Unlock instant, AI-driven research and patent intelligence for your innovation.

Qualitative and quantitative analysis method for detecting different plants in soil

A technique for quantitative analysis, soil, applied in the biological field

Pending Publication Date: 2022-03-01
XIAMEN UNIV
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is a problem of what is an effective plant DNA molecular marker, and how to use this molecular marker to construct a sequencing library and analyze different plant species is also a challenge

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Qualitative and quantitative analysis method for detecting different plants in soil
  • Qualitative and quantitative analysis method for detecting different plants in soil
  • Qualitative and quantitative analysis method for detecting different plants in soil

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] According to Qiagen's DNeasy Power Lyzer Power soil Kit (12855-100), the DNA genomes of 10 soil samples were extracted, and the detailed steps are shown in the instructions. Then if figure 1 As shown, proceed as follows:

[0038] 1. PCR amplification of the target region

[0039] 1. Primer Design

[0040] The primer design region is a part of the plant chloroplast conserved gene RbcL; the primer names are RbcL-F, RbcL-R, and the total length of the amplification is about 260bp.

[0041] See the table below for specific primer information:

[0042] Primer name sequence (5' to 3') RbcL-F atgtcaccacaaacagagactaaagcaagt (SEQ ID NO.01) RbcL-R cgtcctttgtaacgatcaag (SEQ ID NO.02)

[0043] 2. PCR amplification

[0044] (1) Perform PCR amplification on 10 samples, using Taq polymerase (Vazyme; P212-01); 10 μL reaction system;

[0045]

[0046] (2) PCR instrument: Bio-Rad S1000 type

[0047] PCR reaction parameters

[0048] A.1×(2min at 95...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a qualitative and quantitative analysis method for detecting different plants in soil. The chloroplast conserved gene RbcL is used as a molecular target to distinguish plant groups in soil samples, and the method can be used for qualitative and quantitative analysis of different plant types in any ecological, geological and archaeological soil samples or biological metabolism residues.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a qualitative and quantitative analysis method for detecting different kinds of plants in soil. Background technique [0002] Obtaining the distribution of organisms in the history of a specific geographical location is helpful to understand the ecological environment at that time, and also reflects the dynamic balance of biodiversity. However, there are enormous technical challenges in reconstructing historical vegetation in past habitats and in identifying plant taxa present in soil samples. The most common method currently used is to use records of plant pollen preserved in sediments to identify pollen morphology and thus infer historical vegetation composition. But this technology has a big flaw, that is, pollen is very easy to be blown away by the wind due to its characteristics, so it will not stay in one place for a long time, and its regionality is not strong. A...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6895C12Q1/6869
CPCC12Q1/6895C12Q1/6869C12Q2531/113C12Q2525/205C12Q2563/185C12Q2535/122
Inventor 李庆顺戴景锭陈鹭真
Owner XIAMEN UNIV