АНТИТЕЛА К CD30L И ПУТИ ИХ ПРИМЕНЕНИЯ

EA202691026A1Pending Publication Date: 2026-07-13AMGEN INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
EA202691026
Authority / Receiving Office
EA · EA
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-09-12
Filing Date
2024-09-10
Publication Date
2026-07-13

AI Technical Summary

Technical Problem

Current therapeutic options for antagonizing CD30-CD30L signaling in human patients are limited by their affinity and potency, which could be improved to provide broader clinical benefits in treating inflammatory disorders.

Method used

Development of anti-CD30L antibodies with enhanced affinity and potency, specifically designed to bind CD30L with high specificity and inhibit CD30L-induced signaling pathways.

Benefits of technology

The anti-CD30L antibodies demonstrate high affinity for human and cynomolgus CD30L, effectively blocking CD30L-CD30 interactions and inhibiting IL-8 secretion, thereby offering potential therapeutic benefits in treating inflammatory disorders such as asthma and lupus.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

В настоящем изобретении предусмотрены антитела к CD30L и способы получения и применения указанных антител к CD30L.
Need to check novelty before this filing date? Find Prior Art

Description

ANTLCD30L ANTIBODIES AND USES THEREOFCROSS-REFERENCE TO RELATED APPLICATION

[0001] This application claims the benefit of priority to U.S. Provisional Application No. 63 / 537,933, filed September 12, 2023, which is hereby incorporated by reference in its entirety.SEQUENCE LISTING

[0002] Incorporated by reference in its entirety is a sequence listing submitted concurrently herewith and identified as follows: 48,423 kilobyte XML file named 10471 -WOO 1- SEC_Sequence_Listing_USPTO_8-26-2024, created on August 26, 2024.FIELD OF THE INVENTION

[0003] The present invention relates to the field of inflammatory disorders. The present invention relates to anti-CD30L antibodies and treatment of patients with said antibodies.BACKGROUND OF THE INVENTION

[0004] The Cluster of Differentiation 30 Ligand (CD30L, also known as TNFL8, or tumor necrosis factor ligand superfamily member 8) is a member of the Tumor Necrosis Factor (TNF) superfamily and is encoded by the TNFSF8 gene. The main isoform of CD30L comprises of a 234 amino acid transmembrane protein, with 172 amino acids in the extracellular domain. Consistent with one of the hallmark features of the TNF superfamily, CD30L assembles into homotrimeric complexes and binds to its cognate receptor CD30 (TNFRSF8). Upon binding to CD30, CD30L stimulates activation of multiple pathways including Mitogen-activated Protein Kinases (MAPK) and Nuclear Factor kappa B (NF-kB) signaling. Similar to other TNF superfamily members, CD30L and CD30 can be shed from the cell membrane upon cleavage by proteases such as TNFa Converting Enzyme (TACE). CD30L-CD30 engagement has been shown to stimulate increased shedding of both ligand and receptor. Soluble CD30L (sCD30L) can bind to and stimulate CD30 signaling.

[0005] CD30L expression is restricted to the immune system. Its expression is tightly regulated and primarily observed on activated lymphocytes and monocytes. Genetic and pharmacologic mouse models have revealed a role for CD30L-CD30 signaling in regulating differentiation and effector functions of helper T cells and B cells. CD30L signaling has been shown to regulate pan-helper T cell effector cytokines including Thl, Th2, and Thl7. CD30L has also been shown to regulate B cell production of antibodies across multiple isotype classes.Thus, CD30L-CD30 signaling broadly regulate both type 1 and type 2 / allergic adaptive immune responses.

[0006] Several lines of evidence implicate CD30L-CD30 signaling in multiple inflammatory disease indications. A rare loss-of-function genetic variant in TNFRSF8 (CD30) is associated with protection from severe asthma (Olafsdottir et al., Nature Communications, 2020). sCD30 and sCD30L levels have been reported to be elevated in plasma or serum in several disease indications including asthma, inflammatory bowel disease, and multiple sclerosis, suggesting higher levels of pathway signaling activity associated with these diseases.Impairment of CD30-CD30L signaling in mice, either through genetic or pharmacologic models, has been shown to ameliorate disease severity in mouse models of inflammatory disease (see e.g. Kennedy et al., Immunology. 2006 Jun; 118(2): 143-52). Anti-CD30L antibodies are known (see e.g. PCT publication No. WO 2013 / 163377 and PCT publication No. WO 20221 / 77963), however alternative therapeutic antagonism of CD30-CD30L signaling, by for example, anti- CD30L antibodies with increased affinity and / or potency, in human patients could provide broad clinical benefit.SUMMARY OF THE INVENTION

[0007] The present disclosure provides, in part, an antibody which binds CD30L comprising an HCDR1 comprising SEQ ID NO: 1, an HCDR2 comprising SEQ ID NO: 2, an HCDR3 comprising SEQ ID NO: 3, an LCDR1 comprising SEQ ID NO: 4, an LCDR2 comprising SEQ ID NO: 5, and an LCDR3 comprising SEQ ID NO: 6. In an embodiment, the antibody comprises: the HCDR1 consisting of SEQ ID NO: 1, the HCDR2 consisting of SEQ ID NO: 2, the HCDR3 consisting of SEQ ID NO: 3, the LCDR1 consisting of SEQ ID NO: 4, the LCDR2 consisting of SEQ ID NO: 5, and the LCDR3 consisting of SEQ ID NO: 6.

[0008] In an embodiment of any of the above, the antibody comprises a heavy chain variable region (HCVR) comprising SEQ ID NO: 19, or a variant thereof comprising an amino acid sequence having at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 19 and a light chain variable region (LCVR) comprising SEQ ID NO: 20, or a variant thereof comprising an amino acid sequence having at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 20. In an embodiment, the variant of SEQ ID NO: 19 comprises not more than 6, 5, 4, 3, 2 or 1 amino acid substitutions, insertions or deletions relevant to SEQ ID NO: 19 and the variant of SEQ ID NO: 20 comprises not more than 6, 5, 4, 3, 2, or 1 amino acid substitutions, insertions or deletions relevant to SEQ ID NO: 20, wherein thevariations occur in the framework region of the HCVR, LCVR or both HCVR and LCVR. In an embodiment, the antibody comprises a HCVR comprising SEQ ID NO: 19 and a LCVR comprising SEQ ID NO: 20. In an embodiment, the antibody comprises a HCVR consisting of SEQ ID NO: 19 and a LCVR consisting of SEQ ID NO: 20.

[0009] In an embodiment of any of the above, the antibody comprises a heavy chain (HC) comprising SEQ ID NO: 25 and a light chain (LC) comprising SEQ ID NO: 26. In an embodiment, the antibody comprises two HCs and two LCs wherein each HC comprises SEQ ID NO: 25 and each LC comprises SEQ ID NO: 26. In an embodiment, the antibody comprises two HCs and two LCs wherein each HC consists of SEQ ID NO:25 and each LC consists of SEQ ID NO:26. In another embodiment, the antibody consists of two HCs and two LCs wherein each HC consists of SEQ ID NO:25 and each LC consists of SEQ ID NO:26.

[0010] The present disclosure provides an antibody which binds to CD30L comprising a HCDR1 comprising SEQ ID NO: 7, an HCDR2 comprising SEQ ID NO: 8, an HCDR3 comprising SEQ ID NO: 9, an LCDR1 comprising SEQ ID NO: 10, an LCDR2 comprising SEQ ID NO: 11, and an LCDR3 comprising SEQ ID NO: 12. In an embodiment of any of the above, the antibody comprises the HCDR1 consisting of SEQ ID NO: 7, the HCDR2 consisting of SEQ ID NO: 8, the HCDR3 consisting of SEQ ID NO: 9, the LCDR1 consisting of SEQ ID NO: 10, the LCDR2 consisting of SEQ ID NO: 11, and the LCDR3 consisting of SEQ ID NO: 12.

[0011] In an embodiment of any of the above, the antibody comprises a HCVR comprising SEQ ID NO: 23, or a variant thereof comprising an amino acid sequence having at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO:23 and a LCVR comprising SEQ ID NO: 24, or a variant thereof comprising an amino acid sequence having at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 24. In an embodiment, the variant of SEQ ID NO: 23 comprises not more than 6, 5, 4, 3, 2 or 1 amino acid substitutions, insertions or deletions relevant to SEQ ID NO: 23 and the variant of SEQ ID NO: 24 comprises not more than 6, 5, 4, 3, 2, or 1 amino acid substitutions, insertions or deletions relevant to SEQ ID NO: 24, wherein the variations occur in the framework region of the HCVR, LCVR or both HCVR and LCVR. In an embodiment, the antibody comprises a HCVR comprising SEQ ID NO:23 and a LCVR comprising SEQ ID NO: 24. In an embodiment, the antibody comprises a HCVR consisting of SEQ ID NO: 23 and a LCVR consisting of SEQ ID NO: 24.

[0012] In an embodiment of any of the above, the HC comprises SEQ ID NO: 29, and the LC comprises SEQ ID NO: 30. In an embodiment, the antibody comprises two HCs and two LCs, wherein each HC comprises SEQ ID NO: 29, and each LC comprises SEQ ID NO: 30. Inan embodiment, the antibody comprises two HCs and two LCs, wherein each HC consists of SEQ ID NO: 29, and each LC consists of SEQ ID NO: 30. In an embodiment, the antibody consists of two HC and two LC where each HC consist of SEQ ID NO: 29 and each LC consists of SEQ ID NO: 30.

[0013] Provided herein is an anti-CD30L antibody comprising a HC comprising SEQ ID NO: 29 and a LC comprising SEQ ID NO:30. Also provided is an anti-CD30L antibody comprising a two HC and two LC, each HC comprising SEQ ID NO: 29 and each LC comprising SEQ ID NO:30. Further provided is an is an anti-CD30L antibody consisting of two HC and two LC, each HC consisting of SEQ ID NO: 29 and each LC consisting of SEQ ID NO:30.

[0014] Also provided is an anti-CD30L antibody comprising a HC comprising SEQ ID NO: 33, 36, or 39 and a LC comprising SEQ ID NO:30. In one embodiment, the HC comprises SEQ ID NO: 33 and the LC comprises SEQ ID NO: 30. In an embodiment, the antibody comprises two HCs and two LCs, and wherein each HC comprises SEQ ID NO: 33, and each LC comprises SEQ ID NO: 30. In another embodiment the HC comprises SEQ ID NO: 36 and the LC comprises SEQ ID NO: 30. In an embodiment, the antibody comprises two HCs and two LCs, and wherein each HC comprises SEQ ID NO: 36, and each LC comprises SEQ ID NO: 30. In a further embodiment the HC comprises SEQ ID NO: 39 and the LC comprises SEQ ID NO: 30. In an embodiment, the antibody comprises two HCs and two LCs, and wherein each HC comprises SEQ ID NO: 39, and each LC comprises SEQ ID NO: 30.

[0015] Provided herein is also an anti-CD30L antibody comprising a HC comprising SEQ ID NO: 25 and a light chain comprising SEQ ID NO: 26. Provided is an anti-CD30L antibody comprising two HC and two LC, wherein each HC comprises SEQ ID NO: 25 and each LC comprises SEQ ID NO: 26. Further provided is an anti-CD30L antibody consisting of two HC and two LC, wherein each HC consists of SEQ ID NO:25 and each LC consists of SEQ ID NO: 26. Also provided is anti-CD30L antibody comprising a HC comprising SEQ ID NO: 31, 34, or 37 and a LC comprising SEQ ID NO: 26. In one embodiment, the HC comprises SEQ ID NO: 31 and the LC comprises SEQ ID NO: 26. In an embodiment, the antibody comprises two HCs and two LCs, and wherein each HC comprises SEQ ID NO: 31, and each LC comprises SEQ ID NO: 26. In an embodiment, the HC comprises SEQ ID NO: 34 and the LC comprises SEQ ID NO: 26. In an embodiment, the antibody comprises two HCs and two LCs, and wherein each HC comprises SEQ ID NO: 34, and each LC comprises SEQ ID NO: 26. In another embodiment, the HC comprises SEQ ID NO: 37 and the LC comprises SEQ ID NO: 26. In an embodiment, the antibody comprises two HCs and two LCs, and wherein each HC comprises SEQ ID NO: 37, and each LC comprises SEQ ID NO: 26.

[0016] In an embodiment, the antibodies described herein (a) bind to human CD30L with a dissociation constant (KD) value of less than 100, 75 or 50 picomolar as measured by a surface plasma resonance technique or a kinetic exclusion assay; (b) bind to cynomolgus CD30L with a KD value of less 100, 75 or 50 picomolar as measured by a surface plasma resonance technique or a kinetic exclusion assay; (c) bind to human CD30L and cynomolgus CD30L within 10-fold affinity of one another; (d) block the binding of human CD30L to human CD30 as determined by a cell based assay; or (e) inhibit CD30L induced IL-8 secretion as determined by a cell based assay.

[0017] In an embodiment of the antibodies of the present disclosure, the antibody specifically binds CD30L. For example, provided is an antibody which specifically binds CD30L comprising an HCDR1 comprising SEQ ID NO: 1, an HCDR2 comprising SEQ ID NO: 2, an HCDR3 comprising SEQ ID NO: 3, an LCDR1 comprising SEQ ID NO: 4, an LCDR2 comprising SEQ ID NO: 5, and an LCDR3 comprising SEQ ID NO: 6. Also provided is an antibody which specifically binds to CD30L comprising a HCDR1 comprising SEQ ID NO: 7, an HCDR2 comprising SEQ ID NO: 8, an HCDR3 comprising SEQ ID NO: 9, an LCDR1 comprising SEQ ID NO: 10, an LCDR2 comprising SEQ ID NO: 11, and an LCDR3 comprising SEQ ID NO: 12.

[0018] The present disclosure provides a method of treating an inflammatory disorder in a patient comprising administering an effective amount of an antibody of the present disclosure to the patient. In an embodiment, the inflammatory disorder is asthma. In an embodiment, the inflammatory disorder is severe asthma. In an embodiment, the inflammatory disorder is lupus. In an embodiment, the inflammatory disorder is ulcerative colitis.

[0019] Also provided are isolated polynucleotide molecules comprising a nucleic acid sequence encoding they heavy chain and / or the light chain of any of the antibodies of the present disclosure. Provided in one aspect is a polynucleotide encoding: a HCVR; a LCVR; a HC; a LC; a LCVR and a HCVR; or a LC and HC of an antibody that binds CD30L, wherein the antibody comprises an HCDR1 comprising SEQ ID NO: 1, an HCDR2 comprising SEQ ID NO: 2, an HCDR3 comprising SEQ ID NO: 3, an LCDR1 comprising SEQ ID NO: 4, an LCDR2 comprising SEQ ID NO: 5, and an LCDR3 comprising SEQ ID NO: 6. In an embodiment, the antibody comprises a HCVR comprising SEQ ID NO: 19 and a LCVR comprising SEQ ID NO: 20. In an embodiment, the antibody comprises a HC comprising SEQ ID NO: 25 and a LC comprising SEQ ID NO: 26.

[0020] In an embodiment, the polynucleotide encodes the HCVR of the antibody, wherein the amino acid sequence of the HCVR comprises SEQ ID NO: 19. In an embodiment,the polynucleotide encodes the LCVR of the antibody, wherein the amino acid sequence of the LCVR comprises SEQ ID NO: 20. In an embodiment, the polynucleotide encodes both the HCVR and the LCVR of the antibody, wherein the amino acid sequence of the HCVR comprises SEQ ID NO: 19 and the amino acid sequence of the LCVR comprises SEQ ID NO: 20.

[0021] In an embodiment, the polynucleotide encodes the HC of the antibody, wherein the amino acid sequence of the HC comprises SEQ ID NO: 25. In an embodiment, the polynucleotide encodes the LC of the antibody, wherein the amino acid sequence of the LC comprises SEQ ID NO: 26. In an embodiment, the polynucleotide encodes both the LC and the HC of the antibody, wherein the amino acid sequence of the HC comprises SEQ ID NO: 25 and the amino acid sequence of the LC comprises SEQ ID NO: 26.

[0022] In an embodiment, the polynucleotide that encodes the antibody LC comprises the nucleic acid sequence of SEQ ID NO: 18. In an embodiment, the polynucleotide that encodes the antibody HC comprises the nucleic acid sequence of SEQ ID NO: 21.

[0023] Also provided in one aspect is a polynucleotide encoding: a HCVR; a LCVR; a HC; a LC; a LCVR and a HCVR; or a LC and a HC of an antibody that binds CD30L, wherein the antibody comprises an HCDR1 comprising SEQ ID NO: 7, an HCDR2 comprising SEQ ID NO: 8, an HCDR3 comprising SEQ ID NO: 9, an LCDR1 comprising SEQ ID NO: 10, an LCDR2 comprising SEQ ID NO: 11, and an LCDR3 comprising SEQ ID NO: 12. In an embodiment, the antibody comprises a HCVR comprising SEQ ID NO: 23 and a LCVR comprising SEQ ID NO: 24. In an embodiment, the antibody comprises a HC comprising SEQ ID NO: 29 and a LC comprising SEQ ID NO: 30.

[0024] In an embodiment, the polynucleotide encodes the HCVR of the antibody, wherein the amino acid sequence of the HCVR comprises SEQ ID NO: 23. In an embodiment, the polynucleotide encodes the LCVR of the antibody, wherein the amino acid sequence of the LCVR comprises SEQ ID NO: 24. In an embodiment, the polynucleotide encodes both the HCVR and the LCVR of the antibody, wherein the amino acid sequence of the HCVR comprises SEQ ID NO: 23 and the amino acid sequence of the LCVR comprises SEQ ID NO: 24.

[0025] In an embodiment, the polynucleotide encodes the HC of the antibody, wherein the amino acid sequence of the HC comprises SEQ ID NO: 29. In an embodiment, the polynucleotide encodes the LC of the antibody, wherein the amino acid sequence of the LC comprises SEQ ID NO: 30. In an embodiment, the polynucleotide encodes both the LC and the HC of the antibody, wherein the amino acid sequence of the HC comprises SEQ ID NO: 29 and the amino acid sequence of the LC comprises SEQ ID NO: 30.

[0026] In an embodiment, the polynucleotide that encodes the antibody LC comprises the nucleic acid sequence of SEQ ID NO: 16. In an embodiment, the polynucleotide that encodes the antibody HC comprises the nucleic acid sequence of SEQ ID NO: 17.

[0027] In an embodiment, the present disclosure provides a vector comprising any of the polynucleotides of the present disclosure. In an embodiment, the vector is a recombinant expression vector. In an embodiment, the vector comprises a polynucleotide encoding: a HCVR; a LCVR; a HC; a LC; a LCVR and a HCVR; or a LC and HC of an antibody that binds CD30L, wherein the antibody comprises an HCDR1 comprising SEQ ID NO: 1, an HCDR2 comprising SEQ ID NO: 2, an HCDR3 comprising SEQ ID NO: 3, an LCDR1 comprising SEQ ID NO: 4, an LCDR2 comprising SEQ ID NO: 5, and an LCDR3 comprising SEQ ID NO: 6. In an embodiment, the antibody comprises a HCVR comprising SEQ ID NO: 19 and a LCVR comprising SEQ ID NO: 20. In an embodiment, the antibody comprises a HC comprising SEQ ID NO: 25 and a LC comprising SEQ ID NO: 26.

[0028] In an embodiment, the vector comprises polynucleotide encoding the HCVR of the antibody, wherein the amino acid sequence of the HCVR comprises SEQ ID NO: 19. In an embodiment, the vector comprises a polynucleotide encoding the LCVR of the antibody, wherein the amino acid sequence of the LCVR comprises SEQ ID NO: 20. In an embodiment, the vector comprises a polynucleotide encoding both the HCVR and the LCVR of the antibody, wherein the amino acid sequence of the HCVR comprises SEQ ID NO: 19 and the amino acid sequence of the LCVR comprises SEQ ID NO: 20.

[0029] In an embodiment, the vector comprises a polynucleotide encoding the HC of the antibody, wherein the amino acid sequence of the HC comprises SEQ ID NO: 25. In an embodiment, the vector comprises a polynucleotide encoding the LC of the antibody, wherein the amino acid sequence of the LC comprises SEQ ID NO: 26. In an embodiment, the vector comprises a polynucleotide encoding both the LC and the HC of the antibody, wherein the amino acid sequence of the HC comprises SEQ ID NO: 25 and the amino acid sequence of the LC comprises SEQ ID NO: 26.

[0030] In an embodiment, the vector comprises a polynucleotide encoding the antibody LC, wherein the polynucleotide encoding the LC comprises the nucleic acid sequence of SEQ ID NO: 18. In an embodiment, the vector comprises a polynucleotide encoding the antibody HC, wherein the polynucleotide encoding the HC comprises the nucleic acid sequence of SEQ ID NO: 21.

[0031] Also provided is vector comprising a polynucleotide encoding: a HCVR; a LCVR; a HC; a LC; a LCVR and a HCVR; or a LC and a HC of an antibody that binds CD30L, whereinthe antibody comprises an HCDR1 comprising SEQ ID NO: 7, an HCDR2 comprising SEQ ID NO: 8, an HCDR3 comprising SEQ ID NO: 9, an LCDR1 comprising SEQ ID NO: 10, an LCDR2 comprising SEQ ID NO: 11, and an LCDR3 comprising SEQ ID NO: 12. In an embodiment, the antibody comprises a HCVR comprising SEQ ID NO: 23 and a LCVR comprising SEQ ID NO: 24. In an embodiment, the antibody comprises a HC comprising SEQ ID NO: 29 and a LC comprising SEQ ID NO: 30.

[0032] In an embodiment, the vector comprises a polynucleotide encoding the HCVR of the antibody, wherein the amino acid sequence of the HCVR comprises SEQ ID NO: 23. In an embodiment, the vector comprises a polynucleotide encoding the LCVR of the antibody, wherein the amino acid sequence of the LCVR comprises SEQ ID NO: 24. In an embodiment, the vector comprises a polynucleotide encoding both the HCVR and the LCVR of the antibody, wherein the amino acid sequence of the HCVR comprises SEQ ID NO: 23 and the amino acid sequence of the LCVR comprises SEQ ID NO: 24.

[0033] In an embodiment, the vector comprises a polynucleotide encoding the HC of the antibody, wherein the amino acid sequence of the HC comprises SEQ ID NO: 29. In an embodiment, the vector comprises a polynucleotide encoding the LC of the antibody, wherein the amino acid sequence of the LC comprises SEQ ID NO: 30. In an embodiment, the vector comprises a polynucleotide encoding both the LC and the HC of the antibody, wherein the amino acid sequence of the HC comprises SEQ ID NO: 29 and the amino acid sequence of the LC comprises SEQ ID NO: 30.

[0034] In an embodiment, the vector comprises a polynucleotide encoding the antibody LC, wherein the polynucleotide encoding the LC comprises the nucleic acid sequence of SEQ ID NO: 16. In an embodiment, the vector comprises a polynucleotide encoding the antibody HC, wherein the polynucleotide encoding the antibody HC comprises the nucleic acid sequence of SEQ ID NO: 17.

[0035] The present disclosure provides a host cell comprising any of the polynucleotides of the present disclosure or comprising any of the vectors of the present disclosure. In an embodiment, provided is a host cell into which a vector of the present disclosure has been introduced. In an embodiment, the host cell comprises a vector comprising a polynucleotide encoding an antibody HC, wherein the amino acid sequence of the HC comprises SEQ ID NO: 25. In an embodiment, the host cell comprises a vector comprising a polynucleotide encoding an antibody LC, wherein the amino acid sequence of LC comprises SEQ ID NO: 26. In an embodiment, provided is a host cell comprising a vector comprising a polynucleotide encoding an antibody HC and an antibody LC, wherein the amino acid sequence of the HC comprises SEQID NO: 25 and the amino acid sequence of the LC comprises SEQ ID NO: 26. The present disclosure also provides a process for producing an antibody comprising two HCs and two LCs, wherein the process comprises (i) cultivating the host cell of the present disclosure under conditions such that the antibody is expressed and (ii) recovering the expressed antibody. In an embodiment, each HC comprises SEQ ID NO: 25 and each LC comprises SEQ ID NO: 26. The present disclosure also provides an antibody obtainable by said process.

[0036] In an embodiment, the host cell comprises a vector comprising a polynucleotide encoding an antibody HC, wherein the amino acid sequence of the HC comprises SEQ ID NO: 29. In an embodiment, the host cell comprises a vector comprising a polynucleotide encoding an antibody LC, wherein the amino acid sequence of the LC comprises SEQ ID NO: 30. In an embodiment, provided is a host cell comprising a vector comprising a polynucleotide the encodes an antibody HC and an antibody LC, wherein the amino acid sequence of the HC comprises SEQ ID NO: 29 and the amino acid sequence of the LC comprises SEQ ID NO: 30. The present disclosure also provides a process for producing an antibody comprising two HCs and two LCs, wherein the process comprises (i) cultivating the host cell of the present disclosure under conditions such that the antibody is expressed and (ii) recovering the expressed antibody. In an embodiment, each HC comprises SEQ ID NO: 29 and each LC comprises SEQ ID NO: 30. The present disclosure also provides an antibody obtainable by said process.

[0037] The present disclosure provides an antibody of the present disclosure for use in therapy.

[0038] The present disclosure provides an antibody of the present disclosure for use in treating an inflammatory disorder. In an embodiment, the inflammatory disorder is asthma. In an embodiment, the inflammatory disorder is lupus. In an embodiment, the inflammatory disorder is ulcerative colitis.

[0039] The present disclosure provides an antibody of the present disclosure for the manufacture of a medicament for the treatment of an inflammatory disorder. In an embodiment, the inflammatory disorder is asthma. In an embodiment, the inflammatory disorder is lupus. In an embodiment, the inflammatory disorder is ulcerative colitis.

[0040] The present disclosure provides a pharmaceutical composition comprising an antibody of the present disclosure and one or more pharmaceutically acceptable carriers, diluents, or excipients.DETAILED DESCRIPTION

[0041] The present disclosure provides anti-CD30L antibodies and methods of making and using said antibodies. The antibodies of the present disclosure demonstrate improved characteristics, such as characteristics related to stability, compared to other antibodies that were assessed during antibody generation. After an initial screen of over 3,500 antibodies, 368 clones were further assessed for functional activity of binding to CD30L and also for blocking the CD30 (receptor) and CD30L (ligand) interaction using a cell based assay measuring IL-8 secretion. Of those 368 clones, twenty two clones were found to bind native CD30L expressed on human and cynomolgus monkey primary T cells with high affinity These twenty two clones were subjected to various in silico analysis tools and twelve clones were chosen to undergo additional optimization engineering. These twelve antibodies underwent an extensive hotspot remediation process using yeast display screening platform that analyzed a total of 395 combinatorial mutant Fab variants which were then tested for CD30L binding using yeast display methods. Nine antibodies were then converted to IgGl-SEFL2-YTE and tested using five different cell-based assays before and after heat stress and light stress. These nine antibodies were also tested for biochemical and biophysical characterization for, in part, solubility, viscosity, chemical stability, physical stability, and photostability. Of these nine antibodies, antibodies 46265 and 46183 demonstrated desirable physical chemical properties and were more stable compared to the other antibodies that demonstrated non-desirable properties including high viscosity, low activity, antibody clipping, and / or solubility and aggregation issues after a pH jump. All nine antibodies bin together, indicating they bind the same or similar epitope as each other and yet after significant engineering and screening only antibodies 46265 and 46183 demonstrated desired properties for a potential therapeutic.

[0042] In an embodiment, the anti-CD30L antibodies disclosed herein (i) specifically bind human CD30L and cynomolgus monkey CD30L within 10-fold affinity of one another and in the low picomolar range; (ii) demonstrate picomolar IC50 values in a functional assay; (iii) demonstrate increased half-life; and / or (iv) demonstrate acceptable physical chemical properties such as acceptable levels of viscosity and stability.

[0043] As used herein, an “antibody” is an immunoglobulin molecule comprising 2 heavy chains (HCs) and 2 light chains (LCs) interconnected by disulfide bonds. The amino terminal portion of each LC and HC includes a variable region of about 100-120 amino acids primarily responsible for antigen recognition via the CDRs contained therein. The CDRs are separated withregions that are more conserved, termed framework regions (“FR”). Each LCVR and HCVR is composed of 3 CDRs and 4 FRs, arranged from amino-terminus to carboxy -terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The 3 CDRs of the LC are referred to as “LCDR1, LCDR2, and LCDR3,” and the 3 CDRs of the HC are referred to as “HCDR1, HCDR2, and HCDR3.” The CDRs contain most of the residues which form specific interactions with the antigen. The functional ability of an antibody to bind a particular antigen is, thus, largely influenced by the amino acid residues within the six CDRs. Assignment of amino acids to CDR domains within the LCVR and HCVR regions of the antibodies of the present disclosure, unless otherwise stated, is based on the well-known Kabat numbering convention (Kabat, et al., Ann. NY Acad. Sci. 190:382-93 (1971); Kabat et al., Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No. 91-3242 (1991)). It is understand that other numbering conventions may also be used, such as, for example, Chothia (Chothia et al., “Canonical structures for the hypervariable regions of immunoglobulins”, Journal of Molecular Biology, 196, 901-917 (1987); Al-Lazikani et al., “Standard conformations for the canonical structures of immunoglobulins”, Journal of Molecular Biology, 273, 927-948 (1997)), and / or North (North et al., “A New Clustering of Antibody CDR Loop Conformations”, Journal of Molecular Biology, 406, 228-256 (2011)).

[0044] An “anti-CD30L antibody” is an antibody that binds CD30L. In an embodiment, the anti-CD30L antibody specifically binds CD30L. An antigen binding protein is said to “specifically bind” to an antigen when the antigen binding protein binds the antigen with a dissociation constant (KD) is <10'7M as measured via a surface plasma resonance technique (e.g., BIACore, GE-Healthcare Uppsala, Sweden) or Kinetic Exclusion Assay (KinExA, Sapidyne, Boise, Idaho). In an embodiment, the anti-CD30L antibody specifically binds human CD30L. In an embodiment, the anti-CD30L antibody specifically binds cynomolgus (cyno) monkey CD30L. In an embodiment, the anti-CD30L antibody specifically binds human CD30L with an affinity that is within 10-fold the binding affinity of the anti-CD30L antibody binding cynomolgus monkey CD30L. The antibodies, polypeptides, and other molecules of the present disclosure are “isolated” when they exist in a physical milieu distinct from that in which they were produced or would be naturally occurring.

[0045] Also contemplated as part of the present disclosure are Fabs, scFabs, and scFvs comprising the CDRs of the anti-CD30L antibodies of the present disclosure. Also contemplated as part of the present disclosure are Fabs and scFvs comprising the variable regions (LCVR and / or HCVR) of the anti-CD30L antibodies of the present disclosure.

[0046] Antibodies of the present disclosure may be an IgGl, IgG2, or IgG4. The antibodies of the present disclosure may be human or humanized antibodies. In the context of monoclonal antibodies, the terms “human” and “humanized” are well-known to those of ordinary skill in the art (Weiner L J, J. Immunother. 2006; 29: 1-9; Mallbris L, et al., J. Clin. Aesthet. Dermatol. 2016; 9: 13-15).

[0047] The antibodies of the present disclosure, for example IgGl antibodies, may have YTE (EU numbering M252Y, S254T and T256E) to increase the antibody half-life and / or SEFL2 mutations (EU numbering R292C, N297G and V302C) to reduce or eliminate effector function. Antibodies containing YTE and / or SEFL2 mutations as well as antibodies containing neither YTE nor SEFL2 mutations are envisioned as part of the present disclosure. Said antibodies may also have a cysteine clamp added to increase stability after removal of a glycosylation site.

[0048] “Nucleic acid sequence” is intended to encompass a polymer of DNA or RNA, i.e., a polynucleotide, which can be single-stranded or double-stranded and which can contain non-natural or altered nucleotides. The terms “nucleic acid,” “nucleic acid molecule,” “nucleic acid sequence,” and “polynucleotide” may be used interchangeably herein to refer to a polymeric form of nucleotides of any length, either ribonucleotides (RNA) or deoxyribonucleotides (DNA). These terms refer to the primary structure of the molecule, and thus include double- and singlestranded DNA, and double- and single-stranded RNA. The term “modified nucleic acid sequence” includes, as equivalents, analogs of either RNA or DNA made from nucleotide analogs and modified polynucleotides such as, though not limited, to methylated and / or capped polynucleotides. Polynucleotides of the present disclosure include DNA molecules that comprise a non-naturally occurring polynucleotide sequence encoding a polypeptide having the amino acid sequence of at least one of the polypeptides in an anti-CD30L antibody of the present disclosure (e.g., a heavy chain, a light chain, a variable heavy chain region, and a variable light chain region).

[0049] An isolated DNA encoding a HCVR region can be converted to a full-length heavy chain gene by operably linking the HCVR-encoding DNA to another DNA molecule encoding heavy chain constant regions. The sequences of human, as well as other mammalian, heavy chain constant region genes are known in the art. DNA fragments encompassing these regions can be obtained, e.g., by standard PCR amplification.

[0050] An isolated DNA encoding a LCVR region may be converted to a full-length light chain gene by operably linking the LCVR-encoding DNA to another DNA molecule encoding a light chain constant region. The sequences of human, as well as other mammalian, light chain constant region genes are known in the art. DNA fragments encompassing these regions can beobtained by standard PCR amplification. The light chain constant region can be a kappa or lambda constant region. In some embodiments, the light chain constant region is a kappa constant region.

[0051] The term “encoding” or “encodes” refers to a polynucleotide sequence encoding one or more amino acids. The term does not require a start or stop codon. The present disclosure encompasses nucleic acid molecules encoding anti-CD30L antibody polypeptide sequences, including those encoding the heavy chain variable region, the light chain variable region, the heavy chain, and the light chain.

[0052] The polynucleotides of the present disclosure can be expressed in a host cell after the sequences have been operably linked to an expression control sequence. Such expression vectors are typically replicable in the host organisms either as episomes or as an integral part of the host chromosomal DNA. Commonly, expression vectors will contain selection markers, e.g., tetracycline, neomycin, and dihydrofolate reductase, to permit detection of those cells transformed with the desired DNA sequences.

[0053] Transformed cells can be cultured under conditions that promote expression of the polypeptide, and the polypeptide recovered by conventional protein purification procedures. Polypeptides contemplated for use herein include substantially homogeneous recombinant mammalian polypeptides substantially free of contaminating endogenous materials. Cells containing nucleic acids encoding an anti-CD30L antibody of the present disclosure also include hybridomas.

[0054] A polynucleotide encoding an amino acid sequence of an anti-CD30L antibody of the present disclosure can be any length as appropriate for the desired use or function, and can comprise one or more additional sequences, for example, regulatory sequences, and / or be part of a larger nucleic acid, for example, a vector. The skilled artisan will appreciate that, due to the degeneracy of the genetic code, each of the polypeptide sequences disclosed herein is encoded by a large number of other nucleic acid sequences. Mutations can also be introduced into a nucleic acid without significantly altering the biological activity of a polypeptide that it encodes. For example, one can make nucleotide substitutions leading to amino acid substitutions at non- essential amino acid residues.

[0055] It will be appreciated that an anti-CD30L antibody of the present disclosure may have at least one amino acid substitution, providing that the anti-CD30L antibody retains the same or better desired binding specificity (e.g., binding to CD30L). Therefore, modifications to the anti-CD30L antibody are encompassed within the scope of the disclosure. Such modifications may include amino acid substitutions, which may be conservative or non-conservative that do not destroy the desired binding capability of a binding construct. Conservative amino acid substitutions may encompass non-naturally occurring amino acid residues, which are typically incorporated by chemical peptide synthesis rather than by synthesis in biological systems. These include peptidomimetics and other reversed or inverted forms of amino acid moieties. A conservative amino acid substitution may also involve a substitution of a native amino acid residue with a normative residue such that there is little or no effect on the polarity or charge of the amino acid residue at that position.

[0056] Human CD30L consists of the amino acid sequence of SEQ ID NO: 40. Cynomolgus monkey CD30L consists of the amino acid sequence of SEQ ID NO: 41.

[0057] The term “variant,” as used herein with respect to a nucleic acid sequence means (i) a portion or fragment of a referenced nucleotide sequence; (ii) the complement of a referenced nucleotide sequence or portion thereof; (iii) a nucleic acid that is substantially identical to a referenced nucleic acid or the complement thereof; or (iv) a nucleic acid that hybridizes under stringent conditions to the referenced nucleic acid, complement thereof, or a sequences substantially identical thereto. With respect to a peptide or polypeptide, the term “variant,” as used herein, refers to a peptide or polypeptide that differs from a reference peptide or polypeptide in amino acid sequence by the insertion, deletion, or conservative substitution of amino acids, but retains at least one biological activity of the reference peptide or polypeptide. Variant can also mean a protein with an amino acid sequence that is substantially identical to a referenced protein with an amino acid sequence that retains at least one biological activity. The term “isoform” may be used herein to refer to a polypeptide or protein variant. Typically, a protein isoform is a member of a set of highly similar proteins that originate from a single gene or gene family and are the result of genetic differences. While some protein isoforms exhibit the same or similar biological functions, some isoforms have unique functions. Isoforms may be generated from alternative splicing, variable promoter usage, or other post-transcriptional modifications of a single gene.

[0058] A variant may be a nucleic acid sequence that is substantially identical over the full length of a full gene sequence or a fragment thereof. The nucleic acid sequence may be 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical over the full length of the gene sequence or a fragment thereof. In other embodiments, a variant may be an amino acid sequence that is substantially identical over the full length of the amino acid sequence or fragment thereof. The amino acid sequence may be 95%, 96%, 97%, 98%, 99%, or 100% identical over the full length of the amino acid sequence or a fragment thereof. In an embodiment, the variant of the specifiedantibody amino acid sequence is one in which the variation occurs outside of the CDRs of the antibodies, such variations occurring in the framework region of the HCVR, the LCVR or both the HCVR and the LCVR. In another embodiment, the variant of the specified amino acid sequence is one in which the variation occurs outside of the CDRs of the antibodies, such as variations occurring in the framework region of the HCVR, the LCVR, or both the HCVR and LCVR and in which the antibody retains the residues which were mutated during hotspot remediation of the antibody.

[0059] “Sequence identity” refers to the relationship between two or more amino acid (polypeptide or protein) sequences or two or more nucleic acid (polynucleotide) sequences, as determined by comparing the sequences. The identity between two sequences is preferably defined by assessing their identity across the whole length of the sequence as identified herein.

[0060] When comparing the identity of two or more nucleotide or amino acid sequences, the percentage of sequence identity between a first sequence and a second sequence may be calculated by using methods known by a person skilled in the art, e.g., by dividing the number of residues in the first sequence that are identical to the residues at the corresponding positions in the second sequence by the total number of residues in the first sequence and multiplying by 100% or by using a known computer algorithm for sequence alignment such as NCBI Blast, e.g., BLASTN and BLASTP (Altschul, S. F. et al, J. Mol. Biol. 215:403-410 (1990), the GCG program package (Devereux, J., et al, Nucleic Acids Research 12 (1): 387 (1984)), BestFit, FASTA, and EMBOSS Needle (Madeira, F., et al, Nucleic Acids Research 47(W1): W636-W641 (2019)).

[0061] The antibodies of the present disclosure can readily be produced in mammalian cells, non-limiting examples of which includes CHO, NSO, HEK293 or COS cells. The host cells are cultured using techniques well known in the art.

[0062] Vectors containing the polynucleotide sequences of interest (e.g., the polynucleotides encoding the polypeptides of the antibody and expression control sequences) can be transferred into the host cell by well-known methods, which vary depending on the type of cellular host. Examples of vectors include, but are not limited to, plasmids, viral vectors, non- episomal mammalian vectors and expression vectors, for example, recombinant expression vectors.

[0063] The recombinant expression vectors of the disclosure can comprise a nucleic acid of the disclosure in a form suitable for expression of the nucleic acid in a host cell. The recombinant expression vectors include one or more regulatory sequences, selected on the basis of the host cells to be used for expression, which is operably linked to the nucleic acid sequenceto be expressed. Regulatory sequences include those that direct constitutive expression of a nucleotide sequence in many types of host cells (e.g., SV40 early gene enhancer, Rous sarcoma virus promoter and cytomegalovirus promoter), those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences, see Voss et al., 1986, Trends Biochem. Sci. 11 :287, Maniatis et al., 1987, Science 236:1237, incorporated by reference herein in their entireties), and those that direct inducible expression of a nucleotide sequence in response to particular treatment or condition (e.g., the metallothionin promoter in mammalian cells and the tet-responsive and / or streptomycin responsive promoter in both prokaryotic and eukaryotic systems (see id.). It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, etc. The expression vectors of the present disclosure can be introduced into host cells to thereby produce proteins or peptides, including fusion proteins or peptides, encoded by nucleic acids as described herein.

[0064] Typically, expression vectors used in any of the host cells will contain sequences for plasmid maintenance and for cloning and expression of exogenous nucleotide sequences. Such sequences, collectively referred to as “flanking sequences” in certain embodiments will typically include one or more of the following nucleotide sequences: a promoter, one or more enhancer sequences, an origin of replication, a transcriptional termination sequence, a complete intron sequence containing a donor and acceptor splice site, a sequence encoding a leader sequence for polypeptide secretion, a ribosome binding site, a polyadenylation sequence, a polylinker region for inserting the nucleic acid encoding the polypeptide to be expressed, and a selectable marker element. The leader sequence may comprise SEQ ID NO: 32 (MDMRVPAQLLGLLLLWLRGARC) which can be encoded by SEQ ID NO: 28 (atggacatgagagtgcctgcacagctgctgggcctgctgctgctgtggctgagaggcgccagatgc). The leader sequence may comprise SEQ ID NO: 27 (MAWALLLLTLLTQGTGSWA) which can be encoded by SEQ ID NO: 22 (atggcctggg ctctgctgct cctcaccctc ctcactcagg gcacagggtc ctgggcc).

[0065] Various methods of protein purification may be employed to purify proteins, including, but not limited to, antibodies and such methods are known in the art.

[0066] The anti-CD30L antibodies of the present disclosure can be biosynthesized, purified, and formulated for administration by well-known methods. For example, an appropriate host cell, such as HEK 293 or CHO, is either transiently or stably transfected with an expression system for secreting antibodies using a predetermined HC:LC vector ratio if two vectors are used, or a single vector system encoding both heavy chain and light chain. Vectors suitable for expression and secretion of antibodies from these commonly-used host cells are well-known.Following expression and secretion of the antibody, the medium is clarified to remove cells and the clarified medium is purified using any of many commonly-used techniques. For example, the medium may be applied to a Protein A or G column that has been equilibrated with a buffer, such as phosphate buffered saline (pH 7.4). The column is washed to remove nonspecific binding components. The bound antibody is eluted, for example, by a pH gradient (such as 0.1 M sodium phosphate buffer pH 6.8 to 0.1 M sodium citrate buffer pH 2.5). Antibody fractions are detected, such as by SDS-PAGE, and then are pooled. Further purification is optional, depending on the intended use. The antibody may be concentrated and / or sterile filtered using common techniques. Other materials than the antibody, such as host cell and growth medium components, and soluble aggregates and multimers of the antibody, may be effectively reduced or removed by common techniques, including size exclusion, hydrophobic interaction, cation exchange, anion exchange, affinity, or hydroxyapatite chromatography. The purity of the antibody after these chromatography steps is typically greater than 95%. The product may be frozen at -70 °C or may be lyophilized.

[0067] In exemplary aspects, an antibody of the present disclosure comprises a HC comprising a C-terminal lysine, as in SEQ ID NOs: 25, 29, 34, and 36. In alternative aspects, the antibody comprises a HC without the C-terminal lysine, as in SEQ ID NOs: 31, 33, 37 and 39. In addition, the HC N-terminal glutamine and / or the N-terminal glutamic acid of may be converted to pyroglutamic acid, as in SEQ ID NOs: 34, 36, 37 and 39. Either form is envisioned for the antibodies of the present disclosure.

[0068] It is envisioned that an anti-CD30L antibody of the present disclosure, or a pharmaceutical composition comprising the same, treats inflammatory disease. Inflammatory diseases include, but are not limited to autoimmune diseases such as asthma (including severe asthma), rheumatoid arthritis, lupus, and multiple sclerosis, ulcerative colitis and atopic dermatitis.

[0069] Arthritis may be treated by the methods and compositions disclosed herein. As used here, the term “arthritis” refers to chronic inflammatory conditions that primarily affect joints, or the connective tissue surrounding joints, although various body organs may also become affected.

[0070] Arthritis may be autoimmune or traumatic in origin, or it may be triggered by exposure to a foreign antigen, thereafter leading to a chronic condition that is no longer dependent on the continued presence of the triggering antigen. The term “arthritis,” as used herein, includes: arthritis deformans; osteoarthritis; rheumatoid arthritis (adult and juvenile);Lyme disease arthritis; reactive arthritis including Reiter's disease; psoriatic arthritis; arthritis nodosa; seronegative spondylarthropathies, including but not limited to ankylosing spondylitis.

[0071] The antibodies described herein are useful in treating a variety of rheumatic disorders, which are defined herein as any chronic disorder involving painful and often multiple localized inflammations of the joints, muscles, nerves, tendons, skin, eyes, connective tissues or various other organ systems. These include but are not limited to: arthritis; scleroderma; gout; systemic lupus erythematosus; polymyalgia rheumatica; Still's disease; chronic uveitis; disorders resulting in inflammation of the voluntary muscle, including dermatomyositis and polymyositis, including sporadic inclusion body myositis. Systemic lupus erythematosus can cause inflammation of the joints, skin, kidneys, heart, lungs, blood vessels and brain. In its advanced forms, systemic lupus erythematosus this condition can result in kidney failure.

[0072] Provided also are methods for using the antibodies described herein in therapies to treat various disorders of the endocrine system, including but not limited to: juvenile or maturity onset diabetes (including autoimmune, insulin-dependent types of diabetes; non-insulin dependent types and obesity-mediated diabetes); idiopathic adrenal atrophy; Addison's disease; hypothyroidism; Grave's disease; autoimmune thyroiditis, such as Hashimoto's thyroiditis; and polyglandular autoimmune syndromes (types I and II).

[0073] Antibodies described herein are also useful in therapies to treat conditions of the gastrointestinal system, including but not limited to: autoimmune sclerosing cholangitis; coeliac disease; inflammatory bowel diseases, including Crohn's disease and ulcerative colitis; autoimmune pancreatitis, including chronic pancreatitis; idiopathic gastroparesis; and idiopathic ulcers, including gastric and duodenal ulcers.

[0074] Included also are methods for using the antibodies described herein in therapies for treating disorders of the genitourinary system, such as autoimmune and idiopathic glomerulonephritis; and chronic idiopathic prostatitis (non-bacterial), including benign prostatic hypertrophy.

[0075] Also provided herein are methods for using the antibodies described herein in therapies to treat various hematologic disorders, including but not limited to: anemias and hematologic disorders, including pernicious anemia and aplastic anemia, and Fanconi's aplastic anemia; autoimmune hemolytic anemia; idiopathic thrombocytopenic purpura (ITP); myelodysplastic syndromes (including refractory anemia, refractory anemia with ringed sideroblasts, refractory anemia with excess blasts, refractory anemia with excess blasts in transformation); and autoimmune lymphoproliferative syndrome (ALPS).

[0076] The disclosed antibodies are furthermore useful to treat conditions that affect the liver such as autoimmune or chronic inflammatory hepatitis.

[0077] In addition, the disclosed antibodies and combination used to treat various autoimmune or chronic inflammatory disorders that involve hearing loss. One of these is inner ear or cochlear nerve-associated hearing loss that is thought to result from an autoimmune process, i.e., autoimmune hearing loss. This condition currently is treated with steroids, methotrexate and / or cyclophosphamide, which may be administered concurrently with an inhibitor or blocker of the CD30 / CD30L interaction.

[0078] A number of inflammatory pulmonary disorders also can be treated with the disclosed antibodies, including: idiopathic lymphangioleiomyomatosis; chronic obstructive pulmonary disease (COPD) associated with chronic non-infectious bronchitis or with emphysema; and fibrotic lung diseases, such as cystic fibrosis and idiopathic pulmonary fibrosis.

[0079] Disorders associated with transplantation also are treatable with the disclosed antibodies, including graft-versus-host disease. To prevent or ameliorate graft-versus-host disease, compositions comprising one or more of the disclosed antibodies may be administered prior to, concomitantly with, or following bone marrow or solid organ transplantation, including transplantation of heart, liver, lung, skin, kidney or other organs.

[0080] The disclosed antibodies also are useful for treating chronic inflammatory eye diseases, including autoimmune uveitis.

[0081] Such antibodies would also be useful for treating diseases associated with airway inflammation, such as asthma.

[0082] The antibodies described herein also are useful for treating inflammatory disorders that affect the female reproductive system, including: multiple implant failure / infertility; fetal loss syndrome or IV embryo loss (spontaneous abortion); and endometriosis.

[0083] Other medical disorders treatable with the antibodies described herein include chronic inflammation and / or degenerative diseases of the central nervous system. This includes, for example, diseases associated with demyelination, such as multiple sclerosis, systemic sclerosis and the Guillain-Barre syndromes (including acute inflammatory demyelinating polyneuropathy, acute motor axonal neuropathy, acute motor sensory axonal neuropathy and Fisher syndrome). Multiple sclerosis is representative of a chronic, degenerative disease of the central nervous system which may be treated with an agent capable of inhibiting or blocking the interaction of CD30 and CD30L.

[0084] Other chronic inflammatory conditions treatable with the disclosed antibodies include cold agglutinin disease; Behcet's syndrome; Sjogren's syndrome; and idiopathictenosynovitis, as well as various chronic inflammatory disorders associated with hereditary deficiencies. The subject inhibitors, compositions and combination therapies furthermore are useful for treating Bell's palsy (idiopathic facial paralysis); chronic fatigue syndrome (not associated with ongoing infection); chronic degenerative vertebral disc disease; Gulf war syndrome; and myasthenia gravis, which may be treated concurrently with corticosteroids.

[0085] Disorders involving the skin or mucous membranes also are treatable using antibodies described herein. These include: acantholytic diseases, including discoid lupus, subacute cutaneous lupus erythematosus, cutaneous vasculitis, Darier's disease, keratosis follicularis, pemphigus vulgaris and paraneoplastic pemphigus; acne rosacea; alopecia areata; bullous pemphigoid; eczema; erythema, including erythema multiforme and erythema multiforme bullosum (Stevens-Johnson syndrome); inflammatory skin disease; lichen planus; linear IgA bullous disease (chronic bullous dermatosis of childhood); loss of skin elasticity; neutrophilic dermatitis (Sweet's syndrome); pityriasis rubra pilaris; psoriasis; pyoderma gangrenosum; loss of skin elasticity; and toxic epidermal necrolysis.

[0086] Other diseases that can be treated with the disclosed antibodies include: autoimmune-associated chronic mucocutaneous candidiasis; allergies; sarcoidosis; multicentric reticulohistiocytosis; Wegener's granulomatosis; arteritis, including giant cell arteritis; vasculitis and chronic autoimmune myocarditis.

[0087] An anti-CD30L antibody of the present disclosure, or a pharmaceutical composition comprising the same, may be administered by parenteral routes, non-limiting examples of which are subcutaneous administration and intravenous administration. An anti- CD30L antibody of the present disclosure may be administered to a patient with pharmaceutically acceptable carriers, diluents, or excipients in single or multiple doses. Pharmaceutical compositions of the present disclosure can be prepared by methods well known in the art (e.g., Remington: The Science and Practice of Pharmacy, 22nd ed. (2012), A. Loyd et al., Pharmaceutical Press) and comprise an antibody, as disclosed herein, and one or more pharmaceutically acceptable carriers, diluents, or excipients.

[0088] As used interchangeably herein, "treatment" and / or "treating" and / or "treat" are intended to refer to all processes wherein there may be a slowing, interrupting, arresting, controlling, stopping, or reversing of the progression of the disorders described herein, but does not necessarily indicate a total elimination of all disorder symptoms. Treatment includes administration of an anti-CD30L antibody of the present disclosure for treatment of a disease or condition in a human that would benefit from activity of an anti-CD30L antibody of the present disclosure, and includes: (a) inhibiting further progression of the disease; and (b) relieving thedisease, i.e., causing regression of the disease or disorder or alleviating symptoms or complications thereof.

[0089] Therapeutically effective amounts (or dose) of an anti-CD30L antibody of the present disclosure can be administered. The amount of anti-CD30L antibody that constitutes a therapeutically dose may vary with the indication treated, the weight of the patient, the calculated skin surface area of the patient. Dosing of an anti-CD30L antibody can be adjusted to achieve the desired effects. In many cases, repeated dosing may be required. Dosages and the frequency of administration may vary according to such factors as the route of administration, the particular anti-CD30L antibody employed, the nature and severity of the disease to be treated, whether the condition is acute or chronic, and the size and general condition of the subject.

[0090] An anti-CD30L antibody, or a pharmaceutical composition containing such a molecule, can be administered by any feasible method. Protein therapeutics will ordinarily be administered by a parenteral route, for example by injection, since oral administration, in the absence of some special formulation or circumstance, would lead to hydrolysis of the protein in the acid environment of the stomach. Subcutaneous, intramuscular, intravenous, intraarterial, intralesional, or peritoneal bolus injection are possible routes of administration. An anti-CD30L antibody can also be administered via infusion, for example intravenous or subcutaneous infusion.

[0091] Anti-CD30L antibodies can be administered in the form of a composition comprising one or more additional components such as a physiologically acceptable carrier, excipient or diluent. Optionally, the composition additionally comprises one or more physiologically active agents. In various particular embodiments, the composition comprises one, two, three, four, five, or six physiologically active agents in addition to one or more anti- CD30L antibodies.

[0092] As used herein, an “effective amount” means the amount of an anti-CD30L antibody of the present disclosure or pharmaceutical composition comprising such an antibody that will elicit the biological or medical response of or desired therapeutic effect on a tissue, system, animal, mammal, or human that is being sought by the researcher, medical doctor, or other clinician. An effective amount of the antibody may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the antibody to elicit a desired response in the individual. An effective amount is also one in which any toxic or detrimental effect of the antibody is outweighed by the therapeutically beneficial effects. Such benefit includes improving signs or symptoms of inflammatory disease(s). An effective amount can be readily determined by one skilled in the art, by the use of known techniques, and byobserving results obtained under analogous circumstances. An effective amount of an anti- CD30L antibody of the present disclosure may be administered in a single dose or in multiple doses. In determining the effective amount for a patient, a number of factors are considered by the attending medical practitioner, including, but not limited to: the patient's size (e.g., weight or mass), body surface area, age, and general health; the specific disease or disorder involved; the degree of, or involvement, or the severity of the disease or disorder; the response of the individual patient; the particular compound administered; the mode of administration; the bioavailability characteristics of the preparation administered; the dose regimen selected; the use of concomitant medication; and other relevant circumstances known to medical practitioners.EXAMPLESExample 1: CD30L Specificity

[0093] To determine antibody species cross-reactivity and specificity, HEK 293T cells cultured in Freestyle™ 293 Expression Medium with GlutaMAX (Gibco) supplemented with 2% Fetal Bovine Serum (HyClone) and 50 pg / mL G-418 disulfate salt solution (Sigma-Aldrich) were transiently transfected as described below using 293fectinTM transfection reagent (Gibco).

[0094] Members of the TNF superfamily most closely related to CD30L, CD27L, 4- 1BBL, and FasL, were identified by sequence homology. Proteins were expressed on HEK 293T cells by transfection using human CD30L (SEQ ID NO: 40), cynomolgus monkey CD30L (SEQ ID NO: 41), human CD27L (SEQ ID NO: 15), human 4-1BBL (SEQ ID NO: 38), human FasL (SEQ ID NO: 35) or control expression vectors, Gibco™ OptiMEM® media (Gibco), and 293Fectin™ reagent (Invitrogen) according to the manufacturer’s instructions. Human B-cell lymphoma (Ramos) cell lines were also used to determine specificity to endogenously expressed CD30L.

[0095] The transfected cells were incubated overnight on orbital shaker at 120 RPM at 37°C, 5% CO2 in a humidified incubator. The following day, the transfected cells were washed and resuspended in FACs buffer (PBS supplemented with 2% FBS). The cells were added to 96- well clear V-bottom polystyrene plates (Corning®) at 50,000 cells per well, and incubated with 5 pg / mL (or 2-fold diluted samples if concentration less than 5 pg / mL) test antibodies for 2 hours at 4°C. After washing twice with FACs buffer, the cells were stained with Alexa Fluor® 647- conjugated AffiniPure Goat Anti-Human IgG Fcgamma fragment specific (Jackson ImmunoResearch) and 2.5 pg / mL 7- Aminoactinomycin D (Sigma-Aldrich) for 20 minutes at4°C. After an additional washing step, the cells were resuspended in FACS buffer and the intensity of binding was determined using iQue flow cytometry instrument with Intellicyt autosampler (Intellicyt). The acquired data was analyzed with Intellicyt Forecyt® Enterprise Client software.

[0096] Data from hybridomas derived from three cohorts of immunized animals are represented in Table 1.

[0097] These data demonstrate that antibodies bound only human and cyno CD30L. None of the tested antibodies in supernatant bound to human CD27L, human 4-1BBL, human FasL, or 293T cells transfected with a control expression vector. An additional study demonstrated that purified antibody 46265 does not bind to murine CD30L (SEQ ID NO: 13; ratio of 1.0) or rat CD30L (SEQ ID NO: 14; ratio of 1.1).Table 1. Binding of hybridoma supernatants (final Ab concentration 5ug / ml) as determined by flow cytometry (fold binding over control)Example 2: Antibody binding to Human and Cynomolgus Monkey PBMCs

[0098] Binding of anti-CD30L antibodies to endogenous CD30L expressed by primary human and cynomolgus monkey peripheral blood mononuclear cells (human or cyno PBMCs) was assessed by flow cytometry. For human primary cell binding assay, purified human T cells (Biological Specialty Corp.) were thawed and suspended at a concentration of 2.5xl06cells / mL. T cells were stimulated with 5 pg / mL of anti-human CD3 clone OKT3 (eBioscience) bound to the plate and 1 pg / mL of anti -human CD28 (BD Pharmingen) in suspension for 72 hours at 37 °C / 5% CO2. After 72 hours, cells were removed, washed and suspended at a concentration of 0.5xl06cells / mL with 10 ng / mL of IL-2 (Pepro Tech). Cells were then incubated for another 7 days at 37 °C / 5 % CO2. For cynomolgus primary cell binding assay, cynomolgus PBMCs (SNBL) were thawed and suspended in a concentration between 4xl06and 5xl06cells / mL.PBMCs were stimulated with 1 pg / mL of anti-human CD28 (BD Pharmingen) in suspension and1 pg / mL of anti-human CD3 clone SP34 (BD Pharmingen) bound to a plate pre-coated with 5 pg / mL anti-mouse IgG Fc (Pierce) for 72 hours at 37 °C / 5 % CO2. Cells were prepared for flow cytometry after 72 hours post thaw for cynomolgus PBMCs and 10 days post thaw for human T cells. Both human T cells and cynomolgus PBMCs were first incubated with hybridoma supernatants, positive control antibodies and isotype control antibodies. Following wash steps, cells were then incubated with Alexa Fluor 647 AffiniPure F(ab’)2 Fragment Goat Anti-Human IgG Fc (Jackson ImmunoReserach) at 5 pg / mL and 8.25 nM YoProl (Invitrogen). Anti-human CD4 conjugated to the Pacific Blue fhiorophore (BioLegend) was also included for cynomolgus PBMCs in order to gate on the T cell population. Cells were then run-on BD FACSCanto II flow cytometer to detect CD30L antibody binding. Geometric Mean Fluorescence Intensity (gMFI) values were obtained for fluorescent antibody labeled human and cyno PBMCs. These values were divided by those obtained with unlabeled PBMCs to derive a value representing the fold binding over isotype control.Table 2. CD30L antibodies binding PBMC

[0099] These data demonstrate that hybridoma supernatants containing antibodies of the present disclosure bind to endogenously expressed human and cynomolgus CD30L expressed on primary T-cells.Example 3: Affinity of anti-CD30L Antibodies

[0100] Hybridoma supernatants containing Antibody clone 46183 or Antibody clone 46265 were evaluated by a Kinetic Exclusion Assay (KinExA) for their affinity to native cynomolgus CD30L transiently expressed on 293 T cells or to native human CD30L expressed on Ramos cells.

[0101] KinExA was performed in which the Koir was determined from the concentration of free antibody that remains in solution after equilibrium has been established between the antibody and the cell-surface-expressed antigen. KinExA provides a more sensitive determination of binding affinity for the native form of CD30L compared to soluble CD30L. The Kinetic Exclusion Assay method was performed as essentially described in Rathanaswami et al. Anal. Biochem: 373(1): 52-60 (2008).

[0102] Briefly, equilibrium sets were set up for each antibody using either human CD30L-expressing Ramos cells or cynomolgus monkey CD30L-expressing 293T cells. The cells were counted using a hemocytometer. The Ramos cells were titrated and incubated with two different constant antibody concentrations, one at 48 pM and the other at 2 nM, in HUT media (RPMI 1640, 10% FBS, 10 mM HEPES, 2 mM L-Glut, 1 mM Sod. Pyr, 0.1 mM NEAA, 50 pM 2-ME) with 0.05% Sodium Azide. For the high [Ab] equilibrium set, Ramso cells were titrated from 25 million per milliliter concentration 1 :2 for 10 points in eppendorf tubes and equilibrated with 1 nM antibody in a total volume of 400 pl. For the low [Ab] equilibrium set, Ramos cells were titrated from 3.89 million per milliliter concentration, 1 :2 for 10 points in 50 ml Fulcon tubes and equilibrated with 20-30 pM antibody in a total volume of 15.5 mL.

[0103] The cyno CD30L-expressing 293T cells were titrated and incubated with two different constant antibody concentrations, one at 118 pM and the other at 5 nM, in 293 T media (Freestyle expression 293T media with 2% FBS and 50 pg / ml G418) with 0.05% Sodium Azide. For the high [Ab] equilibrium set, 293T cells were titrated from 25 million per milliliter concentration 1 :3 for 10 points in eppendorf tubes and equilibrated with 5 nM antibody in a total volume of 200 pl. For the low [Ab] equilibrium set, 293T cells were titrated from 0.98 million per milliliter concentration 1 :3 for 10 points in 15 ml Fulcon tubes and equilibrated with 118 pM antibody in a total volume of 10.2 mL. For each equilibrium set, reference point controls included a sample with cell media only and a sample without cells. The equilibrium sets were incubated for 24 hours at room temperature, with shaking. After 24 hours of incubation, the supernatants were separated from the cell pellets via centrifugation at 500xg for five minutes. The supernatants of both high [Ab] and low [Ab] equilibrium sets were then run through a KinExA 3200 machine.

[0104] Each equilibrium sample set was read in duplicate on the KinExA machine. For low [Ab] equilibrium samples, 6.8 mL and 4.6 mL of each sample were run in duplicate, respectively, for human and cyno CD30L equilibrium experiments. For high [Ab] equilibrium samples 16 pL and 75 pL of each sample were run in duplicate, respectively for human and cyno CD30L equilibrium experiments.

[0105] PMMA (Polymethyl Methacrylate Particles) beads were coated with goat antihuman Fc Ab or Goat anti-hlgG (Fl+L) Ab and subsequently blocked with a blocking solution (IxPBS pF17.4+10mg / mLBSA+0.05% SodiumAzide). For each equilibrium sample the free [Ab] was detected by running the equilibrium samples through the coated beads followed by a quick wash with the running buffer (IxPBS +1% BSA+0.05% Sodium Azide). The secondary detection antibody (goat anti-huIgG (Fl+L) Alexa 647) was run through the flow cell at 680 ng / mL and500 pL per run. The KinExA voltage output signal was used in KinExA software to calculate the Kd. From the plots at two different initial total [Ab] concentrations the Krf was obtained from curve fitting using n-curve analysis in KinExA Pro software version 4.3.11 (Sapidyne Instruments Inc.). The 95% confidence interval was given as Kd low and Kd high. Results are shown in Table 3.

[0106] These data demonstrate that the antibodies of the present disclosure bind to human CD30L and Cyno CD30L with high affinity.Table 3. Affinity of CD30L antibodies to human and cyno CD30L (shown are Kd with their respective 95% CI determined)Example 4: Antibody-mediated Functional Activity

[0107] Antibodies were tested for the ability to block Ramos cell line (endogenous expression of CD30L)-dependent stimulation of K299 cell line (endogenous expression of CD30) production of Interleukin 8 (IL-8). Abs were prepared in the Assay Medium (RPMI1640 with 10% FBS and 2mM L-Glut), starting at 80nM with 1 :5 dilutions steps, and loaded into the flatbottom 96-well plates, 50ul / well (20nM final start concentration).

[0108] CD30L-expressing Ramos cells were prepared at 10 million / ml in the Assay Medium and added to the anti-CD30L antibodies at 50 pl / well, resulting in 500,000 cells / well. CD30-expressing Karpas-299 cells were prepared at 1 million / ml in the Assay medium and added to the wells containing test Abs and Ramos cells, lOOul / well, resulting in 100,000 cells / well, Ramos :Karpas-299 5: 1 ratio.

[0109] The cells and anti-CD30L antibodies were incubated overnight at 37°C 5% CO2. At the end of incubation supernatants were collected and induced IL8 secretion measured using R&D IL8 ELISA kits. Results are shown in Table 4.

[0110] These data demonstrate that the antibodies of the present disclosure inhibit CD30L induced IL-8 secretion with IC50 values in the picomolar range.Table 4. Inhibition of IL-8 production by CD30L antibodiesExample 5: YTE engineered Fc domains display enhanced interaction with FcRn

[0111] Standard running buffers were as follows: 20 mM MES / HC1, 140 mM NaCl, pH = 5.5 (Buffer A); 20 mM Tris / HCl, 140 mM NaCl, pH = 8.8 (Buffer B). Briefly, each analyte was diluted to 0.5 mg / mL in Buffer A with a minimum 5-fold dilution where possible. Gradient elution was performed after injecting 20 pL of analyte onto a pre-equilibrated column in 20% Buffer B. Gradient conditions were from 20 to 100% Buffer B over 80 minutes after a 10 minute loading, and followed by a 10 minute 100% B wash before a rapid 3 minute return to 20% Buffer B. An antibody without YTE (YTE negative control) and an antibody with YTE (YTE positive control) were used to normalize the retention times (r.t.) of the analytes (Analyte r.t. - YTE negative control r.t.) / ( YTE positive control - YTE negative control r.t.). Data were fit in OriginPro (OriginLab, Northampton, MA) to a Gaussian function after baseline subtraction, and the resultant peak retention time and full width half maximum (FWHM) were obtained from the fitted data. Trel indicates time to elution. A Trel between zero (YTE negative control) and one (YTE positive control) indicates reduced interaction with FcRn. trel= (tsample- tstandardl) / (tstandard2- tstandardi)- Results are shown in Table 5.Table 5. Anti-CD30L antibodies with YTE interactions with FcRnExample 6: YTE engineered Fc domains extend in vivo half-life.

[0112] Mouse PK study was conducted in male huFcRn transgenic line 32 Homozygous mice. The anti-CD30L antibodies with and without YTE mutation were formulated in 10 mM sodium acetate with 9% sucrose, pH 5.2. Mice received a single 1 mg / kg injection with the appropriate test article via the lateral tail vein injection. Blood samples were collected at predetermined time points up to 42 days by submandibular venipuncture. Whole blood was collected, placed into Microvette® 500 pl, K3 EDTA plasma separator tubes (20.1341.102,Sarstedt, Newton, NC), gently mixed by 8-10 manual inversions, and centrifuged at 11,500 x g at 4°C for 5 minutes. The resulting plasma was stored at -70°C (±10°C) until analysis.

[0113] Concentrations of anti-CD30L antibody in mouse plasma specimens were determined by ELISA specific for intact full-length test article with a biotinylated mouse antihuman IgG Fc 1.35.1 mAb (Amgen, PL-50510) as the capture reagent and biotinylated recombinant Human CD30 Ligand / TNFSF8 Protein (R&D Systems, 1028-CL-050) followed by a streptavidin-horseradish peroxidase conjugate (R&D Systems, Inc., Minneapolis, MN) as the detection reagents. Analyte serum concentrations were interpolated from a standard curve using the corresponding analytes, 46265-2 and 46183-1. The LLOQ for the assay in serum was 0.61 ng / mL. The ULOQ for the assay in serum was 10000 ng / mL. Sample concentrations were interpolated from a standard curve fit to a four-parameter logistic model using Watson LIMS (v7.4; Thermo Fisher). PK parameters were estimated from individual plasma concentration- nominal time data by noncompartmental analysis using Phoenix® WinNonlin® (v6.4; Certara, Princeton, NJ). Results are shown in Table 6.

[0114] These data demonstrate anti-CD30L antibodies engineered with YTE Fc domains displayed a prolonged half-life consistent with a YTE engineering in the Fc.Table 6. Half-life of CD30L antibodies with or without YTEExample 7: Anti-CD30L antibodies decrease antibody responses to immunization

[0115] Eight week old female Balb / c mice were immunized by intraperitoneal injection with 100 pg 2,4,6-Trinitropheyl-haptenated ovalbumin (TNP-ova) antigen precipitated with alum (InVivoGen) delivered in 200 pl PBS. 3 weeks after immunization, mice were treated with anti- muCD30L-muIgGl (clone Ml 5) or muIgGl isotype control, N=5 mice per group. Ml 5 is a mouse effector functionless anti-mouse CD30L antibody surrogate for the two antibodies described herein, with comparable in vitro affinity and potency. One day after treatment mice were challenged with 100 pg TNP-ova in alum. Seven days after antigen challenge, mice wereeuthanized and serum collected. Serum was also collected from naive unimmunized mice. IgE and IgG antibody titers were assessed by ELISA. Results are shown in Table 7.

[0116] These data demonstrate that administration of the murine surrogate anti-CD30L antibody reduced of both IgE (associated with type 2 inflammatory responses) and IgG antibody (associated with type 1 inflammatory responses) concentrations as compared to control.Table 7. IgE and IgG titers in vivoExample 8: CD30L in a Mouse Airway Inflammation Model

[0117] Eight week old female Balb / c mice were immunized by intraperitoneal injection with 100 pg ovalbumin (ova) antigen precipitated with alum (InVivoGen). Two weeks after immunization, mice were treated with anti-murine CD30L antibody Ml 5, or IgGl isotype control, N=5 mice per group. Mice were treated twice weekly until the end of study. Starting one day after the first treatment, mouse airways were inflamed by administration of ovalbumin intranasally for three consecutive days each week for three weeks. Four days after the final airway challenge, mice were euthanized and tissues collected. Tissues were also collected from naive unimmunized mice as controls. Blood was collected into serum separator tubes (GE healthcare) and processed according to manufacturers instructions. Serum was frozen at -20 degrees C. Serum was thawed at later timepoints for analysis by ELISA for IgE and IgG antibody titers. Lungs were perfused with PBS before collection. Perfused lungs were processed into single cell suspensions using Miltenyi C tubes and passed through a 100 pm cell strainer. Viable cells were counted and 1x10A6 cells were stained with an antibody panel for flow cytometry analysis. After excluding non-viable cells with a Live / Dead staining reagent, eosinophils, B cells, and T cells were enumerated using standard lineage markers. Results are shown in Table 8.

[0118] These data demonstrate that as compared to control, administration of the murine surrogate anti-CD30L antibody demonstrated a reduction in lung infiltration of eosinophils (associated with type 2 inflammation), B cells, and T cells and showed reduced antibody titers for IgE and IgG isotypes in this mouse airway inflammation model.Table 8. Efficacy of an anti-murine CD30L antibody in vivoSEQUENCES

Claims

CLAIMSWe claim:

1. An antibody that binds CD30L comprising: a. an HCDR1 comprising SEQ ID NO: 1, HCDR2 comprising SEQ ID NO: 2, HCDR3 comprising SEQ ID NO: 3, LCDR1 comprising SEQ ID NO: 4, LCDR2 comprising SEQ ID NO: 5, and LCDR3 comprising SEQ ID NO: 6; or b. an HCDR1 comprising SEQ ID NO: 7, HCDR2 comprising SEQ ID NO: 8, HCDR3 comprising SEQ ID NO: 9, LCDR1 comprising SEQ ID NO: 10, LCDR2 comprising SEQ ID NO: 11, and LCDR3 comprising SEQ ID NO: 12.

2. The antibody of claim 1, wherein the antibody comprises the HCDR1 comprising SEQID NO: 1, the HCDR2 comprising SEQ ID NO:2, the HCDR3 comprising SEQ ID NO: 3, the LCDR1 comprising SEQ ID NO: 4, the LCDR2 comprising SEQ ID NO: 5 and the LCDR3 comprising SEQ ID NO: 6.

3. The antibody of claim 1, wherein the antibody comprises the HCDR1 comprisingSEQ ID NO: 7, the HCDR2 comprising SEQ ID NO: 8, the HCDR3 comprising SEQ ID NO: 9, the LCDR1 comprising SEQ ID NO: 10, the LCDR2 comprising SEQ ID NO: 11, and the LCDR3 comprising SEQ ID NO: 12.

4. The antibody of any of claims 1-3 comprising a. a heavy chain variable region (HCVR) comprising SEQ ID NO: 19, or variant thereof comprising an amino acid sequence having at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 19 and a light chain variable region (LCVR) comprising SEQ ID NO: 20 or a variant thereof comprising an amino acid sequence having at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 20; or b. a HCVR comprising SEQ ID NO: 23, or a variant thereof comprising an amino acid sequence having at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO:23 and a LCVR comprising SEQ ID NO: 24, or a variant thereof comprising an amino acid sequence having at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 24.

5. The antibody of any of claims 1, 2, or 4 comprising the HCVR comprising SEQ ID NO:19 and the LCVR comprising SEQ ID NO: 20.

6. The antibody of any of claims 1, 3, or 4 comprising the HCVR comprising SEQ ID NO:23 and the LCVR comprising SEQ ID NO: 24.

7. The antibody of any of claims 1-6, comprising: a. a heavy chain (HC) comprising SEQ ID NO: 25, and a light chain (LC) comprising SEQ ID NO: 26, or b. a HC comprising SEQ ID NO: 29, and a LC comprising SEQ ID NO: 30.

8. The antibody of any of claims 1, 2, 4, 5 or 7 comprising the HC comprising SEQ IDNO:25 and the LC comprising SEQ ID NO: 26.

9. The antibody of any of claims 1, 3, 4, 6, or 7 comprising the HC comprising SEQ IDNO: 29 and the LC comprising SEQ ID NO: 30.

10. The antibody of any one of claims 1-9, comprising: a. two HC, each HC comprising SEQ ID NO: 25, and two LC, each LC comprising SEQ ID NO: 26; or b. two HC, each HC comprising SEQ ID NO: 29, and two LC, each LC comprising SEQ ID NO: 30.

11. The antibody of any of claims 1, 2, 4, 5, 7, 8 or 10 comprising two HC, each HC comprising SEQ ID NO: 25 and two LC, each LC comprising SEQ ID NO 26.

12. The antibody of any of claims 1, 3, 4, 6, 7, 9 or 10 comprising two HC, each HC comprising SEQ ID NO: 29 and two LC, each LC comprising SEQ ID NO: 30.

13. An anti-CD30L antibody comprising a heavy chain comprising SEQ ID NO: 29 and a light chain comprising SEQ ID NO: 30.

14. An anti-CD30L antibody comprising a heavy chain comprising SEQ ID NO: 25 and a light chain comprising SEQ ID NO: 26.

15. An anti-CD30L antibody comprising a. a HC comprising SEQ ID NO: 33 and a LC comprising SEQ ID NO: 30; b. a HC comprising SEQ ID NO: 36 and a LC comprising SEQ ID NO: 30; c. a HC comprising SEQ ID NO: 39 and a LC comprising SEQ ID NO: 30; d. a HC comprising SEQ ID NO: 31 and a LC comprising SEQ ID NO: 26; e. a HC comprising SEQ ID NO: 34 and a LC comprising SEQ ID NO: 26; or f. a HC comprising SEQ ID NO: 37 and a LC comprising SEQ ID NO: 26.

16. The antibody of any of claims 1-15, wherein the antibodya. binds to human CD30L with a dissociation constant (KD) value of less than 100, 75 or 50 picomolar as measured by a surface plasma resonance technique or a kinetic exclusion assay; b. binds to cynomolgus CD30L with a KD value of less 100, 75 or 50 picomolar as measured by a surface plasma resonance technique or a kinetic exclusion assay; c. binds to human CD30L and cynomolgus CD30L within 10-fold affinity of one another; d. blocks the binding of human CD30L to human CD30 as determined by a cell based assay; or e. inhibits CD30L induced IL-8 secretion as determined by a cell based assay.

17. A method of treating an inflammatory disorder in a patient comprising administering an effective amount of the antibody of any one of claims 1-16 to the patient.

18. The method of claim 17, wherein the inflammatory disorder is asthma.

19. The method of claim 17, wherein the inflammatory disorder is lupus.

20. The method of claim 17, wherein the inflammatory disorder is ulcerative colitis.

21. A polynucleotide encoding: a HCVR; LCVR; both a HCVR and a LCVR; a LC; a HC; or both a HC and a LC of an antibody that binds CD30L, wherein the antibody comprises a. an HCDR1 comprising SEQ ID NO: 1, HCDR2 comprising SEQ ID NO: 2, HCDR3 comprising SEQ ID NO: 3, LCDR1 comprising SEQ ID NO: 4, LCDR2 comprising SEQ ID NO: 5, and LCDR3 comprising SEQ ID NO: 6; or b. an HCDR1 comprising SEQ ID NO: 7, HCDR2 comprising SEQ ID NO: 8, HCDR3 comprising SEQ ID NO: 9, LCDR1 comprising SEQ ID NO: 10, LCDR2 comprising SEQ ID NO: 11, and LCDR3 comprising SEQ ID NO: 12.

22. The polynucleotide of claim 21, wherein the antibody comprises the HCDR1 comprising SEQ ID NO: 1, the HCDR2 comprising SEQ ID NO: 2, the HCDR1 comprising SEQ ID NO: 3, the LCDR1 comprising SEQ ID NO: 4, the LCDR2 comprising SEQ ID NO: 5, and the LCDR3 comprising SEQ ID NO: 6.

23. The polynucleotide of claim 21, wherein the antibody comprises the HCDR1 comprising SEQ ID NO: 7, the HCDR2 comprising SEQ ID NO: 8, the HCDR1comprising SEQ ID NO: 9, the LCDR1 comprising SEQ ID NO: 10, the LCDR2 comprising SEQ ID NO: 11, and the LCDR3 comprising SEQ ID NO: 12.

24. The polynucleotide of claim 21 or 22 encoding the LC of the antibody, wherein the amino acid sequence of the LC comprises SEQ ID NO: 26.

25. The polynucleotide of claim 21 or 22 encoding the HC of the antibody, wherein the amino acid sequence of the HC comprises SEQ ID NO: 25.

26. The polynucleotide of claim 21 or 22 encoding the HC and the LC of the antibody, wherein the amino acid sequence of the HC comprises SEQ ID NO: 25 and the amino acid sequence of the LC comprises SEQ ID NO: 26.

27. The polynucleotide of claim 21 or 23 encoding the LC of the antibody, wherein the amino acid sequence of the LC comprises SEQ ID NO: 30.

28. The polynucleotide of claim 21 or 23 encoding the HC of the antibody, wherein the amino acid sequence of the HC comprises SEQ ID NO: 29.

29. The polynucleotide of claim 21 or 23 encoding the HC and the LC of the antibody, wherein the amino acid sequence of the HC comprises SEQ ID NO: 29 and the amino acid sequence of the LC comprises SEQ ID NO: 30.

30. The polynucleotide of claim 21, 22, 25 or 26, wherein the polynucleotide that encodes the antibody HC comprises SEQ ID NO: 21.

31. The polynucleotide of claim 21, 22, 24, or 26, wherein the polynucleotide that encodes the antibody LC comprises SEQ ID NO: 18.

32. The polynucleotide of claim 21, 23, 28 or 29, wherein the polynucleotide that encodes the antibody HC comprises SEQ ID NO: 17.

33. The polynucleotide of claim 21, 23, 27 or 29, wherein the polynucleotide that encodes the antibody LC comprises SEQ ID NO: 16.

34. A vector comprising one or more polynucleotide of any of claims 21-33.

35. A host cell comprising one or more polynucleotide of any of claims 21-33 or the vector of claim 34.

36. A process for producing an anti-CD30L antibody comprising two HCs and two LCs, wherein the process comprises cultivating the host cell of claim 35 under conditions such that the antibody is expressed and recovering the expressed antibody.

37. The process of claim 36, wherein the HC comprises the amino acid of SEQ ID NO: 25 and the LC comprises the amino acid sequence of SEQ ID NO: 26.

38. The process of claim 36, wherein the HC comprises the amino acid sequence of SEQ IDNO: 29 and the LC comprises the amino acid sequence of SEQ ID NO: 30.

39. An antibody obtainable by the process of claim 37.

40. An antibody obtainable by the process of claim 38.

41. The antibody of any one of claims 1-16, 39 or 40 for use in treating an inflammatory disorder.

42. The antibody of claim 41 for use in treating an inflammatory disorder, wherein the inflammatory disorder is asthma, lupus or ulcerative colitis.

43. The use of the antibody of any one of claims 1-16, 39 or 40 for the manufacture of a medicament for the treatment of an inflammatory disorder.

44. The use of claim 43, wherein the inflammatory disorder is asthma, lupus, or ulcerative colitis.

45. A pharmaceutical composition comprising the antibody of any one of claims 1-16, 39 or40, and one or more pharmaceutically acceptable carriers, diluents, or excipients.