Use of modulators of hcar2 activation in the preparation of a medicament for the treatment of cocaine addiction withdrawal

Abstract

The application of the modulator for activating Hcar2 in the preparation of a drug for cocaine addiction withdrawal belongs to the technical field of biological medicine. The technical problem to be solved is to provide a new cocaine addiction withdrawal treatment target and a modulator for activating the target. The technical solution is that the application first discovers Hcar2 as a target and the application of the modulator for activating Hcar2 in the preparation of a drug for treating cocaine addiction withdrawal, solves the clinical dilemma of the lack of specific treatment drugs for cocaine addiction withdrawal, regulates NAc microglial cell homeostasis through the Hcar2 modulator, is different from traditional neuronal signal pathway targets, the Hcar2 modulator regulation of the application belongs to the neuroimmunomodulation mechanism, and can be verified through a cocaine rat self-administration model, thereby improving the clinical conversion value of the research results.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically the field of drug addiction technology, and specifically the application of Hcar2 activators in the preparation of drugs for treating cocaine addiction withdrawal. Background Technology

[0002] For understanding the technical content of this invention: Cocaine addiction is a chronic, relapsing substance use disorder. Its core pathological mechanism lies in cocaine's blocking of the dopamine transporter (DAT), interfering with the synaptic reuptake process of the dopaminergic projection pathway from the ventral tegmental area (VTA) to the nucleus accumbens (NAc) in the midbrain. This leads to abnormal dopamine accumulation in the synaptic cleft, inducing pathological synaptic plasticity remodeling in the reward circuit, driving the formation and maintenance of compulsive drug-seeking behavior. Clinically, addicts generally exhibit persistently enhanced drug-seeking motivation and extremely high relapse rates during withdrawal, accompanied by withdrawal syndromes such as anxiety, anhedonia, and cognitive impairment, severely impacting prognosis and social functioning. Currently, there are no regulatory-approved specific drugs for cocaine addiction. Existing interventions mainly focus on cognitive behavioral therapy and motivational reinforcement therapy, with limited efficacy and significant individual variability. There is an urgent need to develop biologically based drug treatment strategies targeting new therapies.

[0003] Hcar2 (also known as GPR109A or PUMA-G) is a member of the hydroxycarboxylic acid receptor family and belongs to the Gi-coupled G protein-coupled receptor family. Its high-affinity endogenous ligands are ketone body β-hydroxybutyrate (BHB) and niacin. In the central nervous system, Hcar2 is mainly highly expressed by microglia and exerts potent neuroprotective and anti-inflammatory effects through the BHB / Hcar2 signaling axis: Hcar2 activation can inhibit the release of NF-κB-mediated pro-inflammatory cytokines (IL-1β, TNF-α) and downregulate cAMP levels through the Gi protein-coupled pathway, negatively regulating the pro-inflammatory polarization state of microglia. In addition, microglia, as key immune regulatory cells in the NAc reward circuit, participate in synaptic plasticity remodeling after cocaine exposure through synaptic pruning and inflammatory cytokine secretion. Their dysfunction is closely related to addictive relapse behavior. BHB, a core metabolite of the ketogenic diet, has been shown to cross the blood-brain barrier and exert a direct Hcar2 agonist effect in the brain, suggesting that intervention strategies centered on the BHB / Hcar2 axis have significant translational potential. However, the specific function and molecular mechanism of Hcar2 signaling in cocaine addiction remain unclear, as does its applicability as a therapeutic target for drug development. Meanwhile, the rat self-administration model of cocaine is a classic animal model simulating human cocaine addiction, more closely reflecting the drug-seeking and relapse characteristics of clinical addicts. Exploring the target value of Hcar2 based on this model has greater clinical translational significance.

[0004] Relevant patent documents retrieved: The country of origin is China, publication number CN105974131A, publication date 2016.09.28, "Application of c-Kit as a target for the treatment of drug addiction", this document discloses the application of c-Kit as a drug target in screening drugs for the treatment of drug addiction and in screening drugs for the treatment of addictive psychological cravings and excitement of substance dependence.

[0005] Relevant non-patent literature retrieved: The journal title is *Ningxia Medical Journal*, the article title is "Effects of GABABR in NAc on Withdrawal Symptoms and Cognitive Function in Cocaine-Addicted Rats", and the publication date is January 15, 2025. This article discloses the effects of γ-aminobutyric acid type B receptor (GABABR) in the ventral tegmental nucleus (NAc) of the brain on withdrawal symptoms and cognitive function in cocaine-addicted rats. The study found that GABABR in NAc participates in the regulation of cocaine addiction, and its agonist BLF can induce withdrawal symptoms in cocaine-dependent rats and improve their cognitive function.

[0006] The prior art represented by the aforementioned documents has at least the following unresolved technical problems or defects: In existing technologies, researchers have attempted to explore addiction treatment drugs from different targets. For example, Chinese patent CN105974131A discloses the application of c-Kit as a drug target in screening drugs for treating drug addiction. It uses the c-Kit inhibitor imatinib and verifies the inhibitory effect of imatinib on morphine addiction through rat sensitization and conditional place preference animal models. Another example is the study investigating the effects of GABABR in NAc on withdrawal symptoms and cognitive function in cocaine-addicted rats, finding that the GABABR agonist baclofen (BLF) can induce withdrawal symptoms and improve cognitive function in cocaine-dependent rats. However, none of the above studies have addressed the Hcar2 target, nor have they revealed the mechanism of action of Hcar2 in cocaine addiction withdrawal.

[0007] In summary, there is a lack of effective drugs for treating cocaine addiction withdrawal in the existing technology. Summary of the Invention

[0008] The purpose of this invention is to provide: The application of Hcar2-activating modulators in the preparation of drugs for treating cocaine addiction withdrawal, and related technologies, to address the technical problem of the lack of effective drugs for treating cocaine addiction withdrawal in the prior art.

[0009] Terminology Explanation: Unless otherwise defined, all technical terms in this document have the same meanings as commonly understood by one of ordinary skill in the art to which the subject matter of the claims pertains. Unless otherwise stated, all patents, patent inventions, and publications cited in this document are incorporated herein by reference in their entirety. If multiple definitions exist for terms in this document, the definitions in this chapter shall prevail.

[0010] It should be understood that the above brief description and the following detailed description are exemplary and for illustrative purposes only, and do not limit the subject matter of the invention in any way. In this invention, the singular is used in conjunction with the plural unless otherwise specifically stated. It should also be noted that, unless otherwise stated, the use of “or” or “or” means “and / or”. Furthermore, the use of the term “comprising” and other forms such as “including,” “containing,” and “contains” are not limiting.

[0011] Definitions of standard terms can be found in the references “Modern Molecular Biology (5th Edition), Higher Education Press, authors: Zhu Yuxian, Li Yi, Zheng Xiaofeng and Guo Hongwei, 2019-06-19” and “Genetic Engineering, Higher Education Press, 2013-08-01”.

[0012] Unless otherwise stated, conventional methods within the scope of the art, such as animal model establishment, behavioral testing, brain region localization injection, protein detection, and gene expression analysis, shall be used.

[0013] Unless specifically defined herein, the use of all commercially available products herein employs standard techniques. For example, it may be carried out using the manufacturer's instructions for use with the kit, or in accordance with methods known in the art or the description of this invention. The techniques and methods described herein can generally be implemented according to conventional methods well known in the art, based on the descriptions in the various summary and more specific documents cited and discussed in this specification.

[0014] The terms “optional / arbitrary” or “optionally / arbitrarily” mean that the event or situation described below may or may not occur, including both the occurrence and non-occurrence of the event or situation.

[0015] The term "cocaine addiction withdrawal" as used in this article refers to the withdrawal state that cocaine addicts experience after ceasing cocaine use, characterized by increased drug-seeking motivation and a higher tendency to relapse, including natural withdrawal and induced withdrawal.

[0016] The term “cocaine rat self-administration model” as used in this article refers to an animal model that simulates the active drug-seeking behavior of human cocaine addicts by training rats to actively press a lever or nasal touch to obtain intravenous cocaine injection.

[0017] The term “nucleus accumbens (NAc)” used in this article refers to the nucleus accumbens, the core brain region of the reward circuit, which receives dopaminergic fiber projections from the ventral tegmental area of ​​the midbrain and is an important regulatory nucleus for drug-induced reward behavior.

[0018] The term "β-hydroxybutyric acid" used in this article refers to D-3-hydroxybutyric acid (BHB), also known as β-hydroxybutyric acid or R-3-hydroxybutyric acid, which is an endogenous ketone body with a molecular weight of 126.09 Daltons. This substance plays an important role in human energy metabolism and neuroprotection, and is one of the three major ketone bodies in the human body. Its concentration increases significantly under conditions of starvation, exercise, and low-carbohydrate diets.

[0019] In a first aspect, the present invention provides the use of a regulator that activates Hcar2 in the preparation of a medicament for treating cocaine addiction withdrawal.

[0020] The technical features include: target point – Hcar2; active ingredient – ​​regulator that activates Hcar2; target group – cocaine addiction withdrawal; and application method – development or preparation of drugs for treating cocaine addiction withdrawal.

[0021] The regulator is a substance that upregulates the expression and / or activity of the Hcar2 protein; and / or the regulator is a substance that upregulates the expression of the Hcar2 encoding gene. That is, the regulator is a substance that activates Hcar2 or its encoding gene, referring to a substance that can interact with a target (Hcar2 protein or its encoding gene) and upregulate (activate) its biological function or expression level. The regulator includes regulators of the Hcar2 protein (acting at the protein level), which directly bind to the Hcar2 receptor protein and upregulate its expression level or activity (function), such as at least one of agonists and allosteric regulators. The regulator also includes regulators of the Hcar2 encoding gene (acting at the gene / DNA level), which act on the gene itself and upregulate the expression level of Hcar2 (transcription or translation), such as expression upregulators.

[0022] According to some embodiments of the present invention, the modulator includes an Hcar2 agonist.

[0023] Furthermore, the Hcar2 agonist is selected from small molecule compounds that specifically activate the activity and / or expression of Hcar2.

[0024] Furthermore, the small molecule compound may be selected from at least one of β-hydroxybutyric acid, pharmaceutically acceptable salts of β-hydroxybutyric acid, and ester derivatives of β-hydroxybutyric acid.

[0025] Furthermore, the pharmaceutically acceptable salt of β-hydroxybutyrate is selected from at least one of sodium β-hydroxybutyrate, potassium β-hydroxybutyrate, calcium β-hydroxybutyrate, magnesium β-hydroxybutyrate, zinc β-hydroxybutyrate, arginine β-hydroxybutyrate, lysine β-hydroxybutyrate, ornithine β-hydroxybutyrate, and creatine β-hydroxybutyrate.

[0026] Furthermore, the ester derivative of β-hydroxybutyric acid is selected from at least one of (R)-3-hydroxybutyl(R)-3-hydroxybutyrate (also known as 1,3-butanediol mono-β-hydroxybutyrate), 1,3-butanediol bis-β-hydroxybutyrate, glyceryl tri(β-hydroxybutyrate), methyl β-hydroxybutyrate, ethyl β-hydroxybutyrate, and benzyl β-hydroxybutyrate.

[0027] According to some embodiments of the present invention, the regulator may also be selected from ketogenic diet intervention programs.

[0028] The modulator is able to improve at least the core symptoms of cocaine addiction withdrawal.

[0029] According to some embodiments of the present invention, the modulator has the effect of reducing drug-seeking motivation and relapse tendency after cocaine addiction withdrawal.

[0030] Furthermore, reducing drug-seeking motivation after cocaine addiction withdrawal includes reducing proactive drug-seeking behavior.

[0031] Furthermore, the relapse tendency includes at least one of cue-induced relapse behavior and cocaine-induced relapse behavior.

[0032] According to some embodiments of the present invention, the effects of the drug were verified using a cocaine rat self-administration model.

[0033] Specifically, in a rat self-administered cocaine model, the expression of Hcar2 in the nucleus accumbens, a key brain region for addiction, was upregulated in the low relapse group and downregulated in the high relapse group. This indicates that Hcar2 activation is associated with an anti-relapse phenotype.

[0034] According to some embodiments of the present invention, the drug regulates the expression and / or activity of Hcar2.

[0035] According to some embodiments of the present invention, the drug regulates the expression of the Hcar2 encoding gene.

[0036] The drug's regulation of the expression and / or activity of Hcar2 protein, or the drug's regulation of the expression of the Hcar2 encoding gene, is beneficial in reversing the abnormal expression of Hcar2 in the brain regions of cocaine-addicted rats undergoing withdrawal, thereby restoring the homeostatic function of NAc microglia.

[0037] According to some embodiments of the present invention, the medicament contains the modifier and a pharmaceutically acceptable carrier and / or excipient.

[0038] According to some embodiments of the present invention, the carrier is selected from at least one of solvents, solid excipients, coating materials, controlled-release matrix materials, etc.

[0039] According to some embodiments of the present invention, the excipients are selected from at least one of pH adjusters, stabilizers, preservatives, antioxidants, flavoring agents, etc.

[0040] According to some embodiments of the present invention, the dosage form of the drug is an injectable formulation, an oral formulation, or a nasal formulation.

[0041] Secondly, based on the same inventive concept, the present invention provides: a pharmaceutical composition for treating cocaine addiction withdrawal, comprising the aforementioned modifier and a pharmaceutically acceptable carrier and / or excipient.

[0042] According to some embodiments of the present invention, the dosage form of the pharmaceutical composition is an injectable formulation, an oral formulation, or a nasal formulation.

[0043] Examples 1-4 of this invention at least support the protection scope of "the use of the modifier in the preparation of a medicament for treating cocaine addiction withdrawal".

[0044] The term "use of modifiers in the preparation of medicaments for treating cocaine addiction withdrawal" is derived from the foregoing explanation and / or the application of the corresponding targets in Examples 1-4. Therefore, those skilled in the art can reasonably presume that "use of modifiers in the preparation of medicaments for treating cocaine addiction withdrawal," its subordinate concepts, its substantially equivalent technical means, and technical means that can replace it within the scope of conventional technical means and common knowledge based on the existing level of technology should all fall within the protection scope of "use of modifiers in the preparation of medicaments for treating cocaine addiction withdrawal."

[0045] Examples 1-4 of this invention at least support the protection scope of "pharmaceutical composition".

[0046] "Pharmaceutical composition" is derived from the foregoing explanation and / or the corresponding pharmaceutical summary in Examples 1-4. Therefore, those skilled in the art can reasonably presume that "pharmaceutical composition," its subordinate concepts, its substantially equivalent technical means, and technical means that can replace it within the scope of conventional technical means and common knowledge based on the existing level of technology should all fall within the protection scope of "pharmaceutical composition."

[0047] The present invention has at least the following beneficial effects: Compared with existing technologies, this invention provides the application of a regulator that activates Hcar2 in the preparation of drugs for cocaine addiction withdrawal, which has better technical effects. Specifically, compared with existing technologies, this invention provides a technical solution with a different technical concept, and its technical effects are equivalent to or slightly improved by existing technologies: (1) This invention is the first to use a rat self-administration model of cocaine as a verification system, and discovers and proposes that Hcar2 is a specific drug target for treating cocaine addiction withdrawal, filling the technical gap in the field of cocaine addiction withdrawal where there is no effective molecular target and regulator to activate the target. The research results are more consistent with the pathological characteristics of clinical cocaine addiction. (2) Bulk sequencing and RT-qPCR experiments confirmed that Hcar2 expression was significantly upregulated in microglia in the NAc brain region of rats with low relapse phenotype, indicating that there is a causal relationship between Hcar2 signal activation and the formation of anti-relapse behavior; (3) Experiments have shown that regulating the activity / expression of Hcar2 through modulators (administering BHB or ketogenic diet) can significantly improve the core symptoms of cocaine addiction withdrawal, including reducing active drug-seeking behavior, inhibiting cue / drug-induced relapse, and alleviating anxiety-like behavior, providing a clear direction for drug development for cocaine addiction withdrawal. (4) Hcar2 modulators can reverse the abnormal synaptic plasticity of the mesolimbic dopamine system in cocaine self-administered rats by inhibiting the pro-inflammatory polarization of NAc microglia, thereby improving the neuropathological changes of cocaine addiction from a molecular mechanism perspective. They have the advantages of strong targeting and clear mechanism of action. (5) This invention provides a new drug development approach for the clinical treatment of cocaine addiction withdrawal. With the endogenous metabolite BHB as the core lead compound, it has a good safety profile and is expected to develop a highly specific and effective anti-cocaine addiction withdrawal drug to address the shortcomings of existing clinical treatment methods. Attached Figure Description

[0048] Figure 1 This is a diagram illustrating the construction of a rat self-administered cocaine addiction model according to the present invention, wherein, Figure 1 Figure A in the graph shows the number of pen strokes over time in mice during a ten-day cocaine self-administration training period. Active pokes induce cocaine release, while inactive pokes do not. Figure 1 Figure B in the figure shows the statistical change over time in the actual number of times cocaine was administered to rats during cocaine training.

[0049] Figure 2This is a diagram of single-cell sequencing results of the nucleus accumbens (NAc) in this invention. Specifically, it is a cell type annotation diagram of single-cell sequencing data of the NAc in rats after cocaine addiction, and a control is a cell type annotation diagram of single-cell sequencing data of the NAc brain region in non-addicted rats.

[0050] Figure 3 This is a diagram of the results of single-cell sequencing of the nucleus accumbens Bulk in this invention, specifically a mapping diagram of differentially expressed genes in different cell types. The diagram shows that the differentially expressed genes after addiction mainly affect microglia.

[0051] Figure 4 This is a diagram showing the results of cocaine addiction relapse after pharmacological antagonism of Hcar2 receptors according to the present invention.

[0052] Figure 5 This is a diagram showing the results of cocaine addiction relapse after AAV microglia-specific knockdown of the Hcar2 receptor according to the present invention. Detailed Implementation

[0053] Unless otherwise specified, all raw materials and reagents used in this invention were purchased from commercial suppliers, and experiments were conducted in accordance with the operating instructions. Unless otherwise specified, all instruments, equipment, and apparatus used in this invention are conventional instruments, equipment, and apparatus, and experiments were conducted in accordance with the operating instructions and the accompanying reagents.

[0054] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. Unless otherwise specified in the embodiments, conditions are performed under conventional conditions or conditions recommended by the manufacturer. All reagents or instruments without specified manufacturers are commercially available conventional products. Numerous specific details are provided in the following detailed embodiments to better illustrate the invention. The specific embodiments described herein are for illustrative purposes only and are not intended to constitute any limitation on the invention.

[0055] Data analysis and statistical analysis were performed using professional data processing software, and significance analysis was conducted using one-way ANOVA. P <0.05 indicates a significant difference.

[0056] The main materials used in the following embodiments: (1) Experimental animals: SPF-grade male SD rats, weighing 220-250g, were purchased from Vital River. The animals were housed in an SPF-grade animal room at a temperature of 23±2℃ and a humidity of 50±5%, with a 12-hour light-dark cycle, and free access to food and drinking water.

[0057] (2) Drugs and reagents: Cocaine was purchased from the Institute of Drug Dependence, Peking University; BHB (β-hydroxybutyric acid) was purchased from Bid Pharmaceuticals; Hcar2 antagonist was purchased from MedChemExpress (MCE); AAV-shHcar2 viral vector was purchased from Jikai Gene.

[0058] (3) Main instruments: The rat self-administering box was purchased from Anlai Scientific Instruments, the small animal anesthetic was purchased from Ruiwode, and the rat dorsal cannula was purchased from Anlai Scientific Instruments.

[0059] Example 1: Establishment of a self-administered cocaine addiction rat model (1) Animal preparation: Male SD rats were acclimatized for one week before undergoing jugular vein cannulation. After being anesthetized with isoflurane, the rats were fixed on a stereotaxic instrument, the right jugular vein was separated, and a silicone tube was inserted into the jugular vein to the level of the atrium. The end of the catheter was led out from the back through a subcutaneous tunnel and fixed to the skin. Penicillin was administered postoperatively to prevent infection, and the rats recovered in 7 days.

[0060] (2) Self-administration training: Rats were placed in a cocaine self-administration box equipped with an active lever and a signal light. Each time a rat pressed the active lever, it received an intravenous injection of cocaine (0.25 mg / kg / time, injection time 4 seconds), and the signal light illuminated for 5 seconds as a conditioned stimulus. The training used a fixed-ratio FR1 program, with 3 hours of training per day for 10 consecutive days. The number of active lever presses and the amount of drug ingested were used as indicators of addictive behavior.

[0061] (3) Withdrawal period treatment: After the drug administration training is completed, the rats are transferred to a rearing cage for natural withdrawal. Cocaine is not given during the withdrawal period for 14 days.

[0062] (4) Relapse Test: After the withdrawal period, the rats were placed back into the self-administered drug administration box. Relapse behavior was induced by cues (signal light) or drugs (cocaine priming, 5 mg / kg, intraperitoneal injection). The number of active lever presses was recorded, and the results were as follows: Figure 1 As shown.

[0063] Example 2: Identification of differential Hcar2 expression by septal nucleus Bulk sequencing and single-cell sequencing (1) Experimental grouping: Based on the results of the respiration test in Example 1, the rats were divided into a low respiration group (the number of active lever presses was less than the average value minus 1 standard deviation) and a high respiration group (the number of active lever presses was more than the average value plus 1 standard deviation).

[0064] (2) Tissue sampling: After the behavioral test, the rats were deeply anesthetized and decapitated to remove the brain. The brain tissue of the nucleus accumbens (NAc) was quickly separated on ice, flash-frozen in liquid nitrogen and stored at -80℃.

[0065] (3) Bulk RNA sequencing: Total RNA was extracted from NAc tissues, and libraries were constructed and then subjected to Illumina high-throughput sequencing. Differentially expressed genes were analyzed from the sequencing data to screen for differentially expressed genes between the low reabsorption group and the high reabsorption group.

[0066] (4) Single-cell sequencing: NAc tissue was prepared into a single-cell suspension and single-cell transcriptome sequencing was performed using the 10× Genomics platform to analyze the expression differences of Hcar2 in different cell types (neurons, microglia, astrocytes, etc.).

[0067] (5) RT-qPCR verification: Take about 20-30 mg of freshly isolated rat nucleus accumbens (NAc) tissue and place it in a pre-cooled 1.5 mL RNase-free centrifuge tube. Add 1 mL of TRIzol reagent (Invitrogen), homogenize thoroughly using a tissue homogenizer, and let stand at room temperature for 5 min to allow the nucleoprotein complex to completely dissociate. Add 200 μL of chloroform, shake vigorously for 15 s, let stand at room temperature for 3 min, and then centrifuge at 4℃ and 12000×g for 15 min. Transfer the upper aqueous phase to a new centrifuge tube, add an equal volume of isopropanol, precipitate at -20℃ for 30 min, centrifuge at 4℃ and 12000×g for 10 min, discard the supernatant, wash the precipitate twice with 75% ethanol (prepared with DEPC water), dry at room temperature, and dissolve the RNA in an appropriate amount of DEPC water. RNA concentration and OD260 / 280 ratio (between 1.8 and 2.1) were detected using a nano-spectrophotometer (NanoDrop 2000). RNA integrity (28S:18S band ratio close to 2:1) was detected using agarose gel electrophoresis. 1 μg of total RNA was used for reverse transcription using a kit (Novizan) according to the following system: first, gDNA Eraser was added and incubated at 42℃ for 2 min to remove genomic DNA contamination; then, the reverse transcription reaction system (containing PrimeScript RT Enzyme Mix, RT Primer Mix, and 5×PrimeScript Buffer) was added. The reaction conditions were 37℃ for 15 min followed by 85℃ for 5 s (to inactivate reverse transcriptase) to obtain cDNA, which was stored at -20℃ for later use. Primer-BLAST (NCBI) software was used to design a rat-specific... Hcar2Gene-specific primers were designed to span exons to avoid interference from genomic DNA contamination, and primer specificity was confirmed by BLAST alignment. GAPDH was used as an internal reference gene. The primer sequences are as follows: Rat-GAPDH-F: TGATGGGTGTGAACCACGAG (Seq ID NO:1); Rat-GAPDH-R: GGCATGGACTGTGGTCATGA (Seq ID NO:2). Rat-hcar2-F: GGCACGATGCAATGTTCCTC (Seq ID NO:3); Rat-hcar2-R: CTTGACGTGCCTGTCCATCT (Seq ID NO:4). Using GAPDH as an internal reference gene, the relative expression level of Hcar2 was calculated. The specific method was as follows: The relative expression level of the Hcar2 gene was calculated using the 2^-ΔΔCt method (Livak method), and the specific steps are as follows: 1. The cycle threshold (Ct value) of Hcar2 and the internal reference gene GAPDH in each sample is automatically calculated by the real-time PCR instrument. 2. Calculate the ΔCt value for each sample: ΔCt = Ct(Hcar2) - Ct(GAPDH); 3. Using the mean ΔCt of the control group (saline treatment group) as the calibration reference, calculate the ΔΔCt value of each experimental group (such as the BHB treatment group): ΔΔCt = ΔCt(experimental group) - ΔCt(control group mean); 4. Calculate the relative expression level (Fold change): Relative expression level = 2^(-ΔΔCt); Results are expressed as mean ± standard error (SEM) of relative expression levels. One-way ANOVA or independent samples t-test (depending on the number of groups) was used to compare experimental groups. P < 0.05 was used as the criterion for statistical significance.

[0068] (6) Results: such as Figure 2 and Figure 3 As shown, Bulk sequencing and RT-qPCR experiments confirmed that Hcar2 expression was significantly upregulated in microglia of the NAc brain region of rats with a low relapse phenotype, while its expression was downregulated in the high relapse group, indicating that Hcar2 activation is associated with the anti-relapse phenotype.

[0069] Example 3: Effects of the Hcar2 agonist BHB on the behavior of cocaine-addicted rats in withdrawal. (1) Experimental grouping: Rats that have completed cocaine self-administration training and entered the withdrawal period were randomly divided into 3 groups: control group (administered with an equal volume of physiological saline) and BHB group (200 mg / kg, intraperitoneal injection), with 10 rats in each group.

[0070] (2) Dosage regimen: BHB or an equal volume of normal saline was administered intraperitoneally daily from day 1 to day 14 of the withdrawal period.

[0071] (3) Cue-induced relapse test: On the 14th day of the withdrawal period, the rats were placed in the self-administered drug operation box and given cue stimulation (signal light lit up), and the number of active lever presses was recorded.

[0072] (4) Results: such as Figure 4 As shown, compared with the control group, the spontaneous activity of rats in the BHB treatment group was not significantly abnormal, and the number of cue-induced active lever pressing was significantly reduced, indicating that BHB can significantly reduce active drug-seeking behavior and relapse behavior after cocaine addiction withdrawal.

[0073] Example 4: AAV microglia-specific knockdown of Hcar2 to verify target specificity (1) Virus construction: An AAV viral vector (AAV-shHcar2) carrying Hcar2 shRNA was constructed, with GFP as the reporter gene and microglia-specific promoter driving expression. The specific method was as follows: using rats (Rat)... Hcar2 The gene (GenBank accession number: NM_181476.2, Gene ID: 353250, CDS region length 1,083 bp) is the target of interference.

[0074] Using the GV684 plasmid as the vector backbone, a recombinant AAV vector carrying Hcar2 RNA interference elements was constructed. The expression cassette element sequence was: pAAV-CD68p-EGFP-MIR155(MCS)-WPRE-SV40 PolyA. This means that the expression of the fusion transcript of the EGFP reporter gene and the artificial miRNA scaffold (an artificial miRNA expression cassette based on the endogenous miR-155 backbone, i.e., shRNA-miR chimeric design) was driven by the microglia / macrophage lineage-specific promoter CD68 (CD68 promoter). The target sequence was inserted into the multiple cloning site (MCS) region of the miR-155 scaffold for processing and cleavage, generating mature interfering RNA. Downstream, WPRE and SV40 PolyA signals (transcription termination and polyA tailing signals) were sequentially connected. RNAi targets were designed against the Hcar2 mRNA coding region, and a negative control virus (adeno-associated virus negative control) without interfering sequences was constructed in parallel. The vector backbone and element structure were identical to the target virus, except that the inserted sequence in the MCS region did not contain the Hcar2 homologous interference sequence. After the recombinant plasmid was verified to be correct by sequencing, it was co-transfected with helper plasmids into packaging cells for viral packaging. The final product was prepared by centrifugation, purification, aliquoting, and cryopreservation. The packaged serotype was an optimized microglial cell-targeting serotype (labeled as MG1.2), with a final titer of 1×10⁻⁶. 12 vg / mL, specification 50 μL / tube (total 1×10⁻⁶) 12 vg / tube).

[0075] (2) Brain region localization injection: The SD rats were fixed on a stereotaxic instrument and the coordinates of the NAc region were located (1.80 mm anterior to the anterior fontanelle, 0.8 mm lateral to the midline, and 7.5 mm vertical depth). AAV-shHcar2 or control AAV-shCtrl virus solution (1 μL) was slowly injected into both NAc regions using a microinjection pump at a rate of 0.2 μL / min. The needles were left in place for 5 minutes and then slowly withdrawn.

[0076] (3) Viral expression and behavioral tests: Three weeks after viral injection, cocaine self-administration training and withdrawal period treatment were carried out. BHB (300 mg / kg, intraperitoneal injection) or an equal volume of physiological saline was administered to conduct cue-induced relapse tests.

[0077] (4) Results: such as Figure 5 As shown, the protective effect of BHB was significantly negated after AAV microglia-specific knockdown of the Hcar2 receptor, demonstrating that BHB exerts its therapeutic effect on relapse through Hcar2, and the anti-addictive effect of Hcar2.

[0078] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, and is not intended to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions made by those skilled in the art to the technical solution of the present invention do not depart from the essence and scope of the technical solution of the present invention.

Claims

1. The use of a modifier in the preparation of a medicament for cocaine addiction withdrawal, characterized in that, The regulator is a substance that upregulates the expression and / or activity of Hcar2 protein; and / or The regulator is a substance that upregulates the expression of the Hcar2 encoding gene.

2. The application according to claim 1, characterized in that, The modulator includes an Hcar2 agonist.

3. The application according to claim 2, characterized in that, The Hcar2 agonist is selected from small molecule compounds that specifically activate the activity and / or expression of Hcar2.

4. The application according to claim 3, characterized in that, The small molecule compound is selected from at least one of β-hydroxybutyric acid, pharmaceutically acceptable salts of β-hydroxybutyric acid, and ester derivatives of β-hydroxybutyric acid.

5. The application according to claim 1, characterized in that, The modulator's effects include reducing drug-seeking motivation and relapse tendency after cocaine addiction withdrawal.

6. The application according to claim 5, characterized in that, The relapse tendency includes at least one of cue-induced relapse behavior and cocaine-induced relapse behavior.

7. The application according to claim 1, characterized in that, The drug contains the modifier and a pharmaceutically acceptable carrier and / or excipient.

8. The application according to claim 7, characterized in that, The carrier is selected from at least one of solvents, solid excipients, coating materials, and controlled-release matrix materials; and / or The excipients are selected from at least one of pH adjusters, stabilizers, preservatives, antioxidants, and flavoring agents.

9. The application according to claim 7, characterized in that, The drug is available in injectable, oral, or nasal formulations.

10. A pharmaceutical composition for cocaine addiction withdrawal, characterized in that, It comprises the modifier of any one of claims 1-9 and a pharmaceutically acceptable carrier and / or excipient.

Images