Check patentability & draft patents in minutes with Patsnap Eureka AI!

Method for detecting REV by using NASBA, and reagent set used therein

A reagent and a complete set of technologies, applied in the field of complete sets of reagents, can solve the problems of limited promotion and use, high price, low sensitivity, etc., and achieve the effects of great promotion value, simple detection method and high sensitivity

Active Publication Date: 2021-06-25
BOAO BIOLOGICAL CO LTD
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This patented technology allows for easy identification or testing of specific types of influenza by detecting certain proteins that are associated with these strains. It can be used at different stages during an outbreak without affecting its ability to infect others.

Problems solved by technology

Technologies described involve various techniques for identifying or diagnosing rheumatoid arthritis caused by viruses like tick fever bacteria, measuring its severity based upon changes over time after exposure, and developing assays capable of accurately detecting these conditions without being labor intensive. Current solutions rely heavily on formal analysis involving multiple procedures and complex operations, making them difficult to operate efficiently and sensitive enough for practicality applications.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting REV by using NASBA, and reagent set used therein
  • Method for detecting REV by using NASBA, and reagent set used therein
  • Method for detecting REV by using NASBA, and reagent set used therein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0071] Embodiment 1, the screening of detection REV complete set of reagents and the preparation of detection REV kit

[0072] 1. Preparation of reagent kit for detection of REV

[0073] According to the nucleotide sequence of the REV env gene (Genebank: MG471384), the inventors of the present invention designed and prepared five REV detection kits, which are REV detection kit 1, REV detection kit 2, and REV detection kit 3 , Detection of REV set of reagents 4 and detection of REV set of reagents 5.

[0074] REV Detection Kit 1 consists of primer pair 1 and probe set 1. Primer pair 1 consists of an upstream primer: 5′-CACCAACTCCCTCGATTGCG-3′ and a downstream primer: 5′- AATTCTAATACGACTCACTATAGGGAGA TCATAACAGGTGGAATGCA-3' (the underline is the promoter sequence recognized by T7 RNA polymerase). Probe set 1 consisted of an upstream probe: 5'-TTCACCGCCUAC-FAM-3' and a downstream probe: 5'-TAMRA-TTACGGGUCU-3'.

[0075] REV Detection Kit 2 consists of primer pair 2 and probe s...

Embodiment 2

[0100] Embodiment 2, sensitivity test and specificity test

[0101] 1. Preparation of RNA nucleic acid

[0102] A, preparation of REV-env gene RNA nucleic acid

[0103] 1. Take the plasmid containing the REV-env gene and digest it with the restriction endonuclease EcoRI at 37°C for 2 hours to obtain the digested product.

[0104] 2. After completing step 1, prepare the transcription system, and then transcribe at 37°C for 4 hours.

[0105] The transcription system is 50 μL, including 5 μL 5×Transcription Optimized Buffer (Promega), 2UT7 RNA polymerase, DTT (Promega), 10 U recombinant RNase inhibitor (Promega), rNTP, 5 μL digested product and water. In the transcription system, the concentration of DTT was 10 mM, and the concentration of rNTP was 2 mM.

[0106] 3. Take the system that completed step 2, add 1 μL of DNA digesting enzyme (rDNAseI, 5 U / μL), shake and centrifuge, and incubate at 37° C. for 20 minutes to obtain the transcript RNA.

[0107] 4. After completing ste...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for detecting REV by using NASBA, and a reagent set used therein. The reagent set is composed of a primer pair including a primer F and a primer R, and a probe set. A target sequence of the primer pair contains a specific DNA fragment as shown in SEQ ID NO: 9. The probe group consists of an upstream probe as shown in SEQ ID NO: 3 and a downstream probe as shown in SEQ ID NO: 4. The reagent set provided by the invention is used for detecting the REV, the specificity is good (the REV is accurately identified from ALV, MDV, CIAV and REV), the sensitivity is high (the sensitivity is 2 * 10 copy number/reaction system), the reagent set is suitable for detecting the REV in a sample with low virus content, and the detection method is simple, convenient, rapid and accurate (the detection is completed within 1 hour). The method and the reagent set have great popularization value.

Description

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Owner BOAO BIOLOGICAL CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More