Primer and probe composition, detection method, kit and application thereof for simultaneously detecting mouse parvovirus and mouse thymic virus
By designing specific primer and probe combinations and combining them with real-time PCR, simultaneous detection of mouse parvovirus and mouse thymvirus was achieved, solving the problem of time-consuming and labor-intensive detection in existing technologies and providing an efficient means of monitoring viral contamination.
Patent Information
- Application Number
- CN202310046665.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2022-05-24
- Filing Date
- 2023-01-31
- Publication Date
- 2026-08-04
- Estimated Expiration
- 2043-01-31
AI Technical Summary
In the existing technology, the detection of mouse parvovirus and mouse thymvirus needs to be performed separately, which makes the detection process labor-intensive and time-consuming, and there is a lack of methods and kits for simultaneous detection.
A dual real-time quantitative PCR (qPCR) primer and probe composition for the simultaneous detection of mouse parvovirus and mouse thymvirus is provided, comprising specific upstream and downstream primers and probes, combined with qPCR reaction premix and quantitative standards, to achieve simultaneous detection via real-time quantitative PCR.
It achieves simultaneous detection with good specificity, high sensitivity, and good repeatability, shortens the detection time, reduces costs, and is suitable for early monitoring of rodent biological products and prevention and control of viral contamination.
Smart Images

Figure CN116287447B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of virus detection technology, and relates to primer and probe compositions for the simultaneous detection of mouse parvovirus and mouse thymvirus and their applications. Specifically, it relates to a dual fluorescent quantitative qPCR detection primer and probe composition, detection method, kit and its applications for the simultaneous detection of mouse parvovirus and mouse thymvirus. Background Technology
[0002] With the widespread application of recombinant protein drugs in the medical field, the issue of viral safety of biological products has also received much attention. Rodent cell lines, such as the Chinese hamster ovary cell line (CHO-K1 cells), are often used in protein expression production systems to ensure the correct conformation and activity of the product. However, the risk of viral contamination is unavoidable, whether it is bioactive raw materials or complex production processes.
[0003] Murine minute virus (MVM) is a single-stranded DNA virus, non-enveloped, and extremely stable, readily infecting rodent cells such as CHO-K1 and BHK21 cells. Murid herpesvirus 3 (MTLV) belongs to the Herpesviridae family. Its viral particle diameter is approximately 135 nm. It is an enveloped DNA virus that can infect and kill developing T lymphocytes in the thymus of newborn mice, making it a susceptible pathogen in laboratory animals. ICH Q5A explicitly stipulates that MVM and MTLV, as species-specific viruses in rodent cell lines, require detection of exogenous contamination. Commonly used methods for detecting MVM and MTLV include virus isolation, ELISA antigen detection, and RT-PCR nucleic acid detection. In comparison, quantitative real-time PCR (qPCR) is more intuitive and rapid, suitable for early viral safety risk control.
[0004] Currently, mouse parvovirus (MVM) and mouse thymvirus (MTLV) in samples must be detected by two separate quantitative real-time PCR (qPCR) tests, which is a labor-intensive and time-consuming process. Furthermore, there is a lack of commercially available detection methods and kits that can simultaneously detect MVM and MTLV. Therefore, this invention provides a dual quantitative real-time qPCR detection primer and probe composition, detection method, and kit for the simultaneous detection of mouse parvovirus and mouse thymvirus, solving the problem of labor-intensive and time-consuming detection processes. Summary of the Invention
[0005] The purpose of this invention is to overcome the problem that mouse parvovirus and mouse thymvirus must be detected separately in the prior art.
[0006] Therefore, the present invention provides a primer and probe composition for simultaneously detecting mouse parvovirus and mouse thymvirus, comprising an upstream primer P-MVM-F, a downstream primer P-MVM-R and a probe MVM-P for detecting mouse parvovirus, and an upstream primer P-MTLV-F, a downstream primer P-MTLV-R and a probe MTLV-P for detecting mouse thymvirus.
[0007] The sequence of the upstream primer P-MVM-F is 5'-AACTTACTTCTTCTGCTGCACA-3';
[0008] The sequence of the downstream primer P-MVM-R is 5'-AGACCCAGTAGAAACACCAA CC-3';
[0009] The sequence of the probe MVM-P is 5'-(FAM)-CCAACCTGA / iXNA_C / RGC GRAAACG-(BHQ)-3';
[0010] The sequence of the upstream primer P-MTLV-F is 5'-AGGACTTGCTTTACCTGTTG-3';
[0011] The sequence of the downstream primer P-MTLV-R is 5'-ATACATACCTCTCCAAGAACC G-3';
[0012] The sequence of the probe MTLV-P is 5'-(FAM)-CCAACCTGA / iXNA_C / RGC GRAAACG-(BHQ)-3';
[0013] Where / iXNA_A / indicates locked nucleic acid modification of base A; / iXNA_T / indicates locked nucleic acid modification of base T; / iXNA_G / indicates locked nucleic acid modification of base G; and / iXNA_C / indicates locked nucleic acid modification of base C.
[0014] Specifically, the primer and probe composition described above also includes a probe MTLV-P2 for detecting mouse thymomavirus; the sequence of the probe MTLV-P2 is 5'-(HEX)-TACATTCC / iXNA_C / G / iXNA_C / T / iXNA_T / CAAAC-(BHQ)-3';
[0015] Where / iXNA_T / indicates locked nucleic acid modification of base T; / iXNA_C / indicates locked nucleic acid modification of base C.
[0016] This invention also provides a kit for simultaneously detecting mouse parvovirus and mouse thymvirus. The kit includes the aforementioned primer and probe composition. The upstream primer P-MVM-F, the downstream primer P-MVM-R, the upstream primer P-MTLV-F, and the downstream primer P-MTLV-R are mixed to form a mixed primer. The probes MVM-P and MTLV-P are mixed to form a mixed probe. Preferably, the mixed probe further includes probe MTLV-P2.
[0017] Specifically, the concentrations of the upstream primer P-MVM-F and the downstream primer P-MVM-R in the above-mentioned mixed primers are 0.1-1 mM, 0.1-1 mM, 0.1-1 mM, 0.1-1 mM, and 0.1-1 mM respectively.
[0018] Specifically, the concentration of probe MVM-P in the above-mentioned mixed probe is 0.05-1 mM, and the concentration of probe MTLV-P is 0.05-1 mM. Preferably, the concentration of probe MTLV-P2 is 0.05-1 mM.
[0019] Specifically, the kit also includes a qPCR reaction premix; the qPCR reaction premix contains AceQ Universal U+Probe Master Mix V2 and Mg... 2+ .
[0020] Specifically, the kit also includes quantitative standards; the quantitative standards are a mixture of PUC57-MVM and PUC57-MTLV plasmids.
[0021] Specifically, the kit also includes a positive control; the positive control is a mixture of inactivated MVM strain and MTLV pseudovirus strain; the nucleic acid information of the MTLV pseudovirus strain is the full-length UL27 sequence, assembled using the AdMax packaging system.
[0022] Specifically, the primer and probe compositions or kits mentioned above can be used for early monitoring of common pathogens in rodent laboratory animals, and can also be used to detect in real time whether rodent biological products, raw materials, and their production processes are contaminated with mouse parvovirus and mouse thymvirus.
[0023] This invention also provides a dual real-time quantitative PCR method for the simultaneous detection of mouse parvovirus and mouse thymvirus, comprising the following steps:
[0024] (1) Extract the DNA template from the sample to be tested;
[0025] (2) The DNA template was subjected to real-time quantitative qPCR using the above primer and probe combination;
[0026] (3) When the Ct value of the sample to be tested is ≤35 and there is an obvious amplification curve, the sample to be tested is determined to be positive for mouse parvovirus and mouse thymvirus.
[0027] Specifically, the QPCR amplification program in step (2) above is 95℃ for 10 min; 95℃ for 15 s, 55℃ for 30 s, 72℃ for 20 s, for 41 cycles.
[0028] Compared with the prior art, the present invention has the following advantages and beneficial effects:
[0029] 1. The primer and probe composition and kit provided by this invention can be used to simultaneously detect mouse parvovirus and mouse thymvirus. It can specifically amplify both MVM and MTLV viruses without cross-reacting with other viral nucleic acids or with the genomes of various commonly used cell lines present in the sample. This demonstrates excellent specificity, overcoming the shortcoming of existing technologies that require separate detection of mouse parvovirus and mouse thymvirus. This kit can be used for early monitoring of common pathogens in rodent laboratory animals, and can also detect in real time whether rodent biological products, raw materials, and their production processes are contaminated with mouse parvovirus and mouse thymvirus, enabling rapid preventative measures to minimize the impact of contamination on animal population biosafety, research safety, and losses to enterprises.
[0030] 2. This invention establishes a dual fluorescence quantitative qPCR detection method for the simultaneous detection of mouse parvovirus and mouse thymvirus. It can specifically detect and distinguish between mouse parvovirus and mouse thymvirus. This method has high specificity, high sensitivity, and good repeatability. It can shorten the detection time, reduce the amount of sample used, and lower the detection cost. It solves the technical problem of the labor-intensive and time-consuming nature of the existing detection process. It provides a good detection method for the prevention and control of exogenous virus contamination in rodent biological products and has certain social application prospects.
[0031] The present invention will now be described in further detail with reference to the accompanying drawings. Attached Figure Description
[0032] Figure 1 This is an MVM agarose gel electrophoresis image from an embodiment of the present invention; where maker: DL2000 DNA maker; X: unspotted sample; 1 / 2: NTC; 3 / 4: 1.0 × 10⁻⁶ 1 PUC57-MVM mass PCR product copies / μl; 5 / 6: 1.0×10 2 PUC57-MVM mass PCR product copies / μl; 7 / 8: 1.0×103 PUC57-MVM mass PCR product copies / μl; 9 / 10: 1.0×10 4 PUC57-MVM mass PCR product copies / μl; 11 / 12: 1.0×10 5 PUC57-MVM quality PCR product copies / μl.
[0033] Figure 2 This is an MTLV agarose gel electrophoresis image from an embodiment of the present invention; where maker: DL2000 DNA maker; X: unspotted sample; 1 / 2: NTC; 3 / 4: 1.0 × 10⁻⁶ 1 PUC57-MTLV mass PCR product (copies / μl); 5 / 6: 1.0 × 10 2 PUC57-MTLV mass PCR product copies / μl; 7 / 8: 1.0×10 3 PUC57-MTLV mass PCR product copies / μl; 9 / 10: 1.0×10 4 PUC57-MTLV mass PCR product copies / μl; 11 / 12: 1.0×10 5 PUC57-MTLV quality PCR product copies / μl.
[0034] Figure 3 This is the standard curve of the dual fluorescence quantitative PCR detection method in the embodiments of the present invention.
[0035] Figure 4 This is the virus detection result of the dual fluorescence quantitative PCR detection method in the embodiments of the present invention.
[0036] Figure 5 This is the MTLV specificity detection result in the embodiment of the present invention.
[0037] Figure 6 This is the MVM specificity detection result in this embodiment of the invention.
[0038] Figure 7 This is a schematic diagram of the specificity results of MTLV and MVM in an embodiment of the present invention. Detailed Implementation
[0039] The technical solutions of the present invention will be clearly and completely described below with reference to embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Although representative embodiments of the present invention have been described in detail, those skilled in the art will understand that various modifications and changes can be made to the present invention without departing from the scope of the present invention. Therefore, the scope of the present invention should not be limited to the embodiments, but should be defined by the appended claims and their equivalents.
[0040] The effects of the primer and probe compositions, kits, and detection methods of the present invention will be studied through specific embodiments below.
[0041] Example 1:
[0042] 1. Design primers and probes
[0043] Based on the MVM and MTLV viral nucleic acid sequences retrieved from NCBI, conserved sequences were identified through MegAlign alignment. Primer and probe pairs were then designed accordingly, as follows:
[0044] The sequence of the upstream primer P-MVM-F is 5'-AACTTACTTCTTCTGCTGCACA-3';
[0045] The sequence of the downstream primer P-MVM-R is 5'-AGACCCAGTAGAAACACCAACC-3';
[0046] The sequence of probe MVM-P is 5'-(FAM)-CCAACCTGA / iXNA_C / RGCGRA AACG-(BHQ)-3';
[0047] The sequence of the upstream primer P-MTLV-F is 5'-AGGACTTGCTTTACCTGTTG-3';
[0048] The sequence of the downstream primer P-MTLV-R is 5'-ATACATACCTCTCCAAGAACCG-3';
[0049] The sequence of probe MTLV-P is 5'-(FAM)-CCAACCTGA / iXNA_C / RGCGRAAACG-(BHQ)-3';
[0050] The sequence of probe MTLV-P2 is 5'-(HEX)-TACATTCC / iXNA_C / G / iXNA_C / T / iXNA_T / CAAAC-(BHQ)-3'.
[0051] Where / iXNA_A / indicates locked nucleic acid modification of base A; / iXNA_T / indicates locked nucleic acid modification of base T; / iXNA_G / indicates locked nucleic acid modification of base G; and / iXNA_C / indicates locked nucleic acid modification of base C.
[0052] Primers and probes were synthesized by Shanghai Sangon Biotech Co., Ltd. Upstream primer P-MVM-F, downstream primer P-MVM-R, upstream primer P-MTLV-F and downstream primer P-MTLV-R were mixed to form a mixed primer, and probes MVM-P, MTLV-P and MTLV-P2 were mixed to form a mixed probe for later use.
[0053] 2. Agarose gel electrophoresis
[0054] To demonstrate that the primer composition provided in this embodiment can simultaneously detect mouse parvovirus and mouse thymvirus, the above-mentioned mixed primer and probe composition was used to perform PCR amplification on PUC57-MVM and PUC57-MTLV standards. The amplification program was as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 15 s, 55℃ annealing for 30 s, 72℃ extension for 20 s, for 41 cycles.
[0055] The PCR amplification products were subjected to agarose gel electrophoresis, and the results are as follows: Figure 1 and Figure 2 As shown in the electrophoresis diagram, the primer composition provided in this embodiment can accurately amplify MVM and MTLV without interference between them.
[0056] 3. Preparation of positive control standards
[0057] Inactivated MVM and MTLV pseudovirus containing the target fragment were mixed as a positive control.
[0058] The MTLV pseudovirus was constructed as follows: The shuttle plasmid GV315-MTLV(UL27) was constructed, and then the resulting shuttle plasmid and helper plasmid: pBHG loxΔE1,3Cre were co-transfected into HEK293 cells to obtain recombinant adenovirus Ad / MTLV(UL27). Adeno-X was then used to... TM Virus Purification Kit was used to purify the virus, and the viral titer was determined by endpoint dilution method.
[0059] 4. Extracting viral DNA
[0060] MVM and MTLV viral DNA were extracted using a commercially available viral nucleic acid purification kit (Hangzhou Xinjing Biotechnology Co., Ltd.).
[0061] 5. Optimization of Real-Time PCR Conditions
[0062] The fluorescence quantitative PCR reaction system and procedure performed in this embodiment are as follows.
[0063] Reaction system: 10 μl of qPCR reaction premix, 1.2 μl of mixed primers, 0.4 μl of mixed probes, 5 μl of sample to be tested, and RNase-free deionized water to make up to 20 μl.
[0064] The qPCR reaction premix was AceQ Universal U+ProbeMaster Mix V2, a premix specifically for probe-based quantitative PCR (containing Mg2+ at a final concentration of 0.5 mM). 2+ ).
[0065] The mixed primers are formed by mixing upstream primer P-MVM-F, downstream primer P-MVM-R, upstream primer P-MTLV-F, and downstream primer P-MTLV-R. The concentrations of P-MVM-F, P-MVM-R, P-MTLV-F, and P-MTLV-R in the mixed primers are all 1 mM.
[0066] The hybrid probe is formed by mixing probe MVM-P, probe MTLV-P and probe MTLV-P2. The concentrations of MVM-P and MTLV-P in the hybrid probe are both 0.5 mM, and the concentration of MTLV-P2 is 1 mM.
[0067] Amplification program: 95℃ pre-denaturation, 10 min; 95℃ denaturation, 15 s; 55℃ annealing, 30 s; 72℃ extension, 20 s; 41 cycles.
[0068] 6. Draw the standard curve
[0069] The PUC57-MVM and PUC57-MTLV plasmids were synthesized and sequenced by Sangon Biotech (Shanghai) Co., Ltd.
[0070] The conserved region gene sequence of the PUC57-MTLV standard is as follows:
[0071] ATACATACCTCTCCAAGAACCGGTACCGTACATTCCCGCTTCAAACTGTCTAAAGAATTTTAATGGATGAACCAAATAATAAATTTCAACAGGTAAAGCAAGTCCT
[0072] The conserved region gene sequence of the PUC57-MVM standard is as follows:
[0073] AACTTACTTCTTCTGCTGCACAGCAAAGCAGTCAAACCATGAGTGATGGCACCAGCCAACCTGACAGCGGAAACGCTGTCCACTCAGCTGCAAGAGTTGAACGAGCAGCTGACGGCCCTGGAGGCTCTGGGGGTGGGGGCTCTGGCGGGGGTGGGGTTGGTGTTTCTACTGGGTCT
[0074] Plasmids were extracted using a commercially available kit, and their concentrations were determined. The plasmids were then diluted and mixed to prepare quantitative standards 1, 2, 3, 4, 5, 6, and 7. Quantitative standard 1 had a concentration of 1.0 × 10⁻⁶. 1 A mixture of PUC57-MVM and PUC57-MTLV plasmids (copies / μl), and quantitative standard 2 (1.0 × 10⁻⁶) was prepared. 2 A mixture of PUC57-MVM and PUC57-MTLV plasmids (copies / μl), quantitative standard 3 (1.0 × 10⁻⁶) 3 A mixture of PUC57-MVM and PUC57-MTLV plasmids (copies / μl), and quantitative standard 4 (1.0 × 10⁴ copies / μl). 4 A mixture of PUC57-MVM and PUC57-MTLV plasmids (copies / μl), and quantitative standard 5 (1.0 × 10⁵ copies / μl). 5 A mixture of PUC57-MVM and PUC57-MTLV plasmids (copies / μl), quantitative standard 6 was 1.0 × 10⁶. 6 A mixture of PUC57-MVM and PUC57-MTLV plasmids (copies / μl), quantitative standard 7 was 1.0 × 10⁻⁶. 7 A mixture of PUC57-MVM and PUC57-MTLV plasmids in copies / μl.
[0075] The quantitative standards 1-7 were used in the above-described fluorescence quantitative PCR conditions, and the results are shown in Table 1 and 2. Figure 3 As shown in the table, Ct mean is the average value of Ct; Ct SD is the standard deviation of Ct; and CV% is the coefficient of variation.
[0076] Table 1 Results of quantitative PCR reaction with quantitative standards
[0077]
[0078]
[0079] Depend on Figure 3As shown in Table 1, the limits of quantitation and detection of the primers and methods provided by this invention can both reach 10. 1 copies / μl, at 1.0×10 1 -1.0×10 7 The amplification efficiency was good within the concentration range, and the linear correlation coefficient R of the MTLV standard amplification curve was [value missing]. 2 =1, amplification efficiency of 100.1%, linear correlation coefficient R of MVM standard amplification curve 2 =0.998, with an amplification efficiency of 107.8%, indicating that the present invention has high sensitivity for the detection of MVM and MTLV.
[0080] If the Ct value of the test sample is ≤35 and there is a clear amplification curve, the test sample is considered positive for exogenous murine virus. Otherwise, the sample is negative.
[0081] 7. Stability Assessment
[0082] A positive control group (a mixed sample of MVM strain and MTLV pseudovirus strain) was set up. The limit of detection and limit of quantitation experiments were performed using the above-described quantitative PCR conditions. Each experiment had three parallel samples and was repeated three times. The standard deviation and coefficient of variation within and between groups were calculated to evaluate the stability of the established detection method. The results are as follows: Figure 4 As shown, when the MVM virus titer in the solution is 10... -1 TCID50 / ml, MTLV pseudovirus titer is 2×10 2 At PFU / ml, it can be stably detected by the primers and probes provided by this invention.
[0083] 8. Specificity assessment
[0084] To test the specificity of this invention, the specificity of three commonly used cell lines (Balb / c3T3, BHK21, and CHO-K1) and five murine viral genomes (micetic parvovirus MVM, thymvirus MTLV, polyomavirus MPyV, pneumovirus PVM, and reovirus Reo3) was detected using the above-described quantitative real-time PCR reaction system and procedure. An NTC control was set up, and the detection of common cell lines by the primers and probes provided in this invention was analyzed. The experimental results are as follows: Figures 5-7 As shown.
[0085] Depend on Figure 5 It can be seen that only MTLV can amplify normally in the FAM channel and is judged as positive. Other susceptible viruses MVM, MPyV, PVM, Reo3, commonly used cell lines Balb / c 3T3, BHK21, CHO-K1 and negative control group showed no amplification and were judged as negative.
[0086] like Figure 6Only MVM could amplify normally in the HEX channel, which was positive. Other susceptible viruses MTLV, MPyV, PVM, Reo3, commonly used cell lines Balb / c 3T3, BHK21, CHO-K1 and the negative control group showed no amplification, which was negative.
[0087] like Figure 7 When both MVM and MTLV viruses are present in the sample, the FAM and HEX channels can amplify normally, indicating a positive result. Other susceptible viruses such as MPyV, PVM, and Reo3, as well as commonly used cell lines Balb / c 3T3, BHK21, CHO-K1, and the negative control group, show no amplification, indicating a negative result.
[0088] In summary, the mixed primers formed by mixing upstream primer P-MVM-F, downstream primer P-MVM-R, and upstream primer P-MTLV-F and downstream primer P-MTLV-R provided by this invention can simultaneously and specifically amplify both MVM and MTLV viruses without cross-reacting with other viral nucleic acids or with the genomes of various commonly used cell lines present in the sample, demonstrating excellent specificity. After the composition provided by this invention amplifies MVM and MTLV, probe-free techniques such as agarose gel electrophoresis and polyacrylamide gel electrophoresis can be used to detect the amplified products of MVM and MTLV, achieving simultaneous detection of mouse parvovirus and mouse thymvirus. Alternatively, the mixed primers can be combined with a mixed probe for quantitative real-time PCR, enabling faster and more convenient co-detection and differentiation of mouse parvovirus and mouse thymvirus, overcoming the problem that mouse parvovirus and mouse thymvirus must be detected separately in existing technologies.
[0089] The above examples are merely illustrative of the present invention and do not constitute a limitation on the scope of protection of the present invention. All designs that are the same as or similar to the present invention are within the scope of protection of the present invention.
Claims
1. A primer and probe composition for simultaneously detecting mouse parvovirus and mouse thymvirus, comprising an upstream primer P-MVM-F, a downstream primer P-MVM-R, and a probe MVM-P for detecting mouse parvovirus (MVM), and an upstream primer P-MTLV-F, a downstream primer P-MTLV-R, and a probe MTLV-P2 for detecting mouse thymvirus (MTLV), characterized in that: The sequence of the upstream primer P-MVM-F is 5'-AACTTACTTCTTCTGCTGCACA-3'; The sequence of the downstream primer P-MVM-R is 5'-AGACCCAGTAGAAACACCAACC-3'; The sequence of the probe MVM-P is 5'-FAM-CCAACCTGA / iXNA_C / RGCGRAAACG-BHQ-3'; The sequence of the upstream primer P-MTLV-F is 5'-AGGACTTGCTTTACCTGTTG-3'; The sequence of the downstream primer P-MTLV-R is 5'-ATACATACCTCTCCAAGAACCG-3'; The sequence of the probe MTLV-P2 is 5'-HEX-TACATTCC / iXNA_C / G / iXNA_C / T / iXNA_T / CAAAC-BHQ-3'; Where / iXNA_T / indicates locked nucleic acid modification of base T; / iXNA_C / indicates locked nucleic acid modification of base C.
2. The application of the primer and probe composition as described in claim 1 in detecting mouse parvovirus and mouse thymvirus contamination in rodent biological products.