SNP molecular marker closely linked with cucumber cold-resistant gene LTT and application of SNP molecular marker
A molecular marker, cucumber technology, applied in the direction of recombinant DNA technology, determination/inspection of microorganisms, DNA/RNA fragments, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0053] Acquisition of SNP Markers Linked to Cold Tolerance Genes in Cucumber Seedlings
[0054] Combining the cucumber genome sequence data and parental resequencing data, using bioinformatics combined with phenotypic identification of genetic populations, the SNP in this region was analyzed and located, LTT-SNP1 was found, and the SNP was found (located on chromosome 6, the physical location is 20,813,718) in cucumber parent material CG104 (P 1 ) genome, the base of this site is C; in material CG37(P 2 ) genome, the base is G.
[0055] Based on the obtained SNP molecular marker LTT-SNP1 linked to cold tolerance genes of cucumber seedlings, a CAPS marker (named LTT-SNP1) linked to cold tolerance genes of cucumber seedlings was developed. The forward and reverse primers are:
[0056] LTT-SNP1-F: GACAGAAGTTCTGGGAATT (SEQ ID NO: 2);
[0057] LTT-SNP1-R: CCTGGATACTGTGATGTTGG (SEQ ID NO: 3).
[0058] Due to the relationship between the SNP obtained above (SNP=C / G), when the ba...
Embodiment 2
[0072] Validation of LTT gene flanking markers
[0073] 123 F copies constructed using CG104 and CG37 as parents 2 Groups and 68 natural population materials, the marker LTT-SNP1 linked to the LTT gene obtained in Example 1 was verified to determine the accuracy of the marker for molecular marker-assisted selection: by comparing with the field phenotype of the selected materials than, marked in 123 parts F 2 Among the group materials, the phenotype data reflected by the band patterns of 102 materials were consistent with the results of the field investigation, and the correct rate was 83.0% (Table 1). The amplified bands are shown in figure 2 .
[0074] According to the phenotype data of 68 natural population materials, among the 34 low-temperature sensitive materials, the phenotype data reflected by the band patterns of 28 materials are consistent with the field investigation results, and the correct rate of low-temperature sensitive materials is 82.4% (Table 2) , the amp...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


