A SNP molecular marker for identifying fiber quality of upland cotton, a KASP primer set and application thereof

Abstract

The present application relates to the field of biotechnology, and particularly to a SNP molecular marker for identifying fiber quality of upland cotton, a KASP primer set and application thereof.The present application provides five SNP molecular markers XW1-XW5 which are significantly related to fiber quality, and which can realize accurate and stable genotyping after verification.Among them, the excellent genotype corresponding to the markers XW1, XW2, XW4 and XW5 can significantly improve the fiber length; the excellent genotype corresponding to the marker XW3 can significantly improve the micronaire value, and the present application provides a reliable tool for identifying fiber quality of upland cotton and molecular breeding, and has important application value.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to an SNP molecular marker for identifying the quality of upland cotton fibers, a KASP primer set, and their applications. Background Technology

[0002] Cotton is one of the world's most important economic crops and a major raw material for the textile industry. Upland cotton (Gossypium hirsutum L.) dominates global cotton production due to its high yield and wide adaptability. With socio-economic development and the continuous improvement of people's living standards, the market demand for high-quality cotton textiles is increasing. However, the fiber quality of upland cotton is generally poor; therefore, improving fiber quality has become one of the core objectives of its genetic breeding. In traditional upland cotton breeding, the selection of fiber quality mainly relies on field phenotypic identification. This method is easily affected by environmental conditions, planting years, and the subjectivity of human evaluation, and has inherent limitations such as long cycle, low efficiency, and poor stability, seriously restricting the breeding process of high-yield and high-quality cotton varieties.

[0003] Kompetitive Adllele-specific PCR (KASP) technology is based on the specific matching of primer terminal bases to accurately determine bicelestem of SNP (single nucleotide polymorphism) sites. It has high accuracy in SNP genotyping and also has the advantages of low cost and high throughput. It can be used for variety identification, genetic map construction, germplasm genetic diversity analysis, molecular marker-assisted breeding and other fields.

[0004] With the publication of multiple cotton reference genomes, a large number of QTLs (quantitative trait loci) related to fiber quality have been located and reported. However, translating this QTL information into practical breeding tools still faces significant challenges. A prominent problem is the severe lack of SNP molecular markers closely associated with these QTLs and suitable for breeding. Not all SNP markers are suitable for breeding; ideal breeding SNP markers must possess characteristics such as high polymorphism, ease of identification, and good reproducibility (Kuang Meng, Wang Yanqin, et al., *Cotton Science*, 2016). Furthermore, cotton is an allotetraploid crop with a highly complex genome, and most SNP loci have multiple copies of homologous sequences in the A and D subgenomes. This characteristic easily leads to genotyping errors or inconsistent results. For example, when developing detection methods, KASP primers designed for a single SNP locus may simultaneously amplify multiple homologous loci, making the genotyping results unable to accurately reflect the genotype of the target QTL.

[0005] Currently, there are few SNP molecular markers developed for KASP detection targeting genes related to upland cotton fiber development. Therefore, identifying SNP sites and their allelic variations associated with fiber development-related traits, and developing a KASP genotyping detection system that can specifically identify target sites, is highly stable, and has good reproducibility, is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0006] In view of this, the present invention proposes an SNP molecular marker, a KASP primer set, and their applications for identifying the quality of upland cotton fibers.

[0007] The technical solution of this invention is implemented as follows:

[0008] In a first aspect, the present invention provides the application of reagents for detecting SNP molecular markers in the identification of upland cotton fiber quality, wherein the SNP molecular markers include at least one of XW1, XW2, XW3, XW4, and XW5; wherein XW1 is located at nucleotide position 5234605 of the upland cotton Ghir_D12 chromosome, with a mutated base of T or A; the superior fiber length genotype is TT, and the inferior fiber length genotype is AA; wherein XW2 is located at nucleotide position 8264322 of the upland cotton Ghir_D13 chromosome, with a mutated base of C or T; the superior fiber length genotype is CC, and the inferior fiber length genotype is TT; wherein XW1 is located at nucleotide position 5234605 of the upland cotton Ghir_D12 ... 3 is located at nucleotide 97669166 on chromosome 9766 of upland cotton Ghir_A06, with a mutated base of T or C; the superior genotype for micronaire value is TT, and the inferior genotype is CC; XW4 is located at nucleotide 80709663 on chromosome 80709663 of upland cotton Ghir_A04, with a mutated base of G or C; the superior genotype for fiber length is CC, and the inferior genotype is GG; XW5 is located at nucleotide 24502404 on chromosome 24502404 of upland cotton Ghir_D11, with a mutated base of G or T; the superior genotype for fiber length is GG, and the inferior genotype is TT; the reference genome is upland cotton TM-1 Ghirsutum_genome_HAU_v1.0.

[0009] Furthermore, the SNP molecular markers XW1~XW5 and their respective flanking sequences are shown in SEQ ID NO:1~5, and the SNP molecular markers XW1~XW5 are located at position 22 in the sequences shown in SEQ ID NO:1~5.

[0010] Further, the reagent for detecting the SNP molecular marker includes one or more of the following KASP primer sets KASP-1 to KASP-5: KASP-1 for XW1, wherein KASP-1 consists of two forward primers with nucleotide sequences as shown in SEQ ID NO: 6-7 and a reverse primer with nucleotide sequences as shown in SEQ ID NO: 8; KASP-2 for XW2, wherein KASP-2 consists of two forward primers with nucleotide sequences as shown in SEQ ID NO: 9-10 and a reverse primer with nucleotide sequences as shown in SEQ ID NO: 11; KASP-3 for XW3, wherein KASP-3 consists of two forward primers with nucleotide sequences as shown in SEQ ID NO: 12-13 and a reverse primer with nucleotide sequences as shown in SEQ ID NO: 14; and KASP-4 for XW4, wherein KASP-4 consists of two forward primers with nucleotide sequences as shown in SEQ ID NO: 15-16 and a reverse primer with nucleotide sequences as shown in SEQ ID NO: 8. The reverse primer set shown in NO:17; for the KASP primer set KASP-5 of the XW5, the KASP-5 is composed of two forward primers with nucleotide sequences as shown in SEQ ID NO:18-19 and a reverse primer with nucleotide sequences as shown in SEQ ID NO:20.

[0011] Secondly, the present invention provides a KASP primer set for identifying the quality of upland cotton fibers, comprising one or more of the KASP primer set KASP-1 to KASP-5.

[0012] Thirdly, the present invention provides reagents or kits containing the KASP primer set for identifying the quality of upland cotton fibers.

[0013] Fourthly, this invention provides the application of the reagents or kits in marker-assisted breeding of upland cotton fiber quality phenotypes. In some specific embodiments, the application involves detecting the genotypes of SNP molecular markers XW1, XW2, XW4, and XW5 in a candidate upland cotton population, and selecting individuals with the highest number of dominant genotypes as parents to breed offspring with improved fiber length. In other specific embodiments, the application involves detecting the genotype of SNP molecular marker XW3 in a candidate upland cotton population; and performing targeted screening based on actual breeding objectives: if the breeding objective is to reduce the valence value, individuals with the CC genotype are selected as parents; if the breeding objective is to increase the valence value, individuals with the TT genotype are selected as parents.

[0014] Fifthly, the present invention also provides a method for identifying the fiber quality of upland cotton. The method involves detecting the genotype of at least one locus of the SNP molecular markers XW1-XW5 as described in claim 1 in the upland cotton to be tested, and determining the fiber quality of the upland cotton to be tested based on the detected genotype. Further, the KASP primer set for identifying upland cotton fiber quality is used to perform KASP detection on the upland cotton to be tested.

[0015] The beneficial effects of the present invention include at least the following:

[0016] This invention resequencing 265 upland cotton breeding intermediate materials and systematically collecting fiber quality phenotypic data for three consecutive years. Through integrated genome-wide association analysis, domestication selection analysis, and genome-wide selection screening, five SNP molecular markers significantly associated with fiber quality were identified. Verification showed that the SNP molecular markers provided by this invention can achieve accurate and stable genotyping of 509 upland cotton materials from other breeding populations. Specifically, the superior alleles corresponding to four markers related to fiber length (XW1, XW2, XW4, and XW5) significantly increased fiber length; while the superior allele represented by the XW3 marker significantly increased micronaire value. The molecular markers provided by this invention offer a reliable tool for efficient molecular breeding of upland cotton fiber quality and have significant application value. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 Association analysis (genotype effect box plot) between the five SNP molecular markers (represented by XW1~XW5) provided by this invention and fiber quality phenotypes. The mean difference between the superior genotype and the poor genotype populations was analyzed by t-test. In the figure, * indicates p < 0.05, and **** indicates p < 0.0001.

[0019] Figure 2 Scatter plot of KASP genotyping for XW1~XW5 provided by this invention;

[0020] Figure 3 This invention provides a heatmap of KASP genotyping for XW1~XW5 in 509 upland cotton materials.

[0021] Figure 4 KASP genotyping heatmap of XW1~XW5 in 45 upland cotton materials provided by the present invention;

[0022] Figure 5 The KASP genotyping heatmap of XW1 in 31 upland cotton materials provided by this invention;

[0023] Figure 6 The results of the association analysis between fiber length and the number of superior genotypes of four SNP molecular markers (XW1, XW2, XW4 and XW5) in 509 upland cotton materials are presented. Different letters indicate significant differences between groups (one-way ANOVA).

[0024] Figure 7 The association analysis results of fiber phenotypes and SNP molecular markers XW2, XW3, and XW4 in 509 upland cotton materials are presented. The difference in means between the superior genotype and the inferior genotype populations was analyzed by t-test. In the figure, * indicates p < 0.05, and ** indicates p < 0.01.

[0025] Figure 8 The association analysis results between fiber phenotypes and SNP molecular marker XW5 in 45 upland cotton materials are presented. The difference in means between superior and inferior genotype populations was analyzed by t-test. * in the figure indicates p < 0.05.

[0026] Figure 9 The association analysis results between fiber phenotypes and SNP molecular marker XW1 in 31 upland cotton materials are presented. The mean difference between the superior genotype and the inferior genotype populations was analyzed by t-test. In the figure, ** indicates p < 0.01.

[0027] Figure 10 KASP genotyping heatmaps for 19 upland cotton varieties (a total of 114 lines) on XW1–XW5. Detailed Implementation

[0028] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall be followed. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0029] Example 1: Development of SNPs and KASP primers related to upland cotton fiber quality

[0030] 1. Resequencing and genetic variation detection

[0031] This embodiment presents 265 upland cotton breeding intermediate materials, which are parental derivative lines constructed from backbone parents and bred through continuous multi-generational self-pollination and phenotypic screening. Backbone parents include high-quality long-staple backbone parents such as Belsnow, Aizimian 997, 247-125, and J02-58, while early-maturing cotton backbone parents are derived from varieties awaiting approval and self-bred lines from the Xinjiang Shihezi Cotton Research Institute. Whole-genome resequencing analysis was performed on the 265 upland cotton breeding intermediate materials (cultivated in experimental fields of the Xinjiang Shihezi Cotton Research Institute from 2018 to 2020) (raw sequencing reads are publicly available in the NCBI database, Accession NO: PRJNA1012539). Fiber quality phenotypic data, including fiber length (FL) and micronaire value (M), were measured using a fiber quality analyzer (HFT9000) at Huazhong Agricultural University over three consecutive years. These phenotypic data include the mean, best linear unbiased predictor (BLUP), and single-year phenotypic data. 2,684,989 high-quality SNPs were obtained through genetic variation detection, which served as the basis for subsequent analysis.

[0032] 2. Genome-wide association study (GWAS)

[0033] Using the (P+G+Q) mixed linear model in FaST-LMM (ver 2.07) software, with p=10 -6 SNPs significantly associated with fiber quality were obtained by threshold filtering, and QTLs related to fiber quality were identified based on these. Genome domestication selection analysis was performed using XP-CLR (ver 1.0) software. Compared with wild upland cotton, the top 5% of genomic regions in terms of nucleotide polymorphism (π) and cross-population complex likelihood ratio (XP-CLR) were screened as domestication hotspots. Fiber length-related QTLs were located within these domestication regions, supplementing the GWAS results.

[0034] 3. Construction of a genome-wide selection model (GS)

[0035] Based on GWAS results, with p=10 -4 SNPs were used as threshold filters to obtain SNPs potentially related to fiber quality. These were then used as a dataset to construct a GS model. This model predicted a correlation between the fiber quality phenotypic value and the actual phenotypic value, approximating the generalized heritability of the trait. Large-effect SNPs in the model were screened, and these were used to identify fiber quality-related QTLs.

[0036] 4. Chain Imbalance Screening

[0037] For the identified fiber quality-related QTLs, based on the linkage disequilibrium (R) with Lead-SNPs... 2=1) SNP screening. Simultaneously, ensure that there are no SNPs within 22 bp upstream and 140 bp downstream of each SNP, and extract the genomic sequence of this region (sequences of both genotypes) to use as a template for subsequent PCR amplification. This step screened 3770 eligible SNPs from 9705 SNPs.

[0038] 5. KASP primer development

[0039] KASP primers were designed in batches using Primer3 software (v2.4.0). Optimal parameter settings were determined through multiple validations, ensuring that the primer Tm values ​​were between 57-60℃ and that the Tm values ​​between the forward and reverse primers differed by a maximum of 2℃. Simultaneously, the 3' ends of the two forward primers (F and H primers) were matched with SNPs. This step narrowed down the number of SNPs from 3770 to 488.

[0040] The designed primer set was BLAST-aligned to the upland cotton TM-1 reference genome Ghirsutum_genome_HAU_v1.0 (available in the CottonFGD database at https: / / cottonfgd.net / about / download.html) to ensure that the two forward and reverse primers did not amplify any additional fragments outside the target PCR product. This step screened 98 highly specific SNPs from 488 SNPs.

[0041] The correctness of the KASP primer sets was verified in the aforementioned 265 upland cotton breeding intermediate material populations. This step involved selecting the top 5 SNPs and their corresponding primer sets from each QTL for verification. Two primer sets showed fluorescence in the negative control, possibly due to the presence of primer dimers; two primer sets did not show fluorescence. From the remaining available primer sets, the SNP with the best overall performance and its corresponding primer set were selected from each QTL as the core SNP and corresponding KASP primer set for that QTL. The results identified 5 SNP molecular markers significantly associated with fiber quality, as shown in Table 1.

[0042] Table 1. SNP molecular markers significantly associated with fiber quality

[0043] XW1 Ghir_D12 5234605 SNP T / A TT AA Fiber length XW2 Ghir_D13 8264322 SNP C / T CC TT Fiber length XW3 Ghir_A06 97669166 SNP T / C TT CC Micronaire value XW4 Ghir_A04 80709663 SNP G / C CC GG Fiber length XW5 Ghir_D11 24502404 SNP G / T GG TT Fiber length

[0044] Note: The reference genome is upland cotton TM-1 Ghirsutum_genome_HAU_v1.0.

[0045] The flanking sequences of the above SNP molecular markers are shown in Table 2, and are located at position 22 of the sequences SEQ ID NO:1-4 (underlined, for example, the polymorphic site at the underlined position of the sequence shown in SEQ ID NO:1 is T / A, see Table 1).

[0046] Table 2 Flanking sequences of SNP molecular markers

[0047] XW1 <![CDATA[AGCATTGATTTGCTTACGTCC T TTGTTTTCTTTCTTTATAGATCAACGGAAAGCTCGATCTGTTGGAATTTCATCGAAGCAAAATCACATTATCCAATCATCATTTTGGTATTTTTGGTTACTTTGGTATAAGGTTATAAAT]]> 1 XW2 <![CDATA[AAATGGGGCGTTCTTACACAA C AAGTTAGTTAGAGGAGCTGTAATTAAAGCGAACCTTTCGACAAATCTCTAATAATAACCTGTAAGCCCAAGAAAATTGCGAATCTCAAAAACATTCCTAGACTATTTCCACTCAAGCACA]]> 2 XW3 <![CDATA[CTGACGAAGTACGCCAAAGGA T TATTATCGCCGTAAGACATTTTATATTTTGTATTCTGCATGACATGGGGGTGGTGTCAAGACATTTACAATTTGAAGAATGTATTTTGTATCTAAACTCAAGACCATGAATCTATGGTTC]]> 3 XW4 <![CDATA[AGCACTGAAGATGTTTGAGAC G ATTTTAAGGCAGTATGCTGCGAAGCTGGAATGCCTACTTGTTCGCCAATTTTTCTTTCAAGGTAATCAGAGCAATTTCACAGACATTGGAGGAGATGTCTTTGGCTATAGAGCTTACCTC]]> 4 XW5 <![CDATA[AACGAGGAGGGTGATGGCGAT G TGTTAACAGAAAGGCTCGCTCAATTTGCTGCTATGTTCTTTGTTGCTGTGTAATTTTCAATTTGTTAACATTTTTTTTGTTTGTTACTTATAAAAGGAAGTGGCATGTTGTTCTGGTGAAGT]]> 5

[0048] The primer sets developed for the SNP molecular markers in Table 1 are shown in Table 3:

[0049]

[0050] Association analysis of five SNP molecular markers provided by this invention with upland cotton fiber quality phenotypes

[0051] Among 265 intermediate upland cotton breeding materials, the comparison results of the three-year fiber quality phenotypic averages of superior and inferior genotype populations based on five SNP molecular markers (XW1~XW5) are as follows: Figure 1 As shown in the diagram (genotype effect box plot), the difference between the superior genotype (TT) and the inferior genotype (AA) of the fiber length-related SNP molecular marker XW1 was statistically significant (p<0.05); the differences between the superior and inferior genotypes of the fiber length-related SNP molecular markers XW2, XW4, and XW5 were all highly significant (p<0.0001). The difference between the superior genotype (TT) and the inferior genotype (CC) of the malarial value-related SNP molecular marker XW3 was also highly significant (p<0.0001). The specific genotype correspondences for each marker are shown in Table 1.

[0052] Micronaire value is a key indicator for evaluating the fineness and maturity of cotton fibers, with its optimal value typically falling within the middle range. Therefore, when the micronaire value-related molecular marker XW3 described in this invention is applied to breeding, targeted screening should be conducted based on the actual breeding objectives: if the micronaire value of the breeding population is generally high, the genotype associated with lower values ​​(CC) should be selected; if it is generally low, the genotype associated with higher values ​​(TT) should be selected.

[0053] Example 2: Validation of the screening efficiency of the KASP detection system for the correlation between fiber length and micronaire value in upland cotton.

[0054] 1. Material source and DNA extraction

[0055] In this embodiment, the experimental materials used included three upland cotton populations: the first population consisted of 509 upland cotton breeding intermediates provided by the Xinjiang Academy of Agricultural Sciences; the second population consisted of 45 upland cotton breeding intermediates provided by Xinjiang Guoxin Seed Industry Co., Ltd.; and the third population consisted of 31 materials selected from natural upland cotton populations owned by Huazhong Agricultural University. Approximately 100 mg of leaves were collected from cotton seedlings and placed in 2.0 mL deep-well plates (96 wells) for liquid nitrogen preservation. Genomic DNA was extracted from the cotton leaves using the Plant Genomic DNA Extraction Kit (Magnetic Bead Method) V3 (catalog number 102001000060) from Chengdu Hanchen Guangyi Biotechnology Co., Ltd. The DNA sample concentration was detected using a Nanodrop One 2000, diluted to 20–50 ng / μL, and transferred to 200 μL PCR sample plates.

[0056] 2. Establishment of the KASP testing system

[0057] (1) KASP reaction system

[0058] The KASP 1× reaction system is shown in Table 4. The prepared reagents were placed in the reagent plate. The primers (as shown in Table 3) were synthesized by Sangon Biotech (Shanghai) Co., Ltd. using the PAGE method.

[0059] Table 4 KASP 1× Reaction System

[0060] 2×PACE Master Mix (Standard Rox) 1 F primer (forward) 100μM 0.0033 H primer (forward) 100μM 0.0033 R primer (reverse) 100μM 0.0083 DNA 1 Total 2.015

[0061] (2) KASP reaction procedure:

[0062] Place the sample plate, reagent plate, and reaction plate correctly into their respective positions on the Matrix Arrayer 3250 reaction plate preparation instrument. Select the 96-sample × 4-site or 384-sample × 1-site pipetting scheme. The instrument will automatically construct the reaction system and heat-seal the reaction. Insert the heat-sealed reaction plate into the water bath basket and run the reaction program shown in Table 5 using the Matrix Cycler 2010 high-throughput water bath thermal cycler.

[0063]

[0064] (3) Fluorescence detection and data analysis

[0065] After the water bath was completed, the reaction plate was removed and allowed to cool to room temperature before being placed in a high-speed fluorescence scanner, MatrixScanner 2100, for fluorescence scanning. The Master data analysis software was then used to synchronize the fluorescence data from the reaction plate and perform genotyping. The reaction plate preparation instrument (Matrix Arrayer 3250), the high-throughput water bath thermal cycler (Matrix Cycler 2010), and the high-speed fluorescence scanner (Matrix Scanner 2100) were all provided by Chengdu Hanchen Guangyi Biotechnology Co., Ltd.

[0066] 3. Validation results of fractal efficiency

[0067] The XW1~XW5 molecular markers were used in the first population (509 upland cotton accessions), and the KASP scatter plot (genotyping results) of 96 key intermediate breeding materials is shown below. Figure 2 As shown, the KASP primer set of XW1~XW5 molecular markers provided by this invention can efficiently achieve accurate typing and identification between materials with different genotypes. The KASP genotyping heatmap of the third population (31 natural populations of upland cotton) for the five molecular markers (XW1~XW5) is shown below. Figure 3 As shown; the KASP genotyping heatmap of the second population (45 upland cotton materials) is shown below. Figure 4 As shown; the KASP genotyping heatmap of the third population (31 natural upland cotton accessions) is shown below. Figure 5 As shown in the figure. It can be seen that the KASP primer set provided by this invention can accurately identify the genotypes of different upland cotton materials.

[0068] 4. Further verify the screening effect of KASP primer set on fiber length and micronaire value of upland cotton materials.

[0069] (1) Phenotypic data collection: The fiber quality phenotypic data of upland cotton materials, including fiber length (FL) and micronaire value (M), were measured using a fiber quality analyzer (HFT9000) at Huazhong Agricultural University.

[0070] (2) Based on the genotyping results of the first population (509 upland cotton materials), a phenotypic association analysis related to fiber quality was conducted, and the results are as follows:

[0071] Based on the number of superior genotypes (1-4) of four fiber length-related SNP molecular markers (XW1, XW2, XW4, and XW5), the materials were divided into four populations, and box plots were plotted to compare the distribution of fiber length among the different groups and the significance of differences. Results are as follows: Figure 6 As shown, fiber length increases significantly with the increase in the number of superior genotypes of fiber length-related SNP molecular markers, indicating that aggregating more superior genotypes can significantly improve fiber length.

[0072] Box plots were drawn based on the genotype groups of XW2 and XW4 molecular markers to compare the differences in fiber length between the two groups. The results are as follows: Figure 7 As shown, the fiber length of materials carrying the superior XW2 and XW4 genotypes was significantly higher than that of the inferior genotype groups (p < 0.01 and p < 0.05), consistent with expectations, indicating that the XW2 and XW4 molecular markers and their KASP primer set can be used for genetic improvement of fiber length.

[0073] Box plots were drawn based on the genotype groups of the XW3 molecular marker to compare the differences in malcolon values ​​between the two groups. The results are as follows: Figure 7 As shown, the equine clonal value of materials carrying the superior XW3 genotype was significantly higher than that of the inferior genotype group (p < 0.05), consistent with expectations, indicating that the XW3 molecular marker and its KASP primer set can be used for genetic improvement of equine clonal value.

[0074] It should be noted that in the first population, the frequency of the specific genotype corresponding to molecular marker XW1 was too low (less than 10 plants), resulting in a genotype distribution that did not meet the minimum sample size requirement for effective genetic difference analysis. Furthermore, the superior allele effect of molecular marker XW5 may be subject to complex interference from the genetic backgrounds of XW1, XW2, and XW5 itself, making it difficult to accurately assess its independent contribution to fiber length. Therefore, this embodiment instead uses the second and third populations to perform validation analyses on XW1 and XW5, respectively.

[0075] (3) Based on the genotyping results of the second population (45 intermediate upland cotton breeding materials), a phenotypic association analysis related to fiber quality was conducted, and the results are as follows:

[0076] Box plots were drawn based on the genotype groups of the XW5 molecular marker to compare the differences in fiber length between the two groups. The results are as follows: Figure 8 As shown, the fiber length of the material carrying the superior XW5 genotype was significantly higher than that of the inferior genotype group (p < 0.05), which is consistent with expectations, indicating that the XW5 molecular marker and its KASP primer set can be used for genetic improvement of fiber length.

[0077] (4) Based on the genotyping results of the third population (31 natural upland cotton accessions), a phenotypic association analysis related to fiber quality was conducted, and the results are as follows:

[0078] Box plots were drawn based on the genotype groups of the XW1 molecular marker to compare the differences in fiber length between the two groups. The results are as follows: Figure 9As shown, materials carrying the superior XW1 genotype exhibited significantly longer fiber lengths than those with inferior genotypes (p < 0.01), consistent with expectations. This indicates that the XW1 molecular marker and its KASP primer set can be used for genetic improvement of fiber length. Therefore, the aforementioned five KASP primer sets and their corresponding molecular markers demonstrate high polymorphism and stability, enabling accurate genotyping and providing efficient molecular tools for improving upland cotton fiber length and micronaire value.

[0079] Example 3

[0080] Nineteen existing upland cotton varieties were selected (Xintamian 11, Xintamian 18, Xintamian 10, Zao 36, Zao 79, Zheda 19, Zhongshengmian 16, Huaxin 103, Zhongmian N828, Xinken M2061, ZhongMB703, Xinshi K37, MCR3P15, Xinchang 437, J206-5, Xintamian 102, Yuanmian 5, and Ganmian 215; upland cotton seeds were purchased from Xinjiang Tarim River Seed Industry Co., Ltd.), and six lines were selected from each variety. The KASP primer sets for the five fiber quality-related SNP molecular markers (XW1~XW5) provided in this invention were used (specific primer information is shown in Table 3), and genotyping was performed using the same KASP detection system as in Example 2 to obtain the genotypic results for each variety on the XW1~XW5 markers.

[0081] As Figure 10 The results show that the XW1~XW5 molecular markers and KASP primer sets provided by this invention can accurately identify the homozygous status of different varieties at each marker locus, as well as the genotype of individual plants at different marker loci. It is also shown that existing varieties generally carry a poor genotype at the XW4 molecular marker locus; therefore, introducing the superior XW4 genotype can improve fiber length in subsequent fiber quality improvement breeding. In summary, the XW1~XW5 marker system can efficiently and accurately perform genotyping, clearly revealing genotypic differences among upland cotton varieties. By directionally introducing superior alleles of the corresponding markers, fiber length or micronaire value can be effectively improved, providing a stable and reliable molecular tool for the genetic improvement of upland cotton fiber quality.

[0082] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. The use of reagents for detecting SNP molecular markers in identifying fiber quality in upland cotton, characterized in that, The SNP molecular markers include at least one of XW1, XW2, XW3, and XW4; The XW1 genotype is located at nucleotide 5234605 on chromosome Ghir_D12 of upland cotton, with a mutated base of T or A; the genotype with excellent fiber length is TT, and the genotype with poor fiber length is AA. The XW2 genotype is located at nucleotide position 8264322 on chromosome Ghir_D13 of upland cotton, with a mutated base of C or T; the genotype with excellent fiber length is CC, and the genotype with poor fiber length is TT. The XW3 is located at nucleotide 97669166 on chromosome Ghir_A06 of upland cotton, with a mutated base of T or C; the excellent genotype for macronization is TT, and the poor genotype is CC. The XW4 genotype is located at nucleotide position 80709663 on chromosome Ghir_A04 of upland cotton, with a mutated base of G or C; the genotype with excellent fiber length is CC, and the genotype with poor fiber length is GG. The reference genome is upland cotton TM-1 Ghirsutum_genome_HAU_v1.

0.

2. The application of reagents for detecting SNP molecular markers in the identification of upland cotton fiber quality, characterized in that, The SNP molecular markers include: XW5 and XW1 as described in claim 1, or XW5 and XW2 as described in claim 1, or XW5, XW1 as described in claim 1 and XW2 as described in claim 1; The XW5 is located at nucleotide position 24502404 on chromosome Ghir_D11 of upland cotton, with a mutated base of G or T; the genotype with excellent fiber length is GG, and the genotype with poor fiber length is TT, with the reference genome being upland cotton TM-1 Ghirsutum_genome_HAU_v1.

0.

3. The application according to claim 2, characterized in that, The SNP molecular markers also include XW3 and / or XW4 as described in claim 1.

4. The application according to claim 1, characterized in that, The SNP molecular markers XW1~XW4 and their respective flanking sequences are shown in SEQ ID NO:1~4, and the SNP molecular markers XW1~XW4 are located at position 22 in the sequences shown in SEQ ID NO:1~4.

5. The application according to claim 1, characterized in that, The reagents for detecting SNP molecular markers include one or more of the following KASP primer sets: KASP-1 to KASP-4: (1) KASP primer set KASP-1 for XW1, wherein KASP-1 is composed of two forward primers with nucleotide sequences as shown in SEQ ID NO:6-7 and a reverse primer with nucleotide sequences as shown in SEQ ID NO:8; (2) KASP primer set KASP-2 for XW2, wherein KASP-2 consists of two forward primers with nucleotide sequences as shown in SEQ ID NO:9-10 and a reverse primer with nucleotide sequences as shown in SEQ ID NO:11; (3) KASP primer set KASP-3 for XW3, wherein KASP-3 is composed of two forward primers with nucleotide sequences as shown in SEQ ID NO:12-13 and a reverse primer with nucleotide sequences as shown in SEQ ID NO:14; (4) KASP primer set KASP-4 for XW4, wherein KASP-4 consists of two forward primers with nucleotide sequences as shown in SEQ ID NO:15-16 and a reverse primer with nucleotide sequences as shown in SEQ ID NO:

17.

6. The application according to claim 2, characterized in that, The SNP molecular marker XW5 and its flanking sequence are shown in SEQ ID NO:5, and the SNP molecular marker XW5 site is located at position 22 in the sequence shown in SEQ ID NO:

5.

7. The application according to claim 2, characterized in that, The reagent for detecting SNP molecular markers includes: KASP primer set KASP-5 and KASP-1 as described in claim 5 for XW5, or KASP-5 and KASP-2 as described in claim 5; or KASP-5 and KASP-1 and KASP-2 as described in claim 5; The KASP-5 consists of two forward primers with nucleotide sequences as shown in SEQ ID NO:18-19 and a reverse primer with nucleotide sequences as shown in SEQ ID NO:

20.

8. The application according to claim 7, characterized in that, The SNP molecular markers also include XW3 and / or XW4 as described in claim 1; the reagents for detecting the SNP molecular markers also include KASP-3 and / or KASP-4 as described in claim 5.

9. A KASP primer set for identifying the quality of upland cotton fibers, characterized in that, include: One or more of the KASP primer sets KASP-1 to KASP-4 as described in claim 5.

10. A KASP primer set for identifying the quality of upland cotton fibers, characterized in that, include: The KASP primer set KASP-5 and KASP-1 as described in claim 7, or the KASP primer set KASP-5 and KASP-2, or the primer set KASP-5, KASP-1 and KASP-2.

11. The primer set according to claim 10, characterized in that, It also includes KASP-3 and / or KASP-4 as described in claim 5.

12. A reagent or kit containing the KASP primer set for identifying the quality of upland cotton fibers as described in claim 9, 10, or 11.

13. The application of the reagent or kit according to claim 12 in molecular marker-assisted selection of upland cotton fiber quality phenotypes, characterized in that, Using the KASP primer set for identifying upland cotton fiber quality as described in claim 9, 10, or 11, the corresponding molecular markers are detected. When the detected molecular markers include XW1, XW2, XW4, or XW5, individuals with superior genotypes are selected as parents to breed offspring with improved fiber length. When the detected molecular marker includes XW3, targeted screening is performed according to the actual breeding objective: if the breeding objective is to reduce the valence value, individuals with the CC genotype are selected as parents; if the breeding objective is to increase the valence value, individuals with the TT genotype are selected as parents. When multiple molecular markers are detected, individuals with the largest number of superior genotypes are selected as parents.

14. A method for identifying the quality of upland cotton fibers, characterized in that, The genotype of the SNP molecular marker site of the upland cotton to be tested is detected, and the fiber quality of the upland cotton to be tested is determined based on the detected genotype.

15. The method according to claim 14, characterized in that, The KASP primer set for identifying upland cotton fiber quality as described in claim 9, 10, or 11 was used to perform KASP detection on the upland cotton to be tested.

Images