Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for producing knock-in cell

A cell and sequence technology, applied in the field of knock-in cell production, can solve problems such as low efficiency and incorrect knock-in

Pending Publication Date: 2021-11-12
OSAKA UNIV
View PDF13 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] These methods have been reported to efficiently knock in thousands of bases of DNA in cells, but are sometimes inefficient and cannot be knocked in correctly in fertilized animal eggs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing knock-in cell
  • Method for producing knock-in cell
  • Method for producing knock-in cell

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0130] [Example 1] Genome editing experiment 1 (wild type mouse, Kcnab1 gene, microinjection)

[0131] Using the sequence around the stop codon of exon 14 of the mouse Kcnab1 (Potassium Voltage-Gated Channel Subfamily A Member Regulatory Beta Subunit 1) gene as the target DNA sequence for genome editing, a 3983-base donor sequence ( Figure 2A ).

[0132] (1) Preparation of Cas9 mRNA

[0133] Linearize the plasmid (T7-NLS-hCas9-polyA, RIKEN BRC#RDB13130) containing the sequence of the poly A tail added downstream of the Cas9 coding sequence, and use this as template DNA, using an in vitro transcription kit (MEGAshortscript T7 Transcription Kit, manufactured by Life Technologies), and purified using a purification kit (MEGAClear kit, manufactured by Life Technologies).

[0134] (2) Preparation of gRNA

[0135] The design of gRNA was carried out using an aided design tool (http: / / crispor.tefor.net / ). The gRNA1 (GTATAAATGACTGCTTAATG TGG / sequence number: 19, the underline i...

Embodiment 2

[0148] [Example 2] Genome editing experiment 2 (wild type mouse, Ctgf gene, microinjection)

[0149] The sequence around the stop codon of exon 5 of the mouse Ctgf (connective tissue growth factor) gene was used as the target DNA sequence for genome editing, and a 3556-base donor sequence ( Figure 3A). Preparation of Cas9 mRNA, preparation of gRNA, preparation of donor DNA, introduction into fertilized eggs, and genotyping were carried out in the same manner as in Example 1. The gRNA sequences used are as follows. In addition, the primer sets used are shown in Table 1.

[0150] gRNA1:GACATAGGGCTAGTCTACAAA AGG / Serial number: 21, the underscore is PAM

[0151] gRNA2:CGGAGACATGGCGTAAAGCC AGG / Serial number: 22, the underscore is PAM

[0152] In addition, gRNA2 is set across the genomic sequence corresponding to the 5' homology arm and the genomic sequence corresponding to the 3' homology arm on the genomic DNA. In the donor DNA, there is a donor sequence between two ho...

Embodiment 3

[0156] [Example 3] Genome editing experiment 3 (wild type rat, Tp53 gene, microinjection)

[0157] Using the sequences around exon 2 and exon 4 of the rat Tp53 (tumor protein p53) gene as the target DNA sequence for genome editing, a 4513-base donor sequence ( Figure 4A ).

[0158] (1) Preparation of Cas9 protein-gRNA complex solution and donor DNA

[0159] Using a gRNA that cleaves both the genome-edited target DNA sequence within exon 2 and the 5' homology arm of the donor DNA ( CCC TGCCAGATAGTCCACCTTCT / SEQ ID NO: 23, the underline is PAM), and the gRNA that cuts the target DNA sequence of genome editing in exon 4 ( CCA CAGCGACAGGGTCACCTAAT / SEQ ID NO: 24, the underline is PAM). The design of gRNA was carried out using an aided design tool (http: / / crispor.tefor.net / ).

[0160] In addition, gRNA2 is set across the genomic sequence corresponding to the 3' homology arm and its upstream genomic sequence (the 5' end part of exon 4) on the genomic DNA. The sequence correspo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

It was found out that, by using a site-specific nuclease system which comprises a combination of a molecule simultaneously targeting and cleaving one homology arm sequence of a donor DNA and a genome sequence corresponding to the homology arm sequence, and a molecule targeting and cleaving a genome region close to the site to be cleaved by the aforesaid molecule, reparation via both of non-homologous end joining and homologous recombination is induced between the genome DNA and the donor DNA, and thus a cell, an organism, etc. in which a long-chain donor sequence is knocked-in can be produced at high efficiency and high accuracy.

Description

technical field [0001] The present invention relates to a method for producing a knock-in cell or a knock-in organism using a site-specific nuclease system and a donor DNA, and a kit or composition used in the method. Background technique [0002] Genome editing technologies such as zinc finger nuclease (zinc finger nuclease; ZFN), TAL effector nuclease (transcriptionactivator-like effector nuclease; TALEN), CRISPR-Cas9, etc. cut genomic DNA specifically in animal and plant cells Sequence, thus using the built-in repair mechanism to freely rewrite arbitrary sequence technology. Not only in biological science research, its application is rapidly extended to crop / livestock animal breed improvement, regenerative medicine, genome editing treatment, etc. [0003] When CRISPR / Cas9 (Non-Patent Document 1) is introduced into a mouse fertilized egg, a guide RNA binds to a target DNA sequence, and Cas9, which forms a complex with the guide RNA, cleaves the double strand of the target...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/09
CPCC12N15/113C12N2310/20C12N15/102C12N15/907C12N15/90C12N9/22C12N15/111
Inventor 真下知士吉见一人夘野善弘小谷祐子宫坂佳树冈雄一郎佐藤真
Owner OSAKA UNIV