Qualitative and quantitative analysis method for detecting different plants in soil
A technique for quantitative analysis, soil, applied in the biological field
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] According to Qiagen's DNeasy Power Lyzer Power soil Kit (12855-100), the DNA genomes of 10 soil samples were extracted, and the detailed steps are shown in the instructions. Then if figure 1 As shown, proceed as follows:
[0038] 1. PCR amplification of the target region
[0039] 1. Primer Design
[0040] The primer design region is a part of the plant chloroplast conserved gene RbcL; the primer names are RbcL-F, RbcL-R, and the total length of the amplification is about 260bp.
[0041] See the table below for specific primer information:
[0042] Primer name sequence (5' to 3') RbcL-F atgtcaccacaaacagagactaaagcaagt (SEQ ID NO.01) RbcL-R cgtcctttgtaacgatcaag (SEQ ID NO.02)
[0043] 2. PCR amplification
[0044] (1) Perform PCR amplification on 10 samples, using Taq polymerase (Vazyme; P212-01); 10 μL reaction system;
[0045]
[0046] (2) PCR instrument: Bio-Rad S1000 type
[0047] PCR reaction parameters
[0048] A.1×(2min at 95...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


