Unlock instant, AI-driven research and patent intelligence for your innovation.

Preparation method of functional single-stranded self-assembled RNA (Ribonucleic Acid) nanoparticles

A nanoparticle and self-assembly technology, which is applied in the field of preparation of functional single-stranded self-assembled RNA nanoparticles, can solve the problems of high RNA production costs, field dosage, RNA nanoparticle retention, etc., and achieve low cost and high efficiency.

Pending Publication Date: 2022-07-22
ZHEJIANG SCI-TECH UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, at present, the preparation of RNA nanoparticles is still in the form of in vitro transcription synthesis or chemical synthesis. The contradiction between the high cost of RNA production and the large dosage in the field is the biggest problem facing the application of RNAi biopesticides.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of functional single-stranded self-assembled RNA (Ribonucleic Acid) nanoparticles

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0009] The goal of this example is to rapidly and massively synthesize RNA nanomolecules of the following sequences:

[0010] GGGCACGAGACCCGCGCCGAGCUUUUUUGGCACAAGCUGGAGUACAACUACAACGAGACCCGCGCCGAGCUUUUUUGCCUGGGGCACAAGCUGGAGUACAACGAGACCCGCGCCGAGCUUUUUUGCGGCCCCGUGCUGCUGCCCGACAACGAGACCCGCGCCGAGCUUUUUUGCCACAAGUUCAGCGUGUCCGGCGAAAGCGGUACGCCGGACACGCUGAACUUGUGGCGCUCGGCGCGGGUCUCGUUGUCGGGCAGCAGCACGGGGCCGCGCUCGGCGCGGGUCUCGUUGUACUCCAGCUUGUGCCCCAGGCGCUCGGCGCGGGUCUCGUUGUAGUUGUACUCCAGCUUGUGCCGCUCGGCGCGGGUCUCGUGCCCGAGCUCGUCCAUGCCGUGACGCUCGGCGCGGGAAACCGCUACCCGCGCCGAGCUUUUGCUUUUUUGUCACGGCAUGGACGAGCUC

[0011] Follow the steps below:

[0012] 1. According to the target RNA nanomolecule, the DNA sequence encoded by it can be deduced as follows:

[0013] GGGCACGAGACCCGCGCCGAGCTTTTTTGGCACAAGCTGGAGTACAACTACAACGAGACCCGCGCCGAGCTTTTTTGCCTGGGGCACAAGCTGGAGTACAACGAGACCCGCGCCGAGCTTTTTTGCGGCCCCGTGCTGCTGCCCGACAACGAGACCCGCGCCGAGCTTTTTTGCCACAAGTTCAGCGTGTCCGGCGAAAGCGGTACGCCGGACACGCTGAACTTGTGGCGCTCGGCGCGGGTCTCGTT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a preparation method of functional single-stranded self-assembled RNA (Ribonucleic Acid) nanoparticles, the RNA nanoparticles are obtained by utilizing a biosynthesis method, and the strategy is that a single-stranded self-assembled RNA nano sequence is designed by utilizing an RNANo program, then an expression vector is constructed by a DNA (Deoxyribose Nucleic Acid) sequence coded by the RNA nano sequence, and the expression vector is introduced into a host lacking RNase III, so that the functional single-stranded self-assembled RNA nanoparticles are obtained. And carrying out host expression to obtain the self-assembled RNA nanoparticles. Similar to prokaryotic expression of foreign protein, the single-stranded self-assembled RNA nano-molecules are transcribed, synthesized, self-assembled and folded in a host to form the RNA nano-particles without being degraded by RNA enzyme, mass accumulation is realized, and sustainable and large-scale preparation of the functional single-stranded self-assembled RNA nano-particles is realized.

Description

technical field [0001] The invention relates to a preparation method of functional single-strand self-assembled RNA nanoparticles. Background technique [0002] Recent studies have found that dsRNA or siRNA directly sprayed on plants or microorganisms can enter plants or microorganisms, and then control diseases, pests and weeds by inducing RNAi mechanisms. However, due to the poor stability of naked RNA, the plant absorption efficiency is low. [0003] Therefore, this effect of spray-induced gene silence (SIGS) requires a delivery carrier in the application to improve the absorption efficiency of dsRNA / siRNA. [0004] In recent years, the field of RNA nanotechnology has grown rapidly. As a unique biocompatible material, RNA is widely used to construct nanoparticles through bottom-up self-assembly. In general, RNA nanoparticles can be easily combined with siRNA or dsRNA, as nanocarriers to deliver dsRNA / siRNA into organisms to exert corresponding biological functions, whi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/70C12N1/21C12N15/113C12P19/34C12R1/19
CPCC12N15/70C12N15/113C12P19/34
Inventor 金伟波季伟东吴方丽
Owner ZHEJIANG SCI-TECH UNIV