Recombinant Newcastle disease virus, preparation method, recombinant plasmid and application thereof

A Newcastle disease virus, recombinant plasmid technology, applied in the fields of botanical equipment and methods, biochemical equipment and methods, and applications, can solve the problems of trauma, limited efficacy in patients with advanced tumor spread, etc. Apoptosis-promoting effect

Pending Publication Date: 2021-10-01
JIANGSU KANIONREAL BIOMEDICAL TECH CO LTD
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For a long time, people have mainly used traditional surgical resection, radiotherapy and chemotherapy as the main methods of treating cancer. These methods can control the developm

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant Newcastle disease virus, preparation method, recombinant plasmid and application thereof
  • Recombinant Newcastle disease virus, preparation method, recombinant plasmid and application thereof
  • Recombinant Newcastle disease virus, preparation method, recombinant plasmid and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0069] Example 2, Preparation of recombinant chimeric viruses

[0070] First, the construction of recombinant plasmids (replaced with F gene)

[0071] 1. Filter Tumor-like strains F48E9, NCBI acquire its F gene sequence (GenBank: AY 508514.1) to design OverLAP PCR primers.

[0072] 2. Extraction of viral RNA, using F gene fragment, PCR amplification of the F gene fragment, connect PMD19-T, transform E. coli DH5α, and extract plasmids, identifying the correct PMD19-T plasmid for the next experiment.

[0073] 3, by PCR, to pBrLosata plasmid was amplified fragment A and B required, (fragment A primer: P1: 5'CACGTG AAAGCGCCAGAGAAGATTCCCGGGA3 '; P2: 5'TTTGGGGCCCATCTTGCACCTGGAGGGCGCCAACCGG 3'; P3: 5 'TCCAGGTGCAAGATGGGCCCCAAATCTTCTACCAATG 3' .B fragment primers: P6: 5'cctcatctgtgt tcaGattctgtgtggccctctcat 3 '; P7: 5'acaagaatctgaacagatgaggaacgaaggttcc 3'; p8: 5 'ggcctctccccccccccgcgccgggcggggTTT 3'). The PMD19-T-F plasmid was amplified for template F, and the colloated recovery purificati...

Example Embodiment

[0102] Example 3. Determination of recombinant chimeric viral virus and pathogenic force

[0103] First, EID50 measurement

[0104] The rescued recombinant chimeric virus or parent virus is diluted with a rhinarized PBS, and the chicken embryo is removed from the 37 ° C incubator. Each dilution is inoculated with 6 9-11 days of age SPF chicken embryos (100μL / Enum), after 4-6 days of incubation in a 37 ° C incubator, each chicken embryo must be detected by HA experiment, record the number of chicken embryos per dilution infection, calculate recombinant chimeric virus according to Reed and Muench Method methods or Parent virus EID50.

[0105] Second, TCID50 measurement

[0106] 1. DMEM medium containing 10% FBS, 1% antibiotics DF-1 cells in 96-well micro-culture plates, 37 ° C, 5% CO2 incubator overnight.

[0107] 2, before the recombinant chimeric virus and parent virus, the original cell culture added to step 1 was abandoned, and the 180 μl of DMEM fresh culture group containing...

Example Embodiment

[0119] Example 4, cell fusion experiment to detect the killing effect of recombinant chimeric virus on tumor cells

[0120] Tumor cells are hepatoma cells HepG2, breast cancer cells MDA-MB-231, non-small cell lung cancer cells A549, melanoma cells A375, neuroblastoma cells U251.

[0121] First, recombinant chimeric virus infection tumor cells

[0122] Take a tumor cells in which the long-term long-term tumor cells are collected after trypsin, inoculated in 6-well plates, recombinant chimeric virus rlosata-hn, rlosata-f, rlosata-p, rlosata-m, infected cells, parents Virus rlosata is used as a control, and the Control group is a virus-free SPF chicken embryo cargo liquid. After 24 hours, the 6-well plate was taken, and the cell fusion effect was observed in a fluorescent inverted microscope. See Figure 3A-3E .

[0123] The results show that recombinant chimeric virus rlosata-hn, rlosata-p, rlosata-m generates higher than Rlosata than Rlosata compared to parent viruses, but the diffe...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a recombinant Newcastle disease virus, a preparation method thereof, a recombinant plasmid and the application thereof. The recombinant Newcastle disease virus is obtained by replacing F protein of Newcastle disease virus Losata with F protein of a Newcastle disease virus virulent strain. The recombinant chimeric virus can effectively inhibit tumor cells, promote apoptosis of the tumor cells and effectively treat tumors, and has good safety.

Description

technical field [0001] The present invention generally relates to the field of biotechnology, and specifically relates to a recombinant Newcastle disease virus, a preparation method, a recombinant plasmid, and an application thereof. Background technique [0002] The means of treating cancer mainly include surgery, radiotherapy, chemotherapy, immunotherapy, monoclonal antibody therapy and virus vaccine. [0003] Malignant tumor is one of the major diseases that endanger human health. According to "2015 Global Cancer Statistics", there were about 14.1 million new cancer cases and 8.2 million cancer deaths worldwide in 2015. It is estimated that by 2025, the annual number of new cancer cases worldwide will reach 24.49 million. For a long time, people have mainly used traditional surgical resection and radiotherapy and chemotherapy to treat cancer. These methods can control the development of tumors to a certain extent, but the curative effect on patients with advanced tumor ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N7/01C12N15/45C12N15/85A61K39/17A61P35/00C12R1/93
CPCC12N7/00C07K14/005C12N15/85A61K39/12A61P35/00C12N2760/18121C12N2760/18122C12N2760/18134A61K39/17C07K16/00C07K16/28A61K35/768C12N15/86C12N2760/18143C12N2760/18132A61K48/005
Inventor 肖伟李德山刘天艳刘芝航王振中姜珊
Owner JIANGSU KANIONREAL BIOMEDICAL TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap