A MICROORGANISM INTRODUCED WITH EXOGENOUS NAD-DEPENDENT ISOCITRATE DEHYDROGENASE AND A METHOD FOR PRODUCING L-AMINO ACID USING IT
Patent Information
- Application Number
- EA202690932
- Authority / Receiving Office
- EA · EA
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-05-10
- Filing Date
- 2025-05-09
- Publication Date
- 2026-07-16
AI Technical Summary
Current methods for producing L-amino acids, particularly L-tryptophan and L-histidine, face challenges in efficiency and environmental impact, with direct fermentation methods not achieving large-scale industrialization and chemical processes being inefficient and polluting.
Introduction of a NAD-dependent isocitrate dehydrogenase derived from Streptococcus mutans into Corynebacterium microorganisms to enhance their L-amino acid production capabilities.
The modified microorganisms exhibit increased production of L-amino acids, such as L-tryptophan and L-histidine, offering a more efficient and environmentally friendly approach for industrial-scale production.
Abstract
Description
Microorganisms with introduced foreign NAD-dependent isocitrate dehydrogenase and methods for producing L-amino acids using the same
[0001] The present application relates to a Corynebacterium genus microorganism having L-amino acid production ability, wherein NAD-dependent isocitrate dehydrogenase derived from Streptococcus mutans or a polynucleotide encoding the same has been introduced; a method for producing L-amino acids, comprising a step of culturing the microorganism in a medium; a composition for producing L-amino acids, comprising the microorganism, a culture of the microorganism, a fermentation product of the microorganism, or a combination of two or more thereof; and a use of the microorganism for producing L-amino acids.
[0002]
[0003] The process of producing target substances (e.g., amino acids) from microorganisms has been extensively studied as an environmentally friendly and safe production method. Among these, ongoing research has focused on producing large quantities of target substances from microorganisms of the genus Corynebacterium. Microorganisms of the genus Corynebacterium (Corynebacterium sp.), particularly Corynebacterium glutamicum, are Gram-positive microorganisms widely used for the production of L-amino acids and other useful substances.
[0004] L-amino acids are the basic building blocks of proteins and are used as important raw materials for pharmaceuticals, food additives, animal feed, nutritional supplements, pesticides, and disinfectants. To produce L-amino acids and other useful substances, various research efforts are being conducted to develop high-efficiency production microorganisms and fermentation process technologies. For example, target-substance-specific approaches, such as increasing the expression of genes encoding enzymes involved in L-tryptophan biosynthesis or deleting genes unnecessary for biosynthesis, are primarily being utilized (US 8,945,907 B2).
[0005] L-tryptophan, an essential amino acid, has been widely used as a feed additive, pharmaceutical raw material for fluids, and health food material. It can be produced through chemical synthesis, enzymatic reaction, and fermentation, but currently, direct fermentation using microorganisms is mainly used. According to previous studies, it has been proven through actual quantitative analysis in cells that tryptophan biosynthesis requires the highest level of energy among the 20 amino acids (Proc. Natl. Acad. Sci. USA (2002) V99, pp. 3695-3700). Therefore, research to effectively increase L-tryptophan production is still needed.
[0006] L-histidine, one of the 20 standard amino acids, is classified as an essential amino acid for growing children. L-histidine participates in important physiological processes, including antioxidant activity and immune regulation, and is used in the medical industry as a raw material for gastrointestinal ulcer treatments, circulatory system treatments, and amino acid rehydration solutions. Histidine is particularly abundant in hemoglobin, so it is primarily produced through protein hydrolysis extraction using blood meal. However, this process has drawbacks such as low efficiency and environmental pollution. While L-histidine can be produced through microbial fermentation, large-scale industrialization has not yet been achieved. Therefore, research to effectively increase L-histidine production is still necessary.
[0007]
[0008] The problem to be solved by the present application is to provide a microorganism into which an exogenous NAD-dependent isocitrate dehydrogenase has been introduced and a method for producing L-amino acids using the same.
[0009]
[0010] One aspect of the present application provides a microorganism of the genus Corynebacterium having L-amino acid production ability, into which a NAD-dependent isocitrate dehydrogenase protein derived from Streptococcus mutans or a polynucleotide encoding the same has been introduced.
[0011] In one specific example, the L-amino acid may be at least one selected from the group consisting of L-tryptophan and L-histidine.
[0012] In another specific example, the NAD-dependent isocitrate dehydrogenase protein derived from Streptococcus mutans may comprise the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having at least 80% sequence identity thereto.
[0013] In another specific example, the NAD-dependent isocitrate dehydrogenase protein derived from Streptococcus mutans may be encoded by the icd gene.
[0014] In another specific example, the polynucleotide encoding the NAD-dependent isocitrate dehydrogenase protein derived from Streptococcus mutans may comprise the base sequence of SEQ ID NO: 2.
[0015] In another specific example, the Corynebacterium genus microorganism may be Corynebacterium glutamicum.
[0016] As a microorganism according to any one of the preceding specific examples, the microorganism of the genus Corynebacterium may have an increased ability to produce L-amino acids compared to a non-modified microorganism.
[0017] Another aspect of the present application provides a method for producing L-amino acids, comprising the step of culturing a Corynebacterium genus microorganism having L-amino acid production ability, into which a NAD-dependent isocitrate dehydrogenase protein derived from Streptococcus mutans or a polynucleotide encoding the same has been introduced, in a medium.
[0018] In one specific example, the L-amino acid may be at least one selected from the group consisting of L-tryptophan and L-histidine.
[0019] In another specific embodiment, the method may further comprise a step of recovering L-amino acid from the cultured microorganism, a culture of the microorganism, a fermented product of the microorganism, or the culture medium.
[0020] Another aspect of the present application provides a composition for producing L-amino acids, comprising a Corynebacterium genus microorganism having L-tryptophan production ability, into which a NAD-dependent isocitrate dehydrogenase protein derived from Streptococcus mutans or a polynucleotide encoding the same has been introduced; a culture of the microorganism, a fermentation product of the microorganism, or a combination of two or more thereof.
[0021] In one specific example, the L-amino acid may be at least one selected from the group consisting of L-tryptophan and L-histidine.
[0022]
[0023] The microorganism of the genus Corynebacterium, which has L-amino acid production ability and into which the NAD-dependent isocitrate dehydrogenase protein derived from Streptococcus mutans of the present application or a polynucleotide encoding the same has been introduced, can produce L-amino acids in a high yield and can thus be usefully utilized in the industrial production of L-amino acids.
[0024]
[0025] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application can also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application is not limited by the specific descriptions described below. Furthermore, numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated into this specification in their entirety by reference to more clearly explain the level of the technical field to which this application belongs and the contents of this application.
[0026]
[0027] definition
[0028]
[0029] As used in the specification and appended claims of this application, the singular articles "a," "an," and "the" include plural referents unless otherwise stated. Furthermore, unless otherwise stated, singular terms include plurals, and plural terms include the singular. Furthermore, in the specification and appended claims of this application, unless otherwise stated, the use of "or" is intended to include "and / or."
[0030]
[0031] In this application, the term "about" may be used before a specific numerical value. As used herein, the term "about" encompasses not only the exact number described after the term, but also a range that is or is nearly that number. Whether a number is or is nearly the specific number described can be determined based on the context in which it is presented. For example, the term "about" may refer to a range of -10% to +10% of a numerical value. In another example, the term "about" may refer to a range of -5% to +5% of a given numerical value. However, this is not a limitation.
[0032]
[0033] In this application, the terms "first, second, third," "i), ii), iii),," or "(a), (b), (c), (d),," may be used to distinguish each component. When the terms are used in connection with steps of a method, use, or analysis, these terms do not imply that they are performed consecutively or in order, for example, there may be no time interval between these steps, they may be performed simultaneously, or they may be performed sequentially, in reverse order, or randomly, with intervals of seconds, minutes, hours, days, or months.
[0034]
[0035] In this application, the term "consisting of" means that the proportion of a specific feature, step, component, or other component(s) described below the term totals 100%. The features, steps, components, or other components described below the term "consisting of" may be essential or mandatory. For example, other than the features, steps, components, or other components described below "consisting of," any other feature, step, component, or other component, or any non-essential feature, step, component, or other component may be excluded.
[0036] In this application, the term "consisting essentially of" means that the presence of one or more unspecified features, steps, components, or other components of the subject matter claimed in this application is not substantially affected by the presence of the unspecified one or more features, steps, components, or other components.
[0037] In this application, the term "comprising" means the presence of a feature, step, component, or other component described below the term, and does not exclude the presence of one or more additional features, steps, components, or other components. The features, steps, components, or other components described below "comprising" in this application may be essential or mandatory, but in some embodiments, other optional or non-essential features, steps, components, or other components may be further included.
[0038]
[0039] proteins, polypeptides
[0040]
[0041] In this application, the term "protein" or "polypeptide" means a polymer or oligomer of consecutive amino acid residues. In this application, "polypeptide," "protein," and "peptide" may be used interchangeably.
[0042]
[0043] In this application, the term "mature polypeptide or mature protein" refers to a polypeptide or protein in a form that lacks a signal sequence or a propeptide sequence. A mature polypeptide or mature protein may be a functional form of a polypeptide or protein. A mature polypeptide or mature protein refers to a polypeptide in its final form after translation and / or after posttranslational modification. For example, examples of such posttranslational modifications may include, but are not limited to, N-terminal processing, C-terminal truncation, glycosylation, phosphorylation, and leader sequence removal.
[0044]
[0045] In this application, amino acid sequences are described in N-terminal → C-terminal orientation unless otherwise indicated.
[0046] In the present application, with respect to an amino acid sequence, it is obvious that a polypeptide or protein “comprising” an amino acid sequence set forth in a specific sequence number, a polypeptide or protein “consisting of” an amino acid sequence set forth in a specific sequence number, or a polypeptide or protein “having” an amino acid sequence set forth in a specific sequence number may also include a polypeptide or protein in which some amino acid(s) are deleted, modified, substituted, or added, as long as it has the same or corresponding activity as a polypeptide or protein consisting of the amino acid sequence of the corresponding sequence number. For example, the polypeptide or protein may also include a polypeptide or protein having an amino acid(s) addition or deletion, a naturally occurring mutation, a silent mutation, or a conservative substitution within or before or after the polypeptide or protein (N-terminal or C-terminal), which does not alter the function of the protein, as long as it has the same or corresponding activity.
[0047] Also, for example, a polypeptide or protein conjugated with an N-terminal signal (or leader) sequence that is involved in translocation of a protein (polypeptide) co-translationally or post-translationally, or a polypeptide or protein conjugated with another sequence or linker so that the polypeptide or protein can be identified, purified, or synthesized, may also be included in the scope of the polypeptide or protein having the amino acid sequence set forth in the specific sequence number.
[0048] In this application, the term "conservative substitution" refers to the replacement of an amino acid with another amino acid having similar structural and / or chemical properties. Such amino acid substitutions may generally occur based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. For example, positively charged (basic) amino acids include arginine, lysine, and histidine; negatively charged (acidic) amino acids include glutamic acid and aspartic acid; amino acids with nonpolar side chains (nonpolar amino acids) include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, and proline; Amino acids with polar or hydrophilic side chains (polar amino acids) include serine, threonine, cysteine, tyrosine, asparagine, and glutamine. As another example, amino acids with charged side chains include arginine, lysine, histidine, glutamic acid, and aspartic acid, while amino acids with uncharged side chains (also called neutral amino acids) include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, proline, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. As another example, phenylalanine, tryptophan, and tyrosine can be classified as aromatic amino acids. As another example, valine, leucine, and isoleucine can be classified as branched amino acids.As another example, the 20 amino acids can be classified into five groups based on size: glycine, alanine, and serine; cysteine, proline, threonine, aspartic acid, and asparagine; valine, histidine, glutamic acid, and glutamine; isoleucine, leucine, methionine, lysine, and arginine; and phenylalanine, tryptophan, and tyrosine. However, this is not necessarily limited to these groups. Typically, conservative substitutions may have little or no effect on the activity of a polypeptide or protein.
[0049]
[0050] genes, polynucleotides
[0051]
[0052] In this application, the term "gene" narrowly refers to a polynucleotide encoding a functional molecule, and broadly refers to a polynucleotide comprising a polynucleotide encoding the functional molecule and regions preceding and following the polynucleotide. In one specific example, the functional molecule may be RNA or a protein, and the gene may have a sequence (intron) inserted between each coding region (exon).
[0053]
[0054] In this application, the terms "polynucleotide," "nucleic acid," or "nucleic acid molecule" refer to a polymer of nucleotides in which nucleotide units (monomers) are covalently bonded to form a long chain, and mean a strand of DNA (e.g., cDNA or genomic DNA) or RNA (e.g., mRNA) of a certain length or longer. In this application, "polynucleotide," "nucleic acid," and "nucleic acid molecule" may be used interchangeably.
[0055]
[0056] identity, homology
[0057]
[0058] In this application, the terms "identity" or "homology" refer to the degree of similarity between two given amino acid or base sequences, which may be expressed as a percentage. In this application, "homology" and "identity" may often be used interchangeably.
[0059] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms, which may be used in conjunction with default gap penalties established by the program being used.
[0060] Whether any two polynucleotide or polypeptide sequences are homologous, similar or identical can be determined using known computer algorithms such as the "FASTA" program using default parameters, for example as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as performed in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) or the GAP computer program such as the Smith-Waterman algorithm (Smith and Waterman, Adv. Appl. Math (1981) 2:482) can be determined by comparing the sequence information (GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO et al.](1988) SIAM J Applied Math 48: 1073). For example, homology, similarity, or identity can be determined using BLAST or ClustalW from the National Center for Biotechnology Information database.
[0061]
[0062] Additionally, whether any two polynucleotide sequences have homology, similarity or identity can be determined by a Southern hybridization experiment under appropriate hybridization conditions, which can be determined by methods well known to those skilled in the art (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual; F. M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York), but are not limited thereto. For example, homologous or identical polynucleotide sequences can generally hybridize along the entire sequence or at least about 50%, 60%, 70%, 80% or 90% of the entire length under stringent conditions.
[0063] In this application, the term "stringent conditions" refers to conditions that allow specific hybridization between polynucleotides. Such conditions are specifically described in the literature (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8). For example, it may be a condition in which polynucleotides having high homology or identity hybridize with each other, polynucleotides having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity hybridize with each other, and polynucleotides having lower homology or identity do not hybridize with each other, or a condition in which washing is performed once, specifically twice or three times, at a salt concentration and temperature equivalent to 60°C, 1ХSSC, 0.1% SDS, specifically 60°C, 0.1ХSSC, 0.1% SDS, and more specifically 68°C, 0.1ХSSC, 0.1% SDS, which is a washing condition of a typical southern hybridization.
[0064] The above hybridization can occur between nucleotides having complementary base sequences; however, the hybridized polynucleotides may contain some mismatches between bases, depending on the stringency of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, in DNA, adenosine is complementary to thymine, and cytosine is complementary to guanine. Accordingly, the polynucleotides of the present application may include isolated nucleic acid fragments that are complementary in their entirety, as well as substantially similar base sequences.
[0065] For example, a polynucleotide having homology or identity with the polynucleotide of the present application can be hybridized and detected at a Tm value of 55°C. In addition, the Tm value may be, but is not limited to, 60°C, 63°C, or 65°C, and can be appropriately adjusted by a person skilled in the art.
[0066] The appropriate stringency for hybridizing the polynucleotides depends on the length and degree of complementarity of the polynucleotides, variables which are well known in the art (e.g., J. Sambrook et al., supra).
[0067]
[0068] Nucleic acid structures, vectors, and transformation
[0069]
[0070] As used herein, the term "nucleic acid construct" refers to an artificially designed single- or double-stranded nucleic acid molecule contained within a vector that can be used to integrate a target genetic material into a suitable host or host cell. For example, the nucleic acid construct may comprise a transgene delivered via a transformation vector that allows the inserted sequence to be replicated and / or expressed in the host cell. For example, the transgene may be cloned from an existing sequence or artificially synthesized.
[0071]
[0072] The term "vector" as used in this application means a DNA preparation for delivering a desired polynucleotide into a suitable host or host cell.
[0073] For example, a vector may comprise a base sequence of a polynucleotide encoding a target polypeptide operably linked to a suitable expression control region (or expression control sequence) so as to enable expression of the target polypeptide in a suitable host. The expression control region may include a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and sequences regulating the termination of transcription and translation. After being transformed into a suitable host cell (microorganism), the vector may replicate or function independently of the host genome, or may be integrated into the genome itself to replicate or function.
[0074] Additionally, as an example, the vector of the present application may include a sequence for inserting a target polynucleotide into a chromosome. Insertion of the polynucleotide into the chromosome using the vector may be accomplished by any method known in the art, such as, but not limited to, homologous recombination.
[0075] The vector used in the present application is not particularly limited, and any vector known in the art can be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors, and pDZ series, pDC series, pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series can be used as plasmid vectors. For example, pDZ, pDC, pDC24, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors can be used.
[0076] The above vector may further include a selection marker to determine whether the vector is transformed into a host cell or further, whether the vector is integrated into the host cell chromosome. The selection marker is used to select cells transformed with the vector or to determine whether the target polynucleotide is integrated into the chromosome. Markers that confer selectable phenotypes such as drug resistance, nutrient requirement, cytotoxic agent resistance, or surface polypeptide expression may be used. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypic characteristics, thereby enabling selection of transformed cells.
[0077] In this application, the term "transformation" refers to changing the genetic characteristics of a host cell (microorganism) by introducing a target polynucleotide, or a vector containing the same, into the host cell (microorganism). The transformed polynucleotide may be inserted into the chromosome of the host cell (microorganism) or located extrachromosomally. In addition, the polynucleotide may comprise DNA or RNA. The polynucleotide may be introduced in an appropriate form depending on the purpose of introduction. For example, a polynucleotide for expressing a target polypeptide may be introduced into a host cell (microorganism) in the form of an expression cassette, which is a genetic construct containing all elements necessary for autonomous expression. The expression cassette may typically include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal, all of which are operably linked to the coding sequence of the target polypeptide. The expression cassette may be in the form of an expression vector capable of self-replication. Additionally, the polynucleotide may be introduced into a host cell (microorganism) in its own form and operably linked to a sequence required for expression in the host cell (microorganism), but is not limited thereto.
[0078] As used herein, the term "operably linked" refers to a configuration in which a regulatory sequence is positioned appropriately so that the regulatory sequence controls the expression of a coding sequence. Accordingly, "operably linked" includes a regulatory region of a functional domain with a known or desired activity, such as a promoter, terminator, signal sequence, or enhancer region, attached or linked to a target (gene or polypeptide) so that the expression, secretion, or function of the target can be controlled according to the known or desired activity. For example, it may mean that a promoter sequence that initiates and mediates the transcription of a polynucleotide encoding a polypeptide is functionally linked to the polynucleotide sequence.
[0079] As used herein, the term “expression” includes, but is not limited to, any step involved in the production of a polypeptide, such as transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
[0080] As used herein, the term "expression vector" refers to a linear or circular nucleic acid molecule comprising a target polynucleotide sequence and a regulatory sequence operably linked thereto for expression thereof. For example, it may comprise the base sequence of a polynucleotide encoding a target polypeptide operably linked to a suitable expression regulatory region (or expression regulatory sequence) so as to enable expression of the target polypeptide in a suitable host.
[0081] In this application, the term "regulatory sequence" refers to a polynucleotide sequence necessary for controlling the expression of a target polynucleotide sequence. Each regulatory sequence may be a natural sequence (having the same origin) or a foreign sequence (derived from another gene) relative to the coding sequence, or a mutant sequence thereof, or another artificial sequence. Examples of the regulatory sequence include a leader sequence, a polyadenylation sequence, a propeptide sequence, a promoter, a signal peptide sequence, an operator sequence, a sequence encoding a ribosome binding site, and a sequence that controls transcription and translation termination. The minimum unit of the regulatory sequence may include a promoter, a transcription and translation termination sequence.
[0082]
[0083] In this application, the term "genetic recombination" means a natural or artificial process in which elements that make up genes, such as DNA or RNA, are changed from their original sequence during the disassembly and reassembly process.
[0084] As used herein, the term "recombinant gene" refers to a gene with a novel genetic structure resulting from genetic recombination, such as chemical synthesis or genetic engineering techniques. The terms "recombinant gene," "recombinant DNA," and "recombinant polynucleotide" may be used interchangeably in this application. For example, the recombinant gene may include an artificial combination of nucleic acid fragments, such as regulatory sequences, that are not found together in nature.
[0085] In this application, the term “recombinant protein” means a protein produced as a result of genetic recombination.
[0086]
[0087] microorganism
[0088]
[0089] In this application, the term "microorganism (or strain)" includes both wild-type microorganisms and prokaryotic or eukaryotic microorganisms that have undergone genetic modification, either naturally or artificially. It may be a microorganism that has a specific mechanism weakened or increased due to a cause such as the insertion of an external gene or the increased or inactivated activity of an endogenous gene, and may be a microorganism that includes genetic modification for the production of a desired polypeptide, protein, or product. In this application, the terms "microorganism," "strain," "host," and "host cell" may be used interchangeably.
[0090] As used herein, the term "recombinant microorganism" refers to a microorganism that has been genetically modified to exhibit a different genotype and / or phenotype compared to a naturally occurring microorganism (e.g., when the genetic modification affects the nucleic acid sequence coding of the microorganism), and may include all progeny or potential progeny of the microorganism. The terms "recombinant microorganism," "genetically modified microorganism," "recombinant host cell," "recombinant cell," and "recombinant strain" may be used interchangeably in this application. The recombinant microorganism may, for example, express a gene not found in its native (non-recombinant) form; may not express a gene expressed in its native form; or may express a native gene in a manner different from that in which it is expressed in its native form.
[0091] For example, the microorganism of the present application may be, but is not limited to, a microorganism (e.g., a recombinant microorganism) into which an NAD-dependent isocitrate dehydrogenase protein or a polynucleotide encoding the same has been introduced.
[0092] In this application, the term "microorganism having L-amino acid production ability" refers to a microorganism capable of producing L-amino acids within the organism, and may include both a microorganism that does not inherently have L-amino acid production ability but is endowed with L-amino acid production ability, and a microorganism that inherently has L-amino acid production ability. The L-amino acid production ability may be endowed or enhanced through species improvement.
[0093] In this application, the term "unmodified microorganism (strain)" does not exclude a microorganism (strain) that contains a mutation that may occur naturally, and may refer to a wild-type microorganism (strain) or a natural microorganism (strain) itself, or a microorganism (strain) before its phenotype is changed by a genetic mutation caused by natural or artificial factors. In this application, the term "unmodified microorganism (strain)" may be used interchangeably with "pre-modified microorganism (strain)", "unmodified microorganism (strain)", "parent microorganism", "parent strain", "wild-type microorganism (strain)", "reference microorganism (strain)", or "reference microorganism (strain)". In this application, an unmodified microorganism may refer to a microorganism (strain) into which the NAD-dependent isocitrate dehydrogenase protein of the present application or a polynucleotide encoding the same is not introduced, or before it is introduced, but is not limited thereto. Additionally, in the present application, the unmodified microorganism may be a microorganism that does not contain a polypeptide consisting of sequence number 1 or a polynucleotide consisting of sequence number 2, but is not limited thereto.
[0094]
[0095] Increased protein (polypeptide) activity
[0096]
[0097] In this application, the term "increase" of protein (polypeptide) activity means that the activity of the protein (polypeptide) within a host cell (microorganism) is increased compared to its intrinsic activity. The increase may be used interchangeably with terms such as activation, up-regulation, overexpression, and enhancement. The host cell (microorganism) may be a prokaryotic or eukaryotic microorganism.
[0098] The increase in the above protein (polypeptide) activity may include the display of a protein (polypeptide) activity that the host cell (microorganism) did not inherently possess, or the display of an enhanced protein (polypeptide) activity compared to the inherent activity or activity before modification.
[0099] For example, the above “exhibiting a protein (polypeptide) activity that was not inherently present” or “exhibiting an improved protein (polypeptide) activity” may be due to, but is not limited to, “introduction of a protein (polypeptide).”
[0100] In this application, the term "introduction" of a protein (polypeptide) means that a gene that a microorganism did not originally possess is expressed within the microorganism, thereby causing the activity of a specific protein to be exhibited, or that the activity of the polypeptide is strengthened, increased, or improved compared to the intrinsic activity of the protein or the activity before modification. For example, this may be due to the introduction of a gene encoding the protein (polypeptide) into a host cell (microorganism). For example, a polynucleotide encoding a specific protein (polypeptide) may be introduced into the chromosome of a host cell (microorganism), or a vector containing a polynucleotide encoding a specific protein (polypeptide) may be introduced into the host cell (microorganism), thereby causing the activity of the protein (polypeptide) to be exhibited or improved.
[0101] The above "intrinsic activity" refers to the activity of a specific protein (polypeptide) originally possessed by a host cell (microorganism) or an untransformed host cell (microorganism) before transformation, when the trait changes due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with "activity before transformation."
[0102] An increase in the activity of a protein (polypeptide) compared to the intrinsic activity means that the activity and / or concentration (expression amount) of the protein (polypeptide) of the host cell (microorganism) is enhanced compared to the activity and / or concentration (expression amount) of the protein (polypeptide) originally present in the host cell (microorganism) before transformation or in the non-transformed host cell (microorganism).
[0103] For example, the increase may be, but is not limited to, an increase in the activity or concentration of the corresponding protein (polypeptide) from a previous state, or an increase in the activity or concentration thereof, typically by at least about 1%, at least about 10%, at least about 25%, at least about 50%, at least about 75%, at least about 100%, at least about 150%, at least about 200%, at least about 300%, at least about 400%, or at least about 500%, up to at least about 1000% or at least about 2000%, relative to the activity or concentration in the host cell (microorganism) before transformation or in the untransformed host cell (microorganism).
[0104] An increase in the activity of the above protein (polypeptide) can be achieved by introducing an exogenous protein (polypeptide) or by increasing the activity of an endogenous protein (polypeptide). Whether the activity of the above protein (polypeptide) has increased can be confirmed by an increase in the activity level of the protein (polypeptide), the expression level, or the amount of a product resulting from the activity of the protein (polypeptide).
[0105] The increase in the activity of the above protein (polypeptide) can be achieved by various methods well known in the art, and is not limited as long as the activity of the target protein (polypeptide) can be increased compared to the host cell (microorganism) before transformation. Specifically, it may be, but is not limited to, genetic engineering and / or protein engineering well known to those skilled in the art as routine methods of molecular biology (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).
[0106] Specifically, the increase in activity of the protein (polypeptide) of the present application is
[0107] 1) Increase in the intracellular copy number of a polynucleotide encoding a protein (polypeptide);
[0108] 2) Modification of the gene expression control region on the chromosome that codes for a protein (polypeptide) (e.g., introduction of a mutation in the expression control region, replacement with a sequence having stronger activity, or insertion of a sequence having stronger activity);
[0109] 3) Modification of the base sequence encoding the initiation codon or 5'-UTR region of a gene transcript encoding a protein (polypeptide);
[0110] 4) Modification of the amino acid sequence of the protein (polypeptide) so as to increase the activity of the protein (polypeptide);
[0111] 5) Modification of a polynucleotide sequence encoding a protein (polypeptide) such that the activity of the protein (polypeptide) is increased (e.g., modification of a polynucleotide sequence of a protein (polypeptide) encoding gene such that the protein (polypeptide) is modified such that the activity of the protein (polypeptide) is increased);
[0112] 6) Introduction of a foreign protein (polypeptide) that exhibits the activity of a protein (polypeptide) or a foreign polynucleotide encoding the same;
[0113] 7) Codon optimization of polynucleotides encoding proteins (polypeptides);
[0114] 8) Analyze the tertiary structure of the protein (polypeptide) and select the exposed area to modify or chemically modify it.
[0115] 9) Control of cellular localization of proteins (polypeptides); or
[0116] 10) It may be a combination of two or more selected from 1) to 9), but is not particularly limited thereto.
[0117] for example,
[0118] The increase in the intracellular copy number of the polynucleotide encoding the protein (polypeptide) described above 1) may be caused by introducing a vector containing a polynucleotide encoding the protein (polypeptide) operably linked to an appropriate regulatory sequence into a host cell (microorganism). Alternatively, one copy or two or more copies of the polynucleotide encoding the protein (polypeptide) operably linked to an appropriate regulatory sequence may be introduced into a chromosome within the host cell (microorganism). The introduction into the chromosome may be performed by introducing a vector capable of inserting the polynucleotide into the chromosome within the host cell (microorganism), but is not limited thereto. The vector is as described above. The regulatory sequence may be a natural sequence (same in origin) or a foreign sequence (derived from another gene) to the polynucleotide sequence it encodes, or a mutant sequence thereof, or another artificial sequence, and may induce expression of the polynucleotide within the host cell (microorganism).
[0119] 2) The replacement of the gene expression control region (or expression control sequence) on the chromosome encoding the protein (polypeptide) with a sequence having strong activity may be, for example, introducing a mutation in the sequence by deletion, insertion, substitution, or a combination thereof to further increase the activity of the expression control region, or replacement with a sequence having stronger activity. The expression control region may include, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation. As an example, the original promoter may be replaced with a strong promoter, but is not limited thereto.
[0120] Examples of known strong promoters include, but are not limited to, the cj1 to cj7 promoters (US Patent No. US 7662943 B2), the lac promoter, the trp promoter, the trc promoter, the tac promoter, the lambda phage PR promoter, the PL promoter, the tet promoter, the gapA promoter, the SPL7 promoter, the SPL13 (sm3) promoter (US Patent No. US 10584338 B2), the O2 promoter (US Patent No. US 10273491 B2), the tkt promoter, and the yccA promoter.
[0121] The above 3) modification of the base sequence of the region encoding the initiation codon or 5'-UTR of the gene encoding the protein (polypeptide) may be, for example, a modification that encodes another initiation codon having a higher protein (polypeptide) expression rate than the endogenous initiation codon, or an RBS sequence having a higher protein (polypeptide) expression rate than the endogenous RBS (ribosome binding site) sequence, but is not limited thereto.
[0122] The modification of the amino acid sequence or polynucleotide sequence of the protein (polypeptide) of the above 4) and 5) may be, but is not limited to, introducing a sequence mutation by deletion, insertion, substitution, or a combination thereof in the amino acid sequence of the protein (polypeptide) or the polynucleotide sequence encoding the protein (polypeptide) so as to increase the activity of the protein (polypeptide), or replacing it with an amino acid sequence or polynucleotide sequence modified to increase the activity. The replacement may be performed, for example, by inserting a polynucleotide into a chromosome by homologous recombination, but is not limited thereto.
[0123] The introduction of the foreign polynucleotide exhibiting the activity of the above 6) protein (polypeptide) may be the introduction into the host cell (microorganism) of a foreign polynucleotide encoding a protein (polypeptide) exhibiting the same / similar activity as the protein (polypeptide). The foreign polynucleotide is not limited in its origin or sequence as long as it exhibits the same / similar activity as the protein (polypeptide). The method used for the above introduction can be performed by a person skilled in the art appropriately selecting a known transformation method, and the protein (polypeptide) can be produced by expressing the introduced polynucleotide in the host cell, thereby increasing its activity.
[0124] The above 7) codon optimization of a polynucleotide encoding a protein (polypeptide) may be codon optimization of an endogenous polynucleotide to increase transcription or translation within a host cell (microorganism), or codon optimization of a foreign polynucleotide to achieve optimized transcription or translation within a host cell (microorganism).
[0125] The above 8) analyzing the tertiary structure of a protein (polypeptide) and selecting an exposed portion to modify or chemically modify may be done by, for example, comparing the sequence information of the protein (polypeptide) to be analyzed with a database storing the sequence information of known proteins, determining a template protein candidate based on the degree of sequence similarity, confirming the structure based on this, and selecting an exposed portion to modify or chemically modify, and modifying or modifying it.
[0126] The above 9) regulation of the intracellular location of a protein (polypeptide) may target the protein (polypeptide) to a specific organelle or specific intracellular space within the cell. For example, targeting to the periplasm or cytoplasm may be achieved by adding or removing a leader sequence that functions in targeting the protein (polypeptide), but is not limited thereto.
[0127] Such an increase in protein (polypeptide) activity may be, but is not limited to, an increase in the activity or concentration of the corresponding protein (polypeptide) relative to the activity or concentration of the protein (polypeptide) expressed in the wild type or pre-transformed host cell (microorganism), or an increase in the amount of a product resulting from the activity of the corresponding protein (polypeptide).
[0128]
[0129] Modification of part or all of the polynucleotide in the host cell (microorganism) of the present application may be induced by, but is not limited to, (a) a method using homologous recombination using a vector for chromosomal insertion or genome editing using genetic scissors (engineered nuclease, e.g., CRISPR-Cas9) and / or (b) treatment with light and / or chemicals such as ultraviolet rays and radiation.
[0130]
[0131] culture
[0132]
[0133] In this application, the term "cultivation" refers to the growth of microorganisms under appropriately controlled environmental conditions. The cultivation process can be conducted using appropriate media and culture conditions known in the art. This cultivation process can be easily adjusted and used by those skilled in the art depending on the selected microorganism. Specifically, the cultivation process may be batch, continuous, and / or fed-batch, but is not limited thereto.
[0134] In this application, the term "medium" refers to a material containing nutrients necessary for culturing microorganisms as its main component, and supplies nutrients and growth factors, including water, which is essential for survival and growth. Specifically, the medium and other culture conditions used for culturing the microorganisms of this application may be any medium used for culturing conventional microorganisms without particular limitation. For example, the microorganisms of this application may be cultured under aerobic conditions by controlling temperature, pH, etc. in a conventional medium containing appropriate carbon sources, nitrogen sources, phosphorus sources, inorganic compounds, amino acids, and / or vitamins. For example, culture media for microorganisms of the genus Corynebacterium can be found in the literature ["Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington DC, USA, 1981)].
[0135] In the present application, the carbon source may include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvic acid, lactic acid, citric acid, etc.; amino acids such as glutamic acid, methionine, lysine, etc. In addition, natural organic nutrients such as starch hydrolysate, molasses, blackstrap molasses, rice winter, cassava, sugarcane bagasse, and corn steep liquor may be used, and specifically, carbohydrates such as glucose and sterilized pretreated molasses (i.e., molasses converted to reducing sugar) may be used, and other appropriate amounts of carbon sources may be used in various ways without limitation. These carbon sources may be used alone or in combination of two or more, but are not limited thereto.
[0136] The nitrogen source may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; organic nitrogen sources such as amino acids such as glutamic acid, methionine, glutamine, etc.; peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolysate, fish or its decomposition product, defatted soybean cake or its decomposition product, etc. These nitrogen sources may be used alone or in combination of two or more, but are not limited thereto.
[0137] The above-mentioned components may include potassium phosphate monobasic, potassium phosphate dibasic, or their corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. In addition, amino acids, vitamins, and / or suitable precursors may be included. These components or precursors may be added to the medium in batch or continuous manner, but are not limited thereto.
[0138] In addition, during the cultivation of the microorganism of the present application, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. may be added to the medium in an appropriate manner to adjust the pH of the medium. In addition, during the cultivation, foaming may be suppressed by using an antifoaming agent such as fatty acid polyglycol ester. In addition, to maintain the aerobic state of the medium, oxygen or an oxygen-containing gas may be injected into the medium, or to maintain the anaerobic and microaerobic state, nitrogen, hydrogen, or carbon dioxide gas may be injected without gas injection, but is not limited thereto.
[0139] In the culture of the present application, the culture temperature can be maintained at 20 to 45°C, specifically 25 to 40°C, and the culture can be performed for about 10 to 160 hours, but is not limited thereto.
[0140] In the present application, the term "culture" means a culture solution, concentrated culture solution, dried product of culture solution, culture filtrate, concentrated culture filtrate, or dried product of culture filtrate obtained by culturing a specific microorganism in a culture medium, wherein the culture solution means that it contains a specific microorganism, and the culture filtrate means that it does not substantially contain a specific microorganism (here, substantially means that a specific microorganism separated by filtration or the like is excluded, but does not mean that the filtrate is completely free of microorganisms). The culture is not limited in its formulation, and may be, for example, a liquid, an emulsion, or a solid.
[0141] In this application, the term "fermentation" refers to a process in which microorganisms use their enzymes to decompose organic matter, but not to a putrefaction reaction. While fermentation and putrefaction occur through similar processes, if the resulting decomposition produces useful substances, it is called fermentation. If the resulting decomposition produces foul-smelling or harmful substances, it is called putrefaction.
[0142] In the present application, the method for obtaining a fermented product from the microorganism is not particularly limited, and the product can be obtained according to a method commonly used in the relevant technical field or a similar field.
[0143] In the present application, the term "fermentation" includes all kinds of substances including a fermentation product produced from the microorganism, such as not only the fermented substance itself, but also a substance containing a fermented microorganism, a culture produced from the fermented microorganism, a fermentation product of the culture, a concentrated fermentation product, a dried product of the fermentation product, a filtrate of the fermentation product, a concentrated filtrate of the fermentation product, or a dried product of the fermentation product filtrate, an extract of the fermentation product, or a dilution of the fermentation product.
[0144]
[0145] Specific description of this application
[0146]
[0147] Hereinafter, specific examples of the present application will be described in more detail as follows.
[0148] One aspect of the present application provides a microorganism of the genus Corynebacterium having L-amino acid production ability, into which a NAD-dependent isocitrate dehydrogenase protein derived from Streptococcus mutans or a polynucleotide encoding the same is introduced.
[0149]
[0150] In this application, the term "NAD-dependent isocitrate dehydrogenase (ICD)" refers to an NAD-dependent enzyme among isocitrate dehydrogenases, which are enzymes that catalyze oxidative decarboxylation to produce alpha-ketoglutarate and CO2. The NAD-dependent isocitrate dehydrogenase of this application may be used interchangeably with ICD.
[0151] Specifically, the NAD-dependent isocitrate dehydrogenase protein of the present application may be a protein having NAD-dependent isocitrate dehydrogenase activity encoded by the icd gene, but is not particularly limited in type as long as it has an activity corresponding to NAD-dependent isocitrate dehydrogenase. The NAD-dependent isocitrate dehydrogenase protein encoded by the icd gene is known in the art, and the amino acid and polynucleotide sequences of the NAD-dependent isocitrate dehydrogenase protein can be obtained from known databases, such as, but not limited to, NCBI's GenBank.
[0152] For example, the NAD-dependent isocitrate dehydrogenase protein derived from Streptococcus mutans may include the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having 60% or more homology or identity therewith, but is not limited thereto as long as it has NAD-dependent isocitrate dehydrogenase activity. Specifically, even if it includes a sequence in which some sequences are deleted, modified, substituted or added in the amino acid sequence of SEQ ID NO: 1, as long as it is a protein that exhibits an effect corresponding to the NAD-dependent isocitrate dehydrogenase, it may be included in the NAD-dependent isocitrate dehydrogenase protein. Additionally, any protein having, including, consisting of, or essentially consisting of an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity with the amino acid sequence of the above sequence number 1, and exhibiting an effect corresponding to the above NAD-dependent isocitrate dehydrogenase, may be included in the above NAD-dependent isocitrate dehydrogenase protein.
[0153]
[0154] In addition, the sequence of a polynucleotide encoding a NAD-dependent isocitrate dehydrogenase protein derived from Streptococcus mutans having the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having 60% or more homology or identity therewith can be obtained, for example, based on codon information known in the art. For example, the NAD-dependent isocitrate dehydrogenase protein may be encoded by a polynucleotide having or including a sequence of SEQ ID NO: 2 or a base sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity with the sequence of SEQ ID NO: 2, or consisting of or consisting essentially of the base sequence, but is not limited thereto. In addition, the base sequence of the above sequence number 2 can be obtained from a known database, such as, but not limited to, NCBI's GenBank.
[0155] In the present application, the polynucleotide (gene) including the base sequence of SEQ ID NO: 2 may be used interchangeably with a polynucleotide (gene) having the base sequence of SEQ ID NO: 2, a polynucleotide (gene) consisting of the base sequence of SEQ ID NO: 2, or an icd gene.
[0156] The polynucleotide of the present application may have various modifications in the coding region within a range that does not change the amino acid sequence of the NAD-dependent isocitrate dehydrogenase protein of the present application due to codon degeneracy or taking into account the codons preferred in the organism that is intended to express the NAD-dependent isocitrate dehydrogenase protein of the present application. Therefore, it is obvious that the polynucleotide of the present application may also include a polynucleotide that can be translated into a polypeptide consisting of the amino acid sequence of the NAD-dependent isocitrate dehydrogenase protein of the present application or a polypeptide having homology or identity therewith due to codon degeneracy. For example, the polynucleotide of the present application may be SEQ ID NO: 2 or a degenerated sequence thereof.
[0157] As another example, the polynucleotide of the present application may have or include a base sequence that is at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homologous or identical to SEQ ID NO: 2, or may consist of or consist essentially of a base sequence that is at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homologous or identical to SEQ ID NO: 2, but is not limited thereto.
[0158] In addition, the polynucleotide of the present application may include, without limitation, a probe that can be prepared from a known genetic sequence, for example, a sequence that hybridizes under stringent conditions with a complementary sequence to all or part of the polynucleotide sequence of the present application, so long as it is a sequence encoding the NAD-dependent isocitrate dehydrogenase protein of the present application.
[0159]
[0160] The microorganism of the genus Corynebacterium of the present application has the ability to produce L-amino acids.
[0161] In the present application, the L-amino acid may specifically be L-tryptophan or L-histidine.
[0162] For the purpose of the present application, the microorganism of the present application may include any microorganism capable of producing a desired L-amino acid by introducing an NAD-dependent isocitrate dehydrogenase protein or a polynucleotide encoding the same. For example, the microorganism of the present application may be a genetically modified microorganism or a recombinant microorganism having increased L-amino acid productivity by introducing an NAD-dependent isocitrate dehydrogenase protein or a polynucleotide encoding the same. Specifically, the recombinant microorganism having increased L-amino acid productivity may be a microorganism having increased L-amino acid productivity compared to a natural wild-type microorganism or an unmodified microorganism having an intrinsic activity of NAD-dependent isocitrate dehydrogenase or lacking an intrinsic activity of NAD-dependent isocitrate dehydrogenase, but is not limited thereto.
[0163]
[0164] For example, a microorganism having L-amino acid production ability is a prokaryotic or eukaryotic microorganism capable of producing L-amino acids within the organism, and may include both a microorganism that inherently has L-amino acid production ability or a microorganism that has been granted L-amino acid production ability due to the activity of the NAD-dependent isocitrate dehydrogenase protein introduced in the present application to a microorganism that does not have L-amino acid production ability. The L-amino acid production ability may be granted or enhanced by species improvement.
[0165] The microorganism of the present application may include any microorganism into which an NAD-dependent isocitrate dehydrogenase protein or a polynucleotide encoding the same has been introduced by various known methods.
[0166]
[0167] For example, the recombinant microorganism having L-amino acid production ability of the present application may be a microorganism capable of producing L-amino acids by being transformed through a vector into which a foreign gene encoding the NAD-dependent isocitrate dehydrogenase protein of the present application, specifically, a foreign gene encoding the NAD-dependent isocitrate dehydrogenase protein derived from Streptococcus mutans, has been introduced.
[0168]
[0169] For example, the microorganism producing the L-amino acid may be a microorganism into which a polynucleotide sequence encoding a protein comprising an amino acid sequence of SEQ ID NO: 1, or a protein comprising an amino acid sequence having at least 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% homology or identity with the amino acid sequence of SEQ ID NO: 1 has been introduced.
[0170] For example, the microorganism producing the L-amino acid may be a microorganism into which a polynucleotide capable of encoding a protein including an amino acid sequence having at least 80% homology with the amino acid sequence of SEQ ID NO: 1; or a polynucleotide including a base sequence of SEQ ID NO: 2, or a base sequence having at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology or identity with the base sequence of SEQ ID NO: 2 has been introduced.
[0171]
[0172] For example, the microorganism with increased L-amino acid productivity of the present application may be a microorganism with increased L-amino acid productivity compared to a non-modified microorganism, but is not limited thereto. For example, the non-modified microorganism, which is the target strain for comparing whether the L-amino acid productivity is increased, may be, but is not limited to, the CM05-9157 or CA14-0114 strain.
[0173] For example, the microorganism with increased L-amino acid productivity may have an increase of about 1% or more, specifically, about 1% or more, about 2.5% or more, about 5% or more, about 6% or more, about 7% or more, about 8% or more, about 9% or more, about 10% or more, about 15% or more, about 20% or more, about 25% or more, or about 26% or more (the upper limit is not particularly limited, and may be, for example, about 200% or less, about 150% or less, about 100% or less, about 50% or less, about 45% or less, about 40% or less, or about 35% or less) compared to the L-amino acid productivity of the parent microorganism (parent strain) before mutation or the non-mutated microorganism, but is not limited thereto as long as it has a positive value increase compared to the productivity of the parent microorganism (parent strain) before mutation or the non-mutated microorganism. In another example, the recombinant strain with increased L-amino acid productivity may have an L-amino acid productivity increased by about 1.1 times or more, about 1.15 times or more, about 1.2 times or more, about 1.25 times or more, or about 1.26 times or more (the upper limit is not particularly limited, and may be, for example, about 10 times or less, about 5 times or less, about 3 times or less, about 2 times or less, about 1.5 times or less, about 1.4 times or less, or about 1.35 times or less) compared to the parent microorganism (parent strain) before mutation or the unmodified microorganism, but is not limited thereto.
[0174]
[0175] For example, the microorganism having L-amino acid production ability of the present application may be either a prokaryotic cell or a eukaryotic cell, but may specifically be a prokaryotic cell. The prokaryotic cell may include, but is not limited to, microorganisms belonging to the genus Escherichia sp., Erwinia sp., Serratia sp., Providencia sp., Corynebacteria sp., Pseudomonas sp., Leptospirasp., Salmonella sp., Brevibacteria sp., Hypomononas sp., Chromobacterium sp., and Norcardia sp. Specifically, it may be a microorganism of the genus Escherichia or the genus Corynebacterium. More specifically, it may be a microorganism of the genus Corynebacterium.
[0176] As a microorganism according to any one of the preceding specific examples, the microorganism of the present application may be a microorganism of the genus Corynebacterium.
[0177] Microorganisms in the genus Corynebacterium include Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium stationis, Corynebacterium singulare, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium ammoniagenes, It may be Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium testudinoris, or Corynebacterium flavescens. More specifically, the microorganism of the present application may be Corynebacterium glutamicum, but is not limited thereto.
[0178] Meanwhile, the Corynebacterium genus microorganism having L-amino acid production ability of the present application may include a natural wild-type microorganism itself, a Corynebacterium genus microorganism having improved L-amino acid production ability by increasing or decreasing the activity of a gene related to the L-amino acid production mechanism, or a Corynebacterium genus microorganism having improved L-amino acid production ability by introducing or increasing the activity of an external gene.
[0179]
[0180] Another aspect of the present application provides a method for producing L-amino acids, comprising the step of culturing a Corynebacterium genus microorganism having L-amino acid production ability, into which the NAD-dependent isocitrate dehydrogenase protein derived from Streptococcus mutans of the present application or a polynucleotide encoding the same has been introduced, in a medium.
[0181] In the method of the present application, any culture conditions and methods known in the art can be used to cultivate microorganisms. Those skilled in the art can easily adjust and use these culture processes depending on the selected microorganism.
[0182] L-amino acids produced by the culture of the present invention may be secreted into the medium or remain within the cells.
[0183]
[0184] In one specific example, the method for producing L-amino acids of the present application may further include, for example, prior to the culturing step, a step of preparing a microorganism of the present application, a step of preparing a medium for culturing the strain, or a combination thereof (in any order).
[0185] The L-amino acid production method of the present application may further include a step of recovering a target substance, specifically an L-amino acid, from the cultured microorganism, a culture of the microorganism, a fermented product of the microorganism, or the culture medium. The recovering step may be additionally included after the culturing step.
[0186] The above recovery may be performed by collecting the target L-amino acid using a suitable method known in the art according to the culture method of the microorganism of the present application, such as a batch, continuous or fed-batch culture method. For example, various chromatographies such as centrifugation, filtration, treatment with a crystallized protein precipitant (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC or a combination thereof may be used, and the target substance, specifically, the L-amino acid, may be recovered from the medium or microorganism using a suitable method known in the art.
[0187] Additionally, the L-amino acid production method of the present application may additionally include a purification step. The purification may be performed using any suitable method known in the art. In one example, if the L-amino acid production method of the present application includes both a recovery step and a purification step, the recovery step and the purification step may be performed sequentially or discontinuously, regardless of order, or may be performed simultaneously or integrated into a single step, but is not limited thereto.
[0188] In the method of the present application, the NAD-dependent isocitrate dehydrogenase, introduction, and L-amino acid, etc. are as described in the other embodiments above.
[0189]
[0190] Another aspect of the present application provides a composition for producing L-amino acids, comprising a Corynebacterium genus microorganism having L-amino acid production ability, into which a Streptococcus mutans-derived NAD-dependent isocitrate dehydrogenase protein of the present application or a polynucleotide encoding the same has been introduced, a culture of the microorganism, a fermentation product of the microorganism, or a combination of two or more thereof.
[0191] The composition of the present application may further comprise any suitable excipient commonly used in compositions for producing L-amino acids, and such excipients may be, for example, but are not limited to, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizers, or isotonic agents.
[0192] In one specific example, each component present in the composition of the present application may be included in a microbiologically effective amount, or an amount that can be suitably present in the composition for production.
[0193] In the composition of the present application, NAD-dependent isocitrate dehydrogenase, introduction and L-amino acid, etc. are as described in the other embodiments above.
[0194]
[0195] Another aspect of the present application provides a use for producing L-amino acids by a microorganism of the genus Corynebacterium having L-amino acid production ability, into which the NAD-dependent isocitrate dehydrogenase protein derived from Streptococcus mutans of the present application or a polynucleotide encoding the same has been introduced.
[0196] In the purposes of the present application, NAD-dependent isocitrate dehydrogenase, introduction and L-amino acid, etc. are as described in the other embodiments above.
[0197]
[0198] The present application will be described in more detail below through examples. However, the following examples are merely preferred embodiments intended to illustrate the present application and are therefore not intended to limit the scope of the present application. Furthermore, technical details not described herein can be readily understood and implemented by those skilled in the technical field of the present application or similar fields.
[0199]
[0200] Example 1. Exploration and screening of NAD-dependent isocitrate dehydrogenase (icd) genes.
[0201]
[0202] To select organisms harboring NAD-dependent isocitrate dehydrogenase (icd), the amino acid sequence of the endogenous isocitrate dehydrogenase of Corynebacterium glutamicum was used as a query sequence, and BLAST searches were performed based on the NCBI and Kegg databases. As a result, considering the biosafety level applicable to the production strain and the feasibility of acquisition, three organisms predicted to harbor NAD-dependent isocitrate dehydrogenase were selected, as shown in Table 1 below.
[0203] Sequence Strain Protein Registration Number Biosafety Level 1 Streptococcus mutans WP_002276545.112 Streptococcus sp. 'caviae' WP_075346121.113 Streptococcus varani WP_093650533.11
[0204]
[0205] Example 2. Production of L-tryptophan-producing microorganisms with exogenous NAD-dependent isocitrate dehydrogenase.
[0206]
[0207] Example 2-1. Construction of plasmids for gene replacement
[0208]
[0209] To replace the icd gene in the chromosome of Corynebacterium glutamicum, a plasmid capable of replacing the coding sequence of the endogenous icd gene with the coding sequence of a foreign icd gene was constructed using plasmid pDC24 (SEQ ID NO: 86) as a parent vector.
[0210] Specifically, using the chromosomal DNA of Corynebacterium glutamicum ATCC13869 as a template, the upstream region where homologous recombination occurs was amplified using the primer pair of SEQ ID NO: 7 and SEQ ID NO: 8, and the downstream region was amplified using the primer pair of SEQ ID NO: 9 and SEQ ID NO: 10, and then PCR was performed to obtain each gene fragment. PCR was performed using Solg TM Amplification was performed using Pfu-X DNA polymerase (SolGent co.), and the conditions were denaturation at 95°C for 4 minutes, followed by 27 cycles of denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and polymerization at 72°C for 50 seconds, followed by polymerization reaction at 72°C for 5 minutes. The primer sequences used are shown in Table 2 below.
[0211] Sequence number Sequence (5' → 3') Sequence number 7 TTCTATGACTTATTTATAGAGTCTCTTCACAAAAAGCGC Sequence number 8 TCGACTCTAGAGGATCCCCGGTTTGGGATTCGTTGTAATC Sequence number 9 AATTCGAGCTCGGTACCCTGCTGAATATATGGGTGG Sequence number 10 CTTACTTTTTCTGCCATGAGTCTCCTTGGTTGATGG
[0212] The upstream fragment and downstream fragment of the region where homologous recombination on the chromosome occurs, amplified through the above PCR, and the chromosomal transformation vector pDC24 cut with the smaI restriction enzyme were cloned using the Gibson assembly method (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix) to obtain a recombinant plasmid, which was named pDC24△icd(13869).
[0213]
[0214] Example 2-2. Production of a tryptophan-producing Corynebacterium microorganism introducing NAD-dependent isocitrate dehydrogenase from Streptococcus mutans.
[0215]
[0216] The NAD-dependent isocitrate dehydrogenase derived from Streptococcus mutans selected in Example 1 has an amino acid sequence of SEQ ID NO. 1. Information on the gene encoding the NAD-dependent isocitrate dehydrogenase and the surrounding base sequence was obtained from the National Institutes of Health (NIH GenBank) in the United States, and based on this, the codon-optimized icd gene derived from Streptococcus mutans was synthesized using the gene synthesis service of Bionics Co., Ltd. (SEQ ID NO. 2). In order to insert this into the genomic DNA of Corynebacterium glutamicum, the synthesized gene was used as a template.
[0217] PCR was performed using primer pairs of SEQ ID NO: 11 and SEQ ID NO: 12 to amplify the DNA. The polymerase was Solg. TM Pfu-X DNA polymerase was used, and PCR amplification conditions were as follows: denaturation at 95°C for 2 minutes, followed by 27 cycles of denaturation at 95°C for 20 seconds, annealing at 60°C for 40 seconds, and polymerization at 72°C for 1 minute, followed by polymerization at 72°C for 5 minutes. The primer sequences used are shown in Table 3 below.
[0218] Sequence number (5' → 3') Sequence number 11 CCCATCAACCAAGGAGACTCATGGCAGAAAAAGTAAGTTTTG Sequence number 12 AGCGCTTTTGTGAAGAGACTCTATAAATAAGTCAATAGAACTTC
[0219] Next, the NAD-dependent isocitrate dehydrogenase gene fragment derived from Streptococcus mutans amplified from the above and the chromosomal transformation vector pDC24△icd(13869) constructed in Example 2-1 and cut with SmaI restriction enzyme were cloned using the Gibson assembly method (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix) to obtain a recombinant plasmid, which was named pDC24△icd(13869)-icd(S.mu). Cloning was performed by mixing the Gibson assembly reagent, the gene fragment, and the cut vector in calculated molar amounts and incubating at 50°C for 1 hour. The constructed pDC24△icd(13869)-icd(S.mu) vector was transformed into the tryptophan-producing strain CM05-9157 (US Patent Publication No. 2023-0134555 A1) by electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541-545), and then a second crossover process was performed to obtain a strain in which the coding sequence of the endogenous icd gene on the chromosome was replaced with the coding sequence of the icd gene derived from Streptococcus mutans. The strain was identified by PCR using primers of SEQ ID NOs: 13 and 14, which can amplify the external regions of the homologous recombination upstream and downstream regions of the position where the gene was replaced, respectively, and by genome sequencing. The primer sequences used are shown in Table 4 below.
[0220] Sequence number (5' → 3') Sequence number 13CATTCGTCGATCTCTAGTSequence number 14CAATTCCTTGTCGGTGTC
[0221] The strain obtained by the above method was named CM05-9157ㅿicd::icd(S.mu).
[0222]
[0223] Example 2-3. Production of a tryptophan-producing Corynebacterium microorganism with NAD-dependent isocitrate dehydrogenase derived from Streptococcus sp. 'caviae'
[0224]
[0225] The NAD-dependent isocitrate dehydrogenase derived from Streptococcus sp. 'caviae' selected in Example 1 has the amino acid sequence of SEQ ID NO: 3. Information on the gene and surrounding base sequences was obtained from the National Institutes of Health (NIH GenBank) in the United States, and based on this, the codon-optimized icd gene derived from Streptococcus sp. 'caviae' was synthesized (SEQ ID NO: 4) using the gene synthesis service of Bionics Co., Ltd. In order to insert this into the genomic DNA of Corynebacterium glutamicum, PCR was performed in the same manner as in Example 2-2 using the synthesized gene as a template and the primer pair of SEQ ID NO: 15 and SEQ ID NO: 16. The primer sequences used are shown in Table 5 below.
[0226] Sequence number (5' → 3') Sequence number 15CCCATCAACCAAGGAGACTCatggcggaaaaaattcgctttgSequence number 16AGCGCTTTTTGTGAAGAGACTcaggttatccgccagcactttc
[0227] Next, the NAD-dependent isocitrate dehydrogenase gene fragment derived from Streptococcus sp. 'caviae' amplified from the above and the chromosomal transformation vector pDC24△icd(13869) constructed in Example 2-1, which was digested with SmaI restriction enzyme, were cloned using the Gibson assembly method to obtain a recombinant plasmid, which was named pDC24△icd(13869)-icd(S.ca). Cloning was performed by mixing the Gibson assembly reagent, the gene fragment, and the digested vector in calculated molar amounts and leaving them at 50°C for 1 hour. After the constructed pDC24△icd(13869)-icd(S.ca) vector was transformed into the tryptophan-producing strain CM05-9157 by electroporation, the coding sequence of the endogenous icd gene on the chromosome was transferred to Streptococcus sp. A strain was obtained in which the coding sequence of the 'caviae'-derived icd gene was substituted. The strain was identified by PCR using primers of SEQ ID NOs. 13 and 14 in Table 4, which can amplify regions outside the homologous recombination region upstream and downstream of the gene replacement site, respectively, and by genome sequencing.
[0228] The strain obtained by the above method was named CM05-9157ㅿicd::icd(S.ca).
[0229]
[0230] Example 2-4. Production of a tryptophan-producing Corynebacterium microorganism by introducing NAD-dependent isocitrate dehydrogenase from Streptococcus varani.
[0231]
[0232] The NAD-dependent isocitrate dehydrogenase derived from Streptococcus varani selected in Example 1 has the amino acid sequence of SEQ ID NO: 5. Information on the gene and surrounding base sequences was obtained from the National Institutes of Health (NIH GenBank) in the United States, and based on this, the codon-optimized icd gene derived from Streptococcus varani was synthesized (SEQ ID NO: 6) using the gene synthesis service of Bionics Co., Ltd. In order to insert this into the genomic DNA of Corynebacterium glutamicum, PCR was performed in the same manner as in Example 2-2 using the synthesized gene as a template and the primer pair of SEQ ID NO: 17 and SEQ ID NO: 18. The primer sequences used are shown in Table 6 below.
[0233] Sequence number (5' → 3') Sequence number 17CCCATCAACCAAGGAGACTCatggcggaaaaaattgtgcSequence number 18AGCGCTTTTTGTGAAGAGACTgcgttcgccaatgctatcaatc
[0234] Next, the NAD-dependent isocitrate dehydrogenase gene fragment derived from Streptococcus varani amplified from the above and the chromosomal transformation vector pDC24△icd(13869) constructed in Example 2-1 and cut with SmaI restriction enzyme were cloned using the Gibson assembly method to obtain a recombinant plasmid, which was named pDC24△icd(13869)-icd(S.va). Cloning was performed by mixing the Gibson assembly reagent, the gene fragment, and the cut vector in calculated molar amounts and incubating at 50°C for 1 hour. The constructed pDC24△icd(13869)-icd(S.va) vector was transformed into the tryptophan-producing strain CM05-9157 by electroporation, and a second crossover process was performed to obtain a strain in which the coding sequence of the endogenous icd gene on the chromosome was replaced with the coding sequence of the icd gene derived from Streptococcus varani. The strain was identified by PCR using primers of SEQ ID NOs: 13 and 14, which can amplify the external regions of the homologous recombination region upstream and downstream of the site of the gene replacement, respectively, and by genome sequencing.
[0235] The strain obtained by the above method was named CM05-9157ㅿicd::icd(S.va).
[0236]
[0237] Example 3. Evaluation of L-tryptophan production ability of tryptophan-producing Corynebacterium microorganisms into which an exogenous NAD-dependent isocitrate dehydrogenase gene has been introduced.
[0238]
[0239] In order to confirm the L-tryptophan production ability of the CM05-9157ㅿicd::icd(S.mu), CM05-9157ㅿicd::icd(S.ca), CM05-9157ㅿicd::icd(S.va) strains produced in Examples 2-2, 2-3, and 2-4, respectively, and the parent strain CM05-9157 into which no foreign gene was introduced, they were cultured using the following method.
[0240] Each strain was inoculated into a 250-mL corner-baffle flask containing 25 mL of seed medium and cultured at 30°C for 20 hours with shaking at 200 rpm. Then, 1 mL of the seed culture was inoculated into a 250-mL corner-baffle flask containing 25 mL of production medium and cultured at 30°C for 24 hours with shaking at 200 rpm. After completion of the culture, the production amount of L-tryptophan was measured by HPLC. The compositions of the seed medium and production medium are as follows, and the concentration of L-tryptophan in the culture solution for each strain tested is shown in Table 7 below.
[0241]
[0242] <Seed medium (pH 7.0)>
[0243] Glucose 20g, peptone 10g, yeast extract 5g, urea 1.5g, KH2PO4 4g, K2HPO4 8g, MgSO4 7H2O 0.5g, biotin 100㎍, thiamine HCl 1000㎍, calcium-pantothenic acid 2000㎍, nicotinamide 2000㎍ (based on 1 liter of distilled water)
[0244]
[0245] <Production medium (pH 7.0)>
[0246] Glucose 30 g, (NH4)2SO4 15 g, MgSO4 7H2O 1.2 g, KH2PO4 1 g, yeast extract 5 g, biotin 900 μg, thiamine hydrochloride 4500 μg, calcium-pantothenic acid 4500 μg, CaCO3 30 g (based on 1 liter of distilled water).
[0247] Tryptophan production (g / L)Tryptophan yield (%)CM05-91571.836.27CM05-9157ㅿicd::icd(S.mu)2.327.94CM05-9157ㅿicd::icd(S.ca)1.776.05CM05-9157ㅿicd::icd(S.va)1.826.21
[0248] As a result, as shown in Table 7 above, the CM05-9157ㅿicd::icd(S.mu) strain into which the Streptococcus mutans-derived gene was introduced produced a final 2.32 g / L of L-tryptophan in flask culture. This was confirmed to be an approximately 26.6% improvement in fermentation yield compared to the parent strain CM05-9157, which produced 1.83 g / L. On the other hand, Streptococcus sp. The CM05-9157ㅿicd::icd(S.ca) and CM05-9157ㅿicd::icd(S.va) strains, into which 'caviae'-derived and Streptococcus varani-derived genes were introduced, produced 1.77 g / L and 1.82 g / L of L-tryptophan, respectively, showing a 3.4% and 0.9% decrease in yield, respectively, compared to the parent strain CM05-9157.
[0249] These results imply that only the NAD-dependent isocitrate dehydrogenase gene from Streptococcus mutans, among the foreign NAD-dependent isocitrate dehydrogenase genes, can significantly increase L-tryptophan production in a specific manner in a microorganism of the genus Corytebacterium.
[0250]
[0251] Example 4. Production of L-histidine-producing microorganisms with exogenous NAD-dependent isocitrate dehydrogenase.
[0252]
[0253] Example 4-1. Production of histidine-producing Corynebacterium microorganisms.
[0254]
[0255] To evaluate L-histidine production, the CA14-0114 strain was created by strengthening the genes of the histidine biosynthesis pathway using wild-type Corynebacterium glutamicum ATCC13032 as a starting microorganism.
[0256] Specifically, to relieve feedback inhibition of HisG, the first enzyme in the L-histidine biosynthetic pathway, the codon of the hisG gene was modified to express a protein (SEQ ID NO: 19) (ACS Synth. Biol., 2014, 3 (1), pp 21-29) in which the 233rd and 235th amino acids from the N-terminus of HisG were simultaneously substituted from glycine to histidine and from threonine to glutamine, respectively. In addition, the start codon was substituted from GTG to ATG to enhance the activity of the hisE gene, which is located in the same operon as hisG. Additionally, the promoters of the biosynthetic genes hisN, hisH, hisD, hisA, and hisB were replaced with strong promoters to strengthen the L-histidine biosynthetic pathway, and the pathway was strengthened by introducing additional copies of the hisE(g1a)G(G233H / T235Q) operon and the hisD gene.
[0257]
[0258] Example 4-1-1. Production of histidine-producing microorganisms with resolved feedback limitations.
[0259]
[0260] To construct a histidine-producing strain free of feedback limitations, PCR was performed using the chromosomal DNA of Corynebacterium glutamicum ATCC13032 as a template and the primer pairs of SEQ ID NO: 20 and SEQ ID NO: 21 and the primer pairs of SEQ ID NO: 22 and SEQ ID NO: 23. Using the two amplified DNA fragments as templates and the primers of SEQ ID NO: 20 and SEQ ID NO: 23, PCR was performed in the same manner as in Example 2 to obtain the 'hisE(g1a)G(G233H / T235Q)' gene fragment. In addition, the upstream region of the hisE gene was obtained by performing PCR using the primers of SEQ ID NO: 71 and 72 using the chromosomal DNA of ATCC13032 as a template.
[0261] Sequence numberSequence (5'→3')Sequence number 20gaggagatcaaaacaGTGAAGACATTTGACSequence number 21ACACCAAGCTTGATGGATACCTCTACTGCASequence number 22CAGTAGAGGTATCCATCAAGCTTGGTGTCSequence number 23ACTCTAGAGGATCCCCCTAGATGCGGGCSequence number 71TCGAGCTCGGTACCCACCGAACTCCTGACAGAGTSequence number 72acatgaagcgccTCGGTACATTCTTCCACASequence number 25AAGAATGTACCGAggcgcttcatgtcaacaSequence number 26CAAATGTCTTCATtgttttgatctcctccaSequence number 27ACTGCCTGGTACCACCAGASequence number 28CTGCCTCTCACAAGTTGAAG
[0262] In order to replace with a strong promoter, PCR was performed in the same manner as in Example 1 using the primers of SEQ ID NO: 25 and SEQ ID NO: 26 using the synthetic promoter Pspl13 promoter (SEQ ID NO: 24, Republic of Korea Patent No. 10-1783170) as a template. After treating the pDC24 vector with the restriction enzyme Sma1, the upstream DNA fragment of the amplified hisE gene, the Pspl13 promoter, and the 'hisE(g1a)G(G233H / T235Q)' gene fragment were cloned using the Gibson assembly method to obtain a recombinant plasmid, which was named pDC24△Pn_hisEG:: Pspl13_hisE(g1a)G(G233H / T235Q). Gibson cloning was performed in the same manner as in Example 1.
[0263] The constructed pDC24△Pn_hisEG:: Pspl13_hisE(g1a)G(G233H / T235Q) vector was transformed into Corynebacterium glutamicum ATCC13032 by electroporation, and then a second crossover process was performed to introduce mutations into the existing hisG gene, thereby eliminating feedback restrictions, and a strain with enhanced hisE activity was obtained by substituting the start codon of the hisE gene. The genetic manipulation was confirmed by PCR using primers of SEQ ID NO: 27 and SEQ ID NO: 28 and genome sequencing. The strain thus obtained was named CJ-HIS1.
[0264]
[0265] Example 4-1-2. Production of a histidine-producing microorganism with an enhanced biosynthetic pathway through promoter replacement.
[0266]
[0267] Next, plasmids were constructed to replace the wild-type promoter of each gene with a strong promoter to enhance the activity of the biosynthetic genes hisN, hisH, hisD, hisA, and hisB.
[0268] Specifically, PCR was performed in the same manner as in Example 2 using the chromosomal DNA of Corynebacterium glutamicum ATCC13032 as a template and the primers of SEQ ID NO: 29 and SEQ ID NO: 30, SEQ ID NO: 31 and SEQ ID NO: 32, SEQ ID NO: 33 and SEQ ID NO: 34, SEQ ID NO: 35 and SEQ ID NO: 36, and SEQ ID NO: 37 and SEQ ID NO: 38, and the upstream regions of the hisN, hisH, hisD, hisA, and hisB genes were obtained.
[0269] In addition, using the chromosomal DNA of Corynebacterium glutamicum ATCC13032 as a template, the downstream regions of the hisN, hisH, hisD, hisA, and hisB genes were obtained using primers of SEQ ID NO: 73 and SEQ ID NO: 74, SEQ ID NO: 75 and SEQ ID NO: 76, SEQ ID NO: 77 and SEQ ID NO: 78, SEQ ID NO: 79 and SEQ ID NO: 80, and SEQ ID NO: 81 and SEQ ID NO: 82, respectively.
[0270] Sequence numberSequence (5'→3')Sequence number 29TCGAGCTCGGTACCCATTGGTGCTCGGCGCSEQ ID NO: 30tgggatgtttctGTGTTGTTAGTCTAGTGSEQ ID NO: 31TCGAGCTCGGTACCCAACCAAGTTTAGATGCGCCSEQ ID NO: 32gctgggatgtttctGCCGATAGTTTATGTCASEQ ID NO: 33TCGAGCTCGGTACCCGGTGACAGCTCGCGCCGCATSEQ ID NO: 34gcgctgggatgtttctGGCGAAAAGTTCTCCCSEQ ID NO: 35TCGAGCTCGGTACCCTTGATGCCTGCATGAAGGSEQ ID NO: 36tgacatgaagcgccGAATATTGATCCTATCTSEQ ID NO: 37TTCGAGCTCGGTACCCACCTTCAGCAACCACTCSEQ ID NO: 38tgacatgaagcgccGAAAAATTCTTCTCTSEQ ID NO: 73aaaggaaacactcATGAGCAAATATGCAGACGSEQ ID NO: 74CTAGAGGATCCCCCAGCCGGAGAGGGASEQ ID NO: 75aaaggaaacactcATGACCAAAACTGTCGCSEQ ID NO: 76CTAGAGGATCCCCACCTCTGGAGGCGTGGTCSEQ ID NO: 77cgaaaggaaacactcATGTTGAATGTCACTGACCSEQ ID NO: 78CTAGAGGATCCCCCCGTGCTCAGCCTGAGGAGSEQ ID NO: 79ggagatcaaaacaATGACCTTCACTATTCTTCCSEQ ID NO: 80CTAGAGGATCCCCACGAAACGTGCACAACCTTSEQ ID NO: 81gagatcaaaacaATGACTGTCGCACCASEQ ID NO: 82CTAGAGGATCCCCGGGTCGCGGCCGTAGTGGC
[0271] In order to replace the endogenous promoters of the hisN, hisH, and hisD genes with the strong promoter, the Pcj7 promoter (SEQ ID NO: 39, Patent Registration No. 10-0620092), PCR was performed in the same manner as in Example 2 using the primers SEQ ID NO: 40 and SEQ ID NO: 41, SEQ ID NO: 42 and SEQ ID NO: 43, and SEQ ID NO: 83 and SEQ ID NO: 84 using the Corynebacterium ammoniagenes genomic DNA as a template.
[0272] Sequence number Sequence (5'→3') Sequence number 40 ACTAGACTAACAACACagaaacatcccagcgc Sequence number 41 TCTGCATATTTGCTCATgagtgtttccttt Sequence number 42 ACATAAACTATCGGCagaaacatcccagcgcta Sequence number 43 GACAGTTTTGGTCATgagtgtttcctttcg Sequence number 83 GAGAAACTTTTCGCCagaaacatcccagcgct Sequence number 84 AGTGACATTCAACATgagtgtttcctttcg
[0273] In addition, in order to replace the endogenous promoters of the hisA and hisB genes with the strong promoter, the Pspl13 promoter (SEQ ID NO: 24, Republic of Korea Patent No. 10-1783170), PCR was performed in the same manner as in Example 2 using the Pspl13 promoter as a template and the primers of SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, and SEQ ID NO: 85.
[0274] Sequence number Sequence (5'→3') Sequence number 44AGGATCAATATTCggcgcttcatgtcaac Sequence number 45GAATAGTGAAGGTCATtgttttgatctcct Sequence number 46GAGAAGAATTTTTCggcgcttcatgtcaa Sequence number 85TGGTGCGACAGTCATtgttttgatctcct
[0275] After treating the pDC24 vector with the restriction enzyme Sma1, the upstream DNA fragments of the amplified hisN, hisH, and hisD genes, the Pcj7 promoter fragment, and the downstream DNA fragments of the hisN, hisH, and hisD genes were cloned using the Gibson assembly method to obtain recombinant plasmids, which were named pDC24△Pn:: Pcj7_hisN, pDC24△Pn:: Pcj7_hisH, and pDC24△Pn:: Pcj7_hisD. In addition, after treating the pDC24 vector with the restriction enzyme Sma1, the upstream DNA fragments of the amplified hisA and hisB genes, the Pspl13 promoter fragment, and the downstream DNA fragments of the hisA and hisB genes were cloned using the Gibson assembly method to obtain recombinant plasmids, which were named pDC24△Pn:: Pspl13_hisA and pDC24△Pn:: Pspl13_hisB. Gibson cloning was performed in the same manner as in Example 2.
[0276]
[0277] The constructed pDC24△Pn::Pcj7_hisN vector was transformed into CJ-HIS1 constructed in Example 4-1-1 by electroporation, and then a second crossover process was performed to replace the promoter in the existing hisN gene, thereby obtaining a strain with an enhanced gene. The genetic manipulation was confirmed by PCR using primers of SEQ ID NO: 47 and SEQ ID NO: 48 and genome sequencing. The strain thus obtained was named CJ-HIS2.
[0278]
[0279] Next, the constructed pDC24△Pn::Pcj7_hisH vector was transformed into the constructed CJ-HIS2 by electroporation, and then a second crossover process was performed to replace the promoter of the existing hisH gene, thereby obtaining a strain with an enhanced gene. The genetic manipulation was confirmed by PCR using primers of SEQ ID NO: 49 and SEQ ID NO: 50 and genome sequencing. The strain thus obtained was named CJ-HIS3.
[0280]
[0281] Next, the constructed pDC24△Pn::Pcj7_hisD vector was transformed into the constructed CJ-HIS3 by electroporation, and then a second crossover process was performed to replace the promoter of the existing hisD gene, thereby obtaining a strain with an enhanced gene. The genetic manipulation was confirmed by PCR using primers of SEQ ID NO: 51 and SEQ ID NO: 52 and genome sequencing. The strain thus obtained was named CJ-HIS4.
[0282]
[0283] Next, the constructed pDC24△Pn::Pspl13_hisA vector was transformed into the constructed CJ-HIS4 by electroporation, and then a second crossover process was performed to replace the promoter of the existing hisA gene, thereby obtaining a strain with an enhanced gene. The genetic manipulation was confirmed by PCR using primers of SEQ ID NO: 53 and SEQ ID NO: 54 and genome sequencing. The strain thus obtained was named CJ-HIS5.
[0284]
[0285] Next, the constructed pDC24△Pn::Pspl13_hisB vector was transformed into the constructed CJ-HIS5 by electroporation, and then a second crossover process was performed to replace the promoter of the existing hisB gene, thereby obtaining a strain with an enhanced gene. The genetic manipulation was confirmed by PCR using primers of SEQ ID NO: 55 and SEQ ID NO: 56 and genome sequencing. The strain thus obtained was named CJ-HIS6.
[0286] SEQ ID NO Sequence (5'→3')47GAGCATGCATCAAAG48AGAAATTTGATCCTTATAA49TTGAGAGATGCTTATCG50CACTTCAGTGGCGGATTCCAA51AGCGGGTTTAATTCAGG52GTGGGTAAGGGTTTTCGT53CACGAAAATGATCGTTTTG54TATGGGATTCGATGGCCA55TGTGGGAATCGCTGGGCAC56CGGTCGCCCGCATCTG
[0287]
[0288] Example 4-1-3. Production of histidine-producing microorganisms with enhanced biosynthetic pathways through additional gene insertion.
[0289]
[0290] Next, NCgl1021, known as a gene encoding a transposon in Corynebacterium glutamicum, was used as an insertion site to additionally insert the hisE(g1a)G(G233H / T235Q) operon and the hisD gene. Specifically, to construct a NCgl1021 deletion and target gene insertion vector, the chromosome of ATCC13032 was used as a template and primer pairs of SEQ ID NO: 57 and SEQ ID NO: 58, SEQ ID NO: 59 and SEQ ID NO: 60 were used to perform PCR in the same manner as in Example 2 to amplify the left homologous arm region of NCgl1021 and the right homologous arm region of NCgl1021.
[0291] Sequence number (5'→3') Sequence number 57 TTCGAGCTCGGTACCCATGAAGTCTACCGGC Sequence number 58 gacatgaagcgccGACATCTAATAACCGGGSequence number 59 CCGACGAGGCCTAAGAACTCATTCCTTCTGCT Sequence number 60 CTCTAGAGGATCCCCTTAGAGTGCATTGATC
[0292] PCR was performed in the same manner as in Example 2 using the primers of SEQ ID NO: 61 and SEQ ID NO: 62 using the vector pDC24△Pn :: Pspl13_hisE (g1a) G (G233H / T235Q) produced in the above Example 4-1-1 as a template, and the 'Pspl13_hisE (g1a) G (G233H / T235Q)' gene fragment was obtained. In addition, PCR was performed in the same manner as in Example 2 using the primers of SEQ ID NO: 63 and SEQ ID NO: 64 using the vector pDC24△Pn :: Pcj7_hisD produced in the above Example 4-1-2 as a template, and the 'Pcj7_hisD' gene fragment was obtained.
[0293]
[0294] Sequence number Sequence (5'→3') Sequence number 61 CCGGTTATTAGATGTCggcgcttcatgtca Sequence number 62 ggatgtttctCTAGATGCGGGCGAT Sequence number 63 GCCCGCATCTAGagaaacatcccagcgct Sequence number 64 AGAAGGAATGATGAGTTCTTAGGCCTCGTCGG
[0295] After treating the pDC24 vector with the restriction enzyme Sma1, the left homology arm region, the right homology arm region, 'Pspl13_hisE(g1a)G(G233H / T235Q)' and 'Pcj7_hisD' gene fragments of the amplified NCgl1021 were cloned using the Gibson assembly method to obtain a recombinant plasmid, which was named 'pDC24△NCgl1021::Pspl13_hisE(g1a)G(G233H / T235Q)- Pcj7_hisD'. Gibson cloning was performed in the same manner as in Example 2. The constructed 'pDC24-Pspl13_hisE(g1a)G(G233H / T235Q)-Pcj7_hisD' vector was transformed into CJ-HIS6 constructed in Example 4-1-2 by electroporation, and then a secondary crossing process was performed to obtain a strain with an enhanced histidine biosynthetic pathway through additional gene insertion. The genetic manipulation was confirmed through PCR using primers of SEQ ID NO: 65 and SEQ ID NO: 66 and genome sequencing. The strain thus obtained was named CA10-0114.
[0296] Sequence number (5'→3') Sequence number 65CTTTCAGCTTTCCCTCCCGC Sequence number 66GCTGTACTTTTAGTACA
[0297]
[0298] Example 4-2. Construction of plasmids for gene replacement
[0299]
[0300] In Example 3, a plasmid was constructed for introducing NAD-dependent isocitrate dehydrogenase derived from Streptococcus mutans, which has excellent tryptophan production ability, into the chromosome of a histidine-producing Corynebacterium glutamicum strain. At this time, using plasmid pDC24 as a parent vector, a plasmid capable of replacing the coding sequence of the endogenous icd gene with the coding sequence of an exogenous icd gene under a natural promoter was constructed.
[0301] Specifically, using the chromosomal DNA of Corynebacterium glutamicum ATCC13032 as a template, the upstream region where homologous recombination occurs was amplified using the primer pair of SEQ ID NO: 67 and SEQ ID NO: 68, and the downstream region was amplified using the primer pair of SEQ ID NO: 69 and SEQ ID NO: 70, and then PCR was performed to obtain each gene fragment. PCR was performed using Solg TM Amplification was performed using Pfu-X DNA polymerase (SolGent co.), and the conditions were denaturation at 95°C for 4 minutes, followed by 27 cycles of denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and polymerization at 72°C for 50 seconds, followed by polymerization reaction at 72°C for 5 minutes. The primer sequences used are as shown in Table 16 below.
[0302] Sequence number Sequence (5' → 3') Sequence number 67GAATTCGAGCTCGGTACCCCTCATTTTTCCCAACCCCSequence number 68ttcttcaaaacttactttttctgccatGAGTCTCCTTGGTTGATGSequence number 69ttctattgacttatttatagAGTCTCTTCACAAAAAGCGCSequence number 70CCTGCAGGTCGACTCTAGAGGATCCCCTTGAGTTAGTCCACGCCC
[0303] The upstream fragment and downstream fragment of the region where homologous recombination on the chromosome occurs, amplified through the above PCR, and the chromosomal transformation vector pDC24 cut with the SmaI restriction enzyme were cloned using the Gibson assembly method (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix) to obtain a recombinant plasmid, which was named pDC24△icd(13032).
[0304]
[0305] Example 4-3. Production of a histidine-producing Corynebacterium microorganism introducing NAD-dependent isocitrate dehydrogenase derived from Streptococcus mutans.
[0306]
[0307] In order to introduce a gene encoding NAD-dependent isocitrate dehydrogenase (SEQ ID NO: 1) derived from Streptococcus mutans selected in Example 1 into a histidine-producing Corynebacterium glutamicum strain, PCR was performed using the icd gene (SEQ ID NO: 2) of S. mutans as a template and the primers of SEQ ID NO: 11 and SEQ ID NO: 12 in Table 3 as described in Example 2-2. The polymerase was Solg TM Pfu-X DNA polymerase was used, and PCR amplification conditions were as follows: denaturation at 95°C for 2 minutes, denaturation at 95°C for 20 seconds, annealing at 60°C for 40 seconds, polymerization at 72°C for 1 minute, repeated 27 times, and then polymerization reaction at 72°C for 5 minutes.
[0308] Next, the amplified Streptococcus mutans-derived NAD-dependent isocitrate dehydrogenase gene fragment and the chromosomal transformation vector pDC24△icd(13032) constructed in Example 2-1 and digested with SmaI restriction enzyme were cloned using the Gibson assembly method (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix) to obtain a recombinant plasmid, which was named pDC24△icd(13032)-icd(S.mu). Cloning was performed by mixing the Gibson assembly reagent, the gene fragment, and the digested vector in the calculated molar number and then leaving it at 50°C for 1 hour.
[0309] The constructed pDC24△icd(13032)-icd(S.mu) vector was transformed into the histidine-producing strain CA14-0114 constructed in Example 4-1 by electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541-545), and then a second crossover process was performed to obtain a strain in which the coding sequence of the endogenous icd gene on the chromosome was replaced with the coding sequence of the icd gene derived from Streptococcus mutans. The strain was identified by PCR using primers of SEQ ID NOs. 13 and 14 in Table 4, which can amplify the external regions of the homologous recombination upstream and downstream regions of the position where the gene was replaced, and by genome sequencing.
[0310] The strain obtained by the above method was named CA14-0114ㅿicd::icd(S.mu).
[0311]
[0312] Example 5. Evaluation of L-histidine production capacity of Corynebacterium microorganisms with foreign NAD-dependent isocitrate dehydrogenase genes introduced.
[0313]
[0314] In order to confirm the L-histidine production ability of the CA14-0114ㅿicd::icd (S.mu) strain produced in Example 4 and the parent strain CA14-0114 into which no foreign gene was introduced, the strain was cultured using the following method.
[0315] Each strain was inoculated into a 250-mL corner-baffle flask containing 25 mL of the seed medium and cultured at 30°C for 48 hours with shaking at 200 rpm. Then, 1 mL of the seed culture was inoculated into a 250-mL corner-baffle flask containing 25 mL of the production medium and cultured at 30°C for 24 hours with shaking at 200 rpm. After the culture was completed, the production amount of L-histidine was measured by HPLC. The compositions of the seed medium and production medium are as follows, and the concentration of L-histidine in the culture solution for each strain tested is shown in Table 17 below.
[0316] <Seed medium (pH 7.0)>
[0317] Glucose 5%, Bactopeptone 1%, Sodium Chloride 0.25%, Yeast Extract 1%, Urea 0.4% (based on 1 liter of distilled water)
[0318]
[0319] <Production medium (pH 7.0)>
[0320] 6% raw sugar, 2% ammonium sulfate, 0.1% monobasic potassium phosphate, 0.05% magnesium sulfate heptahydrate, 2.0% CSL (corn steep liquor), 200 μg / L biotin, 30 g / L calcium carbonate (based on 1 liter of distilled water)
[0321] Histidine production (g / L)Histidine production (%)CA14-01144.6100CA14-0114ㅿicd::icd(S.mu)6.2134.8
[0322] As a result, as shown in Table 17 above, the CA14-0114ㅿicd::icd(S.mu) strain into which the Streptococcus mutans-derived NAD-dependent isocitrate dehydrogenase gene was introduced produced a final 6.2 g / L of L-histidine in flask culture, which was confirmed to be an approximately 34.8% improvement in fermentation yield compared to the parent strain CA14-0114, which produced 4.6 g / L.
[0323] These results indicate that the introduction of the NAD-dependent isocitrate dehydrogenase gene from Streptococcus mutans into a microorganism of the genus Corytebacterium not only increases L-tryptophan production capacity as confirmed in Example 3, but also has the effect of increasing L-histidine production capacity.
[0324]
[0325] From the above description, those skilled in the art will understand that the present application can be implemented in other specific forms without altering its technical concept or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of this application should be interpreted to include all changes or modifications derived from the meaning and scope of the following claims and their equivalents, rather than the detailed description above.
Claims
1. A microorganism of the genus Corynebacterium having L-amino acid production ability, into which a NAD-dependent isocitrate dehydrogenase protein derived from Streptococcus mutans or a polynucleotide encoding the same has been introduced.
2. A microorganism of the genus Corynebacterium, wherein the L-amino acid is at least one selected from the group consisting of L-tryptophan and L-histidine.
3. A microorganism of the genus Corynebacterium, wherein the NAD-dependent isocitrate dehydrogenase protein derived from Streptococcus mutans comprises an amino acid sequence of sequence number 1 or an amino acid sequence having at least 80% sequence identity therewith.
4. A microorganism of the genus Corynebacterium, wherein the NAD-dependent isocitrate dehydrogenase protein derived from Streptococcus mutans is encoded by the icd gene.
5. A microorganism of the genus Corynebacterium, wherein the polynucleotide encoding the NAD-dependent isocitrate dehydrogenase protein derived from Streptococcus mutans comprises the base sequence of SEQ ID NO:
2.
6. In the first paragraph, the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.
7. A Corynebacterium microorganism according to any one of claims 1 to 6, wherein the Corynebacterium microorganism has increased L-amino acid production ability compared to a non-modified microorganism.
8. A method for producing L-amino acids, comprising the step of culturing a Corynebacterium genus microorganism having L-amino acid production ability, into which a NAD-dependent isocitrate dehydrogenase protein derived from Streptococcus mutans or a polynucleotide encoding the same has been introduced, in a medium.
9. A method for producing L-amino acid in claim 8, wherein the L-amino acid is at least one selected from the group consisting of L-tryptophan and L-histidine.
10. A method for producing L-amino acid, further comprising a step of recovering L-amino acid from the cultured microorganism, a culture of the microorganism, a fermented product of the microorganism, or the culture medium in accordance with paragraph 8.
11. A composition for producing L-amino acids, comprising a Corynebacterium genus microorganism having L-amino acid production ability, into which a NAD-dependent isocitrate dehydrogenase protein derived from Streptococcus mutans or a polynucleotide encoding the same has been introduced, a culture of the microorganism, a fermented product of the microorganism, or a combination of two or more thereof.
12. A composition for producing L-amino acid, wherein the L-amino acid is at least one selected from the group consisting of L-tryptophan and L-histidine.
13. Use of a microorganism of the genus Corynebacterium having L-amino acid production ability, into which a NAD-dependent isocitrate dehydrogenase protein derived from Streptococcus mutans or a polynucleotide encoding the same has been introduced, for L-amino acid production.