Aptamer sensor for detecting tetracycline based on DNA silver nanoclusters and gold nanorods
An aptamer sensor and gold nanorod technology, applied in the field of biosensors, can solve problems such as complex operation, high cost, and complex processing, and achieve the effect of huge application prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Example 1: Preparation of gold nanorods
[0029] Preparation of gold seeds: Dissolve 0.60 mL of 0.010 M fresh ice-cold NaBH 4Add to 5mL of 0.20M CTAB and 5mL of 0.00050M HAuCl 4 4H 2 In the mixture of O, stir vigorously for 2 minutes, and react at 25°C for 2 hours in the dark;
[0030] Preparation of growth solution: at 25 °C, add 0.2 mL of 0.0040M AgNO 3 The solution was added to 25mL 0.20M CTAB solution, followed by 25.0mL 0.0010M HAuCl 4 4H 2 O solution and 350 μL 0.0788M ascorbic acid (AA), stirred gently, because AA is a reducing agent, after adding the mixed solution, the growth solution changed from light yellow to colorless;
[0031] Preparation of gold nanorods: Mix the above growth solution with 60 μL of gold seeds, and react in the dark at 30°C for 24 hours, the color of the solution gradually turns dark purple; centrifuge the synthesized gold nanorod solution (10,000rpm, 15min) to remove the upper layer The CTAB was redissolved in purified water, repe...
Embodiment 2
[0032] Embodiment 2: the preparation of DNA silver nanocluster
[0033] 10 μM silver nanocluster template sequence 1 (ccccccgggggccccccttttttcaccaccg) was heated at 95°C for 10 min, and then bathed in ice water for 10 min; 31 μL of 10 μM template sequence was dissolved, mixed with 56.1 μL PB buffer (pH 7.2), and then 10 μL of 620 μM silver nitrate (AgNO 3 ) solution, stirred for 1min, ice bathed for 30min; added 10μL 620μM fresh sodium borohydride (NaBH 4 ) solution for 5 minutes, and avoid light in an ice bath for 3 hours to prepare DNA silver nanoclusters;
Embodiment 3
[0034] Example 3: Detection of tetracycline by a label-free fluorescent aptasensor based on DNA silver nanoclusters and gold nanorods:
[0035] After mixing 107.1 μL cDNA-AgNCs with 31 μL 10 μM tetracycline aptamer sequence 2 (cggtggtg), add 171.9 μL ultrapure water to obtain 1 μM dsDNA, and place it in a metal bath at 25°C in the dark to incubate for 1 hour to form a double-stranded structure; then take Add 30 μL of 1 μM dsDNA to 30 μL of different concentrations of tetracycline and react in the dark at 25°C for 30 minutes; add 20 μL of GNR and react in the dark at 25°C for 10 minutes; use ultrapure water to make the reaction system volume up to 300 μL; use a fluorescence spectrophotometer to measure the solution at room temperature of the fluorescence emission spectrum.
[0036] The principle of this method is feasible ( Figure 4 ), as the concentration of tetracycline increases, the fluorescence at 645nm of the system increases gradually ( Figure 5 ). The fluorescence ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| volume | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More