Trichoderma reesei-derived high-selectivity lipase and application thereof
A high-selectivity, lipase technology, applied in the field of medicine, can solve the problem of low selectivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0105] Cloning of embodiment 1 Trichoderma reesei lipase L4 gene
[0106] Trichoderma reesei (Trichoderma reesei) (strain name: RUT-C30) preserved in the laboratory was used to extract total RNA: the spores of Trichoderma reesei (RUT-C30) were inoculated into PDB (potato dextrose broth medium), and in 28 Cultivate at 220rpm for 24h. Total RNA was extracted using the OMEGA Total Kit.
[0107] Use the FastKing one-step method of Tiangen Biochemical Technology (Beijing) Co., Ltd. to remove the first-strand synthesis premix reagent of genomic cDNA and reverse transcribe to obtain the total cDNA, and use the following primers to amplify a gene fragment about 1 kb in length:
[0108] HEC-F:ATGCGGTCCATTCTGGTG
[0109] HEC-R:CTACCAGTGCTCCCAATA
[0110] The PCR system is shown in Table 1 below:
[0111]
[0112] PCR amplification program: (1) 98°C, pre-denaturation for 2min; (2) 98°C, denaturation for 15s; (3) 60°C, annealing for 15s; (4) 72°C, extension for 60s; repeat 30 cycle...
Embodiment 2
[0114] Expression of embodiment 2 recombinant lipase L4 in Pichia pastoris
[0115] (1) Construction of pPIC9K-L4 expression vector and host bacteria
[0116] With the L4 fragment in Example 1 as a template, use primer HEC-F1 (sequence: TACGTA ATGCGGTCCATTCTGGTG) and HEC-R1 (sequence: GCGGCCGC CTACCAGTGCTCCCAATA) amplification, and agarose gel electrophoresis to recover the target DNA band of about 1kbp. The target band and pPIC9K plasmid were respectively digested with SnaBI and NotI (Takara) for 4 h, and the fragments were recovered using OMEGACycle-Pure Kit. Under the action of T4 DNA Ligase (Takara), the digested product was ligated at 16°C for 12 hours, transformed into Escherichia coli Top10 competent cells, and the transformed strains were cultured on LB plates containing 50 μg / mL kanamycin. Escherichia coli transformants were verified with 5AOX1 (sequence: GACTGGTTCCAATTGACAAGC) and 3AOX1 (sequence: GCAAATGGCATTCTGACATCC) primers (see attached figure 2 ).
[01...
Embodiment 3
[0125] Expression of embodiment 3 recombinant lipase L4 in Trichoderma reesei
[0126] (1) Construction of pAN7-1-L4 expression vector and host bacteria
[0127] Extraction of RUT-C30 genome: RUT-C30 spores were inoculated into PDB (Potato Dextrose Broth Medium), and cultured at 28° C. and 220 rpm for 24 hours. Genomes were extracted using Tiangen High Efficiency Plant Genomic DNA Extraction Kit.
[0128] Amplification of CBHI promoter: Using the RUT-C30 genome as a template, use primers HEC-F2 (sequence: CACTCGACCTGCAGGCATGCATGACCGGACGTGTTTTGCC) and HEC-R2 (sequence: AATCACCAGAATGGACCGCATGGTTGACTATTGGGTTTCTGT) to amplify the CBHI promoter, and recover about 1kbp of DNA by agarose gel electrophoresis Strips (see attached Figure 4 ).
[0129] Amplification of the L4 fragment: using the L4 fragment in Example 1 as a template, use primers HEC-F3 (sequence: ACAGAACCCAATAGTCAACCATGCGGTCCATTCTGGTGATT) and HEC-R3 (sequence: ) to amplify, and recover a DNA strip of about 1.1 kbp b...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More