L-aspartic acid beta-decarboxylase mutant

A technology of aspartic acid and decarboxylase, which is applied in the field of enzyme engineering, can solve the problems of affecting the production of L-alanine and the inability to exert catalytic activity, etc., and achieve the effect of improving thermal stability and pH stability

Pending Publication Date: 2022-03-01
JIANGNAN UNIV
1 Cites 0 Cited by

AI-Extracted Technical Summary

Problems solved by technology

In the multi-enzyme cascade catalytic process, the optimum pH catalyzed by maleate cis-trans isomerase MaiA is 8, the optimum pH catalyzed by aspartate lyase AspA is 8.5, and the optimum pH catalyzed by aspartate β decarboxylase ASD is The optimal pH of the react...
View more

Abstract

The invention discloses an L-aspartic acid beta-decarboxylase mutant, and belongs to the technical field of enzyme engineering. The specific enzyme activity of the L-aspartic acid beta-decarboxylase mutant E88R is improved by 2.1 times compared with that of a wild type, and the specific enzyme activity reaches 481 +/-3.7 U/mg. The mutant E88R still has 59% of residual enzyme activity after being treated for 30 minutes at 50 DEG C, and the residual enzyme activity is 88% and 82% respectively under the conditions that the pH is 7.0 and the pH is 8.0. Compared with a wild type enzyme, the thermal stability and pH stability of the mutant enzyme E88R are greatly improved, and later industrial production is facilitated. Under the condition that the pH is 7.5, the specific enzyme activity of the mutant E88R reaches 199 +/-2.1 U/mg and is 1.9 times higher than that of a wild type. 2.5 M maleic acid is used as a substrate, the L-alanine is prepared through whole-cell catalysis, and the production rate reaches 35.66 g/(L.h) and is increased by 1.68 times compared with that of a wild type.

Application Domain

BacteriaMicroorganism based processes +4

Technology Topic

Molecular biologyMutant enzyme +7

Image

  • L-aspartic acid beta-decarboxylase mutant
  • L-aspartic acid beta-decarboxylase mutant
  • L-aspartic acid beta-decarboxylase mutant

Examples

  • Experimental program(7)

Example Embodiment

[0054] Example 1: Construction and Purification of recombinant E. coli BL21 / PET28A-E88R
[0055] (1) Construction of mutant BL21 / PET28A-E88R:
[0056] The PET28A-PD21192ASD plasmid is a template, and the total particle PCR is performed using primer E88R-UP / DOWN, and the primer sequence information is shown in Table 1, and PCR is performed under the conditions shown in Table 2. The obtained PCR product was identified by agarose gel electrophoresis, and then the PCR product was purified and digested. After digestion E. coli E.COLI JM109, the plasmid obtained the recombinant plasmid PET28A-E88R to carry the mutant gene was obtained. The recombinant plasmid PET28A-E88R was transformed into E. coli E.COLI BL21 strain to obtain recombinant strain BL21 / PET28A-E88R.
[0057] Table 1 primer
[0058] name Sequence (5'-3 ') E88R-UP Catagaaggcgctcaggcgctatattgccg E88R-DOWN CCCTTCTTGCCCGATCTTTG
[0059] Table 2 Full Plasmid PCR Amplification Response System
[0060] Reagent Dosage (μL) Primerstar polymerase 25 template 1.0 Upstream primer 1.0 Downstream primer 1.0 DDH 2 O
[0061] The PCR amplification reaction conditions are:
[0062]
[0063] (2) The recombinant strain BL21 / PET28A-E88R in step (1) was inoculated with 5 ml of LB medium (kanamycin concentration of 50 μg / mL), 37 ° C, 200R / min oscillated overnight culture, and obtained seed fluid. The seed fluid was inoculated at 1% (V / V) inoculated in 100 ml of LB medium (kanamycin concentration of 50 μg / mL), 37 ° C, 200R / min oscillate culture to OD 600 At 0.6-0.8, an inducer IPTG was added to 0.2 mM, and 16-18 hours were induced by 16-18 hours to obtain a bacterial liquid, and the cell cell cell was collected by 6000 rpm.
[0064] (3) Use the bacterial cell cells in step (2) using Binding Buffer, and the ultrasonic crushing of ice is 30 min, the supernatant was collected, 0.22 μm Filter membrane was filtered to obtain a crude enzyme solution, purified using the His TRAP FF purification column. The collected purified protein was placed in a phosphate buffer of 50 mm, pH 6.5, 200-12 h, during which dialysate, more thorough replacement of imidazole, and obtained pure enzyme solution. SDS-PAGE gel electrophoresis detects the purity of purified protein. The detection of mutant E88R pure enzymes was activated by 481 ± 3.7 U / mg, which was 2.1 times higher than the wild type.

Example Embodiment

[0065] Example 2: Ultimate pH Determination
[0066] The pure enzyme solution of the mutant and wild-type enzyme in Example 1 was diluted to a concentration of the final concentration of 5 ug / ml, as a petrolease as a control; maintaining the other reaction conditions unchanged, and different pH was added to the reaction system. Phosphate - Citric acid buffer (pH = 3-8), 45 ° C reacted for 10 min and inactivated the reaction, and detecting the most suitable reaction pH. Such as figure 1 As shown, under pH 7.5, the wild-type enzyme is 106 ± 2.7 u / mg, mutant enzyme is affected by 199 ± 2.1 U / mg, and the wild type is 1.9 times.
[0067] Such as figure 2 As shown, the highest enzyme activity of the mutant and wild enzyme is 100%, the most suitable reaction of the mutant E88R is 4.5, and at pH 7.5, still remained about 60% relative enzyme activity. The mutant has a certain improvement in the wild type, acidic conditions and alkaline conditions.

Example Embodiment

[0068] Example 3: Excellent temperature determination
[0069] The pure enzyme liquid in Example 1 was diluted to a concentration of 5 ug / ml at a concentration of 5 ug / ml, and the other reaction conditions were unchanged, and the reaction was carried out at different temperatures for 10 min. Inactivation termination reactions (the temperature is set to 35 ~ 60 ° C), and the most suitable reaction temperature is detected.
[0070] Such as image 3 As shown, the highered enzyme activity of the mutant and wild enzyme is 100%, and the opposing enzyme activity of the mutant is mostly under 55 ° C, and the relative enzyme activity can be maintained at 60 ° C, while the wild type is opposite The enzyme activity is only 12% left.

PUM

no PUM

Description & Claims & Application Information

We can also present the details of the Description, Claims and Application information to help users get a comprehensive understanding of the technical details of the patent, such as background art, summary of invention, brief description of drawings, description of embodiments, and other original content. On the other hand, users can also determine the specific scope of protection of the technology through the list of claims; as well as understand the changes in the life cycle of the technology with the presentation of the patent timeline. Login to view more.
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products