METHOD FOR IMPROVING TRANSFORMATION FREQUENCY
Patent Information
- Authority / Receiving Office
- DE · DE
- Patent Type
- Patents
- Current Assignee / Owner
- SYNGENTA CROP PROTECITON AG
- Filing Date
- 2017-11-28
- Publication Date
- 2026-06-17
AI Technical Summary
The transformation frequency using the phosphinothricin acetyltransferase (PAT) gene as a selectable marker in plant transformation is low, making it resource-intensive, and there is a need for an improved selectable marker to enhance transformation efficiency.
A nucleic acid molecule at least 95% identical to SEQ ID NO: 13 is used to create a chimeric or recombinant nucleic acid construct that confers herbicide tolerance to glutamine synthetase (GS) inhibitor herbicides, increasing transformation frequency in both bacterial and plant cells.
The improved method results in a greater transformation frequency, recovering at least 10% to 1000% more transgenic plants compared to methods using conventional PAT variants like cPAT-09.
Description
RELATED APPLICATIONS
[0001] This application claims the benefit of provisional application 62 / 431,664, filed December 8, 2016.SEQUENCE LISTING
[0002] A Sequence Listing in ASCII text format, submitted under 37 C.F.R. § 1.821, entitled "81157_ST25.txt", 139 kilobytes in size, generated on October 25, 2017 and filed via EFS-Web is provided in lieu of a paper copy.FIELD OF THE INVENTION
[0003] The present invention relates generally to the field of plant biotechnology. More specifically, the present invention relates to compositions and methods for improving transformation frequency. Specifically, the invention includes compositions and methods for using improved selectable markers to improve transformation frequency.BACKGROUND OF THE INVENTION
[0004] Cultivated crops such as maize, soybean, and cotton have substantial commercial value throughout the world. The development of scientific methods useful in improving the quantity and quality of important crops is, therefore, of significant commercial interest. Significant effort has been expended to improve the quality of cultivated crop species by conventional plant breeding. Conventional means for crop and horticultural improvements utilize selective breeding techniques to identify plants having desirable characteristics. However, such selective breeding techniques have several drawbacks, namely that these techniques are often labor intensive and result in plants that often contain heterogeneous genetic components that may not always result in the desirable trait being passed on from the parent plants. Advances in molecular biology have allowed mankind to modify the germplasm of animals and plants. Genetic engineering of plants entails the isolation and manipulation of genetic material (typically in the form of DNA) and the subsequent introduction of that genetic material into a plant's genome. Such technology has the capacity to deliver crops or plants having various improved economic, agronomic or horticultural traits.
[0005] The introduction of the foreign genetic material into a plant's genome is typically performed through one of two ways, although other ways are known to those skilled in the art. The first is biolistic particle bombardment, whereby the foreign DNA, or "transgene," is coated onto a metal particle, which is then shot into plant tissue. Some of that foreign genetic material is taken up by the plant cells, which are thereby "transformed." The second method is by Agrobacterium-mediated transformation, which involves exposing plant cells and tissues to a suspension of Agrobacterium cells that contain certain DNA plasmids. In both methods, the foreign DNA typically encodes for a selectable marker that permits plant cells to grow in the presence of a selection agent, for example an antibiotic or herbicide. These cells can be further manipulated to regenerate into whole fertile transgenic plants.
[0006] Glutamine synthetase (GS) constitutes in most plants one of the essential enzymes for the development and life of plant cells. It is known that GS converts glutamate into glutamine. GS is involved in an efficient pathway in most plants for the detoxification of ammonia released by nitrate reduction, amino acid degradation or photorespiration. Therefore potent inhibitors of GS are very toxic to plant cells and can be used as broad-spectrum herbicides. A class of herbicides, which include phosphinothricin (PPT) and glufosinate, are GS inhibitors. Transgenic plants have been made tolerant to this class of herbicides through the introduction of a gene encoding a phosphinothricin acetyltransferase (PAT). Such plants are said to be herbicide tolerant. In these transgenic plants, PAT detoxifies PPT by acetylation of the free amino group of PPT. The PAT gene is derived from Streptomyces viridochromogenes and confers tolerance to GS inhibitors. (U.S. Patent Nos. 5,531,236, 5,646,024, 5,648,477, and 5,276,268).
[0007] In addition to the PAT gene functioning as an herbicide tolerance trait gene for GS inhibitor herbicides, it can also be used as a selectable marker in the transformation of monocotyledonous and dicotyledonous plant species. In cereal transformation, its use is more widespread than the other selectable markers. However, although the PAT gene has been used successfully as a selectable marker, the transformation frequency is quite low, such that using it as a selectable marker is very resource intensive. An improved PAT, which can confer an increase in transformation frequency, is needed to improve the utility of PAT as a selectable marker.SUMMARY OF THE INVENTION
[0008] The present invention provides an isolated nucleic acid molecule that is at least 95% identical to SEQ ID NO: 13. The present invention also provides for a nucleic acid molecule a chimeric nucleic acid molecule, and / or a recombinant nucleic acid construct or vector which comprise, consist, or essentially consist of a nucleic acid sequence that is at least 95% identical to SEQ ID NO: 113.
[0009] The present invention also provides for use of a nucleic acid molecule of the invention as described herein, wherein expression of said nucleic acid molecule in a cell confers herbicide tolerance to glutamine synthetase (GS) inhibitor herbicides.
[0010] The present invention also provides for a transgenic host cell comprising a nucleic acid molecule of the invention as described herein. The transgenic host cell described above may be a bacterial cell or a plant cell. The transgenic bacterial cell may be an Escherichia coli, Bacillus thuringiensis, Bacillus subtilis, Bacillus megaterium; Bacillus cereus, Agrobacterium ssp. or a Pseudomonas ssp. cell. The transgenic plant cell may be found within a transgenic plant, plant part, plant tissue, or plant cell culture. The transgenic plant may be a monocotyledonous or dicotyledonous plant. The transgenic plant may be selected from the group comprising maize, sorghum, wheat, sunflower, tomato, crucifers, oat, turf grass, pasture grass, flax, peppers, potato, cotton, rice, soybean, sugarcane, sugar beet, tobacco, barley, and oilseed rape.
[0011] The present invention also provides for a progeny of any generation of a transgenic plant, wherein said transgenic plant comprises a nucleic acid molecule of the invention as described herein. The present invention also provides for a transgenic seed, a cutting from a transgenic plant for the purposes of propagation, and for a transgenic propagule from said transgenic plant.
[0012] The present invention also provides for an improved method of plant transformation, comprising the steps of: providing a nucleic acid molecule of the invention as described herein; (b) introducing into a plant, tissue culture, or a plant cell the nucleic acid molecule of step (a) to produce a transformed plant, transformed tissue culture, or a transformed cell having herbicide tolerance; (c) selecting for transformants using a concentration of herbicide that permits cells that express a nucleic acid molecule of step (a) to grow, while killing or inhibiting the growth of cells that do not comprise a nucleic acid molecule of the invention. This improved method with a nucleic acid molecule of the invention results in a greater transformation frequency compared to a similar method not using a nucleic acid molecule of the invention.
[0013] The present invention also provides for an improved method of producing an herbicide tolerant plant, comprising the steps of (a) providing a nucleic acid molecule of the invention as described herein; (b) introducing into a plant, tissue culture, or a plant cell the nucleic acid molecule of step (a) to produce a transformed plant, transformed tissue culture, or a transformed cell having herbicide tolerance; (c) selecting for the transformed plant, transformed tissue culture, or a transformed cell having herbicide tolerance using an appropriate amount of a GS inhibitor herbicide; and (d) growing said transformed plant or regenerating a transformed plant from the transformed tissue culture or transformed plant cell, so a herbicide tolerant plant is produced. This improved method with a nucleic acid molecule of the invention results in a greater transformation frequency compared to a similar method not using a nucleic acid molecule of the invention. In a preferred embodiment, the transgenic plant expresses a PAT gene in an amount that allows for control weeds.
[0014] The present invention also provides for a transgenic herbicide tolerant plant cell produced by the methods of the invention, and further embodiments include a transgenic herbicide tolerant plant comprising a plant cell produced by the methods of the invention. The transgenic herbicide tolerant plant cell is tolerant to herbicides comprising a GS inhibitor as its active ingredient, including phosphinothricin or a compound with a phosphinothricin moiety. The present invention also provides for a method of producing transgenic seed from the transgenic plant described above, where the plant is cultured or grown under appropriate conditions to produce progeny seed which is transgenic.
[0015] The present invention also provides an improved process for producing a transgenic plant that is tolerant to the herbicidal activity of a glutamine synthetase inhibitor, including phosphinothricin or a compound with a phosphinothricin moiety, which comprises the steps of: (a) producing a transgenic plant cell comprising a nucleic acid molecule of the invention; and (b) regenerating a transgenic plant from said cell, wherein more transgenic plant cells are recovered compared to a method that does not use a nucleic acid molecule of the invention, for example cPAT-09 or another PAT variant.
[0016] The present disclosure also provides for a process for protecting a group of cultivated transgenic herbicide tolerant plants in a field by destroying weeds wherein said plants comprise a nucleic acid molecule of the invention, and wherein said weeds are destroyed by application of an herbicide comprising a glutamine synthetase inhibitor as an active ingredient. The application may be, for example, at least 595 g / acre of ammonium glufosinate, at least 1190 g / acre, at least 1,785 g / acre, at least 2380 g / acre, at least 2,975 g / acre, at least 3,570 g / acre, at least 4,165 g / acre, or at least 4,760 g / acre of ammonium glufosinate.
[0017] The present disclosure also provides for a method of producing progeny of any generation of an herbicide tolerant fertile transgenic plant, comprising the steps of: (a) obtaining a herbicide tolerant fertile transgenic plant comprising a nucleic acid molecule of the invention as described herein; (b) collecting transgenic seed from said transgenic plant; (c) planting the collected transgenic seed; and (d) growing the progeny transgenic plants from said seed, wherein said progeny has enhanced herbicide tolerance relative to a non-transformed plant.
[0018] The present invention also provides for a method of selecting or distinguishing an individual plant or a group of crop plants comprising a nucleic acid molecule of the invention from a population of plants of the same species not containing the nucleic acid molecule, said method comprising applying a composition comprising a GS inhibitor as an active ingredient to the population of plants.
[0019] The present disclosure also provides a method of detecting a nucleic acid molecule of the invention in a sample comprising nucleic acids, said method comprising the steps of: (a) obtaining a sample comprising nucleic acids; (b) contacting the sample with a probe comprising the nucleic acid sequence of, for example, any one of SEQ ID NO: 22-32 or complements thereof, that hybridized under high stringency conditions to a nucleic acid molecule of the invention and does not hybridize under high stringency conditions with DNA of a control corn plant; (c) subjecting the sample and the probe to high stringency hybridization conditions; and (d) detecting hybridization of the probe to the DNA.
[0020] The present disclosure also provides a method of detecting the presence of a nucleic acid molecule of the invention in a sample comprising nucleic acids, the method comprising: (a) obtaining a sample comprising nucleic acids; (b) combining the sample with a pair of polynucleotide primers, for example SEQ ID NO: 24 and 25, SEQ ID NO: 27 and 28, or SEQ ID NO: 30 and 31, or complements thereof, which will amplify a product from a template which contains a nucleic acid molecule of the invention and will not amplify a product when the template does not contain a nucleic acid molecule of the invention; (c) performing a nucleic acid amplification reaction which results in an amplicon; and (d) detecting the amplicon.
[0021] The present disclosure also provides a method of detecting the presence of a nucleic acid molecule of the invention in a sample comprising nucleic acids, the method comprising: (a) obtaining a sample comprising nucleic acids; (b) combining the sample with a pair of polynucleotide primers, for example SEQ ID NO: 24 and 25, SEQ ID NO: 27 and 28, or SEQ ID NO: 30 and 31, or complements thereof, which will amplify a product from a template which contains a nucleic acid molecule of the invention and will not amplify a product when the template does not contain a nucleic acid molecule of the invention, and also combining the sample with a polynucleotide probe comprising, for example, a nucleotide sequence of SEQ ID NO: 26, SEQ ID NO: 29, SEQ ID NO: 32, or a complement thereof, which will detect the amplicon; (c) performing a nucleic acid amplification reaction which results in an amplicon which can be detected by the probe; and (d) detecting the probe.BRIEF DESCRIPTION OF THE SEQUENCE LISTING
[0022] SEQ ID NO: 1 is a nucleic acid sequence of PAT variant 2. SEQ ID NO: 2-5 are nucleic acid sequences of expression cassettes comprising PAT variant 2 (SEQ ID NO: 1). SEQ ID NO: 6 is a nucleic acid sequence of PAT variant 1 SEQ ID NO: 7-10 are nucleic acid sequences of expression cassettes comprising PAT variant 1 (SEQ ID NO: 6). SEQ ID NO: 11 is a nucleic acid sequence of PAT variant 3. SEQ ID NO: 12-15 are nucleic acid sequences of expression cassettes comprising PAT variant 3 (SEQ ID NO: 11). SEQ ID NO: 16 is a nucleic acid sequence of PAT variant 4. SEQ ID NO: 17-20 are nucleic acid sequences of expression cassettes comprising PAT variant 4 (SEQ ID NO: 16). SEQ ID NO: 21 is a nucleic acid sequence of PAT variant cPAT-09. SEQ ID NO: 22-23 are nucleic acid sequences of expression cassettes comprising PAT variant cPAT-09 (SEQ ID NO: 21) SEQ ID NO: 24-26 are primers and probe useful for the detection and identification of PAT variant 1 (SEQ ID NO: 6). SEQ ID NO: 27-29 are primers and probe useful for the detection and identification of PAT variant 2 (SEQ ID NO: 1). SEQ ID NO: 30-32 are primers and probe useful for the detection and identification of PAT variant 3 (SEQ ID NO: 11) or PAT variant 4 (SEQ ID NO: 16). SEQ ID NO: 33-35 are primers and prove useful for the detection and identification of PAT variant cPAT-09 (SEQ ID NO: 21). DETAILED DESCRIPTION OF THE INVENTION
[0023] The present invention provides compositions and methods for improving plant transformation frequency and for identifying, selecting, and / or producing plants and / or plant parts having herbicide tolerance to compositions comprising a glutamine synthetase (GS) inhibitor.
[0024] The methods of the present invention improve transformation frequency, which can also be referred to as transformation efficiency. "Transformation frequency" (TF) is calculated as the percentage of transgenic events for a given construct with a given number of immature embryos used for the transformation. For example, if 100 immature maize embryos were initially transformed, and it was eventually determined that 5 of the events contained full or part of the T-DNA, the transformation frequency would be 5%. By improved transformation frequency it is intended that the number of transformed plants recovered by a transformation attempt is increased by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 125%, at least 150%, at least 175%, at least 200%, at least 300%, at least 400%, at least 500%, at least 600%, at least 700%, at least 800%, at least 900%, or at least 1000% or greater compared to a method that uses a nucleic acid molecule and / or PAT gene variant, for example cPAT-09, which is not a nucleic acid molecule of the invention.
[0025] Although the following terms are believed to be well understood by one of ordinary skill in the art, the following definitions are set forth to facilitate understanding of the presently disclosed subject matter.
[0026] All technical and scientific terms used herein, unless otherwise defined below, are intended to have the same meaning as commonly understood by one of ordinary skill in the art. References to techniques employed herein are intended to refer to the techniques as commonly understood in the art, including variations on those techniques or substitutions of equivalent techniques that would be apparent to one of skill in the art.
[0027] As used herein, the terms "a" or "an" or "the" may refer to one or more than one, unless the context clearly and unequivocally indicates otherwise. For example, "an" endogenous nucleic acid can mean one endogenous nucleic acid or a plurality of endogenous nucleic acids.
[0028] As used herein, the term "and / or" refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative ("or").
[0029] As used herein, the term "about," when used in reference to a measurable value such as an amount of mass, dose, time, temperature, and the like, refers to a variation of ± 0.1%, 0.25%, 0.5%, 0.75%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15% or even 20% of the specified value as well as the specified value. Thus, if a given composition is described as comprising "about 50% X," it is to be understood that, in some embodiments, the composition comprises 50% X whilst in other embodiments it may comprise anywhere from 40% to 60% X (i.e., 50% ± 10%).
[0030] It will be understood that, although the terms "first," "second," etc. may be used herein to describe various elements, these elements should not be limited by these terms. These terms are only used to distinguish one element from another. Thus, a "first" element (e.g., a first promoter sequence) as described herein could also be termed a "second" element (e.g., a second promoter sequence) without departing from the teachings of the present invention.
[0031] The term "plant" refers to any plant, particularly to agronomically useful plants (e.g. seed plants), and "plant cell" is a structural and physiological unit of the plant, which comprises a cell wall but may also refer to a protoplast. The plant cell may be in form of an isolated single cell or a cultured cell, or as a part of higher organized units such as for example, a plant tissue, or a plant organ differentiated into a structure that is present at any stage of a plant's development. The promoters and compositions described herein may be utilized in any plant. A plant may be a monocotyledonous or dicotyledonous plant species. Examples of plants that may be utilized in contained embodiments herein include, but are not limited to, maize (corn), wheat, rice, barley, soybean, cotton, sorghum, beans in general, rape / canola, alfalfa, flax, sunflower, safflower, millet, rye, sugarcane, sugar beet, cocoa, tea, tropical sugar beet, Brassica spp., cotton, coffee, sweet potato, flax, peanut, clover; vegetables such as lettuce, tomato, cucurbits, cassava, potato, carrot, radish, pea, lentils, cabbage, cauliflower, broccoli, Brussel sprouts, peppers, and pineapple; tree fruits such as citrus, apples, pears, peaches, apricots, walnuts, avocado, banana, and coconut; and flowers such as orchids, carnations and roses. Other plants useful in the practice of the invention include perennial grasses, such as switchgrass, prairie grasses, Indiangrass, Big bluestem grass, Miscanthus and the like.
[0032] As used herein, "plant material," "plant part" or "plant tissue" means plant cells, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant clumps, and plant cells that are intact in plants or parts of plants such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruit, kernels, ears, cobs, husks, stalks, roots, root tips, anthers, tubers, rhizomes and the like.
[0033] As used herein, "propagule" refers to any material that is used for propagating a plant, preferably a transgenic plant, more preferably a transgenic plant comprising a nucleic acid molecule of the invention. A propagule may be a seed, cutting, or plurality of cells from a transgenic plant, which can be used to produce a crop of transgenic plants.
[0034] As used herein "plant sample" or "biological sample" refers to either intact or non-intact (e.g. milled seed or plant tissue, chopped plant tissue, lyophilized tissue) plant tissue. It may also be an extract comprising intact or non-intact seed or plant tissue. The biological sample or extract may be selected from the group consisting of corn flour, corn meal, corn syrup, corn oil, corn starch, and cereals manufactured in whole or in part to contain corn by-products.
[0035] The term "RNA" includes any molecule comprising at least one ribonucleotide residue, including those possessing one or more natural ribonucleotides of the following bases: adenine, cytosine, guanine, and uracil; abbreviated A, C, G, and U, respectively, modified ribonucleotides, and non-ribonucleotides. "Ribonucleotide" means a nucleotide with a hydroxyl group at the 2' position of the D-ribofuranose moiety.
[0036] As used herein, the terms and phrases "RNA," "RNA molecule(s)," and "RNA sequence(s)," are used interchangeably to refer to single-stranded RNA, double-stranded RNA, isolated RNA, partially purified RNA, essentially pure RNA, synthetic RNA, recombinant RNA, intracellular RNA, and also includes RNA that differs from naturally occurring RNA by the addition, deletion, substitution, and / or alteration of one or more nucleotides of the naturally occurring RNA.
[0037] As used herein, "heterologous" refers to a nucleotide sequence that either originates from another species or is from the same species or organism but is modified from either its original form or the form primarily expressed in the cell. Thus, a nucleotide sequence derived from an organism or species different from that of the cell into which the nucleotide sequence is introduced, is heterologous with respect to that cell and the cell's descendants. In addition, a heterologous nucleotide sequence includes a nucleotide sequence derived from and inserted into the same natural, original cell type, but which is present in a non-natural state, e.g. present in a different copy number, different location, and / or under the control of different regulatory sequences, than that found naturally in nature.
[0038] As used herein, the term "nucleic acid," "nucleic acid molecule," and / or "nucleotide sequence" refers to a heteropolymer of nucleotides or the sequence of these nucleotides from the 5' to 3' end of a nucleic acid molecule and includes DNA or RNA molecules, including cDNA, a DNA fragment, genomic DNA, synthetic (e.g., chemically synthesized) DNA, plasmid DNA, mRNA, and anti-sense RNA, any of which can be single stranded or double stranded. The terms "nucleotide sequence" "nucleic acid," "nucleic acid molecule," "oligonucleotide" and "polynucleotide" are also used interchangeably herein to refer to a heteropolymer of nucleotides. Nucleic acid sequences provided herein are presented herein in the 5' to 3' direction, from left to right and are represented using the standard code for representing the nucleotide characters as set forth in the sequence rules for the U.S. Patent and Trademark Office, 37 CFR §1.821 - 1.825, and the World Intellectual Property Organization (WIPO) Standard ST.25.
[0039] As used herein, the term "gene" is used broadly to refer to any segment of nucleic acid associated with a biological function. Thus, genes include coding sequences and / or the regulatory sequences required for their expression. For example, "gene" refers to a nucleic acid fragment that expresses mRNA or functional RNA, or encodes a specific protein, and which includes regulatory sequences. Genes also include nonexpressed DNA segments that, for example, form recognition sequences for other proteins. Genes can be obtained from a variety of sources, including cloning from a source of interest or synthesizing from known or predicted sequence information, and may include sequences designed to have desired parameters.
[0040] "Coding sequence" refers to a DNA or RNA sequence that codes for a specific amino acid sequence and excludes the non-coding sequences. It may constitute an "uninterrupted coding sequence", i.e., lacking an intron, such as in a cDNA or it may include one or more introns bounded by appropriate splice junctions. An "intron" is a sequence of RNA which is contained in the primary transcript but which is removed through cleavage and re-ligation, or splicing, of the RNA within the cell to create the mature mRNA that can be translated into a protein.
[0041] "Operably linked" refers to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is affected by the other. For example, a promoter is operably linked to a coding sequence or functional RNA when it is capable of affecting the expression of that coding sequence or functional RNA (i.e., that the coding sequence or functional RNA is under the transcriptional control of the promoter). Coding sequences in sense or antisense orientation can be operably-linked to regulatory sequences.
[0042] The terms "complementary" or "complementarity," or "complement" as used herein, refer to the natural binding of polynucleotides under permissive salt and temperature conditions by base-pairing. For example, the sequence "A-G-T" binds to the complementary sequence "T-C-A." The term "complementarity" includes within its meaning two single-stranded molecules that are "partial," in which only some of the nucleotides bind, or where two single-stranded molecules that are complete when total complementarity exists between the single stranded molecules. The degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands.
[0043] The term "nucleic acid fragment," "DNA fragment" or a fragment of a gene will be understood to mean a nucleotide sequence of reduced length relative to a reference nucleic acid or nucleotide sequence and comprising, consisting essentially of and / or consisting of a nucleotide sequence of contiguous nucleotides identical or almost identical (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 98%, 99% identical) to the reference nucleic acid or nucleotide sequence. Such a nucleic acid fragment according to the invention may be, where appropriate, included in a larger polynucleotide of which it is a constituent. In some embodiments, such fragments can comprise, consist essentially of and / or consist of, oligonucleotides having a length of at least about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 750, or 1000 consecutive nucleotides of a nucleic acid or nucleotide sequence according to the invention.
[0044] An "isolated" nucleic acid of the present invention is generally free of nucleic acid sequences that flank the nucleic acid of interest in the genomic DNA of the organism from which the nucleic acid was derived (such as coding sequences present at the 5' or 3' ends). However, the nucleic acid of this invention can include some additional bases or moieties that do not deleteriously affect the basic structural and / or functional characteristics of the nucleic acid. "Isolated" does not mean that the preparation is technically pure (homogeneous). Thus, an "isolated nucleic acid" is present in a form or setting that is different from that in which it is found in nature and is not immediately contiguous with nucleotide sequences with which it is immediately contiguous (one on the 5' end and one on the 3' end) in the naturally occurring genome of the organism from which it is derived. Accordingly, in one embodiment, an isolated nucleic acid includes some or all of the 5' non-coding (e.g., promoter) sequences that are immediately contiguous to a coding sequence. The term therefore includes, for example, a recombinant nucleic acid that is incorporated into a vector, into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (e.g., a cDNA or a genomic DNA fragment produced by PCR or restriction endonuclease treatment), independent of other sequences. Thus, a nucleic acid found in nature that is removed from its native environment and transformed into a plant is still considered "isolated" even when incorporated into the genome of the resulting transgenic plant. It also includes a recombinant nucleic acid that is part of a hybrid nucleic acid encoding an additional polypeptide or peptide sequence.
[0045] The term "isolated" can further refer to a nucleic acid, nucleotide sequence, polypeptide, peptide or fragment that is substantially free of cellular material, viral material, and / or culture medium (e.g., when produced by recombinant DNA techniques), or chemical precursors or other chemicals (e.g., when chemically synthesized). Moreover, an "isolated fragment" is a fragment of a nucleic acid, nucleotide sequence or polypeptide that is not naturally occurring as a fragment and would not be found as such in the natural state. "Isolated" does not mean that the preparation is technically pure (homogeneous), but it is sufficiently pure to provide the polypeptide or nucleic acid in a form in which it can be used for the intended purpose.
[0046] The terms "polypeptide," "protein," and "peptide" refer to a chain of covalently linked amino acids. In general, the term "peptide" can refer to shorter chains of amino acids (e.g., 2-50 amino acids); however, all three terms overlap with respect to the length of the amino acid chain. As used herein, the terms "protein" and "polypeptide" are used interchangeably and encompass peptides, unless indicated otherwise. Polypeptides, proteins, and peptides may comprise naturally occurring amino acids, nonnaturally occurring amino acids, or a combination of both. The polypeptides, proteins, and peptides may be isolated from sources (e.g., cells or tissues) in which they naturally occur, produced recombinantly in cells in vivo or in vitro or in a test tube in vitro, or synthesized chemically. Such techniques are known to those skilled in the art. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual 2nd Ed. (Cold Spring Harbor, NY, 1989); Ausubel et al. Current Protocols in Molecular Biology (Green Publishing Associates, Inc. and John Wiley & Sons, Inc., NY, 1987).
[0047] A "transgene" refers to a gene, polynucleotide or nucleic acid introduced into the genome of an organism by genetic manipulation in order to alter its genotype. A transgene may be introduced by transformation, recombination, or breeding. Transgenes may include, for example, genes, polynucleotides or nucleic acids that are either heterologous or homologous to the particular plant to be transformed. Additionally, transgenes may comprise native genes inserted into a non-native organism, or chimeric genes, polynucleotides or nucleic acids. A transgene can be a coding sequence, a non-coding sequence, a cDNA, a gene or fragment or portion thereof, a genomic sequence, a regulatory element and the like. A "transgenic" organism, such as a transgenic plant, transgenic microorganism, or transgenic animal, is an organism into which a transgene has been delivered or introduced and the transgene can be expressed in the transgenic organism to produce a product, the presence of which can impart an effect and / or a phenotype in the organism. "Transgenic" or "transgenic host" are used herein to include any cell, cell line, callus, tissue, plant part or plant, the genotype of which has been altered by the presence of a heterologous nucleic acid sequence, including those transgenics initially so altered as well as those created by sexual crosses or asexual propagation from the initial transgenic host cell. The term "transgenic" as used herein does not encompass the alteration of the genome (chromosomal or extra-chromosomal) by conventional plant breeding methods or by naturally occurring events such as random cross-fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition or spontaneous mutation.
[0048] The term "transgenic plant" includes reference to a plant, which comprises within its genome a heterologous nucleic acid sequence. Generally, the heterologous nucleic acid sequence is stably integrated within the genome such that the nucleic acid sequence is passed on to successive generations. The heterologous nucleic acid sequence may be integrated into the genome alone or as part of a recombinant expression cassette.
[0049] Different nucleic acids or polypeptides having homology are referred to herein as "homologues." The term homologue includes homologous sequences from the same and other species and orthologous sequences from the same and other species. "Homology" refers to the level of similarity between two or more nucleic acid and / or amino acid sequences in terms of percent of positional identity (i.e., sequence similarity or identity). Homology also refers to the concept of similar functional properties among different nucleic acids or proteins.
[0050] "Expression" refers to the transcription and stable accumulation of mRNA. Expression may also refer to the production of protein.
[0051] The terms "transcriptional cassette," "expression cassette," or "cassette" as used herein means a DNA sequence capable of directing expression of a particular nucleotide sequence in an appropriate host cell, comprising a promoter operably linked to the nucleotide sequence which is operably linked to termination signals. The expression of the nucleotide sequence in the expression cassette may be under the control of a constitutive promoter or of an inducible promoter that initiates transcription only when the host cell is exposed to some particular external stimulus. Additionally, the promoter can also be specific to a particular tissue or organ or stage of development. The expression cassette also typically comprises sequences required for proper translation of the nucleotide sequence. The coding region usually codes for a protein of interest but may also code for a functional RNA of interest, for example antisense RNA or a nontranslated RNA, in the sense or antisense direction. The transcriptional cassette comprising the nucleotide sequence of interest may be chimeric. "Chimeric" is used to indicate that a DNA sequence, such as a vector or a gene, is comprised of two or more DNA sequences of distinct origin that are fused together by recombinant DNA techniques resulting in a DNA sequence, which does not occur naturally. A transcriptional cassette, expression cassette or cassette can incorporate numerous nucleotide sequences, promoters, regulatory elements, nucleotide sequences of interest, etc.
[0052] As used herein, "vector" includes reference to a nucleic acid used in transfection of a host cell and into which can be inserted a polynucleotide. Vectors may also be referred to as "constructs" or "vector constructs". Vectors are often replicons. Expression vectors permit transcription of a nucleic acid inserted therein. "Vector" is defined to include, inter alia, any plasmid, cosmid, phage or Agrobacterium binary vector in double or single stranded linear or circular form which may or may not be self transmissible or mobilizable, and which can transform prokaryotic or eukaryotic host either by integration into the cellular genome or exist extrachromosomally (e.g. autonomous replicating plasmid with an origin of replication). Specifically included are shuttle vectors by which is meant a DNA vehicle capable, naturally or by design, of replication in two different host organisms, which may be selected from actinomycetes and related species, bacteria and eukaryotic (e.g. higher plant, mammalian, yeast or fungal cells).
[0053] "Trait gene" refers to transgenes of agronomic interest which provide beneficial agronomic traits to crop plants. Trait genes encode for "desired traits". Trait genes include but are not limited to genetic elements comprising or that relate to herbicide resistance, increased yield, insect control, fungal disease resistance, virus resistance, nematode resistance, bacterial disease resistance, starch production, modified oils production, high oil production, modified fatty acid content, high protein production, fruit ripening, enhanced animal and human nutrition, biopolymers, environmental stress resistance, pharmaceutical peptides, improved processing traits, improved digestibility, industrial enzyme production, improved flavor, nitrogen fixation, hybrid seed production, and biofuel production.
[0054] "Intron" refers to an intervening section of DNA which occurs almost exclusively within a eukaryotic gene, but which is not translated to amino acid sequences in the gene product. The introns are removed from the pre-mature mRNA through a process called splicing, which leaves the exons untouched, to form an mRNA. Various intron sequences have been shown to enhance expression, particularly in monocotyledonous cells. For example, the introns of the maize Adhl gene have been found to significantly enhance the expression of the wild-type gene under its cognate promoter when introduced into maize cells. Intron 1 of Adh1 was found to be particularly effective and enhanced expression in fusion constructs with the chloramphenicol acetyltransferase gene (Callis et al. 1987, Genes Develop. 1: 1183-1200). In the same experimental system, the intron from the maize bronze 1 gene had a similar effect in enhancing expression. Intron sequences have been routinely incorporated into plant transformation vectors, typically within the non-translated leader.
[0055] "Linker" refers to a polynucleotide that comprises the connecting sequence between two other polynucleotides. The linker may be at least 1, 3, 5, 8, 10, 15, 20, 30, 50, 100, 200, 500, 1000, or 2000 polynucleotides in length. A linker may be synthetic, such that its sequence is not found in nature, or it may naturally occur, such as an intron.
[0056] "Exon" refers to a section of DNA which carries the coding sequence for a protein or part of it. Exons are separated by intervening, non-coding sequences (introns).
[0057] "Transit peptides" generally refer to peptide molecules that when linked to a protein of interest directs the protein to a particular tissue, cell, subcellular location, or cell organelle. Examples include, but are not limited to, chloroplast transit peptides, nuclear targeting signals, and vacuolar signals. To ensure localization to the plastids it is conceivable to use, but not limited to, the signal peptides of the ribulose bisphosphate carboxylase small subunit (Wolter et al. 1988, PNAS 85: 846-850; Nawrath et al., 1994, PNAS 91: 12760-12764), of the NADP malate dehydrogenase (Galiardo et al. 1995, Planta 197: 324-332), of the glutathione reductase (Creissen et al. 1995, Plant J 8: 167-175) or of the R1 protein Lorberth et al. (1998, Nature Biotechnology 16: 473-477).
[0058] The term "transformation" as used herein refers to the transfer of a nucleic acid fragment into the genome of a host cell, resulting in genetically stable inheritance. In some particular embodiments, the introduction into a plant, plant part and / or plant cell is via bacterial-mediated transformation, particle bombardment transformation, calcium-phosphate-mediated transformation, cyclodextrin-mediated transformation, electroporation, liposome-mediated transformation, nanoparticle-mediated transformation, polymer-mediated transformation, virus-mediated nucleic acid delivery, whisker-mediated nucleic acid delivery, microinjection, sonication, infiltration, polyethylene glycol-mediated transformation, protoplast transformation, or any other electrical, chemical, physical and / or biological mechanism that results in the introduction of nucleic acid into the plant, plant part and / or cell thereof, or a combination thereof.
[0059] Procedures for transforming plants are well known and routine in the art and are described throughout the literature. Non-limiting examples of methods for transformation of plants include transformation via bacterial-mediated nucleic acid delivery (e.g., via bacteria from the genus Agrobacterium), viral-mediated nucleic acid delivery, silicon carbide or nucleic acid whisker-mediated nucleic acid delivery, liposome mediated nucleic acid delivery, microinjection, microparticle bombardment, calcium-phosphate-mediated transformation, cyclodextrin-mediated transformation, electroporation, nanoparticle-mediated transformation,, sonication, infiltration, PEG-mediated nucleic acid uptake, as well as any other electrical, chemical, physical (mechanical) and / or biological mechanism that results in the introduction of nucleic acid into the plant cell, including any combination thereof. General guides to various plant transformation methods known in the art include Miki et al. ("Procedures for Introducing Foreign DNA into Plants" in Methods in Plant Molecular Biology and Biotechnology, Glick, B. R. and Thompson, J. E., Eds. (CRC Press, Inc., Boca Raton, 1993), pages 67-88) and Rakowoczy-Trojanowska (2002, Cell Mol Biol Lett 7:849-858 (2002)).
[0060] Thus, in some particular embodiments, the introducing into a plant, plant part and / or plant cell is via bacterial-mediated transformation, particle bombardment transformation, calcium-phosphate-mediated transformation, cyclodextrin-mediated transformation, electroporation, liposome-mediated transformation, nanoparticle-mediated transformation, polymer-mediated transformation, virus-mediated nucleic acid delivery, whisker-mediated nucleic acid delivery, microinjection, sonication, infiltration, polyethyleneglycol-mediated transformation, any other electrical, chemical, physical and / or biological mechanism that results in the introduction of nucleic acid into the plant, plant part and / or cell thereof, or a combination thereof.
[0061] Agrobacterium-mediated transformation is a commonly used method for transforming plants because of its high efficiency of transformation and because of its broad utility with many different species. Agrobacterium-mediated transformation typically involves transfer of the binary vector carrying the foreign DNA of interest to an appropriate Agrobacterium strain that may depend on the complement of vir genes carried by the host Agrobacterium strain either on a co-resident Ti plasmid or chromosomally (Uknes et al 1993, Plant Cell 5:159-169). The transfer of the recombinant binary vector to Agrobacterium can be accomplished by a tri-parental mating procedure using Escherichia coli carrying the recombinant binary vector, a helper E. coli strain that carries a plasmid that is able to mobilize the recombinant binary vector to the target Agrobacterium strain. Alternatively, the recombinant binary vector can be transferred to Agrobacterium by nucleic acid transformation (Höfgen and Willmitzer 1988, Nucleic Acids Res 16:9877).
[0062] Transformation of a plant by recombinant Agrobacterium usually involves co-cultivation of the Agrobacterium with explants from the plant and follows methods well known in the art. Transformed tissue is typically regenerated on selection medium carrying an antibiotic or herbicide resistance marker between the binary plasmid T-DNA borders.
[0063] Another method for transforming plants, plant parts and plant cells involves propelling inert or biologically active particles at plant tissues and cells. See, e.g., US Patent Nos. 4,945,050; 5,036,006 and 5,100,792. Generally, this method involves propelling inert or biologically active particles at the plant cells under conditions effective to penetrate the outer surface of the cell and afford incorporation within the interior thereof. When inert particles are utilized, the vector can be introduced into the cell by coating the particles with the vector containing the nucleic acid of interest. Alternatively, a cell or cells can be surrounded by the vector so that the vector is carried into the cell by the wake of the particle. Biologically active particles (e.g., dried yeast cells, dried bacterium or a bacteriophage, each containing one or more nucleic acids sought to be introduced) also can be propelled into plant tissue.
[0064] Thus, in particular embodiments of the present invention, a plant cell can be transformed by any method known in the art and as described herein and intact plants can be regenerated from these transformed cells using any of a variety of known techniques. Plant regeneration from plant cells, plant tissue culture and / or cultured protoplasts is described, for example, in Evans et al. (Handbook of Plant Cell Cultures, Vol. 1, MacMilan Publishing Co. New York (1983)); and Vasil I. R. (ed.) (Cell Culture and Somatic Cell Genetics of Plants, Acad. Press, Orlando, Vol. I (1984), and Vol. II (1986)). Methods of selecting for transformed transgenic plants, plant cells and / or plant tissue culture are routine in the art and can be employed in the methods of the invention provided herein.
[0065] By "stably introducing" or "stably introduced" in the context of a polynucleotide introduced into a cell is intended the introduced polynucleotide is stably incorporated into the genome of the cell, and thus the cell is stably transformed with the polynucleotide.
[0066] "Stable transformation" or "stably transformed" as used herein means that a nucleic acid is introduced into a cell and integrates into the genome of the cell. As such, the integrated nucleic acid is capable of being inherited by the progeny thereof, more particularly, by the progeny of multiple successive generations. "Genome" as used herein also includes the nuclear and the plastid genome, and therefore includes integration of the nucleic acid into, for example, the chloroplast genome. Stable transformation as used herein can also refer to a transgene that is maintained extrachromasomally, for example, as a minichromosome.
[0067] Stable transformation of a cell can be detected by, for example, a Southern blot hybridization assay of genomic DNA of the cell with nucleic acid sequences which specifically hybridize with a nucleotide sequence of a transgene introduced into an organism (e.g., a plant). Stable transformation of a cell can be detected by, for example, a Northern blot hybridization assay of RNA of the cell with nucleic acid sequences which specifically hybridize with a nucleotide sequence of a transgene introduced into a plant or other organism. Stable transformation of a cell can also be detected by, e.g., a polymerase chain reaction (PCR) or other amplification reactions as are well known in the art, employing specific primer sequences that hybridize with target sequence(s) of a transgene, resulting in amplification of the transgene sequence, which can be detected according to standard methods Transformation can also be detected by direct sequencing and / or hybridization protocols well known in the art.
[0068] The "transformation and regeneration process" refers to the process of stably introducing a transgene into a plant cell and regenerating a plant from the transgenic plant cell. As used herein, transformation and regeneration includes the selection process, whereby a transgene comprises a selectable marker and the transformed cell has incorporated and expressed the transgene, such that the transformed cell will survive and developmentally flourish in the presence of the selection agent. "Regeneration" refers to growing a whole plant from a plant cell, a group of plant cells, or a plant piece such as from a protoplast, callus, or tissue part.
[0069] A "selectable marker" or "selectable marker gene" refers to a gene whose expression in a plant cell gives the cell a selective advantage. "Positive selection" refers to a transformed cell acquiring the ability to metabolize a substrate that it previously could not use or could not use efficiently, typically by being transformed with and expressing a positive selectable marker gene. This transformed cell thereby grows out of the mass of nontransformed tissue. Positive selection can be of many types from inactive forms of plant growth regulators that are then converted to active forms by the transferred enzyme to alternative carbohydrate sources that are not utilized efficiently by the nontransformed cells, for example mannose, which then become available upon transformation with an enzyme, for example phosphomannose isomerase, that allows them to be metabolized. Nontransformed cells either grow slowly in comparison to transformed cells or not at all. Other types of selection may be due to the cells transformed with the selectable marker gene gaining the ability to grow in presence of a negative selection agent, such as an antibiotic or an herbicide, compared to the ability to grow of non-transformed cells. A selective advantage possessed by a transformed cell may also be due to the loss of a previously possessed gene in what is called "negative selection". In this, a compound is added that is toxic only to cells that did not lose a specific gene (a negative selectable marker gene) present in the parent cell (typically a transgene).
[0070] Examples of selectable markers include, but are not limited to, genes that provide resistance or tolerance to antibiotics such as kanamycin (Dekeyser et al. 1989, Plant Phys 90: 217-23), spectinomycin (Svab and Maliga 1993, Plant Mol Biol 14: 197-205), streptomycin (Maliga et al. 1988, Mol Gen Genet 214: 456-459), hygromycin B (Waldron et al. 1985, Plant Mol Biol 5: 103-108), bleomycin (Hille et al. 1986, Plant Mol Biol 7: 171-176), sulphonamides (Guerineau et al. 1990, Plant Mol Biol 15: 127-136), streptothricin (Jelenska et al. 2000, Plant Cell Rep 19: 298-303) , or chloramphenicol (De Block et al. 1984, EMBO J 3: 1681-1689). Other selectable markers include genes that provide resistance or tolerance to herbicides, such as the S4 and / or Hra mutations of acetolactate synthase (ALS) that confer resistance to herbicides including sulfonylureas, imidazolinones, triazolopyrimidines, and pyrimidinyl thiobenzoates; 5-enol-pyrovyl-shikimate-3-phosphate-synthase (EPSPS) genes, including but not limited to those described in U.S. Patent. Nos. 4,940,935,5,188,642, 5,633,435, 6,566,587, 7,674,598 (as well as all related applications) and the glyphosate N-acetyltransferase (GAT) which confers resistance to glyphosate (Castle et al. 2004, Science 304:1151-1154, and U.S. Patent Application Publication Nos. 20070004912, 20050246798, and 20050060767); BAR which confers resistance to glufosinate (see e.g., U.S. Patent Nos. 5,561,236); aryloxy alkanoate dioxygenase or AAD-1, AAD-12, or AAD-13 which confer resistance to 2,4-D; genes such as Pseudomonas HPPD which confer HPPD resistance; Sprotophorphyrinogen oxidase (PPO) mutants and variants, which confer resistance to peroxidizing herbicides including fomesafen, acifluorfen-sodium, oxyfluorfen, lactofen, fluthiacet-methyl, saflufenacil, flumioxazin, flumiclorac-pentyl, carfentrazone-ethyl, sulfentrazone,); and genes conferring resistance to dicamba, such as dicamba monoxygenase (Herman et al. 2005, J Biol Chem 280: 24759-24767 and U.S. Patent No. 7,812,224 and related applications and patents). Other examples of selectable markers can be found in Sundar and Sakthivel (2008, J Plant Physiology 165: 1698-1716).
[0071] Other selection systems include using drugs, metabolite analogs, metabolic intermediates, and enzymes for positive selection or conditional positive selection of transgenic plants. Examples include, but are not limited to, a gene encoding phosphomannose isomerase (PMI) where mannose is the selection agent, or a gene encoding xylose isomerase where D-xylose is the selection agent (Haldrup et al. 1998, Plant Mol Biol 37: 287-96). Finally, other selection systems may use hormone-free medium as the selection agent. One non-limiting example the maize homeobox gene kn1, whose ectopic expression results in a 3-fold increase in transformation efficiency (Luo et al., 2006, Plant Cell Rep 25: 403-409). Examples of various selectable markers and genes encoding them are disclosed in Miki and McHugh (J Biotechnol, 2004, 107: 193-232).
[0072] The term "transgenic plant" includes reference to a plant, which comprises within its genome a heterologous nucleic acid sequence. Generally, the heterologous nucleic acid sequence is stably integrated within the genome such that the nucleic acid sequence is passed on to successive generations. The heterologous nucleic acid sequence may be integrated into the genome alone or as part of a recombinant expression cassette. "Transgenic" is used herein to include any cell, cell line, callus, tissue, plant part or plant, the genotype of which has been altered by the presence of a heterologous nucleic acid sequence, including those transgenics initially so altered as well as those created by sexual crosses or asexual propagation from the initial transgenic. The term "transgenic" as used herein does not encompass the alteration of the genome (chromosomal or extra-chromosomal) by conventional plant breeding methods or by naturally occurring events such as random cross-fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition or spontaneous mutation.
[0073] The terms "event," "transgenic event," or "transgenic plant event" refers to a transgenic plant produced by transformation and regeneration of a single plant cell comprising heterologous DNA, such as an expression cassette that includes a gene of interest. The term "event" also refers to progeny produced by the event.
[0074] One skilled in the art will recognize that the transgenic genotype of the invention can be introgressed by breeding into other plant lines comprising different transgenic or non-transgenic genotypes. For example, a corn inbred comprising the transgenic genotype of the invention, for example PAT variant 3 (SEQ ID NO: 11) can be crossed with a corn inbred comprising the transgenic genotype of the lepidopteran resistant MIR162 event (U.S. Patent No. 8,232,456), thus producing corn seed that comprises both the transgenic genotype of the invention and the MIR162 transgenic genotype. It will be further recognized that other combinations can be made with the transgenic genotype of the invention and thus this example should not be viewed as limiting.
[0075] The transgenic genotype of the invention can be introgressed from the initially transformed plant, such as a corn plant, into an inbred or hybrid using art recognized breeding techniques. The goal of plant breeding is to combine in a single variety or hybrid various desirable traits. For field crops, these traits may include resistance to insects and diseases, tolerance to herbicides, tolerance to heat and drought, reducing the time to crop maturity, greater yield, and better agronomic quality. With mechanical harvesting of many crops, uniformity of plant characteristics such as germination and stand establishment, growth rate, maturity, and plant and ear height, is important.
[0076] Heterologous gene expression is used in many biotechnological applications, including transgenic plants, protein production, and metabolic engineering. One pitfall of expressing a non-native gene in a host organism is low levels of expression due at least in part to codon usage. As more and more genomes have been sequenced from a variety of organisms, it is obvious that synonymous codons are not used in equal frequencies. These codon preferences, also referred to as codon usage bias, significantly influence the expression of a heterologous gene. A highly expressed transgene whose mRNA sequence has not been optimized to the codon usage biases of its host organism, such that it frequently uses codons that are less abundant or rare in the host organism, can suffer from slow translation, including pausing or stalling of the translational machinery which can result in disassociation from the mRNA, depletion of ribosomes, depletion of pools of charged tRNA pools which can result in amino acid starvation of the host, and ultimately reduced levels of heterologous protein production. Alternatively, the use of preferred codons can increase the expression of a transgene by more than 1,000-fold (Gustafsson et al., 2004, Trends Biotechnol 22: 346-353).
[0077] Codon optimization is not simply changing all codons to a particular codon that a host is known to prefer. If all codons of a transgene are changed to a single preferred codon, high expression of the transgene in the host may still negatively affect the equilibrium of the tRNA pools maintained in the host, again leading to inefficient and possible cessation of translation of the transgene. Codon optimization of a transgene requires not only knowledge of preferred codons of a given host, but also knowledge of the relative abundances of each codon and therefore each charged tRNA pool. This method of adjusting codons to match host tRNA abundances, called codon optimization, has traditionally been used for expression of a heterologous gene. However, new strategies for optimization of heterologous expression consider global nucleotide content, local mRNA folding, codon pair bias, codon ramp, and codon correlations. Overall, it is known in the art that a desired heterologous sequence which sufficiently addresses aspects of codon bias, mRNA folding, mRNA stability, translation initiation, and translation elongation to maximize protein synthesis is difficult to predict ((Plotkin and Kudla, 2011, Nat. Rev Genet. 12(1): 32-42) and can only truly be shown empirically.
[0078] In the field of bioinformatics and computational biology, many statistical methods have been proposed to analyze codon usage bias (Hershberg and Petrov 2008). Methods such as the 'frequency of optimal codons' (Fop) (Ikemura 1981), the Relative Codon Adaptation (RCA) and the 'Codon Adaptation Index' (CAI) (Sharp and Li 1987) are used to predict gene expression levels, while methods such as the 'effective number of codons' (Nc) and Shannon entropy from information theory are used to measure codon usage evenness (Novoa and Ribas de Pouplana 2012). Multivariate statistical methods, such as correspondence analysis and principal component analysis, are widely used to analyze variations in codon usage among genes. There are many computer programs to implement the statistical analyses enumerated above, including CodonW, GCUA, and INCA. Additionally, several software packages are available online for this purpose (for example, erilllab.umbc.edu / research / software / 201-2 / ; pbil.univ-lyon1.fr / datasets / charif04 / ; mcinerneylab.com / software / gcua / #; thermofisher.com / us / en / home / life-science / cloning / vector-nti-software / vector-nti-advance-software.html).
[0079] A skilled person would recognize that during the insertion of a nucleic acid molecule, such as any one of SEQ ID NO: 1-20, into a cell, the 5' and / or 3' ends of the inserted molecule may be deleted or rearranged. Such deletions or rearrangements may not affect the function of the inserted molecule, and these relatively small changes result in an inserted molecule that may be considered to be essentially the same as the starting molecule. A skilled person would also recognize that the nucleic acid molecule, such as one comprising any one of SEQ ID NO: 1-20, may undergo full or partial rearrangement or duplication during the insertion event, such that the inserted molecule is a full or partial rearrangement or duplication of the starting nucleic acid molecule. A skilled person would recognize that this inserted molecule may still have the same characteristics and / or traits as the starting molecule, such that the transformed cell or resulting transformed plant may still be desirable.
[0080] A skilled person would recognize that a transgene for commercial use, such as a nucleic acid molecule that comprises any one of SEQ ID NO: 1-20, may need relatively minor modifications to the nucleic acid sequence to comply with governmental regulatory standards. Such modifications would not affect the function of the molecule. A skilled person would recognize that the modified nucleic acid molecule would be essentially the same as the starting molecule.
[0081] Therefore, the invention encompasses a nucleic acid molecule substantially identical to SEQ ID NO: 13, wherein certain nucleotides of SEQ ID NO: 13 are deleted, substituted or rearranged, resulting in a mutated nucleic acid molecule and wherein the functionality of the mutated nucleic acid molecule is the same as the starting molecule. The present invention also provides for a nucleic acid molecule, a chimeric nucleic acid molecule, and / or a recombinant nucleic acid construct or vector which comprise, consist, or essentially consist of a nucleic acid sequence that is at least 95% identical, at least 97% identical, at least 98% identical, at least 99% identical, or 100% identical to SEQ ID NO: 13. The present invention also provides an isolated nucleic acid molecule that is least 95% identical, at least 97% identical, at least 98% identical, at least 99% identical, or 100% identical to SEQ ID NO: 13. The present invention also provides an isolated nucleic acid molecule that is at least 92% identical, at least 94% identical, at least 95% identical, at least 97% identical, at least 98% identical, at least 99% identical, or 100% identical to SEQ ID NO: 11. The present invention also provides for a nucleic acid molecule, a chimeric nucleic acid molecule, and / or a recombinant nucleic acid construct or vector which comprise, consist, or consist essentially of SEQ ID NO: 13.
[0082] In one embodiment, this chimeric nucleic acid molecule of the invention may comprise additional expression cassettes, transcriptional or translational regulatory elements, or prokaryotic origins of replication. In another embodiment, the chimeric nucleic acid molecule may be a recombinant nucleic acid construct, such as a binary vector or a vector suitable for expression in prokaryotes. The recombinant nucleic acid construct may be suitable for transient or stable expression in plants. In another embodiment, the invention encompasses SEQ ID NO: 13 or a nucleic acid molecule that is substantially identical SEQ ID NO: 13 as either an isolated nucleic acid molecule or as part of a larger nucleic acid molecule.
[0083] The present invention also provides for use of a nucleic acid molecule of the invention as described herein, wherein expression of said nucleic acid molecule in a cell confers herbicide tolerance to glutamine synthetase (GS) inhibitor herbicides. GS inhibitor herbicides include phosphinothricin (PPT), glufosinate, bialaphos, Basta, glufosinate ammonium-GLA, or a compound with a phosphinothricin moiety. Commercial GS inhibitor herbicides include Interline ™< , Herbiace ®< , Liberty ®< , Ignite ®< , Rely ®< , Finale ®< , and Basta ®< .
[0084] The present invention also provides for a transgenic host cell comprising a nucleic acid molecule of the invention as described herein. The transgenic host cell described above may be a bacterial cell or a plant cell. The transgenic bacterial cell may be an Escherichia coli, Bacillus thuringiensis, Bacillus subtilis, Bacillus megaterium; Bacillus cereus, Agrobacterium ssp. or a Pseudomonas ssp. cell. The transgenic plant cell may be found within a transgenic plant, plant part, plant tissue, or plant cell culture. The transgenic plant may be a monocotyledonous or dicotyledonous plant. The transgenic plant may be selected from the group comprising maize, sorghum, wheat, sunflower, tomato, crucifers, oat, turf grass, pasture grass, flax, peppers, potato, cotton, rice, soybean, sugarcane, sugar beet, tobacco, barley, and oilseed rape.
[0085] The present invention also provides for a progeny of any generation of a transgenic plant, wherein said transgenic plant comprises a nucleic acid molecule of the invention as described herein. The present invention also provides for a transgenic seed, a cutting from a transgenic plant for the purposes of propagation, and for a transgenic propagule from said transgenic plant.
[0086] The present invention also provides for an improved method of plant transformation, comprising the steps of: providing a nucleic acid molecule of the invention as described herein; (b) introducing into a plant, tissue culture, or a plant cell the nucleic acid molecule of step (a) to produce a transformed plant, transformed tissue culture, or a transformed cell having herbicide tolerance; (c) selecting for transformants using a concentration of herbicide that permits cells that express a nucleic acid molecule of step (a) to grow, while killing or inhibiting the growth of cells that do not comprise a nucleic acid molecule of the invention. This improved method with a nucleic acid molecule of the invention results in a greater transformation frequency compared to a similar method not using a nucleic acid molecule of the invention. The herbicide comprises a GS inhibitor, such as phosphinothricin or glufosinate. Examples of appropriate amounts of GS inhibitor herbicide for selecting a transformed cell having herbicide tolerance range from 1 to 80 mg / L ammonium glufosinate. A preferred range is 1 to 60 mg / L ammonium glufosinate. This improved method provides at least 5% higher, 10% higher, 15% higher, 20% higher, 25% higher, 30% higher, 40% higher, 50% higher, 60% higher, 70% higher, 80% higher, 90% higher, 100% higher, 110% higher, 120% higher, 130% higher, 140% higher, 150% higher, 160% higher, 170% higher, 180% higher, 190% higher, 200% higher, 300% higher, 400% higher, 500% higher, 600% higher, 700% higher, 800% higher, 900% higher, or at least 1000% higher transformation frequency compared to a method that uses a nucleic acid molecule and / or PAT gene variant, for example cPAT-09, which is not a nucleic acid molecule of the invention.
[0087] The present invention also provides for an improved method of producing an herbicide tolerant plant, comprising the steps of (a) providing a nucleic acid molecule of the invention as described herein; (b) introducing into a plant, tissue culture, or a plant cell the nucleic acid molecule of step (a) to produce a transformed plant, transformed tissue culture, or a transformed cell having herbicide tolerance; (c) selecting for the transformed plant, transformed tissue culture, or a transformed cell having herbicide tolerance using an appropriate amount of a GS inhibitor herbicide; and (d) growing said transformed plant or regenerating a transformed plant from the transformed tissue culture or transformed plant cell, so a herbicide tolerant plant is produced. This improved method with a nucleic acid molecule of the invention results in a greater transformation frequency compared to a similar method not using a nucleic acid molecule of the invention. This improved method provides at least 5% higher, 10% higher, 15% higher, 20% higher, 25% higher, 30% higher, 40% higher, 50% higher, 60% higher, 70% higher, 80% higher, 90% higher, 100% higher, 110% higher, 120% higher, 130% higher, 140% higher, 150% higher, 160% higher, 170% higher, 180% higher, 190% higher, 200% higher, 300% higher, 400% higher, 500% higher, 600% higher, 700% higher, 800% higher, 900% higher, or at least 1000% higher transformation frequency compared to a method that uses a nucleic acid molecule and / or PAT gene variant, for example cPAT-09, which is not a nucleic acid molecule of the invention. Examples of appropriate amounts of GS inhibitor herbicide for selecting a transformed cell having herbicide tolerance range from 1 to 80 mg / Lammonium glufosinate. A preferred range is 1 to 60 mg / L ammonium glufosinate. In a preferred embodiment, the transgenic plant expresses a PAT gene in an amount that allows for control weeds.
[0088] The present invention also provides for a transgenic herbicide tolerant plant cell produced by the methods of the invention, and further embodiments include a transgenic herbicide tolerant plant comprising a plant cell produced by the methods of the invention. The transgenic herbicide tolerant plant cell is tolerant to herbicides comprising a GS inhibitor as its active ingredient, including phosphinothricin or a compound with a phosphinothricin moiety. The present invention also provides for a method of producing transgenic seed from the transgenic plant described above, where the plant is cultured or grown under appropriate conditions to produce progeny seed which is transgenic.
[0089] The present invention also provides an improved process for producing a transgenic plant that is tolerant to the herbicidal activity of a glutamine synthetase inhibitor, including phosphinothricin or a compound with a phosphinothricin moiety, which comprises the steps of: (a) producing a transgenic plant cell comprising a nucleic acid molecule of the invention; and (b) regenerating a transgenic plant from said cell, wherein more transgenic plant cells are recovered compared to a method that does not use a nucleic acid molecule of the invention, for example cPAT-09 or another PAT variant.
[0090] The present invention also provides for a process for protecting a group of cultivated transgenic herbicide tolerant plants in a field by destroying weeds wherein said plants comprise a nucleic acid molecule of the invention, and wherein said weeds are destroyed by application of an herbicide comprising a glutamine synthetase inhibitor as an active ingredient. The application may be, for example, at least 595 g / acre of ammonium glufosinate, at least 1190 g / acre, at least 1,785 g / acre, at least 2380 g / acre, at least 2,975 g / acre, at least 3,570 g / acre, at least 4,165 g / acre, or at least 4,760 g / acre of ammonium glufosinate.
[0091] The present invention also provides for a method of producing progeny of any generation of an herbicide tolerant fertile transgenic plant, comprising the steps of: (a) obtaining a herbicide tolerant fertile transgenic plant comprising a nucleic acid molecule of the invention as described herein; (b) collecting transgenic seed from said transgenic plant; (c) planting the collected transgenic seed; and (d) growing the progeny transgenic plants from said seed, wherein said progeny has enhanced herbicide tolerance relative to a non-transformed plant.
[0092] The present invention also provides for a method of selecting or distinguishing an individual plant or a group of crop plants comprising a nucleic acid molecule of the invention from a population of plants of the same species not containing the nucleic acid molecule, said method comprising applying a composition comprising a GS inhibitor as an active ingredient to the population of plants.
[0093] The present disclosure also provides a method of detecting a nucleic acid molecule of the invention in a sample comprising nucleic acids, said method comprising the steps of: (a) obtaining a sample comprising nucleic acids; (b) contacting the sample with a probe comprising the nucleic acid sequence of, for example, any one of SEQ ID NO: 22-32 or complements thereof, that hybridized under high stringency conditions to a nucleic acid molecule of the invention and does not hybridize under high stringency conditions with DNA of a control corn plant; (c) subjecting the sample and the probe to high stringency hybridization conditions; and (d) detecting hybridization of the probe to the DNA.
[0094] The present disclosure also provides a method of detecting the presence of a nucleic acid molecule of the invention in a sample comprising nucleic acids, the method comprising: (a) obtaining a sample comprising nucleic acids; (b) combining the sample with a pair of polynucleotide primers, for example SEQ ID NO: 24 and 25, SEQ ID NO: 27 and 28, or SEQ ID NO: 30 and 31, or complements thereof, which will amplify a product from a template which contains a nucleic acid molecule of the invention and will not amplify a product when the template does not contain a nucleic acid molecule of the invention; (c) performing a nucleic acid amplification reaction which results in an amplicon; and (d) detecting the amplicon.
[0095] The present disclosure also provides a method of detecting the presence of a nucleic acid molecule of the invention in a sample comprising nucleic acids, the method comprising: (a) obtaining a sample comprising nucleic acids; (b) combining the sample with a pair of polynucleotide primers, for example SEQ ID NO: 24 and 25, SEQ ID NO: 27 and 28, or SEQ ID NO: 30 and 31, or complements thereof, which will amplify a product from a template which contains a nucleic acid molecule of the invention and will not amplify a product when the template does not contain a nucleic acid molecule of the invention, and also combining the sample with a polynucleotide probe comprising, for example, a nucleotide sequence of SEQ ID NO: 26, SEQ ID NO: 29, SEQ ID NO: 32, or a complement thereof, which will detect the amplicon; (c) performing a nucleic acid amplification reaction which results in an amplicon which can be detected by the probe; and (d) detecting the probe.EXAMPLES
[0096] The invention will be further described by reference to the following detailed examples. These examples are provided for purposes of illustration only, and are not intended to be limiting unless otherwise specified. Standard recombinant DNA and molecular cloning techniques used here are well known in the art and are described by Ausubel (ed.), Current Protocols in Molecular Biology, John Wiley and Sons, Inc. (1994); J. Sambrook, et al., Molecular Cloning: A Laboratory Manual, 3d Ed., Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press (2001); and by T.J. Silhavy, M.L. Berman, and L.W. Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984).Example 1: PAT codon optimization
[0097] The PAT codon optimized nucleic acid sequences were produced using the codon usage tool available from the Vector NTI Advance ®< software. Using standard algorithms and available ESTs for various monocotyledonous crops, codon optimized sequences were derived from the native nucleic acid sequence of PAT from S. viridochromogenes. Variant 1 (SEQ ID NO: 6) was produced by codon optimization to a wild relative of domesticated Zea mays, namely Zea mays ssp. mexicana. Variant 2 (SEQ ID NO: 1) was produced by codon optimization to barley (Hordeum vulgare). Variant 3 (SEQ ID NO: 11) was produced by a novel method of codon optimization to Sorghum bicolor and also to Oryza sativa. Variant 4 (SEQ ID NO: 16) was produced by codon optimization to Sorghum bicolor. A control PAT DNA sequence, referred to as cPAT-09 (SEQ ID NO: 21), was produced by codon optimization to a dicotyledonous plant species, Arabidopsis thaliana. Percent similarity of these sequences to each other and to the native PAT nucleic acid sequence is shown in Table 1. Table 1: Percent similarity between codon optimized PAT nucleic acid sequences cPAT 09 Variant 1 Native PAT (S. viridochromogenes) Variant 2 Variant 3 Variant 4 cPAT09 1007371737678Variant 1 10085818487Native PAT (S. viridochromogenes) 100888684Variant 2 1009491Variant 3 10095Variant 4 100 Example 2: PAT variants expression cassettes
[0098] Each variant was introduced into four different expression cassettes, which were introduced into binary vectors (Table 2). All expression cassettes for the variants contain the prZmUbi158 maize promoter to drive expression and are terminated by the tZmUbi158 terminator (U.S. Patent No. 9, 187,756). The expression cassette design types a, b, c, and d used the four PAT coding sequence variants. The expression cassette design types a-d may have additional features such as transcriptional enhancers eFMV and e35S, and a 25 nucleotides (25nt) region at the junction between the prZmUbi158 intron and the PAT coding sequence. This 25 nt region may have a role in transgene expression (for example, see Sivamani et al., 2009, Plant Science 177: 549-556). eFMV is a modified figwort mosaic virus enhancer (Maiti et al. 1997, Transgenic Res 6: 143-156). e35S is a cauliflower mosaic virus 35S enhancer region which can activate heterologous core promoters (Ow et al. 1987, PNAS 84: 4870-4874). The control construct 18857 contains an expression cassette comprising the 35s promoter (Odell et al. 1985, Nature 313: 810-812) driving expression of the A. thaliana optimized PAT gene (cPAT-09) operably linked to a NOS terminator (Bevan et al. 1983, Nucleic Acids Res 11: 369-385). 18857, similar to design type "b", lacks enhancers and also lacks the 25 nt region. The other control construct, 20189, is similar to design type "c" and contains the eFMV and e35S enhancers and the 25 nt region. PAT variant types may be referred to as a combination of the PAT variant sequence and the cassette design type. For example, PAT variant 3b has the PAT variant 3 in expression cassette design type b (SEQ ID NO: 13). Table 2: Construct details Binary vector ID PAT expression cassette SEQ ID NO. PAT Variant Cassette Design type Features 23152prUbi 158 / cPAT / tZmUbi1582Variant 2aWithout enhancers; with 25nt23153prZmUbi 158 / cPAT / tZmUbi1583bWithout enhancers; without 25nt231734cWith enhancers; with 25nt232135dWith enhancers; without 25nt23150prZmUbi 158 / cPAT / tZmUbi1587Variant 1aWithout enhancers; with 25nt23151prZmUbi 158 / cPAT / tZmUbi1588bWithout enhancers; without 25nt231669cWith enhancers; with 25nt2318410dWith enhancers; without 25nt23185prZmUbi 158 / cPAT / tZmUbi15812Variant 3aWithout enhancers; with 25nt23154prZmUbi 158 / cPAT / tZmUbi15813bWithout enhancers; without 25nt2317414cWith enhancers; with 25nt2320015dWith enhancers; without 25nt23148prZmUbi 158 / cPAT / tZmUbi15817Variant 4aWithout enhancers; with 25nt23149prZmUbi 158 / cPAT / tZmUbi15818bWithout enhancers; without 25nt2316419cWith enhancers; with 25nt2316520dWith enhancers; without 25nt18857pr35S / cPAT / tNOS22ControlC135s promoter and NOS terminator (control 1)2018923ControlC2With enhancers; with 25nt (control 2) Example 3: Transient assays to characterize PAT variant expression levels
[0099] Transient assays were performed with all binary vector constructs listed in Table 2 with appropriate controls. Maize plants 8-10 days after germination were used for transient assays using Agrobacterium strains each comprising a vector from Table 2. The tops of the plants were cut from the second fully opened leaf and the remaining leaves were also cut to expose the stem of the plant. The stem was then mechanically bruised. One 1 mL of Agrobacteria suspension was applied. Two plants were infiltrated for each test construct. The infiltrated plants were placed in a tray and maintained in a growth chamber around 25 °C with a photoperiod of 16 h light and 8 h dark for 4 days. After 4 days, 4 samples from the newly grown leaf tissue from each plant were collected, total protein was extracted, and PAT protein levels were determined using an ELISA kit from EnviroLogix (catalog number AP014 NWv10; www.envirologix.com). The ELISA results of transient assay are presented in Table 3. PAT protein values are an average of 8 leaf samples collected from two maize plants that were infiltrated with the Agrobacteria containing the respective binary vector, with standard deviation shown. The values are expressed as nanogram PAT enzyme per milligram total soluble protein (TSP). All PAT variants in all expression cassettes expressed at levels higher than that of the control constructs. Table 3: Protein levels of PAT variants in transient assays Vector ID PAT variant Cassette design type PAT protein (ng / mg TSP) 23152Variant 2a1053.7±627.223153b897.4±383.623173*c657.3±577.323213*d1351.5±869.223150Variant 1a224.9±158.223151b489.7±346.923166c651.8±261.523184d1563.4±855.123185Variant 3a576.8±318.823154**b1153.5±691.623174c491.7±546.123200d1542.9±944.623148Variant 4a332.9±200.523149*b139.4±113.623164c147.3±36.423165d398.0±139.118857ControlControl 118.8±25.220189Control 293.8±27.7 Example 4: PAT variants in transgenic plants
[0100] Each of the binary vectors of Table 2 was used to create maize transgenic events. Events were produced by Agrobacterium-mediated transformation of a proprietary maize line. Immature embryos were transformed essentially as described in Negrotto et al. (2000, Plant Cell Reports 19: 798-803). Using this method, genetic elements within the left and right border regions of the binary vector comprising the PAT expression cassette were efficiently transferred and integrated into the genome of the plant cell, while genetic elements outside these border regions were not transferred.
[0101] The PAT gene was used as a selectable marker during the transformation process otherwise performed essentially as Negrotto et al. 2000, with bialaphos / ammonium glufosinate concentration ranging from 1-7.5 (Bialaphos) or 10-40 (ammonium glufosinate) mg / L in the selection media. The embryos producing embryogenic calli were transferred to a series of cell culture selection media containing bialaphos / ammonium glufosinate as selection agent and cultured for 10-11 weeks in total. The selection media also contained 200mg / ml timentin and / or 10ml / l PPM (Plant Preservative Mix) to ensure that all Agrobacteria was cleared from the transformed tissue. Regenerated plants were transferred to the greenhouse for further propagation.Example 5: PAT variant transformation frequencies
[0102] Percentage of transformation frequency (TF) was calculated, and the data are presented in Table 3. Transformation frequency is calculated as the percentage of transgenic events recovered for a given construct over the number of immature embryos used for the transformation. Standard deviation is shown for each construct. Interestingly, for PAT variants 3 and 4, the cassette designs that lacked the enhancers (3a, 3b, 4a and 4b) showed higher TF than the cassettes that were built with the enhancers (3c, 3d, 4c and 4d). Surprisingly, the cassette types with enhancers for all variants yielded sick looking plants. The constructs 23152 (type 2a), 23173 (type 2c), 23213 (type 2d), 23154 (type 3b) and 23149 (type 4b) yielded statistically significant higher TF compared with that of others and controls in multiple experiments in a consistent manner (Table 4). Although the transformation frequency of 23173 (type 2c) and 23213 (type 2d) were high, the transgenic events showed severe abnormal looking plants most likely due to the over expression of the PAT gene and the overexpression of a reporter CFP gene, due to the presence of enhancers. The transgenic events from 23154 (type 3b) and 23149 (type 4b) were normal looking. Statistical analysis was performed on the TF results. In a two tailed student's t test, TF was significantly higher when using vector 23152, 23173, 23213, and 23149 when compared to controls, with a p value of ≤0.05. Unexpectedly, TF was even more significant higher for one construct, 23154, (type 3b), with a p value of ≤0.01 when compared to controls in a student's t test. Overall, these results show that the best variant and best cassette design type for maximal transformation frequency is not obvious and cannot be predicted. Table 4: Transformation frequency in transgenic plants Vector ID PAT variant Cassette design type # of expts # of explants # of transgenic events obtained # of single copy events Transformation frequency% (TF) 23152*Variant 2a489260186.7±1.523153b5100042114.2±0.723173*c23022076.6±1.123213*d236025156.9±0.923150Variant 1a35892153.6±1.423151b713807575.4±1.323166c23701022.7±0.223184d23601413.9±0.123185Variant 3a410304544.4±0.623154**b490071137.9±0.923174c23001083.3±0.923200d26202383.7±2.223148Variant 4a24962454.8±1.523149*b35954056.7±2.023164c23951243.0±1.123165d23861022.6±0.518857ControlControl 11022108243.7±0.620189Control 213380017294.5±0.4Asterisks indicate significant differences in transformation frequency in a two tailed student's t test; for *, p≤0.05; for **, p≤0.01. Example 6: PAT variant protein levels in transgenic plants
[0103] Leaf extracts from T0 transgenic plants, which were the initially transformed plants, were prepared and were quantitatively analyzed for PAT by ELISA (Tijssen 1985) using a kit from EnviroLogix (catalog number AP014 NWv10; www.envirologix.com). Results for ELISAs are an average from the total numbers of plants sampled and shown as nanogram PAT enzyme per milligram total solution protein (TSP). Standard deviation is shown for each construct. Interestingly, the PAT protein expression in leaves of transgenic T0 plants transformed with the new codon optimized constructs, with or without enhancers, was several fold higher (ranging up to 89 fold) than the controls which comprised cPAT-09, which is also plant optimized. The cassette design types c and d (Table 2) with the transcriptional enhancers showed higher expression of the PAT gene over the types a and b (Table 2) that lacked the enhancers. Interestingly, the 23154 construct, which comprised PAT variant type 3b, is not among the highest of PAT protein levels in its leaves compared to other constructs which had lower TF. This indicates that a PAT variant and expression cassette design type which acts as an improved selectable marker for improved transformation frequency cannot be predicted based high levels of PAT protein. Table 5: Expression of PAT in transgenic events Vector ID PAT variant Cassette design type # of plants sampled for ELISA PAT protein (ng / mg TSP) 23152*Variant 2a182051.5±456.523153b112014.5±596.623173*c72816.9±637.623213*d154804.8±778.823150Variant 1a5899.9±00.523151b7747.8±125.823166c21513.6±87.123184d12642.4±411.823185Variant 3a4469.4±47.123154**b13474.0±43.423174c8925.0±158.323200d8733.7±84.423148Variant 4a13297.1±46.123149*b51014.7±84.123164c8859.4±6.723165d5263.3±45.718857ControlControl 14153.8±13.020189Control 263109.3±19.5 Example 7: PAT variant transgene copy number
[0104] For transgene copy number determination, the TAQMAN ™< assay was performed with total DNA extracted from leaf pieces from each putative T0 transgenic event as described by Ingham et al. (2001). DNA from the putative transgenic events was isolated using standard procedures and analyzed using TAQMAN ™< qPCR to determine copy number of the introduced gene. TAQMAN ™< assays were performed following standard methodology using JumpStart ™< Taq ReadyMix ™< (Sigma-Aldrich) and the ABI PRISM ®< 7900HT sequence detection system. Primers and probes for the introduced variants are shown in Table 6. These primers and probes could also be used to identify the presence of a PAT variant in a DNA sample using TAQMAN ™< . In all the blocks, DNA from a one copy PMI transgene maize event as determined by Southern blot was used as control. Events were considered low-copy if they had a raw TAQMAN ™< copy number value of 0.3 to 1.3. Events with a raw TAQMAN ™< number above 1.3 were considered medium to high copy number and are believed to contain more than one copy of the introduced gene. The transgenic events identified as low copy were used for further analysis. Table 6: TaqMan primers and probes SEQ ID NO: Description Sequence 24variant 1 Fwd primerGCGACATCGTGAACCACTACAT25variant 1 Rev primerGCTCGAGGTCGTCGATCCA26variant 1 probeCCACCGTGAACTTCCGCACCG27variant 2 Fwd primerGCGTCAGGCTGCACGAA28variant 2 Rev primerCGAAGTCCCTCTGCCAGAAG29variant 2 probeCTACAAGCACGGCGGCTGGCAC30variant 3&4 Fwd primerCGAGGCCCTCGGCTACA31variant 3&4 Rev primerCGAAGTCCCTCTGCCAGAAG32variant 3&4 probeCTACAAGCACGGCGGCTGGCAC33cPAT-09 Fwd primerTGAGGGTGTTGTGGCTGGTA34cPAT-09 Rev primerTGTCCAATCGTAAGCGTTCCT35cPAT-09 probeCTTCCAGGGCCCAGCGTAAGCA Example 8: Herbicide spray results with T0 transgenic events
[0105] Backbone free low copy events comprising each of the variant types were selected and maintained in GH and sprayed with 4x levels of the herbicide Liberty ™< containing the active ingredient ammonium glufosinate, a glutamate synthetase (GS) inhibitor. All the sprayed T0 events raised from the 16 different codon optimized PAT vectors showed herbicide resistance as good as the controls. No visible leaf damage was found in any of the T0 transgenic events. This indicates that PAT variant type 3b, in addition to surprisingly providing improved transformation frequency when acting as the selectable marker, can act at a commercial level as an herbicide tolerance trait. These sprayed T0 events were transferred to bigger pots and seeds were collected from all the events.Example 9: Herbicide tolerance in T1 PAT variant 3b transgenic plants
[0106] A sum of 40 T1 seeds from 4 T0 events from the construct 23154 (PAT variant type 3b), which gave consistent higher TF and significantly higher PAT expression over controls in repeated experiments, were germinated. The germinating seedlings were tested for the presence of PAT gene by TaqMan ®< PCR analysis, as described in Example 7, and for protein expression of the PAT gene, as described in Example 6. Similarly, 25 T1 seeds from two T0 transgenic events each of control constructs 18857 and 20189 were germinated and assayed for the presence of PAT gene by TagMan ®< PCR. The plants that were negative for the presence of PAT gene were discarded and the positive plants were randomly separated into two sets for spray tests at 4x (2,380 g / acre active ingredient of ammonium glufosinate (Liberty 280SL ™< with 4g / 200ml ammonium sulphate as carrier) and 8x (4,760 g / acre active ingredient of ammonium glufosinate (Liberty 280SL ™< ) levels at the V3 / V4 stage with appropriate controls (18857 and 20189). For each rate of spray, 5 non transgenic maize were maintained as control with and without the ammonium glufosinate spray. This strategy is shown in Table 7. Table 7: Herbicide tolerance in T1 generation of PAT variant 3b transgenic plants Vector ID T0 parent ID # of plants sprayed at 4X # of plants sprayed at 8X Total plants sprayed 2315419A006A151610719A011A151019A034A111219A036A12161885715A010A3234528A006A1902018923A014A1943929A003A016
[0107] One week after the spray, the leaves were scored for leaf damage / necrosis. All the 107 T1 events of 23154 (both heterozygous and homozygous) showed resistance to ammonium glufosinate herbicide spray as good as the controls at 4x and 8x levels. No damage was observed to the plants even with the 8x spray in transgenic events from 23154 or the controls. This indicates that PAT variant 3b maintains full efficacy as a trait in multiple generations, in addition to acting as an improved selectable marker for transformation.Example 10: Ammonium glufosinate concentrations for selection of PAT variant 3b
[0108] A kill curve was conducted to determine the most effective concentration of ammonium glufosinate that could be used with the PAT variant type 3b. The expression cassette of PAT variant type 3b (SEQ ID NO: 13) was introduced into a binary vector, now referred to as 23419. Binary vector 18857 (described in Table 2), which expresses cPAT-09, was used as a control. An effective concentration of ammonium glufosinate is high enough to minimize or eliminate false positives, or "escapes", which do not have the PAT gene but survive selection, but low enough to not kill transgenic plants which do comprise the PAT gene. For vector 23419, 75-86 immature embryos were transformed using Agrobacteria similar to the method described in Example 4. Selection was performed using 10-80 mg / L of ammonium glufosinate (Ignite ®< ). Following selection, plantlets were regenerated and then transferred to rooting media. The survival percentage (%) is shown as the number of plants that rooted over the number of immature embryos initially transformed. Results are shown in Table 8. Table 8: Ammonium glufosinate concentration for PAT variant 3b transformation Ammonium glufosinate (mg / L) % Survival, PAT variant 3b % Survival, cPAT-09 107.11.32011.61.3405.808000
[0109] 10 mg / L to 40 mg / L of ammonium glufosinate all had survivor transgenic plant candidates for the binary vector comprising PAT variant type 3b. Survival percentage from transformation using cPAT-09 (binary vector 18857) was much lower, and did not survive selection at 40 mg / L ammonium glufosinate. A second experiment was performed using 40 mg / L ammonium glufosinate, or using the GS inhibitor bialaphos at 5 mg / L. For this experiment, following transformation the immature embryos were selected, plants were regenerated and rooted, and transgenic plants were identified so that transformation frequency could be calculated. Results are shown in Table 9. Table 9: Improved transformation frequency of PAT variant 3b Treatment PATvariant Valid Explants Total # Events Transformation frequency % (TF) 5 mg / L Bialaphos3b400133.25cPAT-0982570.87540mg / L ammonium glufosinate3b400164cPAT-0982550.625
[0110] Transformation using PAT variant type 3b is clearly shown to result in a higher transformation frequency compared to cPAT-09 using either 40 mg / L ammonium glufosinate or using 5 mg / L bialaphos.Example 11: PAT variant 3b transgenic plant herbicide tolerance in the field
[0111] Field efficacy for the PAT variant type 3b (SEQ ID NO: 13) is tested. SEQ ID NO: 13 is introduced into maize plants as described in Example 4. Herbicide tolerant corn plants comprising SEQ ID NO: 13 are tested in a hybrid cross grown at a field location. For example, efficacy trials consist of one-row plots, with three replications per treatment. The treatment may consist of an application of 2x or 4x the maximum labeled rate applied at the V4 developmental stage of the corn plant. Phytotoxicity may be assessed at 7 days and 14 days after treatment (7 DAT and 14 DAT). Factors of phytotoxicity that are taken into account when rating phytotoxicity include leaf discoloration (for example yellowing of leaf tips or margin), leaf damage (for example burning of leaf tips or margin), and plant growth stunting (for example inadequate elongation between internodes). Phytotoxicity may be quantified as the percentage of plants showing phytotoxicity at 7 or 14 days after V4 application.
Claims
1. An isolated nucleic acid molecule comprising a nucleic acid sequence at least 95% identical to SEQ ID NO: 13.
2. A vector or construct comprising the nucleic acid molecule of claim 1.
3. A transgenic host cell that contains the nucleic acid molecule of claim 1.
4. The cell of claim 3, which is a bacterial cell.
5. The cell of claim 3, which is a plant cell.
6. A plant or plant part comprising the plant cell of claim 5.
7. The cell of claim 3, wherein said nucleic acid molecule further comprises the sequence of SEQ ID NO: 11.
8. The plant of claim 6, wherein said plant is a monocotyledonous plant, preferably millet, switchgrass, maize, sorghum, wheat, oat, turf grass, pasture grass, rice, sugarcane, or barley.
9. The plant of claim 6 or 8, wherein said plant further comprises a nucleic acid molecule comprising a nucleotide sequence which encodes for at least one additional desired trait selected from the group consisting of insect resistance, abiotic stress tolerance, increased yield, improved oil profile, improved fiber quality, delayed ripening, male sterility, herbicide resistance, bacterial disease resistance, fungal disease resistance, viral disease resistance, nematode resistance, modified fatty acid metabolism, modified carbohydrate metabolism, production of a commercially valuable enzyme or metabolite, improved nutritional value, improved performance in an industrial process and altered reproductive capability.
10. A progeny or a propagule of any generation of the plant of claims 6 or 8 to 9, wherein said progeny or propagule comprises the nucleic acid molecule of claim 1.
11. An improved method of plant transformation, comprising the steps of: a) providing the nucleic acid molecule of claim 1; b) introducing into a plant, tissue culture, or a plant cell the nucleic acid molecule of step (a) to obtain a transformed plant, transformed tissue culture, or a transformed cell expressing PAT from the nucleic acid molecule of step (a); and c) selecting for transformants using a concentration of herbicide that permits cells that express PAT from the nucleic acid molecule of step (a) to grow, while killing or inhibiting the growth of cells that do not comprise said PAT gene, wherein said herbicide comprises phosphinothricin or glufosinate, wherein more transformants are recovered compared to a method that does not use the nucleic acid molecule of claim 1.
12. An improved method of selecting for a transgenic plant cell, wherein said method comprises providing the nucleic acid molecule of claim 1 to a plurality of plant cells, and growing said plurality of cells in a concentration of a herbicide that permits cells that express the PAT gene of said vector to grow while killing or inhibiting the growth of cells that do not comprise said PAT gene, wherein said herbicide comprises phosphinothricin or glufosinate, and wherein more transgenic plant cells are recovered compared to a method that does not use the nucleic acid molecule of claim 1.
13. An improved process for producing a transgenic plant that is tolerant to the herbicidal activity of a glutamine synthetase inhibitor, including phosphinothricin or a compound with a phosphinothricin moiety, which comprises the steps of: a) producing a transgenic plant cell comprising the nucleic acid molecule of claim 1; and b) regenerating a transgenic plant from said cell, wherein more transgenic plant cells comprising a PAT gene are recovered compared to a method that does not use the nucleic acid molecule of claim 1.