease EcoRI at 37°C for 2 hours to obtain the digested product.
[0104] 2. After completing step 1, prepare the transcription system, and then transcribe at 37°C for 4 hours.
[0105] The transcription system is 50 μL, including 5 μL 5×Transcription Optimized Buffer (Promega), 2UT7 RNA polymerase, DTT (Promega), 10 U recombinant RNase inhibitor (Promega), rNTP, 5 μL digested product and water. In the transcription system, the concentration of DTT was 10 mM, and the concentration of rNTP was 2 mM.
[0106] 3. Take the system that completed step 2, add 1 μL of DNA digesting enzyme (rDNAseI, 5 U / μL), shake and centrifuge, and incubate at 37° C. for 20 minutes to obtain the transcript RNA.
[0107] 4. After completing ste...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap