Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for distinguishing astragalus root from its counterfeit drug by using SSR molecular marking process

A labeling method, the technology of Radix Astragali, applied in the direction of biochemical equipment and methods, pharmaceutical formulations, microbial determination/inspection, etc.

Inactive Publication Date: 2007-05-23
LANZHOU UNIVERSITY
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But its biggest inconvenience is the design of the primer sequences at both ends
Because of the relative conservation and single-copy nature of the sequences at both ends of the SSR sequence, this technology should be applied when understanding the genetic background of the species and designing corresponding primers. At present, due to the lack of molecular information on Astragalus, SSR has not been used at home and abroad. Methods Labeling and identification of Astragalus membranaceus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for distinguishing astragalus root from its counterfeit drug by using SSR molecular marking process
  • Method for distinguishing astragalus root from its counterfeit drug by using SSR molecular marking process
  • Method for distinguishing astragalus root from its counterfeit drug by using SSR molecular marking process

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Embodiment 1, CTAB extracts the total DNA of dried Radix Astragali and its counterfeit products (hollyhock, upland cotton, alfalfa, round leaf mallow, sweet clover, mallow, golden pheasant)

[0022] (1) Add liquid nitrogen to the fresh leaves and grind them quickly, and the dry materials are crushed with a pulverizer before, and the powder is taken.

[0023] (2) Add preheated 65°C CTAB extraction buffer (pH7.8) to each tube

[0024] 700mmol / L NaCl,

[0025] 50mmol / L Tris-HCl,

[0026] 10mmol / L EDTA,

[0027] 1% CTAB,

[0028] 1% mercaptoethanol,

[0029] Mix well, and incubate at 65°C for about 30-60 minutes.

[0030] (3) Take it out and centrifuge at 10,000 rpm for 10 minutes.

[0031] (4) Take the supernatant and centrifuge at 10,000 rpm for 10 minutes, and keep the supernatant.

[0032] (5) Add an equal volume of chloroform-isoamyl alcohol (24:1), mix well, and rotate at 10,000 rpm for 10 minutes.

[0033] (6) Add 0.1 volume of 2M ammonium acetate to the supe...

Embodiment 2

[0040] Embodiment two, PCR amplification

[0041] number 1

chain of justice

5′CAAAACATAAAAAAGGTGAGA 3′

antisense strand

5′AAGAACCACACTAATATTATT 3′

number 2

chain of justice

5′GGAAGAAAGTATTGGTCTGT 3′

antisense strand

5′AGGAGAGAGTGGAGAGATTA 3′

number 3

chain of justice

5′ TTCGAAGCATCCAAGG 3′

antisense strand

5′AAAAGACAAAACATACTATAAAA 3′

number 4

chain of justice

5′CGTGCCAAATTACATCA 3′

antisense strand

5′TGATGGGAACAAGTACATAA 3′

number 5

chain of justice

5′ ATGGTTTTTTTCCTGCCCTTT 3′

antisense strand

5′AACAAGCCCCCCTAAAAGAA 3′

number 6

chain of justice

5′ CTTTGGCGCTGACACAT 3′

antisense strand

5′CCCAGTGAACATTTTAGGATCA 3′

number 7

chain of justice

5′AAGCTTAGAAGCAAACCAAAGAT 3′

antisense strand

5′ TGTTTTTCATTTTCACCCCAAG 3′

number 8

chain of justice

5′AATGAGGAACCTTTGACCCC 3′

...

Embodiment 3

[0064] Embodiment three, SSR is to Radix Astragali and its counterfeit identification result

[0065] The results of electrophoresis were converted into patterns of electrophoresis bands using the biological software Orthogonality-Experiment Assistant (version: 2.0) (Figs. 8-13). The site with a band was counted as 1, and the site without a band was counted as 0, and the results in the negative control were subtracted from it. And calculate the similarity index Sxy between each material for each pair of primers according to the following formula:

[0066] S xy =2×N xy / N x +N y

[0067] N x is the number of alleles of material X, N y is the number of alleles of material X, N xy is the number of alleles shared by X and Y.

[0068] Calculate the PIC value (polymorphism index content) according to the following formula:

[0069] PIC = 1 - Σ n = 1 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for checking milk vetch root, which uses SSR mark molecule method to check the milk vetch root, wherein it extracts the DNA of real milk vetch root and false milk vetch root, selects 6 couples of inducers from 10 couples of inducers of soybean, to be treated with SSR method.

Description

Technical field: [0001] The invention provides a method for identifying Chinese medicinal materials and their counterfeit products, more precisely, a method for identifying astragalus membranaceus and its counterfeit products, and relates to the SSR molecular marker method. Background technique: [0002] Astragalus is a traditional bulk traditional Chinese medicinal material. The demand for Astragalus in my country is increasing year by year. However, in recent years, due to policies such as returning farmland to forests, closing mountains for afforestation, protecting the ecological environment, and strictly prohibiting the digging of wild Astragalus, resources have become more scarce. This gap between supply and demand has led to a steady rise in the price of astragalus, and the rising profits have attracted many lawbreakers. Now, counterfeiting of astragalus is rampant in the market. Sunflower, Caragana. These counterfeit products that appear on the market are all taken ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K36/481C12Q1/68
Inventor 李红玉刘艳丽支德娟
Owner LANZHOU UNIVERSITY