A COMPOUND FOR REGULATING THE ACTIVITY OF MICRORNA-124

EA202690881A1Pending Publication Date: 2026-07-16JIANGSU CHIA TAI FENGHAI PHARMA CO LTD

Patent Information

Authority / Receiving Office
EA · EA
Patent Type
Applications
Current Assignee / Owner
JIANGSU CHIA TAI FENGHAI PHARMA CO LTD
Filing Date
2024-08-29
Publication Date
2026-07-16

AI Technical Summary

Technical Problem

The prior art is difficult to effectively regulate the activity of microRNA-124, resulting in limited effectiveness in the treatment of inflammatory diseases.

Method used

A compound for regulating microRNA-124 activity has been developed to enhance or inhibit its activity by specific pharmaceutical combinations and preparation methods to treat inflammatory diseases.

Benefits of technology

By regulating the activity of microRNA-124, it can effectively reduce inflammatory responses and provide new anti-inflammatory treatment mechanisms, with potential emerging in the treatment of a variety of inflammatory diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CLAIM-16072026-IMGA0001
    Figure CLAIM-16072026-IMGA0001
Patent Text Reader

Abstract

The present invention discloses a compound for regulating the activity of microRNA-124. The compound has a structure represented by formula (I) and can be used to prevent or treat inflammatory diseases, including, but not limited to, inflammatory bowel diseases, rheumatoid arthritis, Crohn's disease, ulcerative colitis, multiple sclerosis, Alzheimer's disease, Parkinson's disease, osteoarthritis, atherosclerosis, ankylosing spondylitis, psoriasis, dermatitis, Sjogren's syndrome, bronchitis, asthma and inflammation associated with colon cancer, and in particular inflammatory bowel diseases, rheumatoid arthritis, Crohn's disease, ulcerative colitis, multiple sclerosis, osteoarthritis, ankylosing spondylitis, psoriasis, Sjogren's syndrome, bronchitis and inflammation associated with colon cancer.
Need to check novelty before this filing date? Find Prior Art

Description

Compounds for modulating microRNA-124 activity Technical Field

[0001] The present invention belongs to the field of medicinal chemistry and relates to a compound for regulating the activity of microRNA-124 and a preparation method thereof, as well as the medical use of the compound for treating inflammatory diseases. Technical Background

[0002] RNA interference (RNAi) is a process that effectively silences or inhibits target gene expression. It refers to the specific degradation of intracellular mRNA mediated by endogenous or exogenous double-stranded RNA (dsRNA), resulting in silencing of target gene expression and a corresponding loss-of-function phenotype. One of the silencing mechanisms is the inhibition of specific mRNA translation induced by microRNAs.

[0003] MicroRNAs (microRNAs), also known as "mature microRNAs", are small (about 18-24 nucleotides long) non-coding RNA molecules encoded in the genomes of plants and animals. In some cases, highly conserved endogenously expressed microRNAs regulate gene expression by binding to the 3'-untranslated region (3'-UTR) of specific mRNAs. Currently, 700 different miRNAs have been discovered in the human genome, which are widely involved in physiological or pathological processes such as growth, development, and apoptosis of organisms through different expression modes. In recent years, it has been found that changes in human miRNA levels are definite links with a variety of diseases (such as inflammatory response, sepsis, ischemia / reperfusion injury, and cancer).

[0004] Existing studies have found that overexpression of a miRNA (i.e., miR-124) initiates an anti-inflammatory cascade. miR-124 targets signal transducer and activator of transcription 3 (STAT3) to regulate macrophage cytokine production, reducing the secretion of IL-1b, IL-6, and TNF-a, thereby reducing Th17 proliferation. Upregulation of miR-124 in macrophages also reduces the production of MCP1, thereby limiting the recruitment of neutrophils, activating macrophages to transdifferentiate from M1 to M2, inactivating inflammatory macrophages, and transforming them into microglia-like cells. Abivax's microRNA therapy, ABX464, has a novel anti-inflammatory mechanism of action and is being developed for a variety of inflammatory diseases.

[0005] The overexpression of microRNA-124 and its anti-inflammatory cascade in inflammatory responses suggest that therapies targeting microRNA-124 may be effective in treating and / or preventing inflammatory diseases.

[0006] Summary of the Invention

[0007] The present invention provides a compound for regulating the activity of microRNA-124, a pharmaceutical composition and a preparation method thereof, and is used for medical purposes of treating inflammatory diseases.

[0008] The first aspect of the present invention provides a compound of the following formula (I), or a pharmaceutically acceptable salt thereof:

[0009] wherein X and Y are independently selected from CH or N;

[0010] A is selected from cyano, hydroxy, carboxyl, optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, optionally substituted C1-C6 alkoxy, optionally substituted C3-C6 cycloalkyl, and optionally substituted aromatic ring; the substituents of the optionally substituted C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 alkoxy, C3-C6 cycloalkyl, and aromatic ring are independently selected from hydrogen, halogen, cyano, hydroxy, carboxyl, COOR, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, C1-C6 haloalkoxy, C1-C6 alkylthio, C1-C6 haloalkylthio, C1-C6 alkylamino, C1-C6 haloalkylamino, HetAr 1 ;

[0011] HetAr 1 is an optionally substituted 4-10 membered heterocyclic ring or 5-10 membered aromatic ring having 1 to 3 heteroatoms independently selected from N, O or S. In some embodiments, HetAr 1 The substituents may be selected from hydrogen, halogen, cyano, hydroxy, carboxyl, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, C1-C6 haloalkoxy, C1-C6 alkylthio, C1-C6 haloalkylthio, C1-C6 hydroxyalkyl;

[0012] R1 and R2 are independently selected from hydrogen, halogen, hydroxyl, carboxyl, COOR, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 alkoxy, optionally substituted C3-C6 cycloalkyl, optionally substituted C1-C6 alkylamino; the substituents of said C1-C6 alkyl, C1-C6 alkoxy and C3-C6 cycloalkyl, C1-C6 alkylamino are independently selected from hydrogen, halogen, hydroxyl, carboxyl, COOR, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, C1-C6 haloalkoxy, C1-C6 alkylamino, C1-C6 haloalkylamino;

[0013] or R1 and R2 together with the carbon atoms to which they are attached further form an optionally substituted saturated 5- to 6-membered heterocyclic ring, wherein the 5- to 6-membered heterocyclic ring may optionally contain heteroatoms selected from N and O, and the substituents of the optionally substituted saturated 5- to 6-membered heterocyclic ring are independently selected from hydrogen, halogen, hydroxyl, carboxyl, COOR, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, C1-C6 haloalkoxy, C1-C6 alkylamino, and C1-C6 haloalkylamino;

[0014] Alternatively, R1 and R2 together with the carbon atoms to which they are attached further form an optionally substituted 5-6 membered aromatic ring; the substituents are independently selected from hydrogen, halogen, hydroxy, carboxyl, COOR, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, C1-C6 haloalkoxy, C1-C6 alkylamino, and C1-C6 haloalkylamino.

[0015] In other embodiments, the present invention further provides a compound of the following formula (I-1), or a pharmaceutically acceptable salt thereof:

[0016] wherein X and Y are independently selected from CH or N;

[0017] A is selected from cyano, hydroxy, carboxyl, optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, optionally substituted C1-C6 alkoxy, optionally substituted C3-C6 cycloalkyl, and optionally substituted aromatic ring; the substituents of the optionally substituted C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 alkoxy, C3-C6 cycloalkyl, and aromatic ring are independently selected from hydrogen, halogen, cyano, hydroxy, carboxyl, COOR, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, C1-C6 haloalkoxy, C1-C6 alkylthio, C1-C6 haloalkylthio, C1-C6 alkylamino, C1-C6 haloalkylamino, HetAr 1 ;

[0018] HetAr 1 is an optionally substituted 4-10 membered heterocyclic ring or 5-10 membered aromatic ring having 1 to 3 heteroatoms independently selected from N, O or S; the substituents are selected from hydrogen, halogen, cyano, hydroxy, carboxyl, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, C1-C6 haloalkoxy, C1-C6 alkylthio, C1-C6 haloalkylthio, C1-C6 hydroxyalkyl;

[0019] R0 is H or

[0020] R1 and R2 together with the carbon atoms to which they are attached further form an optionally substituted 5-6 membered halogenated aromatic ring; the halogen in the halogenated aromatic ring is independently selected from F, Cl, Br; the substituents are independently selected from hydrogen, halogen, hydroxyl, carboxyl, COOR, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, C1-C6 haloalkoxy, C1-C6 alkylamino, C1-C6 haloalkylamino, HetAr 4 、

[0021] HetAr 4 is an optionally substituted 4-10 membered heterocyclic ring or 5-10 membered aromatic ring having 1 to 3 heteroatoms independently selected from N, O or S, wherein the substituents are selected from hydrogen, halogen, cyano, hydroxy, carboxyl, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, C1-C6 haloalkoxy, C1-C6 alkylthio, C1-C6 haloalkylthio, C1-C6 hydroxyalkyl;

[0022] R a is selected from hydrogen, halogen, hydroxy, carboxyl, C1-C6 alkyl, C1-C6 haloalkyl, R b and R c independently selected from hydrogen, halogen, hydroxy, carboxyl, C1-C6 alkyl, C1-C6 haloalkyl;

[0023] or R b and R c Together with the nitrogen atom to which they are attached, they further form an optionally substituted saturated 5- to 6-membered heterocyclic ring, wherein the 5- to 6-membered heterocyclic ring may optionally contain heteroatoms in N and O, and the substituents of the optionally substituted saturated 5- to 6-membered heterocyclic ring are independently selected from hydrogen, halogen, hydroxyl, carboxyl, COOR, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, C1-C6 haloalkoxy, C1-C6 alkylamino, and C1-C6 haloalkylamino.

[0024] The compounds of the present invention, except for the compound ax shown below:

[0025] The present invention further, in some embodiments, in the compound of formula (I), X is CH; Y is N; A is a C2-C6 alkenyl group; R1 and R2, together with the carbon atoms to which they are attached, further form an optionally substituted 5-6-membered aromatic ring, which is connected to the adjacent benzene ring to form a condensed ring; the substituent is a halogen; further, R1 and R2, together with the carbon atoms to which they are attached, form a benzene ring, which is connected to the adjacent benzene ring to form a condensed ring; the substituent is a halogen.

[0026] The present invention further provides a compound of formula (II) or a pharmaceutically acceptable salt thereof,

[0027] R3 is selected from hydrogen, halogen, cyano, hydroxy, carboxyl, COOR, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, C1-C6 haloalkoxy, C1-C6 alkylthio, C1-C6 haloalkylthio, C1-C6 alkylamino, C1-C6 haloalkylamino, HetAr 2 ; R is a C1-C6 alkyl group;

[0028] HetAr 2 is a substituted or unsubstituted 4-6 membered monocyclic heterocyclic ring having 1 to 3 heteroatoms independently selected from N, O or S; and is connected to the adjacent benzene ring to form a condensed ring; the substituent is selected from hydrogen, halogen, cyano, hydroxyl, carboxyl, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, C1-C6 haloalkoxy, C1-C6 alkylthio, C1-C6 haloalkylthio, C1-C6 hydroxyalkyl;

[0029] R4 is selected from hydrogen, halogen, cyano, hydroxy, carboxyl, COOR, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, C1-C6 haloalkoxy; R is C1-C6 alkyl;

[0030] The following compounds are excluded:

[0031] The present invention further, in some examples, in the compound of formula (II), R3 is selected from HetAr 2 ;HetAr 2 is a substituted or unsubstituted 4-6 membered monocyclic aromatic heterocycle having 1 to 3 heteroatoms independently selected from N, O or S; and is connected to the adjacent benzene ring to form a condensed ring; the substituent is selected from hydrogen, halogen, cyano, hydroxyl, carboxyl, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, C1-C6 haloalkoxy, C1-C6 alkylthio, C1-C6 haloalkylthio, C1-C6 hydroxyalkyl; further substituents are selected from hydrogen, halogen, cyano, hydroxyl, carboxyl, C1-C3 alkyl, C1-C3 haloalkyl, C1-C3 alkoxy, C1-C3 haloalkoxy, C1-C3 alkylthio, C1-C3 haloalkylthio, C1-C3 hydroxyalkyl; R4 is halogen.

[0032] The present invention further, in other examples, in the compound of formula (II), R3 is selected from HetAr 2 ;HetAr 2It is a substituted or unsubstituted 4-6 membered monocyclic saturated heterocyclic ring containing one O; and is connected with the adjacent benzene ring to form a condensed ring; the substituent is selected from hydrogen, halogen, cyano, hydroxyl, and carboxyl; R4 is halogen.

[0033] The present invention further provides a compound of formula (III) or a pharmaceutically acceptable salt thereof

[0034] R6 is selected from hydrogen, halogen, cyano, hydroxy, carboxyl, COOR, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, C1-C6 haloalkoxy, C1-C6 alkylthio, C1-C6 haloalkylthio, C1-C6 alkylamino, C1-C6 haloalkylamino, HetAr 3 ; R is a C1-C6 alkyl group;

[0035] HetAr 3 It is a substituted or unsubstituted 4-6 membered monocyclic heterocyclic ring having 1 to 3 heteroatoms independently selected from N, O or S; and is connected to the adjacent benzene ring to form a condensed ring; the substituent is selected from hydrogen, halogen, hydroxyl, and carboxyl;

[0036] R7 and R8 are independently selected from hydrogen, halogen, hydroxy, carboxyl, COOR, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, C1-C6 haloalkoxy; R is C1-C6 alkyl.

[0037] The present invention further comprises the compound of formula (III),

[0038] In some embodiments, R6 is selected from C1-C6 haloalkoxy or C1-C6 haloalkylthio; R7 and R8 are independently selected from hydrogen, halogen, C1-C6 haloalkyl, C1-C6 alkoxy; in some more specific examples, R6 is selected from C1-C3 haloalkoxy or C1-C3 haloalkylthio; R7 and R8 are independently selected from hydrogen, halogen, C1-C3 haloalkyl, C1-C3 alkoxy; in some embodiments, R7 and R8 are not hydrogen at the same time.

[0039] The present invention further, in the compound of formula (III), R6 is selected from HetAr 1 It is a substituted or unsubstituted 4-6 membered monocyclic heterocyclic ring having 1 to 3 heteroatoms independently selected from N, O or S; and is connected to the adjacent benzene ring to form a condensed ring; the substituents are selected from hydrogen and halogen; R7 and R8 are independently selected from hydrogen and halogen; in some embodiments, R7 and R8 are not hydrogen at the same time.

[0040] The present invention further provides a compound of the following formula (III-1) or a pharmaceutically acceptable salt thereof:

[0041] R6 is selected from hydrogen, halogen, cyano, hydroxy, carboxyl, COOR, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, C1-C6 haloalkoxy, C1-C6 alkylthio, C1-C6 haloalkylthio, C1-C6 alkylamino, C1-C6 haloalkylamino, HetAr 3 ; R is a C1-C6 alkyl group;

[0042] HetAr 3 It is a substituted or unsubstituted 4-6 membered monocyclic heterocyclic ring having 1 to 3 heteroatoms independently selected from N, O or S; and is connected to the adjacent benzene ring to form a condensed ring; the substituent is selected from hydrogen, halogen, hydroxyl, and carboxyl;

[0043] R0 is H or R7, R8 are independently selected from chlorine, C1-C6 haloalkylamino, HetAr 4 、 HetAr 4 is an optionally substituted 4-10 membered heterocyclic ring or 5-10 membered aromatic ring having 1 to 3 heteroatoms independently selected from N, O or S; a is selected from hydrogen, halogen, hydroxy, carboxyl, C1-C6 alkyl, C1-C6 haloalkyl, R b and R c independently selected from hydrogen, halogen, hydroxy, carboxyl, C1-C6 alkyl, C1-C6 haloalkyl; or R b and R c Together with the nitrogen atom to which they are attached, they further form an optionally substituted saturated 5- to 6-membered heterocyclic ring, wherein the 5- to 6-membered heterocyclic ring may optionally contain heteroatoms in N and O, and the substituents of the optionally substituted saturated 5- to 6-membered heterocyclic ring are independently selected from hydrogen, halogen, hydroxyl, carboxyl, COOR, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, C1-C6 haloalkoxy, C1-C6 alkylamino, and C1-C6 haloalkylamino.

[0044] In some examples, R6 is selected from C1-C6 haloalkoxy or C1-C6 haloalkylthio; preferably, R6 is selected from C1-C3 haloalkoxy or C1-C3 haloalkylthio; more preferably, R6 is trifluoromethyloxy.

[0045] In some instances, R7 is selected from F, Cl, or Br.

[0046] In some instances, R0 is H.

[0047] In some embodiments, R7 is halogen; R8 is selected from HetAr 4 or Preferably, HetAr 4is an optionally substituted 4-10 membered heterocyclic ring having 1 to 3 heteroatoms independently selected from N, O or S, preferably HetAr 4 The substituents are selected from hydrogen, halogen, hydroxy, carboxyl, methyl, ethyl, propyl, butyl, C1-C3 haloalkyl.

[0048] In some instances, R a is selected from hydrogen, halogen, hydroxy, carboxyl, methyl, ethyl, propyl, butyl, R b and R c independently selected from hydrogen, halogen, hydroxy, carboxyl, methyl, ethyl, propyl, butyl; or R b and R c Together with the nitrogen atom to which they are attached, they further form an optionally substituted saturated 5- to 6-membered heterocyclic ring containing N and O, wherein the substituents of the 5- to 6-membered heterocyclic ring are independently selected from hydrogen, halogen, hydroxyl, carboxyl, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, C1-C6 haloalkoxy, C1-C6 alkylamino, and C1-C6 haloalkylamino; preferably, R b and R c independently selected from methyl, ethyl, propyl, butyl; or R b and R c Together with the nitrogen atom to which they are attached, they further form a saturated 5- to 6-membered heterocyclic ring containing N and O.

[0049] The present invention also provides compounds 1-7 and 9-51 as shown below, or pharmaceutically acceptable salts thereof:

[0050] Another aspect of the present invention relates to a method for preparing a compound of formula (I) or a pharmaceutically acceptable salt thereof, the method comprising:

[0051] Nucleophilic substitution occurs between a compound of formula (Ia) or a pharmaceutically acceptable salt thereof and a compound of formula (Ib) or a pharmaceutically acceptable salt thereof to obtain a compound of formula (I) or a pharmaceutically acceptable salt thereof;

[0052] Wherein B is a halogen; preferably a chlorine atom; X, Y, R1, and R2 are as defined in formula (I).

[0053] Another aspect of the present invention relates to a method for preparing a compound of formula (II) or a pharmaceutically acceptable salt thereof, the method comprising:

[0054] Nucleophilic substitution occurs between a compound of formula (IIa) or a pharmaceutically acceptable salt thereof and a compound of formula (IIb) or a pharmaceutically acceptable salt thereof to obtain a compound of formula (II) or a pharmaceutically acceptable salt thereof;

[0055] Wherein B is a halogen; preferably a chlorine atom; R3 and R4 are as defined in formula (II).

[0056] Another aspect of the present invention relates to a method for preparing a compound of formula (III) or a pharmaceutically acceptable salt thereof, the method comprising:

[0057] Nucleophilic substitution occurs between a compound of formula (IIIa) or a pharmaceutically acceptable salt thereof and a compound of formula (IIIb) or a pharmaceutically acceptable salt thereof to obtain a compound of formula (III) or a pharmaceutically acceptable salt thereof;

[0058] Wherein B is a halogen; preferably a chlorine atom; R6, R7, and R8 are as defined in formula (III).

[0059] The present invention also provides a pharmaceutical composition comprising the compound of the present invention or a pharmaceutically acceptable salt thereof and one or more pharmaceutically acceptable carriers.

[0060] The present invention also provides use of the compound of the present invention or a pharmaceutically acceptable salt thereof as a microRNA-124 regulator.

[0061] The present invention also provides the compound of the present invention or a pharmaceutically acceptable salt thereof for use in preventing or treating inflammatory diseases.

[0062] The inflammatory diseases described in the present invention include, but are not limited to, inflammatory bowel disease, rheumatoid arthritis, Crohn's disease, ulcerative colitis, multiple sclerosis, Alzheimer's disease, Parkinson's disease, osteoarthritis, atherosclerosis, ankylosing spondylitis, psoriasis, dermatitis, Sjogren's syndrome, bronchitis, asthma and inflammation associated with colon cancer, and specifically inflammatory bowel disease, rheumatoid arthritis, Crohn's disease, ulcerative colitis, multiple sclerosis, osteoarthritis, ankylosing spondylitis, psoriasis, Sjogren's syndrome, bronchitis and inflammation associated with colon cancer.

[0063] The present invention also encompasses methods for synthesizing the compounds of the present invention or pharmaceutically acceptable salts thereof.

[0064] In the present application, the term "pharmaceutically acceptable salt" includes pharmaceutically acceptable acid addition salts and pharmaceutically acceptable base addition salts.

[0065] The term "alkyl," as used alone or as part of a larger group, such as "alkoxy," "alkylamino," and similar terms, means a saturated aliphatic linear or branched monovalent hydrocarbon radical. Unless otherwise specified, an alkyl group generally has 1 to 6 carbon atoms, i.e., (C1-C6)alkyl. As used herein, (C1-C6)alkyl means a radical having 1 to 6 carbon atoms in a linear or branched arrangement. Examples include methyl, ethyl, n-propyl, isopropyl, and the like.

[0066] "Alkenyl" means a branched or straight-chain monovalent hydrocarbon radical containing at least one double bond. Alkenyl groups can be monounsaturated or polyunsaturated and can exist in E or Z configuration. Unless otherwise specified, alkenyl groups generally have 2-6 carbon atoms, i.e., (C2-C6)alkenyl. For example, "(C2-C6)alkenyl" means a radical having 2-6 carbon atoms in a linear or branched arrangement. "Alkynyl" means a branched or straight-chain monovalent hydrocarbon radical containing at least one triple bond. Unless otherwise specified, alkynyl groups generally have 2-6 carbon atoms, i.e., (C2-C6)alkynyl. For example, "(C2-C6)alkynyl" means a radical having 2-6 carbon atoms in a linear or branched arrangement.

[0067] "Alkoxy" means an alkyl radical attached through an oxygen linking atom, represented by -O-alkyl. For example, "(C1-C6)alkoxy" includes methoxy, ethoxy, propoxy, and butoxy.

[0068] "Alkylthio" means an alkyl radical attached through a sulfur linking atom, represented by -S-alkyl. For example, "(C1-C6)alkylthio" includes methylthio, ethylthio, propylthio, and butylthio.

[0069] "Cycloalkyl" means a saturated aliphatic cyclic hydrocarbon radical, generally containing 3-6 ring carbon atoms, i.e., (C3-C6)cycloalkyl. (C3-C6)cycloalkyl includes, but is not limited to, cyclopropyl, cyclobutyl, cyclopentyl, and cyclohexyl.

[0070] The term "alkylamino" means an alkyl or alkoxy group, as appropriate, attached to one or more amino groups. It is represented by -N-alkyl, -NH-alkyl, or NH2-alkyl. For example, "(C1-C6)alkylamino" includes methoxy, ethoxy, propoxy, and butoxy.

[0071] "Monocyclic heterocycle," when used alone or as part of a larger group, means a saturated or unsaturated 4-7 membered ring radical, optionally containing one or more double bonds, generally having 4-7 ring atoms selected from carbon and at least one (generally 1 to 4, more generally 1 or 2) heteroatom (e.g., oxygen, nitrogen). A "substituted monocyclic heterocycle" is substituted at any one or more substitutable ring atoms (ring carbon atoms bonded to hydrogen). A "monocyclic saturated heterocycle" means a saturated 4-7 membered ring radical, not containing double bonds, generally having 4-7 ring atoms selected from carbon and at least one (generally 1 to 4, more generally 1 or 2) heteroatom (e.g., oxygen, nitrogen). The term "monocyclic heterocyclyl" is intended to include all possible isomeric forms.

[0072] "Monocyclic aromatic heterocycle" when used alone or as part of a larger group means an unsaturated 4-6 membered ring radical, generally an aromatic ring group having 4-6 ring atoms selected from carbon and at least one (generally 1 to 4, more generally 1 or 2) heteroatom (e.g., oxygen, nitrogen). Examples of monocyclic 4-6 membered heteroaryl groups include furanyl (e.g., 2-furanyl, 3-furanyl), imidazolyl (e.g., N-imidazolyl, 2-imidazolyl, 4-imidazolyl, 5-imidazolyl), isoxazolyl (e.g., 3-isozolyl, 4-isozolyl, 5-isozolyl), oxadiazolyl (e.g., 2-oxadiazolyl, 5-oxadiazolyl), oxazolyl (e.g., 2-oxazolyl, 4-oxazolyl, 5-oxazolyl), pyrazolyl (e.g., 3-pyrazolyl, 4-pyrazolyl), pyrrolyl (e.g., 1-pyrrole), pyrrole, ... yl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl), isothiazolyl, triazolyl (e.g., 2-triazolyl, 5-triazolyl), tetrazolyl (e.g., tetrazolyl), and thienyl (e.g., 2-thienyl, 3-thienyl).

[0073] "Fused ring" means a bicyclic ring system consisting of two adjacent rings having two atoms in common.

[0074] Certain compounds described herein may exist as various stereoisomers or tautomers. Stereoisomers are compounds that differ only in their arrangement in space. When a compound of the present disclosure is named or shown by structure without specifying stereochemistry, it is to be understood that the name or structure encompasses all possible stereoisomers, geometric isomers, including substantially pure stereo or geometric isomers and combinations thereof. DETAILED DESCRIPTION

[0075] The present invention will be further described below in conjunction with specific examples, based on common technical knowledge and customary means in the art. The following examples are only some preferred embodiments of the present invention and should not be regarded as limiting the present invention. It is obvious to those skilled in the art that several modifications can be made without departing from the scope of the present invention, and these modifications should also be regarded as the scope of protection of the present invention.

[0076] Example 1: Synthesis of Compound 1

[0077] A 25 ml round-bottom flask was filled with nitrogen, and compound 1a (198 mg, 1.0 mmol, Bidex Pharmaceuticals), compound 1b (189 mg, 1.0 mmol, Bidex Pharmaceuticals), Xantphos (29 mg, 0.05 mmol), Pd(OAc)2 (8.5 mg, 0.05 mmol), cesium carbonate (978 mg, 3.0 mmol), and tert-butanol (10 mL) were added in sequence. The mixture was heated to 100 ° C. and reacted for 20 h. The reaction was stopped, and the mixture was evaporated under reduced pressure, water (40 mL) was added, and the mixture was extracted with ethyl acetate (3×25 mL). The mixture was washed with saturated brine and dried over anhydrous sodium sulfate. The organic phases were combined and purified by column chromatography (PE / EA=100:1-10:1, v / v) to give compound 1 (200 mg).

[0078] 1 H NMR(400MHz, DMSO-d6)δ10.51(s,1H),8.48–8.41(m,2H),8.29(d,J=8.9Hz,1H),8.09(d,J=8.6Hz,2H), 7.87 (dd, J=7.6, 1.4Hz, 1H), 7.83 (dd, J=8.1, 1.3Hz, 1H), 7.39 (t, J=7.8Hz, 1H), 7.28 (d, J=8.9Hz, 1H).

[0079] ESI-MS: m / z 351[M+H] + .

[0080] Example 2: Synthesis of Compound 2

[0081] To a 75 mL sealed tube, compound 1a (800 mg, 1.0 eq, Bidex Pharmaceuticals), compound 2a (519 mg, 1.2 eq, Anaiji Chemical), Pd(OAc)2 (91 mg, 0.1 eq), cesium carbonate (2.6 g, 2.0 eq), and Xantphos (701 mg, 0.3 eq) were added. Tert-butanol (10 mL) was added, mixed, and then protected with argon. The mixture was heated in an oil bath at 110°C with stirring for 20 h. The reaction was stopped, and methanol (20 mL) was added. The mixture was filtered, and the filter cake was washed with methanol. The filtrate was concentrated and purified by column chromatography (PE:EA = 100:1-4:1, v / v) to obtain compound 2 (230 mg).

[0082] 1 H NMR(400MHz, DMSO-d6)δ7.92(d,J=9.0Hz,1H),7.86(t,J=5.9Hz,1H),7.65–7.57(m,2H),7.52–7.42(m,2H),7 .36–7.28(m,2H),7.24(d,J=7.3Hz,1H),7.11(t,J=7.8Hz,1H),6.88(d,J=8.9Hz,1H),4.68(d,J=5.9Hz,2H).

[0083] ESI-MS: m / z 269.1[M+H] + .

[0084] Example 3: Synthesis of Compound 3

[0085] The preparation method of the above compound 3b is as follows:

[0086] To a sealed tube were added compound 1a (2 g, 1.0 eq, Bidex Pharmaceuticals), compound 3a (3.67 g, 2.0 eq, Bidex Pharmaceuticals), Pd2(dba)3 (925 mg, 0.1 eq), BINAP (1.26 g, 0.2 eq), and Cs2CO3 (9.87 g, 3.0 eq). 1,4-dioxane (20 mL) was added, and the mixture was heated and stirred at 100°C. After the reaction was completed, water (100 mL) was added, and the mixture was extracted with ethyl acetate (3 × 50 mL). The organic phases were combined, dried over anhydrous sodium sulfate, concentrated under reduced pressure, and purified by column chromatography (PE / EA = 100:1-3:1, v / v) to give crude product 3b (4 g).

[0087] The preparation method of the above compound 3c is:

[0088] The crude compound 3b (4 g) obtained in Preparation Example 1 was dissolved in tetrahydrofuran (10 mL) in a single-necked bottle, and concentrated hydrochloric acid was added dropwise to precipitate a white solid at the bottom of the bottle. The solid was filtered and the filter cake was dried to obtain compound 3c (2 g).

[0089] The preparation method of the above compound 3d is:

[0090] Compound 3c (1.75 g, 1.0 eq), (Boc)2O (3.72 g, 2.1 eq, Anaiji Chemical), DIPEA (3.15 g, 3.0 eq), and 4-DMAP (994 mg, 1.0 eq) were added to a sealed tube, followed by 1,4-dioxane (20 mL). The mixture was heated and stirred at 100°C overnight. After the reaction, 100 mL of ethyl acetate (3 × 50 mL) was added, and the organic phases were combined, dried over anhydrous sodium sulfate, concentrated under reduced pressure, and purified by column chromatography (PE / EA = 100:1-3:1, v / v) to afford compound 3d (740 mg).

[0091] The preparation method of the above compound 3f is:

[0092] Compound 3d (740 mg, 1.0 eq) was added to a single-necked flask and dissolved in 10 mL of DMF. NaH (159 mg, 1.5 eq) was then added and stirred at room temperature for 0.5 h. Compound 3e (353 mg, 1.1 eq, Anaiji Chemical) was then added and stirred at room temperature. After completion of the reaction, water (20 mL) was added and the mixture was extracted with ethyl acetate (3 × 15 mL). The organic phases were combined, dried over anhydrous sodium sulfate, and concentrated under reduced pressure to afford compound 3f (400 mg), which was used directly in the next step without purification.

[0093] Synthesis of the above compound 3:

[0094] Compound 3f and HCl / EA (2 mL, 10 eq) were added to a single-necked bottle and stirred at room temperature overnight. After the reaction was completed, the reaction solution was dried and purified by column chromatography to obtain compound 3 (220 mg).

[0095] 1 H NMR (400MHz, DMSO-d6) δ7.92(d,J=8.9Hz,1H),7.62(ddd,J=12.8,7.8,1.5Hz,2H),7.48(t,J=5.6Hz,1H),7.11(t,J=7.7Hz,1H),6.87(d,J =8.9Hz,1H),6.02(ddt,J=17.3,10.6,5.5Hz,1H),5.29(dq,J=17.2,1.8Hz,1H),5.12(dq,J=10.2,1.6Hz,1H),4.13(tt,J=5.6,1.6Hz,2H).

[0096] ESI-MS: m / z 219.1[M+H] + .

[0097] Example 4: Synthesis of Compound 4

[0098] The preparation method of the above compound 3f is:

[0099] Compound 4a (2 g, 1.0 eq, Bidex Pharmaceuticals), reduced iron powder (1.73 g, 3.0 eq), and ammonium chloride (498 mg, 0.9 eq) were added to a single-necked flask. A mixed solvent (10 mL, ethanol / water = 3:1, v / v) was added and heated under reflux at 80°C for approximately 12 h. After the reaction was complete, methanol was added to dissolve the mixture and filtered. The filter cake was rinsed with methanol, dried, and purified by column chromatography to obtain compound 4b (1.6 g). Synthesis of Compound 4:

[0100] Compound 4b (200 mg, 1.0 eq), compound 1a (218 mg, 0.9 eq, Bidex Pharmaceuticals), Pd(OAc)2 (28 mg, 0.1 eq), cesium carbonate (799 mg, 2.0 eq), and Xantphos (213 mg, 0.3 eq) were added to a sealed tube. Tert-butanol (10 mL) was added and mixed thoroughly. After replacing the atmosphere with argon, the tube was sealed and heated in an oil bath at 110°C with stirring for 4 h. After completion of the reaction, 20 mL of methanol was added, the mixture was filtered, and the filter cake was washed with methanol. The filtrate was concentrated and purified by column chromatography (PE:EA = 100:1-4:1, v / v) to afford compound 4 (80 mg).

[0101] 1 H NMR (400MHz, DMSO-d6) δ9.76 (s, 1H), 8.73 (d, J = 2.7Hz, 1H), 8.28 (dd, J = 9.0, 2.8Hz, 1H), 8.11 (d, J = 8.9Hz, 1H), 7.74 (dd, J = 17.9, 7.7 Hz, 2H), 7.26 (t, J = 7.7 Hz, 1H), 7.07 (t, J = 9.5 Hz, 2H), 4.52 (t, J = 6.4 Hz, 2H), 2.79 (t, J = 6.4 Hz, 2H).

[0102] ESI-MS: m / z 325.2[M+H] + .

[0103] Example 5: Synthesis of Compound 5

[0104] The preparation method of the above compound 5b is:

[0105] A 100 ml round-bottom flask was filled with nitrogen, and sodium hydroxide (12 g, 299 mmol) and DMF (50 mL) were added in sequence. The temperature was raised to 95 ° C for reaction for 0.5 h, and then a DMF solution of compound 5a (5 g, 29.9 mmol, Bidex Pharmaceuticals) and 2-chloro-2,2-difluoroacetic acid sodium (23 g, 149 mmol, Bidex Pharmaceuticals) was added dropwise. After the addition, the reaction was continued for 1.5 h. After the reaction was completed, 100 mL of water was added, and the mixture was extracted with ethyl acetate (3×50 mL). The mixture was washed with saturated brine, dried over anhydrous sodium sulfate, and the organic phases were combined and concentrated. The crude product was purified by silica gel column chromatography (PE:EA=100:1-15:1, v / v) to obtain compound 5b (5.6 g).

[0106] The preparation method of the above compound 5c is:

[0107] Compound 5b (3 g, 13.8 mmol), 10% palladium carbon (300 mg) and methanol (20 mL) were added sequentially to a 50 mL round-bottom flask. The mixture was reacted at room temperature under a hydrogen atmosphere overnight. After completion of the reaction, the filter cake was washed with methanol and concentrated to obtain compound 5c (2.56 g).

[0108] Synthesis of compound 5

[0109] A 25 ml round-bottom flask was filled with nitrogen, and compound 1a (198 mg, 1.0 mmol, Bidex Pharmaceuticals), compound 5c (187 mg, 1.0 mmol), Xantphos (29 mg, 0.05 mmol), Pd(OAc)2 (8.5 mg, 0.05 mmol), cesium carbonate (978 mg, 3.0 mmol), and tert-butanol (10 mL) were added in sequence. The mixture was heated to 100 ° C. and reacted for 20 hours. The reaction was stopped and evaporated to dryness under reduced pressure. 40 mL of water was added, and the mixture was extracted with ethyl acetate (3×25 mL). The mixture was washed with saturated brine and dried over anhydrous sodium sulfate. The organic phases were combined and concentrated. The crude product was purified by silica gel column chromatography (PE:EA=100:1-10:1, v / v) to obtain compound 5 (156 mg).

[0110] 1 H NMR (400MHz, DMSO-d6) δ9.79(s,1H),8.51(d,J=2.3Hz,1H),8.12(d,J=8.8Hz,1H),8.04(dd,J=8.9,2.5Hz,1H),7. 75(dd,J=16.6,7.8Hz,2H),7.27(t,J=7.6Hz,1H),7.10(t,J=8.9Hz,2H),6.70(d,J=7.7Hz,1H),5.39–5.29(m,1H).

[0111] ESI-MS: m / z 349.2[M+H] + .

[0112] Example 6: Synthesis of Compound 6

[0113] The preparation method of the above compound 6a is:

[0114] Compound 5b (1.0 g, 4.61 mmol) and anhydrous THF (15 mL) were added to a 50 mL round-bottom flask and cooled to 0°C. NaH (221 mg, 5.53 mmol) and p-toluenesulfonyl chloride (1.76 g, 9.21 mmol) were added portionwise. The reaction was continued at 10°C for 3 h. After completion of the reaction, saturated ammonium chloride solution was added to quench the reaction. The mixture was extracted with ethyl acetate (3 × 25 mL), washed with saturated brine, dried over anhydrous sodium sulfate, and the organic phases were combined and concentrated. The crude product was purified by silica gel column chromatography (PE / EA = 100:1-25:1, v / v) to obtain compound 6a (1.0 g).

[0115] The preparation method of the above compound 6b is:

[0116] To a 50 ml round-bottom flask were added compound 6a (1 g, 2.69 mmol), 10% palladium on carbon (300 mg), ethyl acetate (15 mL) and tetrahydrofuran (15 mL) in sequence. The mixture was reacted at room temperature under a hydrogen atmosphere overnight. After completion of the reaction, the mixture was filtered, and the filter cake was washed with methanol and concentrated to obtain compound 6c (400 mg).

[0117] Synthesis of compound 6

[0118] A 25 ml round-bottom flask was filled with nitrogen, and compound 1a (198 mg, 1.0 mmol, Bidex Pharmaceuticals), compound 6b (171 mg, 1.0 mmol), Xantphos (29 mg, 0.05 mmol), Pd(OAc)2 (8.5 mg, 0.05 mmol), cesium carbonate (978 mg, 3.0 mmol), and tert-butanol (10 mL) were added in sequence. The mixture was heated to 100 ° C. and reacted for 20 hours. The reaction was stopped and evaporated to dryness under reduced pressure. 40 mL of water was added, and the mixture was extracted with ethyl acetate (3×25 mL). The mixture was washed with saturated brine and dried over anhydrous sodium sulfate. The organic phases were combined and concentrated. The crude product was purified by silica gel column chromatography (PE / EA=100:1-10:1, v / v) to obtain compound 6 (90 mg).

[0119] 1H NMR(400MHz, DMSO-d6)δ9.76(s,1H),8.36(s,1H),8.11(d,J=8.9Hz,1H),7.97(d,J=8.8Hz,1H),7.79– 7.75(m,1H),7.74–7.70(m,1H),7.26(t,J=7.8Hz,1H),7.09(t,J=8.7Hz,2H),3.87(t,J=14.6Hz,2H).

[0120] ESI-MS: m / z 333.2[M+H] + .

[0121] Example 7: Synthesis of Compound 7

[0122] The preparation method of the above compound 7a is:

[0123] Compound 4a (1 g, 1.0 eq, Bidex Pharmaceuticals), TFA (10 mL), and CHCl₃ (4 mL) were added sequentially to a single-necked flask and stirred to dissolve. Trimethylsilane (1 g, Anaiji Chemical) was then slowly added dropwise and stirred at room temperature overnight. After completion of the reaction, 50 mL of water was added, and the mixture was extracted with dichloromethane (3 × 25 mL), washed with saturated brine, dried over anhydrous sodium sulfate, and the organic phases were combined and concentrated to afford crude compound 7a (900 mg).

[0124] The preparation method of the above compound 7b is:

[0125] Compound 7a (900 mg, 1.0 eq) was added to a single-necked bottle, dissolved in methanol, and then 10% palladium carbon (50 mg) was added to replace the hydrogen atmosphere. The mixture was heated at 40°C for overnight reaction. After the reaction was complete, the palladium carbon was removed by filtration and the filtrate was concentrated to obtain compound 7b (450 mg).

[0126] Synthesis of compound 7:

[0127] Compound 7b (440 mg, 1.0 eq), compound 1a (292 mg, 0.5 eq, Bidex Pharmaceuticals), Pd(OAc)2 (66 mg, 0.1 eq), cesium carbonate (1.92 g, 2.0 eq), and Xantphos (512 mg, 0.3 eq) were added to a sealed tube. 3 mL of tert-butanol (3 mL) was added and mixed thoroughly. The atmosphere was replaced with argon, and the tube was sealed. The mixture was heated in an oil bath at 110°C with stirring for 4 h. After the reaction, 2 times the volume of methanol was added, the mixture was filtered, and the filter cake was washed with methanol. The organic phase was dried and purified by column chromatography (PE / EA: 100:1-3:1, v / v) to afford compound 7 (50 mg).

[0128] 1H NMR (400MHz, DMSO-d6) δ9.48 (s, 1H), 8.19 (d, J = 2.6Hz, 1H), 8.05 (d, J = 8.9Hz, 1H),7.73(dd,J=7.6,1.4Hz,1H),7.68(dd,J=8.0,1.3Hz,1H),7.61(dd,J=8.7,2.7Hz,1H),7.22(t,J=7.8Hz,1H),7.0 6(d,J=9.0Hz,1H), 6.71(d,J=8.8Hz,1H), 4.11(t,J=5.1Hz,2H), 2.78(t,J=6.5Hz,2H), 1.94(dq,J=10.4,6.0Hz,2H).

[0129] ESI-MS: m / z 311.2[M+H] + .

[0130] Example 8: Synthesis of Compound 8 (PCT / CN2022 / 095441 Publication Example 1)

[0131] A 25 ml round-bottom flask was filled with nitrogen, and compound 1a (198 mg, 1.0 mmol, Bidex Pharmaceuticals), compound 8a (173 mg, 1.0 mmol, Bidex Pharmaceuticals), Xantphos (29 mg, 0.05 mmol), Pd(OAc)2 (8.5 mg, 0.05 mmol), cesium carbonate (978 mg, 3.0 mmol), and tert-butanol (10 mL) were added in sequence. The mixture was heated to 100 ° C. and reacted for 20 hours. The reaction was stopped and evaporated to dryness under reduced pressure. 40 mL of water was added, and the mixture was extracted with ethyl acetate (3×25 mL). The mixture was washed with saturated brine and dried over anhydrous sodium sulfate. The organic phases were combined and concentrated. The crude product was purified by column chromatography (PE / EA=100:1-10:1, v / v) to obtain compound 8 (89 mg);

[0132] 1 H NMR (400MHz, DMSO-d6) δ9.99(s,1H),8.88(d,J=2.1Hz,1H),8.17(d,J=8.9Hz,1H),7.81(dd,J=7.6,1.4Hz,1H),7.76(d d,J=8.0,1.4Hz,1H),7.49(dd,J=8.8,2.1Hz,1H),7.38(d,J=8.8Hz,1H),7.31(t,J=7.8Hz,1H),7.13(d,J=8.9Hz,1H).

[0133] ESI-MS: m / z 335.1[M+H] + .

[0134] Example 9: Synthesis of Compound 9

[0135] A 25 ml round-bottom flask was filled with nitrogen, and compound 1a (300 mg, 2.1 mmol, Bid Pharmaceutical), compound 9a (300 mg, 1.5 mmol, Anaiji Chemical), Xantphos (29 mg, 0.05 mmol), Pd(OAc)2 (8.5 mg, 0.05 mmol), cesium carbonate (978 mg, 3.0 mmol), tert-butanol (10 mL) were added in sequence. The mixture was heated to 90 ° C for 20 hours, the reaction was stopped, and the mixture was evaporated to dryness under reduced pressure. 40 mL of water was added, and the mixture was extracted with ethyl acetate (3×25 mL), washed with saturated brine, dried over anhydrous sodium sulfate, and the organic phases were combined and concentrated. The crude product was purified by silica gel column chromatography (PE / EA=100:1-10:1, v / v) to give compound 9 (210 mg);

[0136] 1 H NMR(400MHz,DMSO-d6)δ9.98(s,1H),9.43(d,J=2.1Hz,1H),8.18(d,J=8.9Hz,1H),7.93– 7.71 (m, 6H), 7.49 (t, J = 7.5Hz, 1H), 7.34 (dt, J = 18.0, 7.6Hz, 2H), 7.23 (d, J = 8.9Hz, 1H).

[0137] ESI-MS: m / z 305.1[M+H] + .

[0138] Example 10: Synthesis of Compound 10

[0139] Compound 1a (200 mg, 1 mmol, Bidex Pharmaceuticals), compound 10a (175 mg, 1.2 mmol, Bidex Pharmaceuticals), Pd2(dba)3 (92.5 mg, 0.1 mmol), BINAP (188.6 mg, 0.3 mmol) and Cs2CO3 (658 mg, 2 mmol) were added into a sealed tube, tert-butanol (10 mL) was added as solvent, Ar was replaced, and the reaction was carried out at 90°C for 3 h; after the reaction was completed, the reaction was stopped, evaporated to dryness under reduced pressure, 40 mL of water was added, and the mixture was extracted with ethyl acetate (3×25 mL), washed with saturated brine, dried over anhydrous sodium sulfate, the organic phases were combined and concentrated, and the crude product was purified by silica gel column chromatography (PE / EA=100:1-2:1, v / v) to obtain compound 10 (110 mg).

[0140] 1H NMR (400MHz, DMSO-d6) δ10.13(s,1H),9.48(s,1H),8.74(d,J=4.2Hz,1H),8.21(dd,J=8.6,4.0Hz,2H),7.98(d,J=3.1Hz,2 H), 7.85 (d, J = 7.6Hz, 1H), 7.79 (d, J = 7.9Hz, 1H), 7.49 (dd, J = 8.3, 4.2Hz, 1H), 7.34 (t, J = 7.7Hz, 1H), 7.25 (d, J = 8.9Hz, 1H).

[0141] ESI-MS: m / z 306.2[M+H] + .

[0142] Example 11: Synthesis of Compound 11

[0143] Compound 1a (200 mg, 1 mmol, Bidex Pharmaceuticals), compound 11a (283.6 mg, 1.5 mmol), and trifluoroacetic acid (138.2 mg, 1.2 mmol, Anaiji Chemical) were added to a sealed tube, and isopropanol (6 mL) was added as the solvent. Ar was replaced and the reaction was carried out at 90°C for 12 h. After the reaction, water was added to the reaction solution for quenching. The mixture was extracted with DCM (20 mL × 4). The organic phases were separated and combined, washed with saturated NaCl solution, dried over anhydrous Na2SO4, and concentrated in vacuo to obtain the crude product. The product was purified by column chromatography (DCM / MeOH = 100:1-10:1, v / v) to obtain product 11 (37 mg).

[0144] 1 H NMR (400MHz, DMSO-d6) δ10.17(s,1H),9.51(s,1H),8.51(s,1H),8.22(d,J=8.7Hz,1H),8.06(d,J=8.6Hz ,1H),7.95(d,J=8.3Hz,1H),7.83(dd,J=23.2,9.0Hz,3H),7.36(d,J=7.9Hz,1H),7.26(d,J=8.8Hz,1H).

[0145] ESI-MS: m / z 349.2[M+H] + .

[0146] Example 12: Synthesis of Compound 12

[0147] Compound 1a (200 mg, 1 mmol, Bidex Pharmaceuticals), compound 12a (336 mg, 1.5 mmol, Anaiji Chemicals), and p-toluenesulfonic acid (174 mg, 1 mmol) were added to a sealed tube. Isopropanol (6 mL) was added as the solvent, and the mixture was purged with Ar. The reaction was allowed to proceed at 90°C for 12 h. After the reaction, water was added to the reaction solution for quenching. The mixture was extracted with EA (20 mL × 4). The organic phases were separated and combined, washed with saturated NaCl solution, dried over anhydrous Na2SO4, and concentrated in vacuo to obtain the crude product. The product 12 (100 mg) was purified by column chromatography (DCM / MeOH = 100:1-10:1, v / v).

[0148] 1 H NMR (400MHz, DMSO-d6) δ10.07(s,1H),9.45(d,J=2.1Hz,1H),8.20(d,J=8.9Hz,1H),8.13–8.07(m,1H),7.88(d,J=8. 9Hz, 1H), 7.84 (d, J = 7.7Hz, 1H), 7.82–7.72 (m, 3H), 7.62–7.56 (m, 1H), 7.33 (t, J = 7.8Hz, 1H), 7.23 (d, J = 8.9Hz, 1H).

[0149] ESI-MS: m / z 383.1[M+H] + .

[0150] Example 13: Synthesis of Compound 13

[0151] The preparation method of the above compound 13b is:

[0152] Under ice-bath cooling, NaH (1.26 g, 31.5 mmol) was added portionwise to a solution of compound 13a (2.0 g, 10.5 mmol, Bidex Pharmaceuticals) in DMF (20 mL) in a 75 mL sealed tube. After stirring for 10 minutes, t-BuOK (1.3 g, 11.6 mmol) and CF2Br2 (8.8 g, 42.0 mmol, Anaiji Chemical) were added portionwise to the mixture. The sealed tube was quickly sealed and heated to 70 ° C to react overnight. After the reaction was completed, water was added to the reaction solution for quenching, and it was extracted with EA (20 mL × 4). The organic phases were separated and combined, washed with saturated NaCl solution, dried over anhydrous Na2SO4, filtered, concentrated, and purified by column chromatography (PE = 100%) to obtain compound 13b (1.8 g) as a colorless oil.

[0153] The preparation method of the above compound 13c is as follows:

[0154] Compound 13b (4.0 g, 11.4 mmol) was dissolved in anhydrous DCM (60 mL) under N2, cooled to -78 ° C, and then AgBF4 (4.9 g, 25.2 mmol, Anaiji Chemical) was added and the reaction solution was slowly warmed to room temperature and stirred overnight. NaHCO3 solution was added to the mixture until pH>8. DCM (30 mL × 4) was used for extraction, and the organic phases were separated and combined, washed with saturated NaCl solution, dried over anhydrous Na2SO4, filtered, and concentrated to give compound 13c (2.2 g) in the form of a brown oil. The preparation method of the above compound 13d is as follows:

[0155] Compound 13c (210 mg, 0.72 mmol), benzophenone imine (156 mg, 0.86 mmol, Bidex Pharmaceuticals), Pd2(dba)3 (16 mg), BINAP (11 mg), potassium tert-butoxide (112 mg, 1.0 mmol), and 5 mL of anhydrous dioxane were added sequentially to a 25 mL sealed tube and heated to 90°C for 4 h. After completion of the reaction, water was added for quenching, and the mixture was extracted with EA (20 mL x 4). The organic phases were separated and combined, washed with saturated NaCl solution, dried over anhydrous Na2SO4, filtered, concentrated, and purified by column chromatography (PE:EA = 100:1-30:1, v / v) to obtain compound 13d (200 mg).

[0156] The preparation method of the above compound 13e is as follows:

[0157] Compound 13d (200 mg, 0.51 mmol) was dissolved in 5 mL of methanol, and 1N HCl (2 mL) was added. The mixture was reacted at room temperature for 1 h. After completion of the reaction, the mixture was concentrated to obtain compound 13e (79 mg).

[0158] Synthesis of compound 13:

[0159] To a 75 mL sealed tube were added compound 13e (270 mg, 1.52 mmol, 1.0 equiv.), isopropanol (10 mL), compound 1a (357 mg, 1.8 mmol, 1.5 eq., Bidex Pharmaceuticals), and CF3COOH (107 mg, 1.44 mmol, 1.2 eq.), sealed, and heated to 100°C for 48 hours. After completion of the reaction, the reaction solution was extracted with ethyl acetate / water. The organic phases were separated and combined, washed with saturated NaCl solution, dried over anhydrous Na2SO4, filtered, concentrated, and purified by column chromatography (PE:EA = 100:1 to 97:3, v / v) to afford compound 13 (200 mg).

[0160] 1H NMR(400MHz, DMSO-d6)δ9.64(s,1H),8.98(d,J=8.6Hz,1H),8.80–8.40(m,1H),8.21(d,J=9.0Hz,1H),8.18 –7.93(m,1H),7.95–7.61(m,4H),7.62(dd,J=8.6,1.7Hz,1H),7.49(d,J=9.0Hz,1H),7.30(t,J=7.8Hz,1H).

[0161] ESI-MS: m / z 389.2[M+H] + .

[0162] Example 14: Synthesis of Compound 14

[0163] The preparation method of the above compound 14b is as follows:

[0164] Compound 14a (350 mg, 1.72 mmol, Bidex Pharmaceuticals) was added to a single-necked bottle, dissolved in methanol, and then 10% palladium on carbon (50 mg) was added to replace the hydrogen atmosphere. The reaction was allowed to proceed overnight at room temperature. After the reaction was complete, the palladium on carbon was removed by filtration, and the filtrate was concentrated to obtain compound 14b (250 mg).

[0165] Synthesis of compound 14:

[0166] Compound 1a (200 mg, 1 mmol, Bidex Pharmaceuticals), compound 14b (210 mg, 1.2 mmol), Pd(OAc)2 (22.7 mg, 0.1 mmol), Xantphos (175.3 mg, 0.3 mmol) and Cs2CO3 (658 mg, 2 mmol) were added into a sealed tube, tert-butanol (10 mL) was added as solvent, Ar was replaced, and the reaction was carried out at 90°C for 5 h; after the reaction was completed, water was added to the reaction solution for quenching, and the reaction was carried out with EA (20 mL×4). The organic phases were separated and combined, washed with saturated NaCl solution, dried over anhydrous Na2SO4, and concentrated in vacuo to obtain the crude product; purified by column chromatography (PE / EA=100:1-3:1, v / v) to obtain compound 14 (80 mg).

[0167] 1H NMR(400MHz, DMSO-d6)δ9.31(s,1H),8.32(d,J=8.4Hz,1H),8.23(dd,J=7.7,1.9Hz,1H),8.20–8.17(m,1H),8.07(d,J=8.9Hz,1H) ,7.73–7.67(m,2H),7.57(td,J=7.8,1.4Hz,2H),7.22(t,J=7.7Hz,1H),7.14(d,J=8.9Hz,1H),7.04(d,J=8.4Hz,1H),4.01(s,3H).

[0168] ESI-MS: m / z 335.2[M+H] + .

[0169] Example 15: Synthesis of Compound 15

[0170] The preparation method of the above compound 15b is:

[0171] Compound 15a (350 mg, 1.57 mmol, Bidex Pharmaceuticals) was added to a single-necked flask, dissolved in methanol, and then 10% palladium on carbon (50 mg) was added to replace the hydrogen atmosphere. The reaction was allowed to proceed overnight at room temperature. After the reaction was complete, the palladium on carbon was removed by filtration, and the filtrate was concentrated to obtain compound 14b (220 mg).

[0172] Synthesis of compound 15: Compound 1a (200 mg, 1 mmol, Bidex Pharmaceuticals), compound 15b (195 mg, 1.2 mmol), Pd2(dba)3 (92.5 mg, 0.1 mmol), BINAP (188.6 mg, 0.3 mmol) and Cs2CO3 (658 mg, 2 mmol) were added into a sealed tube, tert-butanol (10 mL) was added as solvent, Ar was replaced, and the reaction was carried out at 90°C for 4 h; after completion of the reaction, water was added to the reaction solution, and the mixture was extracted with EA (20 mL×4), the organic phases were combined, washed with saturated NaCl solution, dried over anhydrous Na2SO4, and concentrated in vacuo to obtain the crude product; the product was purified by column chromatography (PE / EA=100:1-3:1, v / v) to obtain compound 15 (120 mg).

[0173] 1H NMR(400MHz, DMSO-d6)δ9.51(s,1H),8.64(dd,J=8.6,5.2Hz,1H),8.41–8.35(m,1H),8.15(d,J=9.0Hz,1H),8.13–8.06(m,1H),7. 74(dd,J=7.9,2.2Hz,2H), 7.68(dd,J=6.6,3.2Hz,2H), 7.40(dd,J=10.5,8.5Hz,1H), 7.34(d,J=8.9Hz,1H), 7.26(t,J=7.8Hz,1H).

[0174] ESI-MS: m / z 323.2[M+H] + .

[0175] Example 16: Synthesis of Compound 16

[0176] Compound 16a (200 mg, 1.36 mmol, Bidex Pharmaceuticals), compound 1a (140 mg, 0.71 mmol, Bidex Pharmaceuticals), and TFA (122 mg, 1.07 mmol) were added to a sealed tube and dissolved in 5 mL of isopropanol. The mixture was heated at 100°C overnight. After completion of the reaction, 10 mL of water was added and the pH was adjusted to ~8 with an appropriate amount of KCO. The mixture was extracted with dichloromethane (20 mL x 3). The organic phases were combined, washed with saturated NaCl solution, dried over anhydrous NaSO, and concentrated in vacuo to obtain the crude product. The product was then purified by column chromatography (PE / EA = 100:1-6:1, v / v) to afford compound 16 (50 mg).

[0177] 1 H NMR (400MHz, DMSO-d6) δ9.53(s,1H),8.70(d,J=2.0Hz,1H),8.05(d,J=8.9Hz,1H),7.74(dd,J=7.6,1.3Hz,1H),7.71–7.62(m,2H ), 7.41 (d, J = 8.8Hz, 1H), 7.28 (d, J = 3.0Hz, 1H), 7.22 (t, J = 7.7Hz, 1H), 7.11 (d, J = 9.0Hz, 1H), 6.38 (d, J = 3.0Hz, 1H), 3.79 (s, 3H).

[0178] ESI-MS: m / z 308.2[M+H] + .

[0179] Example 17: Synthesis of Compound 17

[0180] Compound 17a (200 mg, 1.5 mmol, Bidex Pharmaceuticals), compound 1a (149 mg, 0.75 mmol, Bidex Pharmaceuticals), and TFA (134 mg, 1.18 mmol) were added to a sealed tube and dissolved in 5 mL of isopropanol. The mixture was heated at 100°C overnight. After completion of the reaction, 10 mL of water was added and the pH was adjusted to ~8 with an appropriate amount of KCO. The mixture was extracted with dichloromethane (20 mL x 3). The organic phases were combined, washed with saturated NaCl solution, dried over anhydrous NaSO, and concentrated in vacuo to obtain the crude product. The product was then purified by column chromatography (PE / EA = 100:1-6:1, v / v) to obtain compound 17 (200 mg).

[0181] 1 H NMR (400MHz, DMSO-d6) δ9.74(s,1H),8.87(d,J=2.2Hz,1H),8.11(d,J=8.9Hz,1H),7.96(d,J=2.1Hz,1H),7.83–7.75(m, 2H),7.72(dd,J=8.0,1.3Hz,1H),7.56(d,J=8.9Hz,1H),7.26(t,J=7.8Hz,1H),7.15(d,J=8.9Hz,1H),6.99–6.92(m,1H).

[0182] ESI-MS: m / z 295.2[M+H] + .

[0183] Example 18: Synthesis of Compound 18

[0184] To a 75 mL sealed tube, compound 18a (200 mg, 1.5 mmol, Bidex Pharmaceuticals), isopropanol (10 mL), compound 1a (446 mg, 2.25 mmol, Bidex Pharmaceuticals), and CF3COOH (134 mg, 1.8 mmol) were added sequentially. The mixture was heated at 100°C for 48 hours. After completion of the reaction, 30 mL of water was added, and a solid precipitated, which was filtered to obtain compound 18 (100 mg).

[0185] 1 H NMR (400MHz, CDCl3) δ10.30 (s, 1H), 9.49 (d, J = 32.3Hz, 2H), 8.17 (d, J = 8.9Hz, 1H), 7.78 (dt, J = 13.2, 7.6Hz, 4H), 7.36–7.16 (m, 2H), 5.71 (s, 1H).

[0186] ESI-MS: m / z 295.1[M+H] + .

[0187] Example 19: Synthesis of Compound 19

[0188] To a 75 mL sealed tube, compound 1a (416 mg, 1.4 mmol), isopropanol (10 mL), compound 19a (200 mg, 2.1 mmol, Anaiji Chemical), and CF3COOH (125 mg, 1.68 mmol) were added sequentially and heated at 100°C for 48 hours. After completion of the reaction, water (30 mL) was added, and a solid precipitated, which was filtered to obtain compound 19 (200 mg).

[0189] 1 H NMR (400MHz, CDCl3) δ9.97(s,1H),9.47(d,J=2.1Hz,1H),9.34(s,1H),8.16(d,J=8.9Hz,1H),8.07(d,J=8.7Hz,1H),7.8 8(dd,J=8.8,2.2Hz,1H),7.78(ddd,J=19.0,7.8,1.4Hz,2H),7.30(t,J=7.8Hz,1H),7.20(d,J=8.9Hz,1H),5.75(s,1H).

[0190] ESI-MS: m / z 312.1[M+H] + .

[0191] Example 20: Synthesis of Compound 20

[0192] The preparation method of the above compound 20b is:

[0193] Compound 20a (350 mg, 1.83 mmol, Bidex Pharmaceuticals) was added to a single-necked bottle, dissolved in methanol, and then 10% palladium carbon (50 mg) was added to replace the hydrogen atmosphere. The reaction was allowed to proceed overnight at room temperature. After the reaction was complete, the palladium carbon was removed by filtration and the filtrate was concentrated to obtain compound 20b (230 mg).

[0194] Synthesis of compound 20:

[0195] Compound 1a (200 mg, 1 mmol, Bidex Pharmaceuticals), compound 20a (162.6 mg, 1.2 mmol), Pd2(dba)3 (92.5 mg, 0.1 mmol), BINAP (188.6 mg, 0.3 mmol) and Cs2CO3 (658 mg, 2 mmol) were added into a sealed tube, tert-butanol (10 mL) was added as solvent, the atmosphere was replaced with nitrogen, and the reaction was carried out at 90°C for 4 h. After the reaction, water was added to the reaction solution for quenching, and the solution was extracted with EA (20 mL×4). The organic phases were separated and combined, washed with saturated NaCl solution, dried over anhydrous Na2SO4, and concentrated in vacuo to obtain the crude product. The product was purified by column chromatography (PE / EA=100:1-3:1, v / v) to obtain compound 20 (100 mg).

[0196] 1 H NMR(400MHz,DMSO-d6)δ9.90(s,1H),9.16(d,J=2.1Hz,1H),8.68(s,1H),8.15(d,J=9.0Hz,1H),7.7 9(ddd,J=9.0,6.6,1.7Hz,2H),7.75(d,J=9.7Hz,2H),7.29(t,J=7.8Hz,1H),7.17(d,J=8.9Hz,1H).

[0197] ESI-MS: m / z 296.1[M+H] + .

[0198] Example 21: Synthesis of Compound 21

[0199] The preparation method of the above compound 21b is:

[0200] Compound 21a (1 g, 1.0 eq, Bidex Pharmaceuticals) and NCS (1.04 g, 1.2 eq, Bidex Pharmaceuticals) were added to a single-necked flask, along with 10 mL of chloroform. The mixture was heated at 90°C for 4 h. After completion of the reaction, the reaction solution was evaporated under reduced pressure to dryness to obtain crude compound 21b (0.6 g).

[0201] Synthesis of compound 21:

[0202] Compound 21b (300 mg, 1.0 eq), compound 21c (339 mg, 1.2 eq, Bidex Pharmaceuticals), Pd(OAc)2 (36 mg, 0.1 eq), cesium carbonate (1.04 g, 2.0 eq), and Xantphos (277 mg, 0.3 eq) were added to a sealed tube. 5 mL of tert-butanol was added, the atmosphere was replaced with argon, and the mixture was heated in an oil bath at 110°C for 10 h. After completion of the reaction, 2 volumes of methanol were added, the reaction mixture was filtered, and the filter cake was washed with methanol. The filtrate was concentrated and purified by column chromatography (PE:EA = 100:1-6:1, v / v) to afford compound 21 (30 mg).

[0203] 1 H NMR (400MHz, DMSO-d6) δ10.08(s,1H),8.71(d,J=7.5Hz,1H),8.07(s,1H),8.05–7.94(m,2H),7.39(d,J=8.6Hz,2H),6.58(d,J=7.6Hz,1H).

[0204] ESI-MS: m / z 329.1[M+H] + .

[0205] Example 22: Synthesis of Compound 22

[0206] The preparation method of the above compound 22b is:

[0207] Compound 22a (2.75 g, 1.0 eq, Bidex Pharmaceuticals) and urea (10.62 g, 10.0 eq) were added to a sealed tube and heated at 180°C with stirring for 4 h. After completion of the reaction, the mixture was cooled to room temperature and stirred with ice water. The mixture was filtered and the filter cake washed with ice water. The solid was dissolved in 200 mL of saturated sodium carbonate and 250 mL of water, and the aqueous phase was extracted with EA until free of impurities. The pH was adjusted to 5-6 with concentrated HCl, stirred for 1 h, and filtered to yield compound 22b (2.35 g).

[0208] The preparation method of the above compound 22c is as follows:

[0209] Compound 22b (2.35 g, 1.0 eq) and phosphorus oxychloride (3.99 g, 2.0 eq, Anaiji Chemical) were added to a single-necked flask, along with 20 mL of toluene. The mixture was heated under reflux at 110°C for 6 h. After completion of the reaction, the reaction solution was spin-dried to obtain compound 22c (800 mg), which was used directly in the next step without purification.

[0210] Synthesis of compound 22:

[0211] Compound 22c (800 mg, 1.0 eq), compound 21c (854 mg, 1.2 eq, Bidex Pharmaceuticals), and p-toluenesulfonic acid (830 mg, 1.0 eq) were added to a sealed tube. 2-pentanol was added for dissolution, and the mixture was heated at 105°C for 5 h. After completion of the reaction, the 2-pentanol was evaporated, 30 mL of water was added, and the mixture was extracted with EA (20 mL x 4). The organic phases were combined, washed with saturated NaCl solution, dried over anhydrous Na2SO4, and concentrated in vacuo to obtain the crude product. The crude product was then purified by column chromatography (PE / EA = 100:1-5:1, v / v) to afford 20 mg of compound 22.

[0212] 1 H NMR (400MHz, DMSO-d6) δ10.41 (s, 1H), 9.42 (s, 1H), 8.26 (d, J = 8.7Hz, 2H), 8.03 (d, J=7.6Hz, 1H), 7.95 (d, J=7.9Hz, 1H), 7.38 (d, J=9.1Hz, 3H), 7.20 (t, J=7.9Hz, 1H).

[0213] ESI-MS: m / z 340.1[M+H] + .

[0214] Example 23: Synthesis of Compound 23

[0215] The preparation method of the above compound 23b is:

[0216] Compound 23a (2 g, 1.0 eq, Bidex Pharmaceuticals), reduced iron powder (1.8 g, 3.0 eq), and NH4Cl (1.8 g, 3.0 eq) were added to a single-necked flask. 40 mL of ethanol / water (3:1) was added and refluxed at 100°C overnight. After filtering to remove the iron powder, the ethanol was dried, and the mixture was extracted with water and EA. The organic phase was dried to afford compound 23b (1.2 g).

[0217] The preparation method of the above compound 23c is:

[0218] Compound 23b (1.2 g, 1.0 eq) and urea (4.24 g, 10.0 eq, Bidex Pharmaceuticals) were added to a sealed tube and heated with stirring at 180°C for 4 h. After completion of the reaction, the mixture was cooled to room temperature and stirred with ice water. The mixture was filtered, and the filter cake was washed with ice water and dried to obtain compound 23c (1.2 g).

[0219] The preparation method of the above compound 23d is:

[0220] Compound 3 (1.1 g, 1.0 eq) and 10 mL of POCl₃ were added to a single-necked flask and stirred at reflux at 110°C for 4 h. After completion of the reaction, the majority of the POCl₃ was removed by vacuum distillation. The remaining POCl₃ was then quenched with ice water. Solid impurities were removed by filtration, and the product was extracted with EA. The organic phase was spin-dried to afford compound 23d (400 mg).

[0221] Synthesis of compound 23:

[0222] Compound 23d (400 mg, 1.0 eq), compound 21c (392 mg, 1.1 eq, Bidex Pharmaceuticals), and TsOH (415 mg, 1.2 eq) were added to a sealed tube. 2-Pentanol was added for dissolution, and the mixture was heated under reflux at 105°C for 4 h. After completion of the reaction, 2-pentanol was removed by distillation under reduced pressure. 30 mL of water was added, and the mixture was extracted with EA (20 mL x 4). The combined organic phases were washed with saturated NaCl solution, dried over anhydrous NaSO, and concentrated in vacuo to afford the crude product. Purification by column chromatography (PE / EA = 100:1-4:1, v / v) afforded compound 23 (55 mg).

[0223] 1 H NMR (400MHz, CDCl3) δ9.08 (s, 1H), 7.89–7.84 (m, 2H), 7.79 (d, J = 1.9Hz, 1H), 7.70 (d, J=8.5Hz, 1H), 7.47 (s, 1H), 7.34 (dd, J=8.5, 1.9Hz, 1H), 7.28 (d, J=4.7Hz, 2H).

[0224] ESI-MS: m / z 340.1[M+H] + .

[0225] Example 24: Synthesis of Compound 24

[0226] The preparation method of the above compound 24b is as follows:

[0227] Compound 5-chloro-2-fluorobenzaldehyde (24a, 3.02 g, 19.1 mmol, Bidex Pharmaceuticals) was dissolved in DMAC (10 mL). A 4-fold amount of guanidine carbonate (4 g, Bidex Pharmaceuticals) was added and the mixture was reacted at 140°C for 3 hours. TLC analysis indicated no residual starting material. Heating was discontinued, the mixture was cooled to room temperature, 100 mL of water was added, and the mixture was cooled at 0°C overnight. Filtration and drying afforded compound 24b (2.2 g) as a yellow solid.

[0228] Synthesis of compound 24:

[0229] To a round-bottom flask were added 24b (180 mg, 1.0 mmol), dioxane (75 mL), 24c (240 mg, 1.0 mmol, Bidex Pharmaceuticals), Pd2(dba)3 (46 mg, 0.05 mmol), anhydrous carbonate (480 mg, 1.5 mmol), and Xantphos (29 mg, 0.05 mmol). The reaction was then heated to 115°C under nitrogen for 6 hours. The reaction was stopped, cooled to room temperature, and the solvent was evaporated under reduced pressure. 20 mL of water was added to the residue, and the mixture was extracted three times with ethyl acetate (3 x 20 mL). The organic phases were combined, washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated. The crude product was purified by silica gel column chromatography (PE / EA = 4:1-2:1, v / v) to obtain compound 24 (120 mg) as a yellow solid.

[0230] 1 H NMR (400MHz, DMSO-d6) δ10.21(s,1H),9.32(s,1H),8.16–8.02(m,3H),7.87–7.79(m,1H),7.70(d,J=9.0Hz,1H),7.34(d,J=8.6Hz,2H).

[0231] ESI-MS: m / z 340.1[M+H] + .

[0232] Example 25: Synthesis of Compound 25

[0233] The preparation method of the above compound 25b is:

[0234] Compound 25a (3.0 g, 17.0 mmol, Bidex Pharmaceuticals) was dissolved in DMAC (10 mL) and 4 times the amount of guanidine carbonate (4 g, Bidex Pharmaceuticals) was added. The mixture was reacted at 140°C for 3 hours. TLC analysis indicated no residual starting material. Heating was discontinued, the mixture was cooled to room temperature, 100 mL of water was added, and the mixture was cooled at 0°C overnight. Filtration and drying afforded compound 25b (2.3 g) as a yellow solid, which was used directly in the next reaction without purification.

[0235] Synthesis of compound 25:

[0236] To a round-bottom flask were added 25b (198 mg, 1.0 mmol), dioxane (75 mL), 24c (240 mg, 1.0 mmol), Pd2(dba)3 (46 mg, 0.05 mmol), anhydrous carbonate (480 mg, 1.5 mmol), and Xantphos (29 mg, 0.05 mmol). The reaction was then heated to 115°C under nitrogen for 6 hours. The reaction was stopped, cooled to room temperature, and the solvent was evaporated under reduced pressure. 20 mL of water was added to the residue, and the mixture was extracted three times with ethyl acetate (3 x 20 mL). The organic phases were combined, washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated. The crude product was purified by silica gel column chromatography (PE / EA = 4:1-2:1, v / v) to obtain compound 25 (110 mg) as a yellow solid.

[0237] 1 H NMR (400MHz, DMSO-d6) δ9.30 (s, 1H), 7.82 (d, J = 8.6Hz, 2H), 7.56 (s, 1H), 7.45 (s, 1H), 7.23 (s, 1H), 6.99 (d, J = 8.8Hz, 1H).

[0238] ESI-MS: m / z 358.1[M+H] + .

[0239] Example 26: Synthesis of Compound 26

[0240] Compound 22c (400 mg, 1.0 eq), compound 8a (418 mg, 1.2 eq, Bidex Pharmaceuticals), and TFA (179 mg, 1.2 eq) were added to a sealed tube and dissolved in 5 mL of isopropanol. The mixture was heated and stirred at 100°C overnight. After completion of the reaction, 10 mL of water was added and the pH was adjusted to ~8 with an appropriate amount of KCO. The mixture was extracted with dichloromethane (20 mL x 3). The organic phases were combined, washed with saturated NaCl solution, dried over anhydrous NaSO, and concentrated in vacuo to obtain the crude product. The product was then purified by column chromatography (PE / EA = 100:1-3:1, v / v) to afford compound 26 (70 mg).

[0241] 1 H NMR (400MHz, DMSO-d6) δ10.48(s,1H),9.41(s,1H),8.62(s,1H),8.04(dd,J=7.6,1.3Hz,1 H), 7.95 (dd, J=8.0, 1.3Hz, 1H), 7.65 (dd, J=8.9, 2.1Hz, 1H), 7.41 (dd, J=8.4, 6.5Hz, 2H).

[0242] ESI-MS: m / z 336.1[M+H]+ .

[0243] Example 27: Synthesis of Compound 27

[0244] Compound 23d (200 mg, 1 mmol), compound 8a (191.4 mg, 1.1 mmol, Bidex Pharmaceuticals), and p-toluenesulfonic acid (207.6 mg, 1.2 mmol) were added to a sealed tube. Sec-pentanol (6 mL) was added as the solvent, and the reaction was carried out under Ar substitution at 90°C for 2 h. After completion of the reaction, 30 mL of water was added to the reaction solution, and the mixture was extracted with EA (20 mL x 4). The organic phases were combined, washed with saturated NaCl solution, dried over anhydrous Na2SO4, and concentrated in vacuo to obtain the crude product. The product was then purified by column chromatography (PE / EA = 100:1-3:1, v / v) to obtain compound 27 (30 mg).

[0245] 1 H NMR (400MHz, DMSO-d6) δ10.26(s,1H),9.35(s,1H),8.30(d,J=2.1Hz,1H),7.98(d,J=8.5Hz,1H),7. 80 (d, J = 2.0 Hz, 1H), 7.57 (dd, J = 8.8, 2.1 Hz, 1H), 7.43 (dd, J = 8.5, 2.0 Hz, 1H), 7.36 (d, J = 8.8 Hz, 1H).

[0246] ESI-MS: m / z 336.1[M+H] + .

[0247] Example 28: Synthesis of Compound 28

[0248] Compound 22c (400 mg, 1.0 eq), compound 28a (384 mg, 1.2 eq, Bidex Pharmaceuticals), and p-toluenesulfonic acid (346 mg, 1.0 eq) were added to a sealed tube. 2-pentanol was added for dissolution, and the mixture was heated and stirred at 105°C for 10 h. After completion of the reaction, the 2-pentanol was evaporated, 10 mL of water was added, and the pH was adjusted to ~8 with an appropriate amount of K2CO3. The mixture was extracted with dichloromethane (20 mL x 3). The organic phases were combined, washed with saturated NaCl solution, dried over anhydrous Na2SO4, and concentrated in vacuo to obtain the crude product. The product was then purified by column chromatography (PE / EA = 100:1-10:1, v / v) to afford compound 28 (88 mg).

[0249] 1H NMR (400MHz, DMSO-d6) δ10.29(s,1H),9.39(s,1H),8.19(d,J=8.6Hz,2H),8.01 (d,J=7.6Hz,2H),7.93(d,J=7.9Hz,1H),7.40–7.34(m,1H),7.28–7.10(m,3H).

[0250] ESI-MS: m / z 322.2[M+H] + .

[0251] Example 29: Synthesis of Compound 29

[0252] Compound 22c (500 mg, 1.0 eq), compound 19a (94 mg, 0.25 eq, Anaiji Chemical), and p-toluenesulfonic acid (233 mg, 1.2 eq) were added to a sealed tube. 2-pentanol was added for dissolution, and the mixture was heated and stirred at 105°C for 10 h. After completion of the reaction, the 2-pentanol was evaporated, 10 mL of water was added, and the pH was adjusted to ~8 with an appropriate amount of K2CO3. The mixture was extracted with dichloromethane (20 mL x 3). The organic phases were combined, washed with saturated NaCl solution, dried over anhydrous Na2SO4, and concentrated in vacuo to obtain the crude product. The product was then purified by column chromatography (PE / EA = 100:1-10:1, v / v) to afford compound 29 (88 mg).

[0253] 1 H NMR(400MHz,DMSO-d6)δ10.46(s,1H),9.43(s,1H),9.37(s,1H),9.29(s,2H),8.09 (d, J=8.7Hz, 1H), 8.03 (dd, J=13.6, 8.2Hz, 2H), 7.96 (d, J=7.9Hz, 1H), 7.41 (t, J=7.8Hz, 1H).

[0254] ESI-MS: m / z 313.1[M+H] + .

[0255] Example 30: Synthesis of Compound 30

[0256] Compound 22c (500 mg, 1.0 eq), compound 18a (84 mg, 0.25 eq, Bidex Pharmaceuticals), and TFA (223 mg, 1.2 eq) were added to a sealed tube and dissolved in 5 mL of isopropanol. The mixture was heated and stirred at 100°C overnight. After completion of the reaction, the reaction solution was concentrated, 10 mL of water was added, and the pH was adjusted to ~8 with an appropriate amount of K2CO3. The mixture was extracted with dichloromethane (20 mL x 3). The organic phases were combined, washed with saturated NaCl solution, dried over anhydrous Na2SO4, and concentrated in vacuo to obtain the crude product. The product was then purified by column chromatography (PE / EA = 100:1-3:1, v / v) to afford compound 30 (65 mg).

[0257] 1 H NMR(400MHz,DMSO-d6)δ12.43(s,1H),10.19(s,1H),9.35(s,1H),8.96–8.74(m,1H),8.13(s,1H) ), 8.00 (d, J = 7.5Hz, 1H), 7.91 (d, J = 7.9Hz, 1H), 7.64 (s, 1H), 7.55 (s, 1H), 7.35 (t, J = 7.7Hz, 1H).

[0258] ESI-MS: m / z 296.1[M+H] + .

[0259] Example 31: Synthesis of Compound 31

[0260] Compound 22c (500 mg, 1.0 eq), compound 17a (84 mg, 0.25 eq, Bidex Pharmaceuticals), and TFA (223 mg, 1.2 eq) were added to a sealed tube and dissolved in 3 mL of isopropanol. The mixture was heated at 100°C overnight. After completion of the reaction, the reaction solution was concentrated, 10 mL of water was added, and the pH was adjusted to ~8 with an appropriate amount of K2CO3. The mixture was extracted with dichloromethane (20 mL x 3). The organic phases were combined, washed with saturated NaCl solution, dried over anhydrous Na2SO4, and concentrated in vacuo to obtain the crude product. The product was then purified by column chromatography (PE / EA = 100:1-10:1, v / v) to afford compound 31 (100 mg).

[0261] 1 H NMR(400MHz, DMSO-d6)δ10.21(s,1H),9.36(d,J=1.8Hz,1H),8.68(s,1H),8.03–7.95(m, 2H),7.94–7.85(m,2H),7.57(d,J=8.9Hz,1H),7.36(t,J=7.8Hz,1H),7.03–6.92(m,1H).

[0262] ESI-MS: m / z 296.1[M+H] + .

[0263] Example 32: Synthesis of Compound 32

[0264] Compound 23d (240 mg, 1.34 mmol), compound 32a (344 mg, 1.34 mmol, Bidex Pharmaceuticals), Pd2(dba)3 (61.2 mg, 0.067 mmol), Xantphos (77.3 mg, 0.134 mmol) and Cs2CO3 (653 mg, 2 mmol) were added to a sealed tube, 1,4-dioxane (10 mL) was added as a solvent, the atmosphere was replaced with nitrogen, and the reaction was carried out at 90°C for 4 h; after the reaction, 30 mL of water was added to the reaction solution, and the mixture was extracted with DCM (20 mL×4), the organic phases were combined, washed with saturated NaCl solution, dried over anhydrous Na2SO4, and concentrated in vacuo to obtain the crude product; the product was purified by column chromatography (PE / EA=100:1-3:1, v / v) to obtain compound 32 (100 mg).

[0265] 1 H NMR(400MHz,DMSO-d6)δ10.43(s,1H),9.42–9.38(m,1H),8.18–8.13(m,2H),8.01(d, J=8.6Hz,1H),7.80(d,J=2.0Hz,1H),7.69–7.65(m,2H),7.47(dd,J=8.6,2.0Hz,1H).

[0266] ESI-MS: m / z 356.1[M+H] + .

[0267] Example 33: Synthesis of Compound 33

[0268] The preparation method of the above compound 33b is:

[0269] Compound 33a (3.8 g, 1.0 eq, Anaiji Chemical), guanidine carbonate (17.77 g, 4.0 eq, Bidex Pharmaceuticals), and 40 mL of DMAC were added to a sealed tube and heated at 140°C for 4 h. After TLC confirmed the completion of the reaction, the mixture was cooled to room temperature, poured into ice water, and stirred in an ice-water bath for 20 min. The mixture was filtered and the filter cake was dried to obtain compound 33b (3.0 g).

[0270] Synthesis of compound 33:

[0271] Compound 33b (200 mg, 1.0 eq), compound 24c (276 mg, 1.0 eq, Bidex Pharmaceuticals), Pd2(dba)3 (104 mg, 0.1 eq), tBuXphos (146 mg, 0.3 eq), and cesium carbonate (744 mg, 2.0 eq) were added to a sealed tube. 5 mL of dioxane was added, the atmosphere was replaced with argon, and the mixture was heated to 90°C and allowed to react overnight. After completion of the reaction, 30 mL of water was added to the reaction solution, and the mixture was extracted with EA (20 mL x 4). The organic phases were combined, washed with saturated NaCl solution, dried over anhydrous Na2SO4, and concentrated. The residue was purified by column chromatography (PE / EA = 100:1-9:1, v / v). After concentration, the solid was slurried to obtain compound 33 (300 mg).

[0272] 1 H NMR (400MHz, DMSO-d6) δ9.99(s,1H),9.15(s,1H),8.17–8.04(m,2H),7.83(d,J=8.8Hz,1H),7.40–7.29(m,2H),7.13–6.95(m,2H),3.94(s,3H).

[0273] ESI-MS: m / z 336.0[M+H] + .

[0274] Example 34: Synthesis of Compound 34

[0275] The preparation method of the above compound 34b is as follows:

[0276] Compound 34a (5 g, 35.19 mmol, Bidex Pharmaceuticals) and guanidine carbonate (25.36 g, 140.75 mmol, Bidex Pharmaceuticals) were added to a sealed tube, and 30 mL of DMAC was added as solvent. The reaction was carried out at 140°C for 6 h. After the reaction, the reaction solution was added dropwise to ice water and stirred to precipitate a solid. The filter cake was filtered and dried to obtain the crude product, compound 34b (3.1 g).

[0277] Synthesis of compound 34:

[0278] Compound 34b (600 mg, 3.68 mmol), compound 24c (886 mg, 3.68 mmol, Bidex Pharmaceuticals), Pd2(dba)3 (168.4 mg, 0.184 mmol), Xantphos (212.8 mg, 0.368 mmol) and Cs2CO3 (1797 mg, 5.52 mmol) were added to a sealed tube, 1,4-dioxane (15 mL) was added as a solvent, Ar was replaced, and the reaction was carried out at 100°C for 6 h; after the reaction, 30 mL of water was added to the reaction solution, and the mixture was extracted with EA (20 mL×4), the organic phases were combined, washed with saturated NaCl solution, dried over anhydrous Na2SO4, and concentrated in vacuo to obtain the crude product; the product was purified by column chromatography (DCM / MeOH=100:1-10:1, v / v) to obtain compound 34 (100 mg).

[0279] 1 H NMR (400MHz, DMSO-d6) δ10.18 (s, 1H), 9.33 (s, 1H), 8.06 (t, J = 7.1Hz, 3H), 7.45–7.28 (m, 4H).

[0280] ESI-MS: m / z 324.4[M+H] + .

[0281] Example 35: Synthesis of Compound 35

[0282] The preparation method of the above compound 35b is as follows:

[0283] Compound 35a (1 g, 1.0 eq, Anaiji Chemical), guanidine carbonate (3.76 g, 4.0 eq, Bidex Pharmaceuticals), and 10 mL of DMAC were added to a sealed tube. The mixture was heated and stirred at 140°C for 4 h. After the reaction was completed, the mixture was cooled to room temperature, poured into ice water, stirred in an ice-water bath for 20 min, filtered, and dried to obtain 940 mg of compound 35b (940 mg).

[0284] Synthesis of compound 35:

[0285] Compound 35b (940 mg, 1.0 eq), compound 24c (1.17 g, 1.1 eq, Bidex Pharmaceuticals), Pd2(dba)3 (404 mg, 0.1 eq), Xantphos (765 mg, 0.3 eq), and cesium carbonate (2.87 g, 2.0 eq) were added to a sealed tube. 10 mL of dioxane was added, the atmosphere was replaced with argon, and the reaction was allowed to proceed at 90°C overnight. After completion of the reaction, the dioxane was evaporated, 30 mL of water was added, and the mixture was extracted with ethyl acetate (20 mL x 3). The organic phases were combined, washed with saturated NaCl solution, dried over anhydrous Na2SO4, and concentrated in vacuo to obtain the crude product. The product was then purified by column chromatography (PE / EA = 100:1-9:1, v / v), and the product was slurried to obtain compound 35 (200 mg).

[0286] 1 H NMR(400MHz,DMSO-d6)δ10.36(s,1H),9.50(d,J=0.8Hz,1H),8.19(d,J=8.3Hz,1H),8 .16–8.09(m,2H),8.05–7.97(m,1H),7.67(dd,J=8.4,1.8Hz,1H),7.39–7.32(m,2H).

[0287] ESI-MS: m / z 374.0[M+H] + .

[0288] Example 36: Synthesis of Compound 36

[0289] Preparation method of the above compound 36b:

[0290] Compound 36a (2 g, 13.41 mmol, Bidex Pharmaceuticals) and guanidine carbonate (9.67 g, 53.65 mmol, Bidex Pharmaceuticals) were added to a sealed tube, and DMAC (20 mL) was added as solvent. The reaction was carried out at 140°C for 6 h. After completion of the reaction, the reaction solution was added dropwise to ice water and stirred to precipitate a solid. The filter cake was filtered and dried to obtain the crude product, compound 36b (1.7 g).

[0291] ESI-MS: m / z 171.2[M+H] + .

[0292] Synthesis of compound 36:

[0293] Compound 36b (400 mg, 2.35 mmol), compound 24c (566 mg, 2.35 mmol, Bidex Pharmaceuticals), Pd2(dba)3 (108 mg, 0.12 mmol), Xantphos (136 mg, 0.24 mmol) and Cs2CO3 (1149 mg, 3.53 mmol) were added to a sealed tube, 1,4-dioxane (15 mL) was added as a solvent, Ar was replaced, and the reaction was carried out at 100°C for 6 h; after the reaction, 30 mL of water was added to the reaction solution, and the mixture was extracted with EA (20 mL×4), the organic phases were separated and combined, washed with saturated NaCl solution, dried over anhydrous Na2SO4, and concentrated in vacuo to obtain the crude product; the product was purified by column chromatography (PE / DCM=100:1-2:1, v / v) to obtain compound 36 (100 mg).

[0294] 1 H NMR (400MHz, DMSO-d6) δ10.37(s,1H),9.48(s,1H),8.22–8.18(m,1H),8.11(dd,J=14.4,8.6Hz,3H),7.72(s,1H),7.35(d,J=8.7Hz,2H).

[0295] ESI-MS: m / z 331.2[M+H] + .

[0296] Example 37: Synthesis of Compound 37

[0297] Preparation method of the above compound 37b:

[0298] Compound 37a (3.0 g, 18.9 mmol, Bidex Pharmaceuticals) was dissolved in DMAC (10 mL) and 4-fold the amount of guanidine carbonate was added. The mixture was reacted at 140°C for 3 hours. TLC analysis indicated no residual starting material. Heating was discontinued, the mixture was cooled to room temperature, 100 mL of water was added, and the mixture was cooled at 0°C overnight. Filtration and drying afforded compound 37b (2.1 g) as a yellow solid, which was used directly in the next reaction without purification.

[0299] Synthesis of compound 37:

[0300] To a round-bottom flask were added 37b (179 mg, 1.0 mmol), dioxane (75 mL), 24c (240 mg, 1.0 mmol, Bidex Pharmaceuticals), Pd2(dba)3 (46 mg, 0.05 mmol), anhydrous carbonate (480 mg, 1.5 mmol), and Xantphos (29 mg, 0.05 mmol). The reaction was then heated to 115°C under nitrogen for 6 hours. The reaction was stopped, cooled to room temperature, and the solvent was evaporated under reduced pressure. 20 mL of water was added to the residue, and the mixture was extracted three times with ethyl acetate (3 x 20 mL). The organic phases were combined, washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated. The crude product was purified by silica gel column chromatography (PE / EA = 4:1-2:1, v / v) to obtain compound 37 (140 mg) as a yellow solid.

[0301] 1 H NMR (400MHz, DMSO-d6) δ10.34 (s, 1H), 9.50 (s, 1H), 8.09 (d, J = 8.6Hz, 2H), 7.81 (t, J=8.0Hz, 1H), 7.67 (d, J=8.5Hz, 1H), 7.51 (d, J=7.5Hz, 1H), 7.36 (d, J=8.6Hz, 2H).

[0302] ESI-MS: m / z 340.7[M+H] + .

[0303] Example 38: Synthesis of Compound 38

[0304] Preparation method of the above compound 38b:

[0305] Compound 38a (2 g, 1.0 eq, Bidex Pharmaceuticals), ethyl acrylate (939 mg, 1.2 eq, Anaiji Chemical), palladium acetate (88 mg, 0.05 eq), tri(o-methylphenyl)phosphine (238 mg, 0.1 eq), and triethylamine (7.8 mL) were added to a sealed tube and heated to 125°C overnight. After completion of the reaction, 50 mL of water was added and the mixture was extracted with dichloromethane (3 x 30 mL). The combined organic phases were washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated. The crude product was purified by silica gel column chromatography (DCM / MeOH = 100:1-10:1, v / v) to obtain compound 38b (1.8 g).

[0306] Preparation method of the above compound 38c:

[0307] Compound 38b (1.8 g, 1.0 eq) was added to a sealed tube. After dissolving in 10 mL of 1,4-dioxane, 0.5 mL of concentrated hydrochloric acid was added dropwise, and the mixture was heated to 100°C and allowed to react overnight. After completion of the reaction, 30 mL of water was added, and the pH was adjusted to greater than 7 with saturated aqueous NaHCO₃. The mixture was extracted three times with ethyl acetate (3 x 20 mL). The organic phases were combined, washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated. The crude product was slurried with n-hexane:ethyl acetate (10:1) and filtered to afford compound 38c (1.0 g).

[0308] Preparation method of the above compound 38d:

[0309] Compound 38c (1 g, 1.0 eq) was added to a 50 mL single-necked flask, followed by 10 mL of toluene and phosphorus oxychloride (1.34 g, 2.0 eq, Anaiji Chemical). The mixture was heated to 100°C and allowed to react overnight. After completion of the reaction, the phosphorus oxychloride and toluene were removed as much as possible by distillation under reduced pressure. 50 mL of water was added, and the mixture was extracted with dichloromethane (3 x 30 mL). The organic phases were combined, washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated to afford compound 38d (670 mg).

[0310] Synthesis of compound 38:

[0311] Compound 38d (670 mg, 1.0 eq), compound 38e (414 mg, 1.2 eq, Anaiji Chemical), Pd(OAc)2 (61 mg, 0.1 eq), cesium carbonate (1.76 g, 2.0 eq), and Xantphos (470 mg, 0.3 eq) were added to a sealed tube. 10 mL of tert-butanol was added and mixed thoroughly. The atmosphere was replaced with argon. The tube was sealed and heated in an oil bath at 110°C for 20 h. After the reaction, 2 volumes of methanol were added, the mixture was filtered, and the filter cake was washed with cold methanol. The filtrate was concentrated, and the residue was purified by column chromatography (PE:EA = 100:1-19:1, v / v), followed by slurrying with petroleum ether to afford compound 38 (82 mg).

[0312] 1 H NMR (400MHz, DMSO-d6) δ8.92(s,1H),8.31(dd,J=8.2,1.6Hz,1H),8.18(d,J=9.0Hz,1H),7.81(d,J=2 .7Hz,1H),7.68(d,J=9.1Hz,1H),7.57–7.47(m,2H),7.42–7.31(m,2H),7.13(td,J=7.7,1.6Hz,1H).

[0313] ESI-MS: m / z 339.1[M+H] + .

[0314] Example 39: Synthesis of Compound 39

[0315] Compound 38e (255 mg, Anaiji Chemical), DMSO (2 mL) and CDI (389 mg) were added sequentially to a 25 mL single-necked bottle and stirred at room temperature. Compound 21c (354 mg, Bid Pharmaceuticals) was dissolved in DMSO (2 mL), added dropwise to the reaction solution, and reacted for 0.5 hours. After completion of the reaction, it was quenched with 1N hydrochloric acid (16 mL) and extracted with ethyl acetate (15 mL × 3), and the organic phases were combined; the organic phase was washed with saturated brine (10 mL) and dried over anhydrous sodium sulfate. The filtrate was filtered and vacuum desolvated to obtain a crude product. The crude product was purified by column chromatography with an eluent (PE / EA=10 / 1, v / v) to give compound 39 (115 mg) as a white solid.

[0316] 1 H NMR (400MHz, DMSO-d6) δ (ppm) 9.58 (s, 1H), 8.33 (s, 1H), 8.15 (dd, J = 8.3, 1.6Hz, 1H), 7.67 –7.52(m,2H),7.47(dd,J=8.0,1.5Hz,1H),7.36–7.23(m,3H),7.05(td,J=7.7,1.6Hz,1H).

[0317] ESI-MS: m / z 331.1[M+H] + .

[0318] Example 40: Synthesis of Compound 40

[0319] To a 75 mL sealed tube were added compound 21a (1 g, 1.0 eq, Bidex Pharmaceuticals), compound 21c (1.38 g, 1.2 eq, Bidex Pharmaceuticals), Pd(OAc)2 (73 mg, 0.05 eq), cesium carbonate (4.24 g, 2.0 eq), and Xantphos (1.38 g, 0.15 eq). Tert-butanol (12 mL) was then added and mixed. The atmosphere was replaced with argon, the tube was sealed, and the reaction was heated to 110°C for 4 h. After completion of the reaction, methanol (20 mL) was added, the mixture was filtered, and the residue was washed with methanol. The filtrate was concentrated and purified by column chromatography (PE:EA = 100:1-2:1, v / v) to afford compound 40 (210 mg).

[0320] 1H NMR (400MHz, CDCl3) δ8.39 (dd, J=7.6, 0.9Hz, 1H), 7.96 (d, J=2.2Hz, 1H), 7.70–7.60 ( m,2H),7.27(d,J=1.2Hz,1H),7.25(q,J=3.3Hz,2H),6.88(s,1H),6.32–6.23(m,2H).

[0321] ESI-MS: m / z 295.1[M+H] + .

[0322] Example 41: Synthesis of Compound 41

[0323] Preparation method of the above compound 41c:

[0324] Compound 41a (1.00 g, Jiangsu Aikang) and compound 41b (8.64 g, Anaiji Chemical) were added sequentially to a 75 mL sealed tube and heated to 150°C for 2 hours to precipitate a large amount of off-white solid. The mixture was cooled to 0°C, stirred for 15 minutes, and filtered. The filter cake was rinsed with petroleum ether (100 mL) and dried. The filter cake was removed and air-dried at 50°C for 1 hour to obtain 0.95 g of compound 41c (400 mg) as a beige solid.

[0325] Synthesis of compound 41:

[0326] To a 15 mL sealed tube were added compound 41c (400 mg), DMAC (4 mL), compound 21c (782 mg), Pd(OAc)2 (50 mg), Xantphos (383 mg), and DIPEA (885 mg) in sequence. The mixture was heated to 90°C under argon for 15 hours. After completion, the reaction was diluted with ethyl acetate (30 mL), followed by addition of water (30 mL). The mixture was filtered to remove the solid. The filtrate was separated, the organic phase retained, and the aqueous phase was extracted with ethyl acetate (15 mL x 3). The combined organic phases were washed with saturated brine (10 mL) and dried over anhydrous sodium sulfate. The filtrate was filtered, the solvent removed in vacuo, and the residue purified by column chromatography using EA / MeOH = 30:1, v / v as eluent to afford compound 41 (195 mg) as a beige solid.

[0327] 1 H-NMR(400MHz,DMSO-d6)δ(ppm):12.55–12.17(m,1H),9.80(s,1H),8.09(dd,J=9.0,1 .7Hz, 2H), 7.96 (d, J = 3.3Hz, 1H), 7.88 (d, J = 8.9Hz, 1H), 7.30 (dd, J = 14.7, 8.8Hz, 3H).

[0328] ESI-MS: m / z 323.14[M+H] + .

[0329] Example 42: Synthesis of Compound 42

[0330] Preparation method of the above compound 42a:

[0331] Compound 41 (110 mg) and POCl3 (2.6 g) were added sequentially to a 25 mL single-necked flask and heated to 90°C for 6 hours to obtain an orange-red solution. The reaction was then terminated. The reaction solution was vacuum-desolvated to obtain a dark red liquid. Ether (20 mL) was added to precipitate a dark red solid, which was filtered to obtain Compound 42a (100 mg) as a dark red solid.

[0332] Synthesis of compound 42:

[0333] Compound 42a (100 mg), MeOH (1 mL), and MeONa (16 mg) were added sequentially to a 10 mL single-necked flask and allowed to react at room temperature for 1 hour. After completion of the reaction, the solvent was removed in vacuo, and the residue was purified by column chromatography using PE / EA (1:2, v / v) as the eluent to afford Compound 42 (65 mg) as a yellow solid.

[0334] 1 H-NMR(400MHz,DMSO-d6)δ(ppm):10.01(s,1H),8.62(s,1H),8.15–8.09(m,2H), 8.06 (d, J=9.1Hz, 1H), 7.43 (d, J=9.1Hz, 1H), 7.35 (d, J=8.7Hz, 3H), 4.13 (s, 3H).

[0335] ESI-MS: m / z 323.14[M+H] + .

[0336] Example 43: Synthesis of Compound 43

[0337] The preparation method of the above compound 43b is as follows:

[0338] Compound 43a (1.0 g, 4.28 mmol) was dissolved in acetonitrile (10 mL), and N,N,N'-trimethylethylenediamine (525 mg, 5.14 mmol) and DIPEA (1.66 g, 12.8 mmol) were added. The reaction was allowed to react at room temperature for 12 h. TLC analysis indicated no residual starting material. Water (30 mL) was added, and the mixture was extracted three times with ethyl acetate (3 x 20 mL). The organic phases were combined, washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated. The residue was slurried with PE (3 mL) and isopropyl ether (5 mL), filtered, and dried to afford Compound 43b (890 mg) as a yellow solid.

[0339] Synthesis of compound 43:

[0340] Compound 43b (870 mg, 2.9 mmol) and 21c (620 mg, 3.5 mmol) were dissolved in isopropanol (10 mL), and trifluoroacetic acid (1.66 g, 14.6 mmol) was added. The mixture was then heated to 90°C under nitrogen for 2 hours. The reaction was stopped, cooled to room temperature overnight, and filtered. The filter cake was washed with cold isopropanol. After drying, compound 43 (320 mg) was obtained as a yellow solid.

[0341] 1 H NMR (400MHz, DMSO-d6) δ11.24(s,1H),8.26(d,J=9.0Hz,1H),7.79(d,J=8.5Hz,2H),7.62(d,J=2.2Hz,1H),7.42(d, J=8.5Hz,2H),7.40–7.33(m,1H),4.14(t,J=6.8Hz,2H),3.58(s,3H),3.42(p,J=5.5Hz,2H),2.71(d,J=3.2Hz,6H).

[0342] ESI-MS: m / z 440.1[M+H] + .

[0343] Example 44: Synthesis of Compound 44

[0344] The preparation method of the above compound 44a is as follows:

[0345] Compound 25a (1.45 g, 8.21 mmol, Bidex Pharmaceuticals) was dissolved in 1,4-dioxane (20 mL), and N,N,N'-trimethylethylenediamine (923 mg, 9.03 mmol, Anaiji) and DIPEA (2.12 g, 16.4 mmol, Sinopharm) were added. The temperature was raised to 90°C and the reaction was allowed to react for 3 h. TLC confirmed the absence of residual starting material. 60 mL of water was added, and the mixture was extracted three times with ethyl acetate (3 x 30 mL). The organic phases were combined, washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated. The residue was purified by column chromatography (DCM / MeOH = 10:1, v / v) to afford compound 44a (1.63 g).

[0346] Synthesis of the above compound 44b:

[0347] Compound 44a (1.6 g, 5.36 mmol) and guanidine carbonate (3.86 g, 21.4 mmol, Bidex Pharmaceuticals) were added to a sealed tube, and 15 mL of DMAC was added as solvent. The reaction was allowed to proceed at 140°C for 3 h. After completion of the reaction, the reaction solution was added dropwise to ice water and stirred to precipitate a solid. The filter cake was filtered and dried to obtain the crude product, compound 44b (0.98 g).

[0348] Synthesis of compound 44:

[0349] Compound 44b (960 mg, 3.44 mmol), compound 24c (826 mg, 3.44 mmol), Pd2(dba)3 (157 mg, 0.17 mmol), Xantphos (98 mg, 0.17 mmol) and Cs2CO3 (1.6 g, 5.16 mmol) were added to a sealed tube, 1,4-dioxane (15 mL) was added as solvent, and the reaction was carried out at 115°C under argon protection for 6 h; after the reaction, 30 mL of water was added to the reaction solution, and the mixture was extracted with EA (20 mL×4), the organic phases were combined, washed with saturated NaCl solution, dried over anhydrous Na2SO4, and concentrated in vacuo to obtain the crude product; the product was purified by column chromatography (DCM / MeOH=100:1-10:1, v / v) to obtain compound 44 (200 mg).

[0350] 1 H NMR(400MHz,DMSO-d6)δ10.19(s,1H),9.54(s,1H),8.10–8.03(m,2H),7.39–7.28(m,3H),7.01 (d,J=1.9Hz,1H),3.53(t,J=6.4Hz,2H),3.40–3.39(m,2H),2.94(s,3H),2.78(d,J=4.8Hz,6H).

[0351] ESI-MS: m / z 440.1[M+H]+ .

[0352] Example 45: Synthesis of Compound 45

[0353] The preparation method of the above compound 45a is as follows:

[0354] Compound 25a (2.0 g, 11.3 mmol) was dissolved in 1,4-dioxane (20 mL), and morpholine (1.09 g, 12.5 mmol) and DIPEA (2.93 g, 22.7 mmol) were added. The temperature was raised to 100°C and the reaction was allowed to proceed for 4 h. TLC confirmed the absence of residual starting material. 60 mL of water was added, and the mixture was extracted three times with ethyl acetate (3 x 30 mL). The organic phases were combined, washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated to afford Compound 45a (1.52 g) as a yellow oil.

[0355] Synthesis of the above compound 45b:

[0356] Compound 45a (1.5 g, 6.17 mmol) and guanidine carbonate (4.4 g, 24.4 mmol) were added to a sealed tube, and 20 mL of DMAC was added as solvent. The reaction was carried out at 140°C for 6 h. After completion of the reaction, 60 mL of water was added, and the mixture was extracted three times with ethyl acetate (3 x 30 mL). The organic phases were combined, washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated. The residue was slurried with PE (10 mL) and EA (1 mL), filtered, and dried to obtain Compound 45b (1.1 g) as a yellow solid.

[0357] Synthesis of compound 45:

[0358] Compound 45b (1.05 g, 3.97 mmol), compound 24c (953 mg, 3.97 mmol), Pd2(dba)3 (185 mg, 0.20 mmol), Xantphos (117 mg, 0.20 mmol) and Cs2CO3 (1.94 g, 5.97 mmol) were added to a sealed tube, 1,4-dioxane (20 mL) was added as solvent, and the reaction was carried out at 115 ° C under argon protection for 6 h; after the reaction, 60 mL of water was added to the reaction solution, and the mixture was extracted with EA (30 mL×4). The organic phases were combined, washed with saturated NaCl solution, dried over anhydrous Na2SO4, and concentrated in vacuo to obtain a crude product; PE (10 mL) and EA (2 mL) were used for slurrying, and the filter cake was filtered and purified by column chromatography (DCM / MeOH=100:1-10:1, v / v) to obtain compound 45 (350 mg).

[0359] 1H NMR (400MHz, DMSO-d6) δ10.16(s,1H),9.32(s,1H),8.05(d,J=8.6Hz,2H),7.34(d,J =4.2Hz,2H),7.31(s,1H),6.87(s,1H),3.86(t,J=4.4Hz,4H),3.12(t,J=4.5Hz,4H).

[0360] ESI-MS: m / z 425.1[M+H] + .

[0361] Example 46: Synthesis of Compound 46

[0362] The preparation method of the above compound 46a is as follows:

[0363] Compound 25a (2.0 g, 11.3 mmol) was dissolved in 1,4-dioxane (20 mL), and methylpiperazine (1.25 g, 12.5 mmol) and DIPEA (2.93 g, 22.7 mmol) were added. The temperature was raised to 100°C and the reaction was allowed to proceed for 4 h. TLC confirmed the absence of residual starting material. 60 mL of water was added, and the mixture was extracted three times with ethyl acetate (3 x 30 mL). The organic phases were combined, washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated to afford Compound 46a (1.50 g) as a yellow oil.

[0364] Synthesis of the above compound 45b:

[0365] Compound 46a (1.5 g, 6.17 mmol) and guanidine carbonate (4.5 g, 24.9 mmol) were added to a sealed tube, and 20 mL of DMAC was added as solvent. The reaction was carried out at 140°C for 6 h. After completion of the reaction, 60 mL of water was added, and the mixture was extracted three times with ethyl acetate (3 x 30 mL). The organic phases were combined, washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated. The residue was slurried with PE (10 mL), EA (1 mL), and i-PrOH (1 mL), filtered, and dried to obtain compound 46b (1.0 g) as a yellow solid.

[0366] Synthesis of compound 46:

[0367] Compound 46b (1.0 g, 3.61 mmol), compound 24c (960 mg, 3.99 mmol), Pd2(dba)3 (185 mg, 0.20 mmol), Xantphos (117 mg, 0.20 mmol) and Cs2CO3 (1.94 g, 5.97 mmol) were added into a sealed tube, 1,4-dioxane (20 mL) was added as solvent, and the mixture was reacted at 115°C under argon protection for 6 h. After the reaction, 60 mL of water was added to the reaction solution, and the mixture was extracted with EA (30 mL×4). The organic phases were combined, washed with saturated NaCl solution, dried over anhydrous Na2SO4, and concentrated in vacuo to obtain a crude product. A mixed solvent of PE (10 mL), EA (2 mL), DCM (1 mL) and i-PrOH (1 mL) was used for slurrying, and the mixture was filtered and dried to obtain a yellow solid compound 46 (410 mg).

[0368] 1 H NMR (400MHz, DMSO-d6) δ10.21(s,1H),9.35(s,1H),8.06(d,J=8.8Hz,2H),7.42(d,J=1.7Hz,1H),7.33(d,J=8.6Hz ,2H),7.00(d,J=1.9Hz,1H),3.59(dd,J=12.4,5.2Hz,4H),3.49–3.41(m,2H),3.19(t,J=12.0Hz,2H),2.92(s,3H).

[0369] ESI-MS: m / z 438.1[M+H] + .

[0370] Example 47: Synthesis of Compound 47

[0371] The preparation method of the above compound 47b is as follows:

[0372] Compound 25a (1.46 g, 8.27 mmol) was dissolved in acetonitrile (20 mL), and compound 47a (1.25 g, 8.67 mmol) and DIPEA (2.14 g, 16.6 mmol) were added. The temperature was raised to 50°C and the reaction was allowed to proceed overnight. TLC confirmed the absence of residual starting material. The solvent was removed by distillation under reduced pressure, and the mixture was purified by column chromatography (PE / EA = 100:1-3:1, v / v) to afford compound 47b (1.90 g).

[0373] Synthesis of the above compound 47c:

[0374] Compound 47b (1.9 g, 6.32 mmol) and guanidine carbonate (4.5 g, 24.9 mmol) were added to a sealed tube, and 20 mL of DMAC was added as solvent. The reaction was carried out at 140°C for 6 h. After the reaction, 100 mL of water was added, and the mixture was extracted three times with ethyl acetate (3 x 50 mL). The organic phases were combined, washed with saturated brine, dried over anhydrous sodium sulfate, concentrated, and purified by column chromatography (PE / EA = 3:1 to EA / MeOH = 20:1, v / v) to obtain compound 47c (1.7 g) as a yellow solid.

[0375] Synthesis of compound 47:

[0376] Compound 47c (1.7 g, 5.28 mmol), compound 24c (1.4 g, 5.83 mmol), Pd2(dba)3 (242 mg, 0.26 mmol), Xantphos (458 mg, 0.79 mmol) and Cs2CO3 (3.4 g, 10.5 mmol) were added to a sealed tube, 1,4-dioxane (20 mL) was added as a solvent, Ar was replaced, and the reaction was carried out at 115°C for 3 h. After the reaction, 60 mL of water was added to the reaction solution, and the mixture was extracted with EA (30 mL×4). The organic phases were combined, washed with saturated NaCl solution, dried over anhydrous Na2SO4, and concentrated in vacuo to obtain a crude product. Column chromatography (PE / EA=100:1-1:1, v / v) was used for purification to obtain 2.1 g of the crude product, which was then slurried with a mixed solvent of PE (10 mL), EA (10 mL) and MeOH (0.3 mL), filtered and dried to obtain a yellow solid compound 47 (1.4 g).

[0377] 1 H NMR (400MHz, DMSO-d6) δ10.11(s,1H),9.56(s,1H),8.12–8.00(m,2H),7.32(d,J=8.7Hz,2H),7.22(d,J=1.8Hz,1H),6.84 (d,J=1.9Hz,1H),3.52(t,J=4.6Hz,4H),3.34(d,J=6.5Hz,3H),2.92(s,3H),2.61(t,J=6.2Hz,2H),2.38(t,J=4.6Hz,4H).

[0378] ESI-MS: m / z 482.4[M+H] + .

[0379] Example 48: Synthesis of Compound 48

[0380] The preparation method of the above compound 48b is as follows:

[0381] Compound 25a (4.7 g, 26.6 mmol) was dissolved in acetonitrile (30 mL), and compound 48a (3.3 g, 28.6 mmol) and DIPEA (6.9 g, 53.5 mmol) were added. The temperature was raised to 50°C and the reaction was allowed to proceed overnight. TLC monitoring confirmed the absence of residual starting material. The solvent was removed by distillation under reduced pressure, and the mixture was purified by column chromatography (DCM) to afford compound 48b (5.8 g) as a yellow solid.

[0382] Synthesis of the above compound 48c:

[0383] Compound 48b (5.8 g, 21.3 mmol) and guanidine carbonate (15.4 g, 85.5 mmol) were added to a sealed tube, and 70 mL of DMAC was added as solvent. The reaction was carried out at 140°C for 2 h. After the reaction, 200 mL of water was added, and the mixture was extracted three times with ethyl acetate (3 x 100 mL). The organic phases were combined, washed with saturated brine, dried over anhydrous sodium sulfate, concentrated, and purified by column chromatography (PE / EA = 100:1-8:1, v / v) to obtain Compound 48c (5 g) as a yellow solid.

[0384] Synthesis of compound 48:

[0385] Compound 48c (1.3 g, 4.44 mmol), compound 24c (1.2 g, 5.0 mmol, Bidex Pharmaceuticals), Pd2(dba)3 (203 mg, 0.22 mmol), Xantphos (381 mg, 0.66 mmol) and Cs2CO3 (2.89 g, 8.89 mmol) were added into a sealed tube, 1,4-dioxane (20 mL) was added as solvent, and the mixture was reacted at 115°C under argon protection for 3 h; after the reaction, 60 mL of water was added to the reaction solution, and the mixture was extracted with EA (30 mL×4), the organic phases were combined, washed with saturated NaCl solution, dried over anhydrous Na2SO4, and concentrated in vacuo to obtain the crude product; the product was purified by column chromatography (PE / EA=100:1-3:1, v / v) to obtain compound 48 (1.0 g).

[0386] 1 H NMR(400MHz,DMSO-d6)δ10.16(s,1H),9.22(s,1H),8.15–8.00(m,2H),7.36–7.30(m,3H),7.2 8(d,J=1.7Hz,1H),4.39(s,1H),3.14(td,J=12.0,8.2Hz,4H),1.90–1.61(m,4H),1.23(s,3H).

[0387] ESI-MS: m / z 453.2[M+H] + .

[0388] Example 49: Synthesis of Compound 49

[0389] The preparation method of the above compound 49b is as follows:

[0390] Compound 25a (1.58 g, 8.95 mmol) was dissolved in acetonitrile (30 mL), and compound 49a (1.0 g, 9.88 mmol) and DIPEA (2.3 g, 17.8 mmol) were added. The temperature was raised to 110°C and the reaction was allowed to react for 2 h. TLC analysis confirmed the absence of residual starting material. The solvent was then removed by distillation under reduced pressure, and the mixture was purified by column chromatography (PE / EA = 100:1-8:1, v / v) to afford compound 49b (1.7 g) as a yellow solid.

[0391] Synthesis of the above compound 49c:

[0392] Compound 49b (1.7 g, 6.59 mmol) and guanidine carbonate (4.7 g, 26.1 mmol) were added to a sealed tube, and 20 mL of DMAC was added as solvent. The reaction was carried out at 140°C for 2 h. After the reaction, 100 mL of water was added, and the mixture was extracted three times with ethyl acetate (3 x 60 mL). The organic phases were combined, washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated to obtain a crude solid compound 49c (2.0 g).

[0393] Synthesis of compound 49:

[0394] Compound 49c (2.0 g, 7.18 mmol), compound 24c (1.8 g, 7.50 mmol), Pd2(dba)3 (296 mg, 0.32 mmol), Xantphos (560 mg, 0.97 mmol) and Cs2CO3 (4.2 g, 12.9 mmol) were added to a sealed tube, 1,4-dioxane (40 mL) was added as solvent, Ar was replaced, and the reaction was carried out at 115°C for 4 h. After the reaction, 100 mL of water was added to the reaction solution, and the mixture was extracted with EA (3x60 mL). The organic phases were combined, washed with saturated NaCl solution, dried over anhydrous Na2SO4, and concentrated in vacuo to obtain the crude product; the crude product was purified by column chromatography (PE / EA=100:1-10:1, v / v) to obtain compound 49 (1.2 g).

[0395] 1H NMR (400MHz, DMSO-d6) δ10.21(s,1H),9.43(s,1H),8.06(d,J=8.8Hz,2H),7.43(d,J=1.7Hz,1H),7.33(d,J=8.6Hz,2H),7.07(d,J=1.9 Hz,1H),4.02–3.70(m,3H),3.48(dd,J=10.7,5.1Hz,2H),3.30–3.18(m,1H),2.84(ddd,J=11.4,6.9,2.9Hz,1H),0.85(d,J=5.6Hz,3H).

[0396] ESI-MS: m / z 439.2[M+H] + .

[0397] Example 50: Synthesis of Compound 50

[0398] The preparation method of the above compound 50b is:

[0399] Compound 25a (1.3 g, 7.36 mmol) was dissolved in acetonitrile (15 mL), and compound 50a (1.0 g, 8.26 mmol) and DIPEA (1.9 g, 14.7 mmol) were added. The temperature was raised to 50°C and the reaction was allowed to proceed overnight. TLC confirmed the absence of residual starting material. The solvent was removed by distillation under reduced pressure, and the mixture was purified by column chromatography (PE / EA = 100:1-8:1, v / v) to afford compound 50b (1.7 g) as a yellow solid.

[0400] Synthesis of the above compound 50c:

[0401] Compound 50b (1.7 g, 6.12 mmol) and guanidine carbonate (4.4 g, 24.4 mmol) were added to a sealed tube, and 15 mL of DMAC was added as solvent. The reaction was carried out at 140°C for 2 h. After the reaction was completed, 100 mL of water was added, and the mixture was extracted three times with ethyl acetate (3 x 100 mL). The organic phases were combined, washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated to obtain crude compound 50c (2.2 g). Synthesis of Compound 50:

[0402] Compound 50c (2.0 g, 6.69 mmol), compound 24c (1.8 g, 7.50 mmol), Pd2(dba)3 (306 mg, 0.33 mmol), Xantphos (581 mg, 1.0 mmol) and Cs2CO3 (4.4 g, 13.5 mmol) were added to a sealed tube, 1,4-dioxane (30 mL) was added as solvent, and the reaction was carried out at 115°C under argon protection for 4 h. After the reaction, 60 mL of water was added to the reaction solution, and the mixture was extracted with EA (4x50 mL). The organic phases were combined, washed with saturated NaCl solution, dried over anhydrous Na2SO4, and concentrated in vacuo to obtain the crude product; the product was purified by column chromatography (PE / EA=100:1-10:1, v / v) to obtain compound 50 (1.6 g).

[0403] 1 H NMR (400MHz, DMSO-d6) δ10.18(s,1H),9.35(s,1H),8.05(d,J=9.0Hz,2H),7.40–7.2 8(m,3H),6.95(d,J=1.9Hz,1H),3.24(t,J=5.7Hz,4H),2.28(tt,J=13.6,5.0Hz,4H).

[0404] ESI-MS: m / z 459.2[M+H] + .

[0405] Example 51: Synthesis of Compound 51

[0406] The preparation method of the above compound 51b is:

[0407] Compound 25a (1.58 g, 8.95 mmol) was dissolved in acetonitrile (30 mL), and compound 49a (1.0 g, 9.88 mmol) and DIPEA (2.3 g, 17.8 mmol) were added. The temperature was raised to 110°C and the reaction was allowed to react for 2 h. TLC analysis confirmed the absence of residual starting material. The solvent was then removed by distillation under reduced pressure, and the mixture was purified by column chromatography (PE / EA = 100:1-8:1, v / v) to afford solid compound 51b (2.0 g).

[0408] Synthesis of the above compound 51c:

[0409] Compound 51b (2.0 g, 7.76 mmol) and guanidine carbonate (5.6 g, 31.1 mmol) were added to a sealed tube, and 20 mL of DMAC was added as solvent. The mixture was reacted at 140°C for 2 h. After the reaction, 100 mL of water was added, and the mixture was extracted with ethyl acetate (3 x 80 mL). The organic phases were combined, washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated to afford crude compound 51c (2.2 g).

[0410] Synthesis of compound 51:

[0411] Compound 51c (2.2 g, 7.89 mmol), compound 24c (2.1 g, 8.75 mmol), Pd2(dba)3 (361 mg, 0.39 mmol), Xantphos (685 mg, 1.18 mmol) and Cs2CO3 (5.1 g, 15.6 mmol) were added to a sealed tube, 1,4-dioxane (40 mL) was added as solvent, and the reaction was carried out at 115°C under argon protection for 5 h. After the reaction, 100 mL of water was added to the reaction solution, and the mixture was extracted with EA (3x80 mL). The organic phases were combined, washed with saturated NaCl solution, dried over anhydrous Na2SO4, and concentrated in vacuo to obtain the crude product. The crude product was purified by column chromatography (PE / EA=100:1-10:1, v / v) to obtain compound 51 (1.3 g).

[0412] 1 H NMR (400MHz, DMSO-d6) δ10.20(s,1H),9.43(s,1H),8.10–8.03(m,2H),7.43(d,J=1.7 Hz,1H),7.33(d,J=8.7Hz,2H),7.07(d,J=1.8Hz,1H),3.97(d,J=8.4Hz,1H),3.88(dd d,J=10.2,6.9,2.7Hz,1H),3.77(ddd,J=10.9,5.7,2.9Hz,1H),3.55–3.45(m,2H),3. 25(dd,J=11.1,4.0Hz,1H),2.84(ddd,J=11.5,6.9,2.9Hz,1H),0.85(d,J=5.6Hz,3H).

[0413] ESI-MS: m / z 439.2[M+H] + .

[0414] Biological assays

[0415] Experiment 1: Upregulation of miR124 by compounds

[0416] The effects of test compounds on miR124 expression levels were evaluated in human peripheral blood mononuclear cells (PBMCs). PBMCs were revived at 37°C, centrifuged at 400g for 10 minutes, and resuspended in RPMI1640 complete medium (containing 10% FBS) and incubated at 37°C + 5% CO2 for 24 hours. Screening was performed using 6-well plates: cells were seeded at a density of 2.0×106 cells / 4mL in 6-well plates and activated with RPMI1640 complete medium containing PHA-L (5ug / mL) and IL-2 (40U / mL) for 48 hours. Test compounds were added (final concentration 5μM) and treated at 37°C, 5% CO2 for 6 days, with the medium replaced on the third day. A control group received the same treatment with an equal amount of DMSO.

[0417] RNA extraction: On day 6, cells were collected into 15 mL centrifuge tubes and centrifuged at 400 g for 10 min. The supernatant was discarded. 500 μL of Trizol was added to the cell pellet, which was then pipetted evenly. The pellet was then transferred to a 1 mL centrifuge tube (RNase-free) and lysed at room temperature for 15 min. 100 μL of chloroform (Trizol:chloroform = 5:1 by volume) was added to each tube and mixed thoroughly. The pellet was allowed to stand at room temperature for approximately 15 min. Centrifugation was then performed at 4°C and 12,000 g for 15 min until distinct layers were visible (from bottom to top: pink lower organic phase, white middle protein phase, colorless supernatant aqueous phase). RNA from the upper layer was transferred to a clean 1.5 mL centrifuge tube (RNase-free). An equal amount of isopropanol was added and the pellet was allowed to stand at room temperature for 10 min to precipitate the RNA. The pellet was then centrifuged at 4°C and 12,000 g for 10 min. A small amount of white precipitate was visible at the bottom of the tube. Add 500 μL of 75% ethanol to rinse the precipitate and let it stand at room temperature for 5 minutes; centrifuge at 4°C and 7600g for 5 minutes; add RNase-free H2O to dissolve the precipitate after it becomes transparent, and detect the RNA sample concentration.

[0418] Reverse transcription: The above RNA reverse transcription system is detailed in Table 1:

[0419] Table 1. RNA reverse transcription system

[0420] cDNA reaction cycling conditions: 25°C, 5 min; 50°C, 15 min; 85°C, 5 min.

[0421] Fluorescence quantitative PCR reaction: miRNA quantification reaction was performed using the SYBR Green I chimeric fluorescence method, and the transcription level of the housekeeping gene U6 was detected as an internal reference. The fluorescence quantitative PCR amplification reaction system is detailed in Table 2:

[0422] Table 2. Fluorescence quantitative PCR amplification system Note: 1 is the stem-loop primer GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGAC; 2 indicates the cDNA template after 5-fold dilution; 2 indicates the cDNA template after 5-fold dilution.

[0423] (1) Using the protocol described above, different donor PBMC cells were used to evaluate the average fold change of miR-124 expression (compared with DMSO) by relative quantification. The in vitro results are detailed in Table 3 below:

[0424] Table 3. Upregulated expression levels of miR124 in PBMCs in vitro Note: The screening results of different batches in the table are normalized.

[0425] Experiment 2: Preventive and therapeutic effects of compounds on ulcerative colitis (UC) in mice

[0426] The sodium sulfate dextran (DSS)-induced ulcerative colitis (UC) model was used to evaluate the preventive and therapeutic effects of the positive drug ABX464 and the disclosed compound 23 on DSS-induced UC.

[0427] After acclimation, C57BL / 6 female mice (20-22 g) were randomly divided into seven groups according to body weight, as shown in Table 4. The mice were fed a 3% DSS diet on day 1. After 10 days of DSS feeding, the diet was switched to normal drinking water until day 13. The mice were then gavaged with the corresponding solvent and drug continuously from day 1 to 13. Body weight changes were recorded daily from day 1 to 13. Colon length was measured after body weight was recorded on day 13. The relative rate of body weight change and colon length were used to evaluate the preventive and therapeutic effects of the test drugs on ulcerative colitis in mice.

[0428] Table 4. Experimental animal groups and model induction cycles Note: Solvent 10% DMSO + 10% castor oil + 80% saline

[0429] (1) The results of the weight experiment showed that compared with the normal control group, the DSS model group began to experience a significant decrease in weight on the 8th day (p < 0.0001), and the weight loss rate gradually increased, reaching 14% on the 10th day (p < 0.0001). The 50 mg / kg dose group showed no sustained weight loss starting from day 8, and the 50 mg / kg test drug group showed a weight loss of 3.09% on day 9 (p=0.0004). Compared with the DSS model group, the weight of all drug-treated groups increased significantly on day 10. The weight loss rates of the ABX464 positive drug group and the test drug 6.25, 12.5, 25, and 50 mg / kg dose groups were 6.02% (p=0.0001), 7.52% (p=0.0046), 8.99% (p=0.0498), 7.96% (p=0.0087), and 3.8% (p<0.0001), respectively. The extent of weight recovery at the end point of the experiment was as follows: test drug group 450 mg / kg > ABX464 50 mg / kg. The extent of weight recovery in the low and medium dose groups of the test drug was comparable to that of the positive drug ABX464 (see Table 5 for details). These results indicate that compound 23 of the present disclosure has a good effect on restoring weight loss in mice with DSS-induced ulcerative colitis.

[0430] (2) Colon length results showed that compared with the normal control group, the colon length of the DSS model group was significantly shortened (p < 0.0001), only 72.3% of the control group; compared with the DSS model group, the colon length of all drug-treated groups increased significantly, among which the colon lengths of the positive drug group, the test drug 6.25, 12.5, 25 and 50 mg / kg dose groups were 96.5% (p < 0.0001), 89.79% (p = 0.0002), 98.1% (p < 0.0001), 90.9% (p < 0.0001) and 103.3% (p < 0.0001) of the control group, respectively (see Table 3 for details). The above results suggest that the disclosed compound 23 has a good therapeutic effect on the shortening of the colon in mice with DSS-induced ulcerative colitis.

[0431] Table 5. Percentage change in relative body weight of C57BL / 6 mice (%) Note: The data in the table are expressed as mean ± standard deviation (Mean ± SEM); * indicates P < 0.05 compared with the model group, ** indicates P < 0.01 compared with the model group, *** indicates P < 0.001 compared with the model group, **** indicates P < 0.0001 compared with the model group, and #### indicates P < 0.0001 compared with the control group.

[0432] Table 6. Colon length of C57BL / 6 mice Note: **** indicates P<0.0001 compared with the control group, ### indicates P<0.001 compared with the model group, and #### indicates P<0.0001 compared with the model group.

[0433] Trial 3: Pharmacokinetic testing

[0434] (1) SD male rats were used as test animals. Liquid chromatography-tandem mass spectrometry (LC-MS / MS) was used to determine the plasma drug concentrations at different time points after oral administration of ABX464 and compounds 23, 44, and 45, and after intravenous administration of test compounds 44 and 45. The pharmacokinetic characteristics of compounds 23, 44, and 45 in rats were investigated.

[0435] Male SD rats (200-220 g) were gavaged with ABX464 and compound 23 at a dose of 20.0 mg / kg, and compounds 44 and 45 at 25 mg / kg and 1 mg / kg, respectively, by gavage and intravenous administration, with three rats per group. The dosing solvent was 10% DMSO + 10% Cremophor EL in saline. The rats were fasted for approximately 12 hours before dosing and allowed to eat freely for 4 hours after dosing. Blood (0.2 mL) was collected from the jugular vein before dosing and at 5, 15, 30, 1, 2, 4, 6, 8, and 24 hours after dosing, and placed in labeled EDTA-K2 anticoagulant tubes. The blood was gently inverted to thoroughly mix the anticoagulant EDTA-K2 and immediately placed on wet ice. Plasma was separated by centrifugation immediately after blood collection at 4°C, 3500 rpm, for 5 minutes. The upper plasma layer was removed and stored at -80°C until analysis. LC-MS / MS was used to quantify the concentration of compound 23 in plasma. The pharmacokinetic parameters of the sample analysis results were calculated using WinNonlin software.

[0436] Table 7. Pharmacokinetic parameters

[0437] Pharmacokinetic results showed that: SD male rats were gavaged with 20 mg / kg of the test compound and ABX464, respectively. max 1853.3 ng / mL and 727.0 ng / mL, respectively, AUC 0-tThe Cmax of compounds 44 and 45 were 389 ng / mL and 2547 ng / mL, AUC0-t were 5573 h*ng / mL and 8400 h*ng / mL, respectively, the terminal elimination half-life was 8.7 h and 5.4 h, and the absolute bioavailability was 34.3% and 27.6%, respectively. The results are shown in Table 7. Compared with ABX464 at the same dose, compound 23 has a longer elimination half-life and a longer systemic exposure (C max and AUC 0-t ) is high and has good pharmacokinetic properties; compared with the positive compound ABX464, compound 45 has a long half-life and high systemic exposure (Cmax and AUC0-t); compound 44 has a longer half-life and the pharmacokinetic properties of the test compound are good.

[0438] (2) Beagle dogs were used as test animals. Liquid chromatography-tandem mass spectrometry (LC-MS / MS) was used to determine the plasma concentrations of test compound 45 at different time points after oral and intravenous administration. The pharmacokinetic characteristics of test compound 45 in beagle dogs were investigated.

[0439] Male beagle dogs (9-12 kg) were gavage-administered and intravenously administered with 6 mg / kg and 1 mg / kg of the test drug 45, respectively, in a 10% DMSO + 10% Cremophor EL solution in saline. The gavage group fasted for at least 12 hours prior to dosing, with free access to water. Four hours after dosing, all dogs were fed. Blood (1 mL) was collected from the jugular vein before dosing and at 5, 15, 30, 1, 2, 4, 8, 10, and 24 hours after dosing, and placed into labeled EDTA-2K anticoagulant tubes. The tubes were gently inverted to thoroughly mix the EDTA-2K anticoagulant and immediately placed on wet ice. Plasma was separated by centrifugation within 1 hour of blood collection at 4°C, 6800 g, and 6 minutes. The upper plasma layer was removed and stored at -20°C until analysis. The concentration of the test compound in dog plasma was determined by LC-MS / MS. The pharmacokinetic parameters were fitted using WinNonlin software, and the absolute bioavailability was calculated. The results are shown in Table 8.

[0440] Table 6. Pharmacokinetic parameters of compounds in beagle dogs

[0441] Pharmacokinetic results showed that when beagle dogs were orally administered 6 mg / kg of the test compound 45, the Cmax and AUC0-t of compound 45 were 204 ng / mL and 990 h*ng / mL, respectively, the terminal elimination half-life was 7.18 h, and the absolute bioavailability was 10.7%.

Claims

1. A compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein X and Y are independently selected from CH or N; A is selected from cyano, hydroxyl, carboxyl, optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, optionally substituted C1-C6 alkoxy, optionally substituted C3-C6 cycloalkyl, and optionally substituted aromatic ring; the substituents of the optionally substituted C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 alkoxy, C3-C6 cycloalkyl and aromatic ring are independently selected from hydrogen, halogen, cyano, hydroxyl, carboxyl, COOR, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, C1-C6 haloalkoxy, C1-C6 alkylthio, C1-C6 haloalkylthio, C1-C6 alkylamino, C1-C6 haloalkylamino, HetAr 1 ; He 1 is an optionally substituted 4-10 membered heterocyclic ring or 5-10 membered aromatic ring having 1 to 3 heteroatoms independently selected from N, O or S; R1 and R2 are independently selected from hydrogen, halogen, hydroxyl, carboxyl, COOR, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 alkoxy, optionally substituted C3-C6 cycloalkyl, optionally substituted C1-C6 alkylamino; the substituents of the C1-C6 alkyl, C1-C6 alkoxy and C3-C6 cycloalkyl, C1-C6 alkylamino are independently selected from hydrogen, halogen, hydroxyl, carboxyl, COOR, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, C1-C6 haloalkoxy, C1-C6 alkylamino, C1-C6 haloalkylamino; Or R1 and R2 together with the carbon atoms to which they are attached further form an optionally substituted saturated 5- to 6-membered heterocyclic ring, wherein the 5- to 6-membered heterocyclic ring may optionally contain heteroatoms in N and O, and the substituents of the optionally substituted saturated 5- to 6-membered heterocyclic ring are independently selected from hydrogen, halogen, hydroxyl, carboxyl, COOR, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, C1-C6 haloalkoxy, C1-C6 alkylamino, C1-C6 haloalkylamino; or R1 and R2 together with the carbon atoms to which they are attached further form an optionally substituted 5-6 membered aromatic ring; the substituents are independently selected from hydrogen, halogen, hydroxyl, carboxyl, COOR, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, C1-C6 haloalkoxy, C1-C6 alkylamino, C1-C6 haloalkylamino; The following compounds ax are excluded: Preferably, in the compound of formula (I), X is CH; Y is N; A is C2-C6 alkenyl; R1 and R2 together with the carbon atoms to which they are attached further form an optionally substituted 5-6-membered aromatic ring, and are connected with adjacent benzene rings to form a condensed ring; the substituent is halogen; further preferably, R1 and R2 together with the carbon atoms to which they are attached form a benzene ring, and are connected with adjacent benzene rings to form a condensed ring; The substituent is halogen.

2. A compound of formula (I-1), or a pharmaceutically acceptable salt thereof, wherein X and Y are independently selected from CH or N; A is selected from cyano, hydroxyl, carboxyl, optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, optionally substituted C1-C6 alkoxy, optionally substituted C3-C6 cycloalkyl, and optionally substituted aromatic ring; the substituents of the optionally substituted C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 alkoxy, C3-C6 cycloalkyl and aromatic ring are independently selected from hydrogen, halogen, cyano, hydroxyl, carboxyl, COOR, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, C1-C6 haloalkoxy, C1-C6 alkylthio, C1-C6 haloalkylthio, C1-C6 alkylamino, C1-C6 haloalkylamino, HetAr 1 ; He 1 is an optionally substituted 4-10 membered heterocyclic ring or 5-10 membered aromatic ring having 1 to 3 heteroatoms independently selected from N, O or S; the substituents are selected from hydrogen, halogen, cyano, hydroxyl, carboxyl, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, C1-C6 haloalkoxy, C1-C6 alkylthio, C1-C6 haloalkylthio, C1-C6 hydroxyalkyl; R0 is H or R1 and R2 together with the carbon atoms to which they are attached further form an optionally substituted 5-6 membered halogenated aromatic ring; the halogen in the halogenated aromatic ring is independently selected from F, Cl, Br; the substituents are independently selected from hydrogen, halogen, hydroxyl, carboxyl, COOR, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, C1-C6 haloalkoxy, C1-C6 alkylamino, C1-C6 haloalkylamino, HetAr 4 , He 4 is an optionally substituted 4-10 membered heterocyclic ring or 5-10 membered aromatic ring having 1 to 3 heteroatoms independently selected from N, O or S, the substituent being selected from hydrogen, halogen, cyano, hydroxyl, carboxyl, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, C1-C6 haloalkoxy, C1-C6 alkylthio, C1-C6 haloalkylthio, C1-C6 hydroxyalkyl; R a is selected from hydrogen, halogen, hydroxyl, carboxyl, C1-C6 alkyl, C1-C6 haloalkyl, R b and R c independently selected from hydrogen, halogen, hydroxy, carboxyl, C1-C6 alkyl, C1-C6 haloalkyl; or R b and R c Together with the nitrogen atom to which they are attached, they further form an optionally substituted saturated 5- to 6-membered heterocyclic ring, wherein the 5- to 6-membered heterocyclic ring may optionally contain heteroatoms in N and O, and the substituents of the optionally substituted saturated 5- to 6-membered heterocyclic ring are independently selected from hydrogen, halogen, hydroxyl, carboxyl, COOR, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, C1-C6 haloalkoxy, C1-C6 alkylamino, and C1-C6 haloalkylamino; The following compounds ax are excluded:

3. A compound of formula (II) or a pharmaceutically acceptable salt thereof: R3 is selected from hydrogen, halogen, cyano, hydroxyl, carboxyl, COOR, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, C1-C6 haloalkoxy, C1-C6 alkylthio, C1-C6 haloalkylthio, C1-C6 alkylamino, C1-C6 haloalkylamino, HetAr 2 ; R is a C1-C6 alkyl group; He 2 is a substituted or unsubstituted 4-6 membered monocyclic heterocyclic ring having 1 to 3 heteroatoms independently selected from N, O or S; and is connected to the adjacent benzene ring to form a condensed ring; the substituent is selected from hydrogen, halogen, cyano, hydroxyl, carboxyl, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, C1-C6 haloalkoxy, C1-C6 alkylthio, C1-C6 haloalkylthio, C1-C6 hydroxyalkyl; R4 is selected from hydrogen, halogen, cyano, hydroxyl, carboxyl, COOR, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, C1-C6 haloalkoxy; R is C1-C6 alkyl; The following compounds are excluded: Preferably, in the compound of formula (II), R3 is selected from HetAr 2 ;HetAr 2 is a substituted or unsubstituted 4-6 membered monocyclic aromatic heterocycle having 1 to 3 heteroatoms independently selected from N, O or S; and is connected to the adjacent benzene ring to form a condensed ring; the substituent is selected from hydrogen, halogen, cyano, hydroxyl, carboxyl, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, C1-C6 haloalkoxy, C1-C6 alkylthio, C1-C6 haloalkylthio, C1-C6 hydroxyalkyl; the further substituent is selected from hydrogen, halogen, cyano, hydroxyl, carboxyl, C1-C3 alkyl, C1-C3 haloalkyl, C1-C3 alkoxy, C1-C3 haloalkoxy, C1-C3 alkylthio, C1-C3 haloalkylthio, C1-C3 hydroxyalkyl; R4 is halogen; More preferably, in the compound of formula (II), R3 is selected from HetAr 2 ;HetAr 2 It is a substituted or unsubstituted 4-6 membered monocyclic saturated heterocyclic ring containing one O; and it is connected with the adjacent benzene ring to form a condensed ring; the substituent is selected from hydrogen, halogen, cyano, hydroxyl, and carboxyl; R4 is halogen.

4. A compound of formula (III) or a pharmaceutically acceptable salt thereof: R6 is selected from hydrogen, halogen, cyano, hydroxyl, carboxyl, COOR, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, C1-C6 haloalkoxy, C1-C6 alkylthio, C1-C6 haloalkylthio, C1-C6 alkylamino, C1-C6 haloalkylamino, HetAr 3 ; R is a C1-C6 alkyl group; He 3 is a substituted or unsubstituted 4-6 membered monocyclic heterocyclic ring having 1 to 3 heteroatoms independently selected from N, O or S; and connected with the adjacent benzene ring to form a condensed ring; the substituent is selected from hydrogen, halogen, hydroxyl, and carboxyl; R7 and R8 are independently selected from hydrogen, halogen, hydroxyl, carboxyl, COOR, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, C1-C6 haloalkoxy; R is C1-C6 alkyl.

5. The compound according to claim 3 or a pharmaceutically acceptable salt thereof, wherein R6 is selected from C1-C6 haloalkoxy or C1-C6 haloalkylthio; R7 and R8 are independently selected from hydrogen, halogen, C1-C6 haloalkyl, and C1-C6 alkoxy; preferably, R6 is selected from C1-C3 haloalkoxy or C1-C3 haloalkylthio; R7 and R8 are independently selected from hydrogen, halogen, C1-C3 haloalkyl, and C1-C3 alkoxy; more preferably, R7 and R8 are not hydrogen at the same time, or preferably R6 is selected from HetAr1 is a substituted or unsubstituted 4-6 membered monocyclic heterocycle having 1 to 3 heteroatoms independently selected from N, O or S; and is connected to the adjacent benzene ring to form a condensed ring; the substituent is selected from hydrogen and halogen; R7 and R8 are independently selected from hydrogen and halogen; more preferably, R7 and R8 are not hydrogen at the same time.

6. A compound of formula (III-1) or a pharmaceutically acceptable salt thereof: R6 is selected from hydrogen, halogen, cyano, hydroxyl, carboxyl, COOR, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, C1-C6 haloalkoxy, C1-C6 alkylthio, C1-C6 haloalkylthio, C1-C6 alkylamino, C1-C6 haloalkylamino, HetAr 3 ; R is a C1-C6 alkyl group; He 3 is a substituted or unsubstituted 4-6 membered monocyclic heterocyclic ring having 1 to 3 heteroatoms independently selected from N, O or S; and connected with the adjacent benzene ring to form a condensed ring; the substituent is selected from hydrogen, halogen, hydroxyl, and carboxyl; R0 is H or R7 and R8 are independently selected from chlorine, C1-C6 haloalkylamino, HetAr 4 , He 4 is an optionally substituted 4-10 membered heterocyclic ring or 5-10 membered aromatic ring having 1 to 3 heteroatoms independently selected from N, O or S; R a is selected from hydrogen, halogen, hydroxyl, carboxyl, C1-C6 alkyl, C1-C6 haloalkyl, R b and R c independently selected from hydrogen, halogen, hydroxy, carboxyl, C1-C6 alkyl, C1-C6 haloalkyl; or R b and R c Together with the nitrogen atom to which they are attached, they further form an optionally substituted saturated 5- to 6-membered heterocyclic ring, wherein the 5- to 6-membered heterocyclic ring may optionally contain heteroatoms in N and O. The substituents of the optionally substituted saturated 5- to 6-membered heterocyclic ring are independently selected from hydrogen, halogen, hydroxy, carboxyl, COOR, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, C1-C6 haloalkoxy, C1-C6 alkylamino, and C1-C6 haloalkylamino.

7. The compound according to claim 6 or a pharmaceutically acceptable salt thereof, wherein R6 is selected from C1-C6 haloalkoxy or C1-C6 haloalkylthio; preferably, R6 is selected from C1-C3 haloalkoxy or C1-C3 haloalkylthio; more preferably, R6 is trifluoromethyloxy; preferably, R7 is selected from F, Cl or Br; preferably, R0 is H; preferably, R7 is halogen; R8 is selected from HetAr 4 or Preferably, HetAr 4 is an optionally substituted 4-10 membered heterocyclic ring having 1 to 3 heteroatoms independently selected from N, O or S, preferably HetAr 4 The substituents are selected from hydrogen, halogen, hydroxyl, carboxyl, methyl, ethyl, propyl, butyl, C1-C3 haloalkyl; preferably, R a is selected from hydrogen, halogen, hydroxy, carboxyl, methyl, ethyl, propyl, butyl, R b and R c independently selected from hydrogen, halogen, hydroxy, carboxyl, methyl, ethyl, propyl, butyl; or R b and R c Together with the nitrogen atom to which they are attached, they further form an optionally substituted saturated 5- to 6-membered heterocyclic ring containing N and O, wherein the substituents of the 5- to 6-membered heterocyclic ring are independently selected from hydrogen, halogen, hydroxyl, carboxyl, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, C1-C6 haloalkoxy, C1-C6 alkylamino, C1-C6 haloalkylamino; preferably, R b and R c independently selected from methyl, ethyl, propyl, butyl; or R b and R c Together with the nitrogen atom to which they are attached, they further form a saturated 5- to 6-membered heterocyclic ring containing N and O.

8. A compound or a pharmaceutically acceptable salt thereof, wherein the compound is selected from:

9. A method for preparing a compound, characterized in that: Any of the following (1) to (3): (1) Preparation method of the compound of formula (I): The compound of formula (Ia) or its pharmaceutically acceptable salt undergoes nucleophilic substitution with the compound of formula (Ib) or its pharmaceutically acceptable salt to obtain a compound of formula (I) or its pharmaceutically acceptable salt; wherein B is a halogen; preferably a chlorine atom; X, Y, R1, R2 are as described in claim 1 definition; (2) Preparation method of the compound of formula (II): The compound of formula (IIa) or its pharmaceutically acceptable salt undergoes nucleophilic substitution with the compound of formula (IIb) or its pharmaceutically acceptable salt to obtain the compound of formula (II) or its pharmaceutically acceptable salt; wherein B is a halogen; preferably a chlorine atom; R3 and R4 are as defined in claim 2; (3) Preparation method of the compound of formula (III): The compound of formula (IIIa) or its pharmaceutically acceptable salt undergoes nucleophilic substitution with the compound of formula (IIIb) or its pharmaceutically acceptable salt to obtain a compound of formula (III) or its pharmaceutically acceptable salt; wherein B is a halogen; preferably a chlorine atom; R6, R7, and R8 are as defined in any one of claims 3 to 7.

10. A pharmaceutical composition comprising the compound according to any one of claims 1 to 8 or a pharmaceutically acceptable salt thereof and one or more pharmaceutically acceptable carriers.

11. Use of the compound according to any one of claims 1 to 8 or a pharmaceutically acceptable salt thereof as a microRNA-124 regulator.

12. Use of the compound according to any one of claims 1 to 8 or a pharmaceutically acceptable salt thereof in the preparation of a medicament for preventing or treating inflammatory diseases.

13. The use according to claim 12, characterized in that: The inflammatory disease is selected from inflammatory bowel disease, rheumatoid arthritis, Crohn's disease, ulcerative colitis, multiple sclerosis, Alzheimer's disease, Parkinson's disease, osteoarthritis, atherosclerosis, ankylosing spondylitis, psoriasis, dermatitis, Sjogren's syndrome, bronchitis, asthma and inflammation associated with colon cancer; preferably, the inflammatory disease is selected from inflammatory bowel disease, rheumatoid arthritis, Crohn's disease, ulcerative colitis, multiple sclerosis, osteoarthritis, ankylosing spondylitis, psoriasis, Sjogren's syndrome, bronchitis and inflammation associated with colon cancer.