Unlock instant, AI-driven research and patent intelligence for your innovation.

SNP molecular marker closely linked with cucumber cold-resistant gene LTT and application of SNP molecular marker

A molecular marker, cucumber technology, applied in the direction of recombinant DNA technology, determination/inspection of microorganisms, DNA/RNA fragments, etc.

Active Publication Date: 2022-02-08
INST OF VEGETABLE & FLOWERS CHINESE ACAD OF AGRI SCI
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, the SNP markers linked to cold tolerance gene (LTT) in cucumber seedlings have not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SNP molecular marker closely linked with cucumber cold-resistant gene LTT and application of SNP molecular marker
  • SNP molecular marker closely linked with cucumber cold-resistant gene LTT and application of SNP molecular marker
  • SNP molecular marker closely linked with cucumber cold-resistant gene LTT and application of SNP molecular marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Acquisition of SNP Markers Linked to Cold Tolerance Genes in Cucumber Seedlings

[0054] Combining the cucumber genome sequence data and parental resequencing data, using bioinformatics combined with phenotypic identification of genetic populations, the SNP in this region was analyzed and located, LTT-SNP1 was found, and the SNP was found (located on chromosome 6, the physical location is 20,813,718) in cucumber parent material CG104 (P 1 ) genome, the base of this site is C; in material CG37(P 2 ) genome, the base is G.

[0055] Based on the obtained SNP molecular marker LTT-SNP1 linked to cold tolerance genes of cucumber seedlings, a CAPS marker (named LTT-SNP1) linked to cold tolerance genes of cucumber seedlings was developed. The forward and reverse primers are:

[0056] LTT-SNP1-F: GACAGAAGTTCTGGGAATT (SEQ ID NO: 2);

[0057] LTT-SNP1-R: CCTGGATACTGTGATGTTGG (SEQ ID NO: 3).

[0058] Due to the relationship between the SNP obtained above (SNP=C / G), when the ba...

Embodiment 2

[0072] Validation of LTT gene flanking markers

[0073] 123 F copies constructed using CG104 and CG37 as parents 2 Groups and 68 natural population materials, the marker LTT-SNP1 linked to the LTT gene obtained in Example 1 was verified to determine the accuracy of the marker for molecular marker-assisted selection: by comparing with the field phenotype of the selected materials than, marked in 123 parts F 2 Among the group materials, the phenotype data reflected by the band patterns of 102 materials were consistent with the results of the field investigation, and the correct rate was 83.0% (Table 1). The amplified bands are shown in figure 2 .

[0074] According to the phenotype data of 68 natural population materials, among the 34 low-temperature sensitive materials, the phenotype data reflected by the band patterns of 28 materials are consistent with the field investigation results, and the correct rate of low-temperature sensitive materials is 82.4% (Table 2) , the amp...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an SNP molecular marker closely linked with a cucumber cold-resistant gene LTT and application of the SNP molecular marker, and belongs to the technical field of molecular markers. According to the invention, the nucleotide sequence of the SNP molecular marker closely linked with the cucumber cold-resistant gene LTT is shown as SEQ ID NO: 1, and C / G polymorphism exists in the 45th basic group of the SEQ ID NO: 1; the SNP marker is developed by taking a seedling cold-resistant inbred line CG104 and a seedling low-temperature sensitive inbred line CG37 as materials, the banding patterns of 102 parts of materials of the SNP in 123 parts of F2 group materials are consistent with a field survey result, the accuracy is 83.0%, and genotype data and phenotype data of 68 parts of natural group materials are verified to obtain relatively high identification accuracy; and the SNP molecular marker provided by the invention can be used for performing cold-resistant screening on cucumber candidate materials, and has the advantages of high efficiency, less limitation and accuracy.

Description

technical field [0001] The invention belongs to the technical field of molecular markers, and in particular relates to a closely linked SNP molecular marker of cucumber cold resistance gene LTT and an application thereof. Background technique [0002] Cucumber (Cucumis sativus L.) is an important economic crop, and my country is the country with the largest cucumber cultivation area in the world. Cucumber originated in the tropical rainforest area at the southern foot of the Himalayas. It likes warmth but is not cold-tolerant. It is a typical cold-sensitive plant (An Zhixin et al., 2006). The optimum temperature for cucumber germination is 15°C-35°C (WEHNER, 1982; 1984); the optimum temperature for cucumber growth is 25-30°C / 18-20°C (day / night) (Li Huimin, 2016). However, there are generally problems of long-term low temperature (<20°C / 8-12°C, day / night) and short-term critical low temperature (15°C / 4-8°C, day / night) in cucumber cultivation in winter and spring in northe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6895C12Q1/6858C12N15/11
CPCC12Q1/6895C12Q1/6858C12Q2600/13C12Q2600/156C12Q2531/113C12Q2521/301
Inventor 顾兴芳张圣平苗晗李彩霞董邵云刘小萍
Owner INST OF VEGETABLE & FLOWERS CHINESE ACAD OF AGRI SCI