L-threonine transport protein as well as coding gene and application thereof
A threonine, coding technology, applied in the field of amino acids, to achieve the effect of improving yield
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0068] Example 1. The effect of L-threonine transporter ThrE on the production of L-threonine by 33a
[0069] This example is to verify the effect of two recombinant bacteria of the L-threonine transporter ThrE, namely knockout recombinant bacteria and overexpression recombinant bacteria, on the production of L-threonine by 33a.
[0070] 1. According to the gene knockout method in Corynebacterium glutamicum 33a, knockout of thrE is realized.
[0071] (1) Extract the genome of Corynebacterium glutamicum 33a using the bacterial genome extraction kit of Shanghai Jierui Company;
[0072] Through gene sequencing, the genome of the L-threonine transporter NCgl0580 in Corynebacterium glutamicum 33a has a nucleotide sequence as shown in SEQ ID NO: 1, with a full length of 903 nucleotides; the gene code is as shown in SEQ ID NO: 300 amino acids shown in ID NO:2.
[0073] (2) Use specific primers thrE-1: 5'-GCTCTAGACATCAATCTGGTCAACGAA and thrE-2: 5'-GACATGGAGATGAGCTAAGAATGCGGCCACGAAGG...
Embodiment 2
[0083] Example 2. Effect of L-threonine transporter NCgl0580 on the production of L-threonine by 33a
[0084] This example is to verify the effect of two recombinant bacteria of the L-threonine transporter NCgl0580, namely knockout recombinant bacteria and overexpression recombinant bacteria, on the production of L-threonine by 33a.
[0085] 1. The steps for knocking out the gene encoding NCgl0580 are as follows:
[0086] (1) Extract the genome of Corynebacterium glutamicum 33a using the bacterial genome extraction kit of Shanghai Jierui Company;
[0087] (2) Use specific primers NCgl0580-1: TCCCCCGGGTTCGAGCGCTGCGGTGACT and NCgl0580-2: GTAGACATGACGGCGACTTTGCAGGGATAGGGCGGAAC to amplify the left homology arm of the target gene; use specific primers NCgl0580-3:
[0088] AAGTCGCCGTCATGTCTACGTGGGCCGCGATCATCCTT and NCgl0580-4:
[0089] GCTCTAGAATGTTCCTGTCATCGCTGG amplifies the right homology arm of the target gene, and obtains the homology arm fragment of the target gene deletion ...
Embodiment 3
[0099] Example 3. Functional verification of L-threonine transporter NCgl0580
[0100] This example is to verify the L-threonine transport function of the L-threonine transporter NCgl0580.
[0101] The addition of amino acid dipeptide is a commonly used experimental method for functional verification of amino acid transporters. In order to verify the transporter of L-threonine, L-threonine dipeptide (L-thr-thr) was synthesized in Nanjing Peptide Industry Co., Ltd. for L-threonine transport experiments. The Corynebacterium glutamicum was activated on a solid seed plate, and then inoculated into a liquid seed medium for overnight culture until it reached the logarithmic growth phase. The bacteria in the logarithmic growth phase were collected, washed twice with CGX II basic medium, inoculated into CGX II basic medium, added with 3 mM L-thr-thr dipeptide, and pre-cultured at 30°C for 2 hours. The pre-cultured cells were collected and washed twice with pre-cooled CGXII basic med...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More