Dsrna targeting phosphoenolpyruvate carboxykinase gene pepck and use thereof
By targeting the dsRNA of the phosphoenolpyruvate carboxykinase gene PEPCK, the problem of insufficient target information in the development of spider mite nucleic acid pesticides has been solved, achieving efficient and environmentally friendly spider mite control.
Patent Information
- Application Number
- CN202510664100.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-22
- Publication Date
- 2026-07-21
- Estimated Expiration
- 2045-05-22
Smart Images

Figure CN120310798B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, and to a dsRNA targeting the phosphoenolpyruvate carboxykinase gene PEPCK and its application, specifically targeting the gluconeogenesis process of spider mites. The dsRNA of the PEPCK gene can be used to achieve efficient control of spider mites. Background Technology
[0002] Spider mites, commonly known as red spider mites, are extremely small and are usually only identifiable after they have swarmed into webs or already damaged plants. Major species include the carmine spider mite, the two-spotted spider mite, and the truncate spider mite. Spider mites are highly adaptable to different hosts and can damage hundreds of agricultural and economic crops, including vegetables, cotton, and fruit trees. The application of chemical pesticides is currently the main method for controlling agricultural mites; however, due to their short generation cycle, high reproductive capacity, and parthenogenesis, coupled with the irrational and unscientific use of chemical pesticides, their resistance is more pronounced than that of other agricultural pests.
[0003] RNA interference (RNAi) is a conserved post-transcriptional gene silencing mechanism, primarily caused by the degradation of mRNA induced by endogenous or exogenous double-stranded RNA (dsRNA), leading to the specific inhibition of target gene expression. RNAi boasts advantages such as high efficiency, specificity, no pollution, and a wide range of selectable target genes. Novel nucleic acid pesticides developed based on this technology are considered the third revolution in pesticide history, enabling precise control of pests and mites through targeted application, and are also considered an ideal means of addressing pesticide resistance in pests and mites. Currently, the United States has developed and marketed the world's first nucleic acid pesticide, Calantha™, for the control of potato beetles. The journal *Science* also published in 2024 that the application of nucleic acid pesticides is a major breakthrough in agricultural science.
[0004] Spider mites exhibit high affinity for exogenous dsRNA, and dsRNA can be delivered to them through simple feeding or spraying, indicating that developing nucleic acid pesticides for spider mite control based on RNAi technology has broad prospects. Currently, the development of nucleic acid pesticides for spider mites is progressing slowly, with the core problem being the lack of effective target information.
[0005] Therefore, based on the biological characteristics of spider mites, such as their strong digestive ability and rapid adaptation to adversity, this invention discovers and proposes a dsRNA targeting the phosphoenolpyruvate carboxykinase gene PEPCK for efficient control of spider mites, and also provides ideal target information for the development of spider mite nucleic acid pesticides. Summary of the Invention
[0006] To address the aforementioned technical problems, this invention provides a dsRNA targeting the phosphoenolpyruvate carboxykinase gene PEPCK and its application in the control of spider mites.
[0007] To achieve the above objectives, the technical solution of the present invention is as follows:
[0008] A dsRNA targeting the phosphoenolpyruvate carboxykinase gene PEPCK, the nucleotide sequence of which is shown in SEQ ID NO: 1.
[0009] This invention also provides an application of dsRNA targeting the phosphoenolpyruvate carboxykinase gene PEPCK, the application comprising at least one of the following:
[0010] (5) Controlling spider mites or preparing products for controlling spider mites;
[0011] (6) Promote the death of spider mites or prepare products that promote the death of spider mites;
[0012] (7) Inhibit the survival of spider mites or prepare products that inhibit the survival of spider mites;
[0013] (8) Inhibit the expression of the PEPCK gene in spider mites or prepare products that inhibit the expression of the PEPCK gene in spider mites.
[0014] Preferably, the spider mites include, but are not limited to, two-spotted spider mite, carmine spider mite, and truncated spider mite.
[0015] Preferably, the composition includes at least the dsRNA described above.
[0016] This invention also provides a method for preparing dsRNA targeting the phosphoenolpyruvate carboxykinase gene PEPCK, comprising the following steps:
[0017] S1. Extract total RNA from spider mites, remove genomic DNA from the total RNA, and reverse transcribe to synthesize cDNA;
[0018] S2. Design the corresponding primer pair PEPCK-P1, use cDNA as a template, and perform PCR amplification using primer pair PEPCK-P1 to obtain the phosphoenolpyruvate carboxykinase gene PEPCK.
[0019] S3. Based on the nucleotide sequence of the phosphoenolpyruvate carboxykinase gene PEPCK, a primer pair PEPCK-P2 was designed.
[0020] S4. RNAi fragments were synthesized by PCR amplification, the amplification products were recovered, and dsRNA was synthesized and purified to obtain dsRNA targeting the phosphoenolpyruvate carboxykinase gene PEPCK.
[0021] Preferably, the primer pair PEPCK-P1 includes an upstream primer PEPCK-P1-F with a nucleotide sequence as shown in SEQ ID NO: 2 and a downstream primer PEPCK-P1-R with a nucleotide sequence as shown in SEQ ID NO: 3.
[0022] Preferably, the nucleotide sequence of the phosphoenolpyruvate carboxykinase gene PEPCK is shown in SEQ ID NO: 4.
[0023] Preferably, in step S2, the PCR amplification reaction system is: 12.5 μL of K5 HiFi 2×PCR Master Mix, 1 μL each of 10 μM upstream and downstream primers, 1 μL of cDNA template, and ddH2O to a final volume of 25 μL; the PCR amplification reaction program is: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 55℃ annealing for 15 s, 72℃ extension for 1 min, for a total of 34 cycles; and 72℃ final extension for 3 min.
[0024] Preferably, the primer pair PEPCK-P2 includes an upstream primer PEPCK-P2-F1 with a nucleotide sequence as shown in SEQ ID NO: 5 and a downstream primer PEPCK-P2-R1 with a nucleotide sequence as shown in SEQ ID NO: 6, as well as an upstream primer PEPCK-P2-F2 with a nucleotide sequence as shown in SEQ ID NO: 7 and a downstream primer PEPCK-P2-R2 with a nucleotide sequence as shown in SEQ ID NO: 8.
[0025] Preferably, in step S4, the PCR amplification reaction system is: 12.5 μL of K5 HiFi 2×PCR Master Mix, 1 μL each of 10 μM upstream and downstream primers, 1 μL of cDNA template, and ddH2O to a final volume of 25 μL; the PCR amplification reaction program is: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 55℃ annealing for 15 s, 72℃ extension for 10 s, for a total of 34 cycles; and 72℃ final extension for 3 min.
[0026] Compared with existing technologies, the beneficial effects of this solution are:
[0027] This invention targets the gluconeogenesis process of spider mites, discovering and providing the dsRNA of the phosphoenolpyruvate carboxykinase gene PEPCK. This dsRNA can efficiently inhibit glycogen conversion in spider mites, exhibiting excellent lethality and effectively controlling spider mite populations, thus reducing field damage. This dsRNA can be used in the development of transgenic mite-resistant plants or novel acaricides, specifically controlling agricultural mites without affecting other beneficial insects and predatory mites. Its application can also effectively reduce the use of chemical acaricides, offering greater environmental friendliness. Furthermore, it enriches the spider mite-specific RNAi target database, laying the foundation for the creation of green acaricides. Attached Figure Description
[0028] Figure 1 This is an electrophoretic analysis diagram of the amplification of the phosphoenolpyruvate carboxykinase gene PEPCK in Example 1 of this invention;
[0029] Figure 2 This is an electrophoretic analysis diagram of the dsRNA amplification of the phosphoenolpyruvate carboxykinase gene PEPCK in Example 2 of this invention.
[0030] Figure 3 This is the statistical result of the survival rate of spider mites fed with dsRNA of the phosphoenolpyruvate carboxykinase gene PEPCK in Example 3 of this invention.
[0031] Figure 4 This is the death phenotype of the spider mite in Example 3 of this invention. Detailed Implementation
[0032] To enable those skilled in the art to better understand the present invention, the technical solution of the present invention will be described in further detail below with reference to the embodiments and accompanying drawings. Obviously, the described embodiments are merely some, not all, of the embodiments of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort should fall within the scope of protection of the present invention.
[0033] It should be noted that, unless otherwise specified, the embodiments and features described in the present invention can be combined with each other. The present invention will now be described in detail with reference to the embodiments.
[0034] Example 1: Synthesis of the phosphoenolpyruvate carboxykinase gene PEPCK
[0035] 1. Spider mite population
[0036] Two-spotted spider mite and carmine spider mite were collected from a rose garden in Kunming, Yunnan Province, while truncate spider mite was collected from a soybean field in Lanzhou, Gansu Province. All spider mite populations were reared in a constant temperature and light incubator. The test host was cowpea seedlings, and the rearing conditions were 26℃, 14 hours of light, and 10 hours of darkness.
[0037] 2. RNA extraction and reverse transcription
[0038] Two hundred female adult mites aged 3-5 days were selected, flash-frozen in liquid nitrogen, and total RNA was extracted using Trizol. Then, 1 μg of RNA was added to 1 μL of DNase I to remove genomic DNA contamination. Using the purified RNA as a template, first-strand cDNA was synthesized by reverse transcription using the Takara PrimeScript II 1st Strand cDNA Synthesis Kit. The reaction system and conditions were strictly performed according to the kit instructions.
[0039] 3 Primer Design and Gene Cloning
[0040] Based on the genome databases of *Tetranychus spp.* and *Tetranychus carmine*, full-length CDS primer P1 (Table 1) was designed using Primer 5.0 software. The primers were synthesized by Qingke Biotechnology Co., Ltd., and PCR amplification was performed using *Tetranychus spp.* cDNA as a template. The reaction mixture consisted of: 12.5 μL K5HiFi 2×PCR Master Mix, 1 μL each of forward and reverse primers (10 μM), 1 μL cDNA template, and ddH2O to a final volume of 25 μL.
[0041] Table 1 Primers for amplifying the PEPCK gene sequence
[0042]
[0043] 4. PCR amplification and product verification
[0044] The PCR reaction program was set as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 55℃ annealing for 15 s, 72℃ extension for 1 min, for a total of 34 cycles; final extension at 72℃ for 3 min; products stored at -20℃. Electrophoresis analysis showed that the band position of the amplified product was consistent with the expected target fragment size of 2013 bp (see...). Figure 1 The results indicate that the primers have good specificity, and the full-length CDS of the phosphoenolpyruvate carboxykinase gene can be successfully amplified by PCR. The nucleotide sequence is shown in SEQ ID NO: 4.
[0045]
[0046] After gel recovery of the amplification product, it was ligated to the pClone007 (Qingke Biotechnology) vector using a rapid ligase, and then transformed into 5α competent cells. The revived competent cells were evenly spread onto solid LB culture plates and incubated at 37°C for 14 hours. Single colonies were picked for bacterial sequencing. Positive colonies were amplified in LB culture medium, and plasmids were extracted.
[0047] Example 2 Synthesis of dsRNA of phosphoenolpyruvate carboxykinase gene PEPCK 1 Primer design
[0048] Based on the CDS sequence of the phosphoenolpyruvate carboxykinase gene PEPCK cloned in Example 1, dsRNA primer P2 was designed using Primer 5.0 software (see Table 2). The primer design included the following key features: a 300-500 bp region was selected from the full-length CDS sequence as a template; and T7 RNA polymerase promoter sequences (5'-TAATACGACTCACTATAGGGAGAGAATAGGCATGCGTAGATC-3') were added to the upstream and downstream 5' ends.
[0049] The primer Tm value is controlled at 55±3℃, the GC content is 40-60%, and three consecutive G / C bases are avoided at the 3' end. The last base is preferably T.
[0050] Table 2 Primers for amplifying the dsRNA sequence of the phosphoenolpyruvate carboxykinase gene PEPCK.
[0051]
[0052] 2. Synthesis and purification of dsRNA
[0053] The full-length plasmid of the phosphoenolpyruvate carboxykinase gene was used as a template to amplify upstream and downstream fragments. The reaction system consisted of: 12.5 μL K5 HiFi 2×PCR Master Mix, 1 μL each of upstream and downstream primers (10 μM), 1 μL cDNA template, and ddH2O to a final volume of 25 μL. The PCR program was set as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 55℃ annealing for 15 s, and 72℃ extension for 10 s, for a total of 34 cycles; final extension at 72℃ for 3 min; and product storage at -20℃.
[0054] dsRNA synthesis was performed using the T7 RiboMAX™ Express RNAi System. The reaction mixture consisted of: 10 μL RiboMAX™ Express T7 2× Buffer, 1-8 μL DNA template, 2 μL Enzyme Mix, and Nuclease-free Water to a final volume of 20 μL. The mixture was incubated at 37°C for 4 h. After removing the DNA template, equal volumes of sense and antisense RNA were mixed and incubated at 70°C for 10 min, then slowly cooled to room temperature. 1 μL of RQ1 high-purity RNase-free DNase and 1 μL of RNase A solution (1:200 dilution) were added, and the mixture was incubated at 37°C for 30 min to degrade residual DNA.
[0055] dsRNA was purified using the ethanol precipitation method: ① Add 0.1 volume of 3M sodium acetate (pH 5.2) and 1 volume of isopropanol, and incubate on ice for 5 min; ② Centrifuge at 14000 rpm for 10 min, and discard the supernatant; ③ Wash the precipitate with 0.5 mL of 70% ethanol and dry at room temperature for 15 min; ④ Dissolve the RNA in 20-50 volumes of Nuclease-free Water and store at -70℃. The dsRNA concentration (A260 / A280 ≥ 1.8) was determined using NanoDrop 2000, and the integrity of the dsRNA was detected by agarose gel electrophoresis. The dsRNA nucleotide sequence is shown in SEQ ID NO: 1.
[0056] dsRNA nucleotide sequence (SEQ ID NO: 1):
[0057] TGCATCTCTAGTATTGGTCTTGATAAGTTGTCTTCAAAGGCAAGAAACTTTGTTGAGGAAAAGGCCAGAATATGTGAACCAGATAGCATTCACATATGCGATGGCACTGAAGAAGAAAACAATCAGCTTATCAATTTGATGGTCCAACAAGGAATGATCAAAAAATTACCAAAATATGAAAATTGTTGGCTG TCTCGAACTGATCCAGCTGATGTTGCTCGTGTAGAGTCTCTGACATTTATTTCAACCAGAAATAAACGTGATACTGTTCCAGAACCCAAACCTGGAGTAAAAGGAACTCTTGGAAATTGGATGTCACCGGATGATTTAGACAAAGCTCTAAATTCACGGTTCCCTAAATGCATGAAGGGAAGAACAATGTAT.
[0058] The results showed that the target dsRNA fragment was successfully cloned using the full-length PEPCK plasmid as a template, and the size of the further synthesized dsRNA was consistent with the theoretical value of 384 bp. Figure 2 ).
[0059] Example 3: Feeding Method for Delivering dsRNA
[0060] The purified dsRNA solution from Example 2 was diluted with enzyme-free water to 1500 ng / μL. Then, a 10 μL pipette was used to evenly spot the solution onto a 35 mm culture dish using the drop method, forming a 2×2 cm rectangular distribution grid.
[0061] Fresh cowpea leaves were cut into 2×2cm pieces and then dehydrated at 60℃ for 2 minutes. The dehydrated leaves were divided into two groups: a control group and an experimental group. The dehydrated leaves of the experimental group were placed on droplets of dsRNA and allowed to fully absorb the dsRNA solution for 4-5 hours. Both groups of leaves were then transferred to new petri dishes. The bottom of the petri dishes was pre-lined with sterile sponges and filter paper for leaf hydration and preservation. Thirty healthy mites were selected and transferred to the treated leaves. Each experiment had three independent biological replicates. The mites were fed continuously for seven days, and the survival rate was observed and recorded daily. The mortality phenotype of the spider mites was photographed using a super-depth-of-field microscope.
[0062] PEPCK-containing dsRNA solutions were delivered to larval stages of *Tetranychus carmineus*, *Tetranychus two-spotted*, and *Tetranychus truncatula* via feeding, with dsGFP targeting green fluorescent protein as a control. Feeding revealed that, compared to the control group, all three spider mite species began to die 2 days after ingesting the dsRNA, and the mortality rate increased significantly with feeding time, exceeding 50% by day 7 in all three species. Figure 3 Taking the death phenotype of the carmine spider mite as an example, after ingesting PEPCK dsRNA, the spider mite's growth is significantly restricted, its body shape becomes shriveled, and its dorsal digestive cells disappear. Figure 4 The results indicate that dsRNA targeting PEPCK can significantly inhibit the energy metabolism system of mites, leading to mass mortality and demonstrating high efficiency in precise control of spider mites.
[0063] The above specific embodiments are merely explanations of the present invention and are not intended to limit the present invention. After reading this specification, those skilled in the art can make modifications to these embodiments without contributing any inventive step, but as long as they are within the scope of the claims of the present invention, they are protected by patent law.
Claims
1. The application of a dsRNA targeting the phosphoenolpyruvate carboxykinase gene PEPCK, characterized in that, The nucleotide sequence of the dsRNA is shown in SEQ ID NO:
1. The application is for the prevention and control of spider mites or the preparation of products for the prevention and control of spider mites. The method of application is to directly feed the dsRNA to spider mites.
2. The application according to claim 1, characterized in that, The control of spider mites includes promoting spider mite mortality and inhibiting spider mite survival.
3. The application according to claim 1, characterized in that, The spider mites include, but are not limited to, two-spotted spider mite, carmine spider mite, and truncated spider mite.
4. The application according to claim 1, characterized in that, The method for preparing the dsRNA includes the following steps: S1. Extract total RNA from spider mites, remove genomic DNA from the total RNA, and reverse transcribe to synthesize cDNA; S2. Design the corresponding primer pair PEPCK-P1, use cDNA as a template, and perform PCR amplification using primer pair PEPCK-P1 to obtain the phosphoenolpyruvate carboxykinase gene PEPCK. S3. Based on the nucleotide sequence of the phosphoenolpyruvate carboxykinase gene PEPCK, a primer pair PEPCK-P2 was designed. S4. RNAi fragments were synthesized by PCR amplification, the amplification products were recovered, and dsRNA was synthesized and purified to obtain dsRNA targeting the phosphoenolpyruvate carboxykinase gene PEPCK.
5. The application according to claim 4, characterized in that, The primer pair PEPCK-P1 includes an upstream primer PEPCK-P1-F with the nucleotide sequence shown in SEQ ID NO: 2 and a downstream primer PEPCK-P1-R with the nucleotide sequence shown in SEQ ID NO:
3.
6. The application according to claim 4, characterized in that, The nucleotide sequence of the phosphoenolpyruvate carboxykinase gene PEPCK is shown in SEQ ID NO:
4.
7. The application according to claim 4, characterized in that, In step S2, the PCR amplification reaction system is as follows: 12.5 μL of K5HiFi 2×PCR Master Mix, 1 μL each of 10 μM upstream and downstream primers, 1 μL of cDNA template, and ddH2O to a final volume of 25 μL; the PCR amplification reaction program is as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 55℃ annealing for 15 s, 72℃ extension for 1 min, for a total of 34 cycles; and 72℃ final extension for 3 min.
8. The application according to claim 4, characterized in that, The primer pair PEPCK-P2 includes an upstream primer PEPCK-P2-F1 with the nucleotide sequence shown in SEQ ID NO: 5 and a downstream primer PEPCK-P2-R1 with the nucleotide sequence shown in SEQ ID NO: 6, as well as an upstream primer PEPCK-P2-F2 with the nucleotide sequence shown in SEQ ID NO: 7 and a downstream primer PEPCK-P2-R2 with the nucleotide sequence shown in SEQ ID NO:
8.
9. The application according to claim 4, characterized in that, In step S4, the PCR amplification reaction system is as follows: 12.5 μL of K5HiFi 2×PCR Master Mix, 1 μL each of 10 μM upstream and downstream primers, 1 μL of cDNA template, and ddH2O to a final volume of 25 μL; the PCR amplification reaction program is as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 55℃ annealing for 15 s, 72℃ extension for 10 s, for a total of 34 cycles; and 72℃ final extension for 3 min.
10. A composition for controlling spider mites, characterized in that, The composition comprises at least the dsRNA as described in claim 1.
Citation Information
Patent Citations
MiR-7885-5p and target gene PEPCK thereof in preparation of termite detoxification inhibitor and application thereof
CN116536311A
Inhibiting insecticide resistance and making susceptible insects hyper-susceptible to pesticides
US20220142169A1