Method for expressing human recombined interleukin 18 (rhIL-18) through yeast as well as product
A technology for interleukin and yeast expression, which can be used in microorganism-based methods, recombinant DNA technology, botanical equipment and methods, etc., and can solve problems such as inability to use
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
example 2
[0038] Upstream primer example 2: tactttggcaagcttgaatctaaat (SEQ ID NO: 3)
example 1
[0039] Downstream primer example 1: gtcttcgctttgaacagtga (SEQ ID NO: 4)
[0040] Downstream primer example 2: gtcttcgctttgaacagtgaacat (SEQ ID NO: 5)
[0041] RT-PCR using GIBCOBRL's SuperScript II TM (cat#: 18089-011; Lot#: 1072465) reverse transcription kit for reverse transcription, using TAKARA company's Ex Taq enzyme (cat#: DRR001A) for PCR reaction.
[0042] Strain GS115 / KM71 / was purchased from Invitrogen.
[0043] Strain XL-1Blue was purchased from CLONTECH Company.
[0044] Preparation
[0045] Expression vector construction
[0046] The Escherichia coli-yeast shuttle vector was designed as the expression vector pYE3. The vector contains the replication signal of Escherichia coli, AMP or NEO resistance gene, T3 or T7 promoter, PHO1 promoter or AOX1 promoter, α factor signal peptide sequence, enhancer sequence, 3' untranslated sequence of PHO1 gene, etc. (figure 1).
[0047] Acquisition of the target gene
[0048] Extract the mRNA of Chinese blood lymphocytes, ...
Embodiment
[0071] Construction of Secretory Expression Plasmids
[0072] At the same time, the splicing product cloning vector pMD18T-IL18 and the yeast secretion expression vector pPICZαA were digested with EcoR I and Xba I, the fragments were separated by agarose gel electrophoresis, and the 613bp chIL18 gene fragment was recovered; the 3.5kb vector DNA fragment was recovered by ethanol precipitation purification. then at T 4 Under the action of DNA ligase (2.5 units / μl, 10X ligation buffer containing ATP, TAKARA CO.#2011A CA), the gene fragment was ligated with the vector. The ligation product was transformed into competent Escherichia coli host cell TOP10F' (Invitrogen). After screening by Zeocin resistance plate, the positive transformants were identified by colony PCR, and the positive clones that could amplify a 613bp DNA fragment were screened. Two of them were selected, and a small amount of plasmid was extracted for further enzyme digestion identification.
[0073] Mass extr...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More