Method for producing knock-in cell
A cell and sequence technology, applied in the field of knock-in cell production, can solve problems such as low efficiency and incorrect knock-in
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0130] [Example 1] Genome editing experiment 1 (wild type mouse, Kcnab1 gene, microinjection)
[0131] Using the sequence around the stop codon of exon 14 of the mouse Kcnab1 (Potassium Voltage-Gated Channel Subfamily A Member Regulatory Beta Subunit 1) gene as the target DNA sequence for genome editing, a 3983-base donor sequence ( Figure 2A ).
[0132] (1) Preparation of Cas9 mRNA
[0133] Linearize the plasmid (T7-NLS-hCas9-polyA, RIKEN BRC#RDB13130) containing the sequence of the poly A tail added downstream of the Cas9 coding sequence, and use this as template DNA, using an in vitro transcription kit (MEGAshortscript T7 Transcription Kit, manufactured by Life Technologies), and purified using a purification kit (MEGAClear kit, manufactured by Life Technologies).
[0134] (2) Preparation of gRNA
[0135] The design of gRNA was carried out using an aided design tool (http: / / crispor.tefor.net / ). The gRNA1 (GTATAAATGACTGCTTAATG TGG / sequence number: 19, the underline i...
Embodiment 2
[0148] [Example 2] Genome editing experiment 2 (wild type mouse, Ctgf gene, microinjection)
[0149] The sequence around the stop codon of exon 5 of the mouse Ctgf (connective tissue growth factor) gene was used as the target DNA sequence for genome editing, and a 3556-base donor sequence ( Figure 3A). Preparation of Cas9 mRNA, preparation of gRNA, preparation of donor DNA, introduction into fertilized eggs, and genotyping were carried out in the same manner as in Example 1. The gRNA sequences used are as follows. In addition, the primer sets used are shown in Table 1.
[0150] gRNA1:GACATAGGGCTAGTCTACAAA AGG / Serial number: 21, the underscore is PAM
[0151] gRNA2:CGGAGACATGGCGTAAAGCC AGG / Serial number: 22, the underscore is PAM
[0152] In addition, gRNA2 is set across the genomic sequence corresponding to the 5' homology arm and the genomic sequence corresponding to the 3' homology arm on the genomic DNA. In the donor DNA, there is a donor sequence between two ho...
Embodiment 3
[0156] [Example 3] Genome editing experiment 3 (wild type rat, Tp53 gene, microinjection)
[0157] Using the sequences around exon 2 and exon 4 of the rat Tp53 (tumor protein p53) gene as the target DNA sequence for genome editing, a 4513-base donor sequence ( Figure 4A ).
[0158] (1) Preparation of Cas9 protein-gRNA complex solution and donor DNA
[0159] Using a gRNA that cleaves both the genome-edited target DNA sequence within exon 2 and the 5' homology arm of the donor DNA ( CCC TGCCAGATAGTCCACCTTCT / SEQ ID NO: 23, the underline is PAM), and the gRNA that cuts the target DNA sequence of genome editing in exon 4 ( CCA CAGCGACAGGGTCACCTAAT / SEQ ID NO: 24, the underline is PAM). The design of gRNA was carried out using an aided design tool (http: / / crispor.tefor.net / ).
[0160] In addition, gRNA2 is set across the genomic sequence corresponding to the 3' homology arm and its upstream genomic sequence (the 5' end part of exon 4) on the genomic DNA. The sequence correspo...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


