Compositions and methods for treating muscle disorders

Abstract

The present invention discloses approaches to modulating DUX-4 expression in a cell using novel miRNA molecules.

Description

[0001] Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application COMPOSITIONS AND METHODS FOR MUSCLE DISORDERS Field of the Invention The invention related to miRNA molecules. Background Genetic disorders are a major source of disease burden, and many of them have few or no medical or curative treatments. Along with other genetically linked muscle wasting disorders, Facioscapulohumeral Muscular Dystrophy (“FSHD”) is a genetic disorder that causes progressively increasing weakness and atrophy of the muscles. FSHD is so named because the muscles in the face, shoulder, and upper arm are the most affected, but it also affects other muscles in the body, including the legs, eyes, heart, hip, or abdominal muscles. FSHD causes progressively worsening symptoms that may result in asymmetric weakness FSHD is a genetic disorder caused by a genetic mutation that leads to inappropriate expression of the DUX4 gene on chromosome 4. DUX4 is the double homeobox protein 4 gene. FSHD can be inherited by just one parent because it is an autosomal dominant genetic disorder. FSHD often affects patients before the age of 20 and has an estimated prevalence in the United States of 4 cases per 100,000 individuals. There is currently no medical treatment to arrest or reverse the muscular effects of FSHD. Summary The present invention provides novel nucleic acid molecules and methods that result in changes to expression of DUX4 that result in treatment of FSHD. Nucleic acid molecules of the invention comprise an miR scaffold and a miR guide sequence that targets a double homeobox 4 (DUX4) transcript. By targeting DUX4 transcripts, the nucleic acid molecules of the invention result in an appropriate expression profile for the DUX4 gene. In aspects of the invention, the nucleic acid molecule may comprise an miRNA guide sequence having at least 95% sequence identity to a sequence selected from SEQ ID NOs: 1250- 2769 or 6687-6770. The nucleic acid molecule may comprise one or more substitutions, for example conservative substitutions, that allow the guide sequence to continue to target DUX4. Accordingly, the miRNA guide sequence may have at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to a sequence selected from SEQ ID NOs: 1250-2597 or 6687- Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application 6770. In aspects of the invention, the nucleic acid molecule comprises a miRNA guide sequence selected from SEQ ID NOs: 1250-2769 or 6687-6770. The nucleic acid molecule may comprise an miRNA having at least 95% sequence identity to a sequence selected from the group of SEQ ID NOs: 2770-3597 or 6670-6812, each of which incorporates a guide sequence targeting DUX4. The nucleic acid molecule may target a DUX4 transcript at the position shown in Table 6. The miRNA scaffold may be derived selected from any pri-miRNA scaffold. For example, the miRNA scaffold is derived from the pri-miRNA selected from the group consisting of pri-miR-21, pri-miR-22, pri-miR-26a, pri-miR-30a, pri-miR-33, pri-miR-122, pri-miR-375, pri-miR-199, pri-miR-99, pri-miR-194, pri-miR-155, and pri-miR-451. The miRNA scaffold may be derived from pri-miR-33. The nucleic acid may comprise 5-6 thymidines at the 5’ end. The nucleic acid of claim 1, further comprising a promoter sequence. The promoter sequence may be a U6 promoter sequence, MHCK7 promoter sequence, CK6 promoter sequence, tMCK promoter sequence, CK5 promoter sequence, MCK promoter sequence, HAS promoter sequence, MPZ promoter sequence, desmin promoter sequence, APOA2 promoter sequence, hAAT promoter sequence, INS promoter sequence, IRS2 promoter sequence, MYH6 promoter sequence, MYL2 promoter sequence, TNNI3 promoter sequence, SYN1 promoter sequence, GFAP promoter sequence, NES promoter sequence, MBP promoter sequence, or TH promoter sequence. Nucleic acid molecules of the invention may be delivered to cells by any known method, for example, nucleic acid molecules of the invention may be delivered by lipid nanoparticles (LNP) or viral vectors. The viral vector may be any viral vector, for example an adeno- associated virus (AAV) vector. Accordingly, aspects of the invention provide an AAV vector comprising a promoter sequence, a nucleic acid molecule of the invention (comprising a miR scaffold and a miR guide sequence that targets a DUX4 transcript), and a capsid protein. The viral vector may comprise at least one modification that results in reduced liver- tropism of the AAV vector and / or preferential targeting of the AAV vector to muscle tissue. The capsid protein may comprise at least one modification that is an insertion between any two contiguous amino acids between amino acids 262-269, 327-332, 382-386, 452-460, 488-505, 527-539, 545-558, 581-593, 704-714, or any combination thereof in an AAV9 capsid Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application polypeptide or in an analogous position in an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV rh.74, AAV rh.10 capsid polypeptide. The capsid protein may be selected from the sequences in Tables 1-5. The vector may further comprise a nuclear export sequence enabling nuclear spreading. Aspects of the invention also provide methods for inhibiting expression of a gene or gene product in a cell, the method comprising administering to a subject a composition that results in expression within the cell of a nucleic acid molecules of the invention (comprising a miR scaffold and a miR guide sequence that targets a DUX4 transcript). In methods of the invention, nucleic acid molecules of the invention may be delivered to cells by any known method. In preferred aspects, the nucleic acid molecules may be delivered by AAV vectors. Advantageously, the AAV vectors may comprise at least one modification results in reduced liver-tropism of the AAV vector and / or preferential targeting of the AAV vector to muscle tissue. The AAV vectors may comprise a capsid protein selected from the sequences in Tables 1-5. The methods of the invention may result in treatment of muscular dystrophy. The muscular dystrophy is Facioscapulohumeral Muscular Dystrophy 1. The treatment may comprise arresting the muscular effects of muscular dystrophy. The treatment may comprise reversing the muscular effects of the muscular dystrophy. Aspects of the nucleic acid molecules (e.g. cargo) and capsid proteins are described in further detail below. For sequences disclosed throughout this application, it is understood that nucleic acid molecules and peptides may comprise one or more substitutions, for example conservative substitutions, that allow sequences to continue to function. Accordingly, sequences may have at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the sequence disclosed. A conservative substitution refers to amino acid substitutions that do not significantly affect or alter binding characteristics of a particular protein. Generally, conservative substitutions are ones in which a substituted amino acid residue is replaced with an amino acid residue having a similar side chain. For example, conservative substitutions may include a substitution found in one of the following groups: Group 1: Alanine (Ala or A), Glycine (Gly or G), Serine (Ser or S), Threonine (Thr or T); Group 2: Aspartic acid (Asp or D), Glutamic acid (Glu or Z); Group 3: Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application Asparagine (Asn or N), Glutamine (Gln or Q); Group 4: Arginine (Arg or R), Lysine (Lys or K), Histidine (His or H); Group 5: Isoleucine (Ile or I), Leucine (Leu or L), Methionine (Met or M), Valine (Val or V); and Group 6: Phenylalanine (Phe or F), Tyrosine (Tyr or Y), Tryptophan (Trp or W). Additionally, or alternatively, amino acids can be grouped into conservative substitution groups by similar function, chemical structure, or composition (e.g., acidic, basic, aliphatic, aromatic, or sulfur-containing). For example, an aliphatic grouping may include, for purposes of substitution, Gly, Ala, Val, Leu, and Ile. Other conservative substitutions groups include sulfur- containing: Met and Cysteine (Cys or C); acidic: Asp, Glu, Asn, and Gln; small aliphatic, nonpolar, or slightly polar residues: Ala, Ser, Thr, Pro, and Gly; polar, negatively charged residues and their amides: Asp, Asn, Glu, and Gln; polar, positively charged residues: His, Arg, and Lys; large aliphatic, nonpolar residues: Met, Leu, Ile, Val, and Cys; and large aromatic residues: Phe, Tyr, and Trp. Engineered capsid proteins The present invention provides capsid protein variants for viral vectors that detarget liver tissue and target skeletal muscle and heart tissue at the same time that may be used to deliver nucleic acid molecules of the invention that comprise an miR scaffold and a miR guide sequence that targets a double homeobox 4 (DUX4) transcript. Aspects of the invention provide adeno-associated virus (AAV) vectors comprising a capsid protein comprising an amino acid insert. For example, the capsid protein may comprise an insert selected from Table 1-5. Aspects of the present invention provide an AAV vector comprising a capsid protein comprising the amino acid sequence RGDR. In the capsid protein, RGDR may be inserted after amino acid 455 in reference to an AAV9 capsid or equivalent position in another AAV capsid. AAV vectors may comprise the amino acid sequence X1NX2X3X4RGDRX5X6L, wherein X1, X2, X3, X4, X5, and X6 may be any amino acid. In aspects of the invention, X1may be an amino acid selected from the group consisting of: A, I, F, G, H, L, M, Q, S, T, V. In preferred aspects of the invention, X1may be an amino acid selected from the group consisting of: A, I, L, M, S, V. In aspects of the invention, X2 may be an amino acid selected from the group consisting of A, G, S, T, Y. Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application In aspects of the invention, X3may be an amino acid selected from the group consisting of S, N, G, P. In preferred aspects of the invention, X3 may be S. In aspects of the invention, X4 may be an amino acid selected from the group consisting of A, G, H, I, M, S, T, V. In aspects of the invention, X5 may be an amino acid selected from the group consisting of A, G, Q. In aspects of the invention, X6may be an amino acid selected from the group consisting of A, I, L, M, N, Y. In preferred aspects of the invention, X6may be selected from the group consisting of A, S, and Y. X1 may is located at amino acid 451, X2 located at amino acid 453, X3 located at amino acid 454, X4is located amino acid 455, and RGDRX5X6L inserted after amino acid 455 in reference to an AAV9 capsid or equivalent position in another AAV capsid. In aspects of the invention, two amino acids from X1, X2, X3, and X4 are wild type amino acids in reference to an AAV9 capsid or equivalent position in another AAV capsid and two amino acids from X1, X2, X3, and X4 are not wild type amino acids. For example, capsid proteins variants of the invention may comprise a sequence as set forth in Table 5a. Notably, capsid protein variants on the invention comprise deletions, substitutions, and / or insertions relative to wild-type viral vector capsids. In aspects of the invention, the capsid protein comprises an amino acid sequence selected from Table 5a and the amino acid sequence is in hypervariable region IV (HVR IV) relative to wild-type AAV9. The capsid protein variant may comprise substitutions at amino acids 451-455 relative to a wild-type AAV9 vector capsid. For example, the substitutions at amino acids 451- 455 relative to a wild-type AAV9 vector capsid may be an amino acid sequence selected from column 1 of Table 5b. In aspects of the invention, the capsid protein variant may further comprise an insert. For example, the capsid protein may comprise a 7-mer insert selected from column 2 of Table 5b. The insert may be in the location after amino acid 455 relative to a wild- type AAV9 vector. Advantageously, viral vectors comprising an amino acid sequence of the invention exhibit muscle tropism as compared to a wild-type AAV vector. Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application In aspects of the invention, the capsid protein further comprises a deletion of G267 in reference to an AAV9 capsid or equivalent position in another AAV capsid. Advantageously, the vector may exhibit reduced liver tropism as compared to a wild-type AAV vector. As described, for the HVR IV variants, the 5 amino acids upstream are at positions 451- 455, shown in column 1 of Table 5b. The 7-mer insert for HVR IV variants starts with "RGD" and is inserted after amino acid 455, shown in column 2 of Table 5b. Exemplary guides and capsids The present invention provides novel nucleic acid molecules and methods that result in changes to expression of DUX4 that result in treatment of FSHD. Nucleic acid molecules of the invention comprise an miR scaffold and a miR guide sequence that targets a double homeobox 4 (DUX4) transcript. By targeting DUX4 transcripts, the nucleic acid molecules of the invention result in an appropriate expression profile for the DUX4 gene. Preferential exemplary guides are described in Table 7 below. In exemplary aspects of the invention, the guide sequence may comprise a sequence having at least 95% sequence identity to a sequence selected from SEQ ID NOs: 6860-6865. For example, SEQ ID NOs: 6860, 6861, 6862, 6863, 6864, or 6865. The nucleic acid molecule may comprise an miRNA having at least 95% sequence identity to a sequence selected from the group of SEQ ID NOs: 2770-3597 or 6670-6812, each of which incorporates a guide sequence targeting DUX4. The nucleic acid molecule may target a DUX4 transcript at a position shown in Table 6 (with exemplary guide sequences described in Table 7). In preferred aspects of the invention, the miRNA guide sequence comprises a sequence having at least 95% sequence identity to a sequence selected from SEQ ID NO: 1250-2769, SEQ ID NOs: 6855-6963, SEQ ID NOs: 6855-6955, SEQ ID NOs: 6855-6945, SEQ ID NOs: 6855- 6935, SEQ ID NOs: 6855-6925, SEQ ID NOs: 6855-6915, SEQ ID NOs: 6855-6905, SEQ ID NOs: 6855-6895, SEQ ID NOs: 6855-6885, SEQ ID NOs: 6855-6875, SEQ ID NOs: 6855-6870, SEQ ID NOs: 6855-6865, or SEQ ID NOs: 6860-6865. For example, SEQ ID NO: 6861, 6862, 6863, 6864, or 6865, for example, SEQ ID NOs: 6860, 6861, 6862, 6863, 6864, or 6865. Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application In preferred aspects of the invention, the guide sequence may be encapsidated in an AAV vector comprising an engineered AAV vector capsid. The vector capsid may be engineered from an AAV9 capsid protein. The AAV vector capsid may comprise an amino acid sequence as shown as described in Tables 1-5 below, with Table 5a / b describing preferred engineered capsid sequences. In exemplary aspects of the invention, the capsid may comprise a sequence selected from among SEQ ID NO: 4479, 4486, 4487, 4503, 4544, 4667, 4832, 4838, or 5036. In aspects of the invention, the capsid protein may comprise a sequence selected from among sequences 4470-4490, 4500-4520, 4540-4560, 4660-4680, 4830-4850, 5630-5650. The capsid may comprise a sequence selected from among sequences 4475-4480, 4480- 4490, 4500-4510, 4540-4550, 4660-4670, 4830-4840, 5030-5040. The capsid may comprise a sequence selected from among sequences 4475-4480, 4485- 4490, 4500-4505, 4540-4545, 4665-4670, 4830-4835, 5035-5040, for example SEQ ID NO: 4479, 4486, 4487, 4503, 4544, 4667, 4832, 4838, or 5036. Altogether, exemplary guide miRNAs (for example as part of a construct) may be encapsidated by exemplary capsids described herein. For example: In exemplary aspects of the invention, the guide sequence may comprise a sequence having at least 95% sequence identity to a sequence selected from SEQ ID NOs: 6860, 6861, 6862, 6863, 6864, or 6865. The guide sequence may be encapsidated by an AAV capsid comprising a sequence selected from among SEQ ID NO: 4479, 4486, 4487, 4503, 4544, 4667, 4832, 4838, or 5036. For example, exemplary miRNA guide sequences may be encapsidated by exemplary engineered capsids as shown below: miRNA Capsid miRNA Capsid miRNA Capsid i E i i i E i i g i E i ing : O: 2038 446 679 326 387 36 Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application miRNA Capsid miRNA Capsid miRNA Capsid guide SEQ comprising guide SEQ comprising guide SEQ comprising ID NO: SEQ ID NO: ID NO: SEQ ID NO: ID NO: SEQ ID NO: 7862 878 036 449 676 327 383 3647 2869 Accordingly, in preferred a spects of the invention, the miRNA guide sequence may comprise a sequence having at least 95% sequence identity to a sequence selected from SEQ ID NO: 1250-2769 and the AAV vector capsid encapsidating the miRNA guide may comprise a sequence selected from Tables 1-5. For example, in embodiments of the invention the miRNA guide sequence may comprise a sequence having at least 95% sequence identity to a sequence selected from SEQ ID NOs: 6855-6963 and the capsid protein encapsidating the miRNA guide may comprise a sequence selected from among sequences 4470-4490, 4500-4510, 4540-4550, 4660-4670, 4830-4840, 5630-5640. In further exemplary aspects of the invention the guide sequence may comprise a sequence having at least 95% sequence identity to a sequence selected from SEQ ID NOs: 6855- 6955 and the capsid protein encapsidating the miRNA guide may comprise a sequence selected from among sequences 4470-4490, 4500-4510, 4540-4550, 4660-4670, 4830-4840, 5630-5640. The guide sequence may comprise a sequence having at least 95% sequence identity to a sequence selected from SEQ ID NOs: 6855-6945 and the capsid protein encapsidating the miRNA guide may comprise a sequence selected from among sequences 4475-4490, 4500-4505, 4540-4505, 4665-4670, 4830-4840, 5035-5040. The guide sequence may comprise a sequence Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application having at least 95% sequence identity to a sequence selected from SEQ ID NOs: 6855-6935 and the capsid protein encapsidating the miRNA guide may comprise a sequence selected from among sequences 4475-4490, 4500-4505, 4540-4505, 4665-4670, 4830-4840, 5035-5040. In further exemplary aspects of the invention, the guide sequence may comprise a sequence having at least 95% sequence identity to a sequence selected from SEQ ID NOs: 6855- 6925 and the capsid protein encapsidating the miRNA guide may comprise a sequence selected from among sequences 4475-4490, 4500-4505, 4540-4505, 4665-4670, 4830-4840, 5035-5040. The guide sequence may comprise a sequence having at least 95% sequence identity to a sequence selected from SEQ ID NOs: 6855-6915 and the capsid protein encapsidating the miRNA guide may comprise a sequence selected from among sequences 4475-4490, 4500-4505, 4540-4505, 4665-4670, 4830-4840, 5035-5040. The guide sequence may comprise a sequence having at least 95% sequence identity to a sequence selected from SEQ ID NOs: 6855-6895 and the capsid protein encapsidating the miRNA guide may comprise a sequence selected from among sequences 4475-4490, 4500-4505, 4540-4505, 4665-4670, 4830-4840, 5035-5040. The guide sequence may comprise a sequence having at least 95% sequence identity to a sequence selected from SEQ ID NOs: 6855-6885 and the capsid protein encapsidating the miRNA guide may comprise a sequence selected from among sequences 4475-4490, 4500-4505, 4540-4505, 4665-4670, 4830-4840, 5035-5040. In further exemplary aspects of the invention, the guide sequence may comprise a sequence having at least 95% sequence identity to a sequence selected from SEQ ID NOs: 6855- 6875 and the capsid protein encapsidating the miRNA guide may comprise a sequence selected from among sequences 4475-4490, 4500-4505, 4540-4505, 4665-4670, 4830-4840, 5035-5040. The guide sequence may comprise a sequence having at least 95% sequence identity to a sequence selected from SEQ ID NOs: 6855-6865 and the capsid protein encapsidating the miRNA guide may comprise a sequence selected from among SEQ ID NO: 4479, 4486, 4487, 4503, 4544, 4667, 4832, 4838, or 5036. In preferred aspects of the invention, the guide sequence may comprise a sequence having at least 95% sequence identity to a sequence selected from SEQ ID NOs: 6860-6865, for example, SEQ ID NOs: 6861, 6862, 6863, 6864, or 6865, and the capsid protein encapsidating the miRNA guide may comprise a sequence selected from among SEQ ID NO: 4479, 4486, 4487, 4503, 4544, 4667, 4832, 4838, or 5036. Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application Table 1: MyoAAV (eMyoAAV) Capsid Variants SEQ SEQ RANK N-MER MOTIF ID ENCODING SEQUENCE ID N N .: Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application SEQ SEQ RANK N-MER MOTIF ID ENCODING SEQUENCE ID NO: NO.: Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application SEQ SEQ RANK N-MER MOTIF ID ENCODING SEQUENCE ID NO: NO.: Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application SEQ SEQ RANK N-MER MOTIF ID ENCODING SEQUENCE ID NO: NO.: Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application SEQ SEQ RANK N-MER MOTIF ID ENCODING SEQUENCE ID NO: NO.: Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application SEQ SEQ RANK N-MER MOTIF ID ENCODING SEQUENCE ID NO: NO.:

[0002] Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application Table 2: Enhanced MyoAAV (eMyoAAV) Capsid Variants RANK N-MER INSERT SEQ ENCODING SEQUENCE SEQ ID ID N N .: Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application RANK N-MER INSERT SEQ ENCODING SEQUENCE SEQ ID ID NO: NO.: Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application RANK N-MER INSERT SEQ ENCODING SEQUENCE SEQ ID ID NO: NO.: Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application RANK N-MER INSERT SEQ ENCODING SEQUENCE SEQ ID ID NO: NO.: Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application RANK N-MER INSERT SEQ ENCODING SEQUENCE SEQ ID ID NO: NO.: Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application RANK N-MER INSERT SEQ ENCODING SEQUENCE SEQ ID ID NO: NO.:

[0003] Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application Table 3: Top Ranking SEQ SEQ Skeletal Muscle Specific n- Variant ID Variant ID : .: mer inserts and / or RGD 2 3 Motifs 3 4 4 5 5 6 SEQ 6 7 Variant ID 7 8 8 9 9 0 0 1 1 2 2 3 3 4 4 5 5 6 6 7 7 8 8 9 9 0 0 1 1 2 2 3 3 4 4 5 5 6 6 7 7 8 8 9 9 0 0 1 1 2 2 3 3 4 4 5 5 6 6 7 7 8 8 9 9 0 0 1 1 2 2 3 Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application SEQ SEQ SEQ Variant ID Variant ID Variant ID : .: 5 6 6 7 7 8 8 9 9 0 0 1 1 2 2 3 3 4 4 5 5 6 6 7 7 8 8 9 9 0 0 1 1 2 2 3 3 4 4 5 5 6 6 7 7 8 8 9 9 0 0 1 1 2 2 3 3 4 4 5 5 6 6 7 7 8 8 9 9 0 0 1 1 2 2 3 3 4 4 5 5 6 Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application SEQ Variant ID

[0004] Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application Table 4: Top Ranking Variant SEQ Variant SEQ Skeletal Muscle Specific n- ID ID : .: mer inserts and / or RGD 7 7 Motifs 8 8 9 9 0 0 Variant SEQ 1 1 ID 2 2 3 3 4 4 5 5 6 6 7 7 8 8 9 9 0 0 1 1 2 2 3 3 4 4 5 5 6 6 7 7 8 8 9 9 0 0 1 1 2 2 3 3 4 4 5 5 6 6 7 7 8 8 9 9 0 0 1 1 2 2 3 3 4 4 5 5 6 6 Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application Variant SEQ Variant SEQ Variant SEQ ID ID ID : .: 7 7 8 8 9 9 0 0 1 1 2 2 3 3 4 4 5 5 6 6 7 7 8 8 9 9 0 0 1 1 2 2 3 3 4 4 5 5 6 6 7 7 8 8 9 9 0 0 1 1 2 2 3 3 4 4 5 5 6 6 7 7 8 8 9 9 0 0 1 1 2 2 3 3 4 4 5 5 6 6 Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application Variant SEQ ID

[0005] Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application Table 5a: HVR IV Capsid SEQ SEQ Amino Acid Sequence ID Amino Acid Sequence ID Variants NO: NO: SEQ 2 56 Amino Acid Sequence ID 3 57 4 58 5 59 6 60 7 61 8 62 9 63 0 64 1 65 2 66 3 67 4 68 5 69 6 70 7 71 8 72 9 73 0 74 1 75 2 76 3 77 4 78 5 79 6 80 7 81 8 82 9 83 0 84 1 85 2 86 3 87 4 88 5 89 Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application SEQ SEQ SEQ Amino Acid Sequence ID Amino Acid Sequence ID Amino Acid Sequence ID NO NO: NO: 4 58 5 59 6 60 7 61 8 62 9 63 0 64 1 65 2 66 3 67 4 68 5 69 6 70 7 71 8 72 9 73 0 74 1 75 2 76 3 77 4 78 5 79 6 80 7 81 8 82 9 83 0 84 1 85 2 86 3 87 4 88 5 89 6 90 7 91 Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application SEQ SEQ SEQ Amino Acid Sequence ID Amino Acid Sequence ID Amino Acid Sequence ID NO NO: NO: 6 60 7 61 8 62 9 63 0 64 1 65 2 66 3 67 4 68 5 69 6 70 7 71 8 72 9 73 0 74 1 75 2 76 3 77 4 78 5 79 6 80 7 81 8 82 9 83 0 84 1 85 2 86 3 87 4 88 5 89 6 90 7 91 8 92 9 93 Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application SEQ SEQ SEQ Amino Acid Sequence ID Amino Acid Sequence ID Amino Acid Sequence ID NO NO: NO: 8 62 9 63 0 64 1 65 2 66 3 67 4 68 5 69 6 70 7 71 8 72 9 73 0 74 1 75 2 76 3 77 4 78 5 79 6 80 7 81 8 82 9 83 0 84 1 85 2 86 3 87 4 88 5 89 6 90 7 91 8 92 9 93 0 94 1 95 Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application SEQ SEQ SEQ Amino Acid Sequence ID Amino Acid Sequence ID Amino Acid Sequence ID NO NO: NO: 0 64 1 65 2 66 3 67 4 68 5 69 6 70 7 71 8 72 9 73 0 74 1 75 2 76 3 77 4 78 5 79 6 80 7 81 8 82 9 83 0 84 1 85 2 86 3 87 4 88 5 89 6 90 7 91 8 92 9 93 0 94 1 95 2 96 3 97 Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application SEQ SEQ SEQ Amino Acid Sequence ID Amino Acid Sequence ID Amino Acid Sequence ID NO NO: NO: 2 66 3 67 4 68 5 69 6 70 7 71 8 72 9 73 0 74 1 75 2 76 3 77 4 78 5 79 6 80 7 81 8 82 9 83 0 84 1 85 2 86 3 87 4 88 5 89 6 90 7 91 8 92 9 93 0 94 1 95 2 96 3 97 4 98 5 99 Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application SEQ SEQ SEQ Amino Acid Sequence ID Amino Acid Sequence ID Amino Acid Sequence ID NO NO: NO: 4 68 5 69 6 70 7 71 8 72 9 73 0 74 1 75 2 76 3 77 4 78 5 79 6 80 7 81 8 82 9 83 0 84 1 85 2 86 3 87 4 88 5 89 6 90 7 91 8 92 9 93 0 94 1 95 2 96 3 97 4 98 5 99 6 00 7 01 Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application SEQ SEQ SEQ Amino Acid Sequence ID Amino Acid Sequence ID Amino Acid Sequence ID NO NO: NO: 6 70 7 71 8 72 9 73 0 74 1 75 2 76 3 77 4 78 5 79 6 80 7 81 8 82 9 83 0 84 1 85 2 86 3 87 4 88 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application Table 5b: Split Amino Acid Sequences from 5 aa SEQ SEQ Table 5a subs- ID 7 aa insert ID 19 5 aa SEQ SEQ 20 subs- ID 7 aa insert ID 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application 5 aa SEQ SEQ 5 aa SEQ SEQ subs- ID 7 aa insert ID subs- ID 7 aa insert ID 87 88 89 90 91 92 93 94 95 96 97 98 99 00 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application 5 aa SEQ SEQ 5 aa SEQ SEQ subs- ID 7 aa insert ID subs- ID 7 aa insert ID 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application 5 aa SEQ SEQ 5 aa SEQ SEQ subs- ID 7 aa insert ID subs- ID 7 aa insert ID 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application 5 aa SEQ SEQ 5 aa SEQ SEQ subs- ID 7 aa insert ID subs- ID 7 aa insert ID 91 92 93 94 95 96 97 98 99 00 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application 5 aa SEQ SEQ 5 aa SEQ SEQ subs- ID 7 aa insert ID subs- ID 7 aa insert ID 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application 5 aa SEQ SEQ 5 aa SEQ SEQ subs- ID 7 aa insert ID subs- ID 7 aa insert ID 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application 5 aa SEQ SEQ 5 aa SEQ SEQ subs- ID 7 aa insert ID subs- ID 7 aa insert ID 95 96 97 98 99 00 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application 5 aa SEQ SEQ 5 aa SEQ SEQ subs- ID 7 aa insert ID subs- ID 7 aa insert ID 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application 5 aa SEQ SEQ 5 aa SEQ SEQ subs- ID 7 aa insert ID subs- ID 7 aa insert ID 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application 5 aa SEQ SEQ 5 aa SEQ SEQ subs- ID 7 aa insert ID subs- ID 7 aa insert ID 99 00 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application 5 aa SEQ SEQ 5 aa SEQ SEQ subs- ID 7 aa insert ID subs- ID 7 aa insert ID 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 151t o / e i14141414141ti9363O W10 / 220-ETA K:.o NtekcoDyenrottA tpircsnart 4XU Da g nitegrats ec Q071 2 3 4neE DO777777777uS IN2 2 2 2 2qes rGG CGGCGGGGGG AeNg CAC CAC CAC CACC GCAGCGC GG G Rine CGas msGAGCacCGaGCGgGC gCAGCGgGa GAtCtGA aCtGaCcGAtCaypA A A A A A A A A A A G G A G G A G G A G G A G G ralp Q0E1112 3 4DO0 0101010me S IN2 2 2 2 2xE: C 6eC CTCCTCCTCCTCTT CTCCCT CTCCT CTCCCT CCCCTClb eGTG GCTG GCTTG GCTGCG adiCTuCGGCTGTCGGCGGCGGCGG g GCTGCGCTGCCGCTGCCGCTGCCGCTGCQ0E51 2 3 4SDIO N25125 5 51212121151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGGCA GCCCGGCA GCCCGGCACACA GCCGCCGCCGCCGCCQ5E767778797SDIO N7272727272rGeg CG ACGG CACGCG AC AC ACGC CneCGCG G GCGGCCGgGGC gCGCGgG CCAtGCCAtsAG s GACGACGACAG G atccapA A A A ActACCaaACCagA A G G A G G A G G A G G A G G Q5E161718191SDIO N0202020202CTCTCTGT TCCTCT CCCT CT CCCCTC G CCGG C CGG CT TGCGCGGTGG e GTGTGTGC TGCG diCCGGCGGCGGCGCGCGGTGCTGTG ugGCT CGCT CGCT CGTCCTGTCCTQ5E56 7 8 9SDIO N25125 5 51212121151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGCCA GCCCGCCA GCCCGCCACACA GCCGCCGCCGCCGCCQ0E818283848SDIO N7272727272rAC AC AC AC AC egGGCGGCGCGCGCneCCAt CGCCAt CG CAs AGC c CG G GCCAc CGCCAc CG sCAGCGCAG AG AG aCga Cgg CaaCCagCCgapA A A A A A G G A G G A G G A G G A G G Q0E212223242SDIO N0202020202GCTGCTGCTGCTGCTCTGGCTGGCTGGCTGGCTGG eCGG G G G G TGCG TGCG G G TGC TGCG di CugGTGC TGC TGC TGCTTG GTCCTG GTCCTG GTCCTG G GTCCTGTCCTQ0E61 2 3 4SDIO N26126 6 61212121151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGCCA GCCCG G GGTCCCG G GGTCCCGCGCG GGTCCG GGTG Q5E868788898SDIO N7272727272rAC egGGC CCGCGCGCG GCAGCACA neCCAc CGA G G G G G s AG AGaTCAGaTCAGaTCAGaTCsCCggG GGttCCGGt CGG cCGG cCac C t C c CpA A G GCCA GCCA GCCA GCCA G Q5E262728292SDIO N0202020202GCTCGCGCGCG CTGGCTGTGCTGTGCTCTGTGGTGGG GTCGTCTCTCeCGCTCTGCTGCTdi CTugGTG GGCGGCGGCGGCGTCCTACCTG GACCTG G G GACCTGACCTG Q5E66 7 8 9SDIO N26126 6 61212121151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfG G GGTCCCG G GGTCCCG G GGTCCCGC CG GGTG GCCCGTG Q0E919293949SDIO N7272727272rCeg CGCGCGCG GG GCAGCACAGACnGA e AG TGGgTG G GgTGGG gTCCa CG sg CACACA s GG CGGCGGCGGCGCGG Ctt Ctc Cc c Cgat C c CpCA GCCA GCCA GCCA A G GgCA A Q0E313233343SDIO N0202020202CCTGCGCGCG G GTGCTCTCTC GCGTGGTGGTG TT TeGTCCTGTCCTGTCCTGTCCT GCGCdiGGCGCGCGCCCGG ug CCTG G G G A GACCTG GACCTG G G GACCTG GGTCCQ0E71 2 3 4SDIO N27127 7 71212121151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGCC CCGTG GCC CCGTG GCC CCGTG GCC CCGTG GCCCGTG Q5E969798999SDIO N7272727272rGG GG GG GG GG egGAC GACACACACnCesGCa C CCa CGCCa CGCCg CGCCg Cs CGGGGGGGGG GGCGGCGGCGCGG AaA AaAgGa aapa gAaA AaA AgA GCA GCA GCA GCA GCA Q5E363738393SDIO N0202020202CG CG CG CG G TTGCTTTGCTT CTGTT CTGTC TCTGTeCGCGCC GCGCC GCGCC GCGCGCGCdi CGGCGGCGGCGGCCGG ugG GGTCCG GGTCCG GGTCCG G GGTCCGGTCCQ5E76 7 8 9SDIO N27127 7 71212121151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGCC CCGTG GCC CCGTG GTC CCGTG GTC CCGTG GTCCGTG Q0E010203040SDIO N8282828282rGG GG egGACAC CA CGT CA CGT CA CG nCeCGg CGCCg CGG C GcCGG aCTGG aCGGGCGG GCG TCACG TCACT CG ssag gaA p AaA AgAA gaGAgGA ggG GCA GCACG GCG GCG G Q0E414243444SDIO N0202020202CG G TC TC TC TTGCTC GTTGCTGCGTGGTGGTACACA CGCG GCGCGCG eC CC CT G G T G G T Gdi CGGCGGC C C C C C CGC CugG G G G G G G G GGTCCGGTCCACCG ACCG ACCG Q0E81 2 3 4SDIO N28128 8 81212121151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGTCGTCCCGTCGTCCCGTCGTCCCGTC CCGTG GTCCGTG Q5E060708090SDIO N8282828282rCeg CA GT CCA TCCA TCA CGT CA CGTnG e GCGCGCssCtG GG CtG GG CtGGCGG aCGC cGC cCG TCaAT CagATggAT CaaAT Ca A apACG G GACG G GACG G GACG G GAgCG G G Q5E464748494SDIO N0202020202TC TC TC TC C CCGGTGCCGGTGGCCGTGGTT GGTA A GACCGACCGA eTG G T G G T G G T G G T Gdi CC C C C C C C C C C C CGC CugGCCG GCCG GCCG GCG GCG A G A G A G ACG ACG Q5E86 7 8 9SDIO N28128 8 81212121151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uC CfG GGTCCCCG GGTCC C C C C C C CCG GGTG G GGTG G GGTCCQ0E111213141SDIO N8282828282rGeg CG GTGCGTGCG GTGCG GTGCGTneGCAaCG CGCAaCCGCAaC G AaC GG ACsGC C C C g CsCGGC GGCGC GG G aCt C a C a C cC GtpGcCGCGtCGCGcCGCGcCGCCGtCGCQ0E515253545SDIO N0202020202CCCCCCCC CGGTG GGTG GGTG GGC G GGG G G GTGTG eCCCCCGCCCCGCCCCGCCCCGCCCdiG ugGGCGGCGGCGGCGGGCATCGCG ATCGCG G G ATCGCATCGCATCGCQ0E91 2 3 4SDIO N29129 9 91212121151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uC CfG GGTCCCCG GGTCC C C CCG G GGTG G GGTCCCG G GGTCCQ5E161718191SDIO N8282828282rGeg CG GTGCG GTGG CGTCC G CC G G neGCA GgCGCAg CGCAgCC T aGG CC GGTGaG ssCGGCGGGGTGCCGTGCCaCt CGcCC cgapGcCGCGtCGCGcCGCCCACCCCatACCQ5E565758595SDIO N0202020202CGCCCCCG G G TG GG GTG GTG G G G G GC CG GTGTG G G eCCCCCGCCCCGCCCGGCACGGCACdiG ugGGCGGCGGGCGGAGG ATCGCG ATCGCGCACATCGCCCCCGCCCCG Q5E96 7 8 9SDIO N29129 9 91212121151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfG G GGTCCCG G GGTCCCG G GGTCCCG G GGTCCCG G GGTCCQ0E212223242SDIO N8282828282rCC CC CC CC CC egGGG GG GG GG GG nTeGssGaGGTGaGGTGaGGTGgGGTGgG TGCCGTGCCGTGCCGTGCCGGCCaacpCCACCCCgtACCC gcCACCC aa TCACCCCatACCQ0E616263646SDIO N0202020202GTG G G G G G G G GTG GTG GTG GTG GCGC C C CG G G G G G e GGCACGGCACGGCACGGCACGGCACdiGGAuCGGAGGAGGAGGAgCCCCGCC C C CCCCGCCCCGCCCCGCCCCG Q0E01 2 3 4SDIO N30130 0 01313131151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGC CG G GGTG G AGTCCCG G AGTCCCG G AGTCCCG G AGTCCQ5E262728292SDIO N8282828282rCCC T C T C T C TegGGGT C T C T C T CnTGe ssGgG GGGGGGGGGGTGCG CgCGGCaCGCGCTCaGCTG C GCTG CcGCTCagaagaaggapCCACCG G ACCG G ACCG G ACCGaG ACCQ5E666768696SDIO N0202020202G AT AT AT AT GTG CG GGCGCGGCC GGCGGCGC CCCCCeGG ACG GG GG GG C GGCGGCGGCGG diGGAuCAACCACACACCgCCCCGCAAGCAAGCAAGCA G G GCG GCG GCG G Q5E06 7 8 9SDIO N30130 0 01313131151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfG G AGTCCCG G AGTCCCG G AGTCCCGC CGCG AGTG G GTCG Q0E313233343SDIO N8282828282rCT C T C T C TGTeTg CGGT C T C T C TAnG G e GcCGGcCGGGGGG GgCgC TCg CssGCTG C GCTG C GCTG C GCTCGGCCaaggggagg Cgp G G ACCG G ACCG G ACCG G ACCTgCGGCQ0E717273747SDIO N0202020202ATCATCATCATCACG GGCGG GG G CCCCG A CCCGCA GG GG GG GG e GGGCGGCGGCGG GCGCdiAACuCACACACCGGA gGCAACAACAACA G GGCG GGCG GGCG GGTG ACCQ0E11 2 3 4SDIO N31131 1 11313131151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGC CGC CGC CGC CGCG GTCG G GTCG G GTCG G GTCG G GTCG Q5E363738393SDIO N8282828282rGTGTGTGTGTegGTATATATATAnTeCssGa CGTCa CGTCa CGTCa CGTCa CCGCCGCGCCGCGCCGCGCCGGCCaaaacgagc CgpTCGGCTCGGCTCGGCTCGGCTgCGGCQ5E767778797SDIO N0202020202ACG ACG ACG ACG ACG GA C AGA C AGA A A C AGCAGCA e GGCGCGGCGCGGCGCGGCGCGGCGCdiGGA GGA GGA GGA GGA ugGTG ACCGTG ACCGTG ACCGTG G ACCGTACCQ5E16 7 8 9SDIO N31131 1 11313131151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfG G GTC CCG G G GTC CCG G G GGTCCCGCG G GGTCCG GGTCCQ0E414243444SDIO N8282828282rGTeTGT CgG AT CACGCCACGCCACG nTCe ssGg CGTCgACGCaG GCaG GCaG CGCCGGCCCTG CCCTG CCCTG CCaag CgapTCGGCTCGGCGgGaTACGaGcTACGaGgTACQ0E818283848SDIO N0202020202ACG ACG A A A GAA GGA T AGACCTACCTACCCCGCGCGTGAGTGAGTGA e GCGCGCGGCGGCdiGGA GGA GGCGGCGGGCugGTG G GG GG GG ACCGTACCCCG GCCG GCCG G Q0E21 2 3 4SDIO N32132 2 21313131151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfG G GGTCCCG G GGTCCCG G GGTCCCGC CGCG GGTG G GGTG Q5E464748494SDIO N8282828282rCeg CACGCCACGCCACGCCACGCCACG n G e ssCCaG GCgG GCgG GCgG GCgG TG CCCTG CCCTCCCTG CCCTG CCapGgGcTACGaGaTACGGaGcTACGaGgTACGgGgTACQ5E868788898SDIO N0202020202TA TA TA TA A GACCGGACCCGACACCTACCTCATGCATGAGTGAGTGA e GGGGGCGGCGGCdiGGCGGCGGCGGCGGGCugCCGGCCGGCCGGCGGCGG G G G G G GCG GCG G Q5E26 7 8 9SDIO N32132 2 21313131151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGCCGTCCCGCCGTCCCGCCGTCCCGCCGTCCCGCCGTCCQ0E515253545SDIO N8282828282reTgTACG TTACG TTACTTACTTACneCCg CG G GAGCCAg CGCCAa CGCCAa CGCCAa CsCG s GCG GCG GCGCG G aapCTaCCCCgTtCCCCaG TaCCCCaG TcCCCCgTaCCCQ0E919293949SDIO N0202020202T A T A T A T A A GGCGGGCGGCGG GC GCGG GC GCT GG GC GCGGCG G G G G G eCGCGCGGCGG GG di CGuTGCGCGCGCCG gGCAG GTCAG GTCAG GTAG GTA G A G A G ACG ACG A Q0E31 2 3 4SDIO N33133 3 31313131151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGCCGTCCCGCCGTCCCGCCGTCCCGCCGTCCCGCCCGTG Q5E565758595SDIO N8282828282reTA T A G GCGC gTCGT CTTAC C CATneCCAa CGGCCAa CGC ACGA sCGC gGCAtTCGCAa CG s GCG G G G G G G GGG agpCTtCCCCgCTcCCCCaTtCCCG GtCaTG GGaCaTG G Q5E969798999SDIO N0202020202TGA TGA TGA GAG GAG GCGGGCGCGGCGCGGCCCC CCCCC CCeCGG G CGG G CGGCC CCG C Gdi CGTGCGCGCAGTAGTA GC C CCGC CugGCG AGCG AGCG A ATTGCATTGCQ5E36 7 8 9SDIO N33133 3 31313131151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGCCGTCCCGCCGTCCCGCCGTCCCGCC CCGTG GCCGTCCQ0E616263646SDIO N8282828282rGeg CCGCG G GCGC ATCTC C CATCTneGCaGGACA GTCACCACAtGC CGCAcGGCAcG ssGGG GGG GAtG GGG G G atpGCcTG GGaCaTG GG GtCtTG GGaCaTG GG GtCaTG G Q0E010203040SDIO N1212121212GAG GAG GAG GAG GAG CCCCCCCCC CCCCC CCCCC CCCCC CCeCC C C CCG C C G C C G C C G C Gdi CGC C CG GC C C C C C CCCG GCG GCGCugATT CATT CATT CATTGCATTGCQ0E41 2 3 4SDIO N34134 4 41313131151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGCCGTCCT C C TCG GGTG G GGTCC T C C TCG GGTG G GGTCCQ5E666768696SDIO N8282828282rGeg CCTGC GC GC GC CCGCGC CGCG neGA CACcGC TssC a GGC C CCTGC aC C TGC aC CCTGC aCG GCAC CAC CAC CA atggaaagcapGCcTG GGCG G GGCG G GGCG G GGCG G G Q5E060708090SDIO N1212121212G G CGCGCGC CAGCGCGCGCGCGCGCGGCCC CA A A A eCC CGCG G G G TGGCTGGCTGGCTGG di CCC CGGG GGG GGG GGG ugG ATTGCCCA GGCCCA A A GGCCCGGCCCGGCQ5E46 7 8 9SDIO N34134 4 41313131151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uC T C CT C C T C C T C CfG G GGTG G GGTG G GGTG G GGTG G AGTCCQ0E717273747SDIO N8282828282rGC GC GC GC egCCGC CGC CGC CG CG nCTeGssCC C TGC C TGTCGTCCCgCg GC TGCACCgCACCgCACC CAC tCTCaaaagcggg CpGCG G GGCG G GGCG G GGCG G GTCctGGCQ0E111213141SDIO N1212121212GC CGGC CGCGGC CGCGGC CGC G CGGCCA CAG AG AG AGGCCGCGC CTG eTGTGTGGTGG G G diGGG GGG GGG GGG AGCA ugCCA GGCCCA A A G G GGCCCGGCCCGGCACCG Q0E51 2 3 4SDIO N35135 5 51313131151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfG G AGTCCCG G AGTCCCG G AGTCCCG G AGTCCCG G AGTCCQ5E767778797SDIO N8282828282rCG CC C CG CG egC T CG G G GTGTGTnTG aC TGCGtTC TGCCTGtCCTGCessCCCTCCCCCtCTCCC CTCCCcCTCataCpTCGGCTCttTCG GT tcCGGCT caCGGCT taCGGCQ5E161718191SDIO N1212121212C G C G C G C G G GC CCAGC CCAGC CCAGC C CCAGC CCA TG G G G G G GT T T TeGGGG GGG GGG G G diACA ACA ACA ACA AGCA ugGCCG GCCG GCCG GCG GCG A G A G A G ACG ACG Q5E56 7 8 9SDIO N35135 5 51313131151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfG G AGTCCCG G AGTCCCGC CGC CGCG GTCG G GTCG G GTCG Q0E818283848SDIO N8282828282rC CG AC AC AC e G gC TGT C GGC GGGG nTG GCCsc TGC C Ca GC CCaGC Ca G esCCTCCCCcCTCCC CCCCC CCCCC CCCapTCttGGCTCctGGCT agCGCCT gaCGCCT ggCGCCQ0E212223242SDIO N1212121212C G C G GCG GC GC C G GCG CCA A GGA GG TGGCCA GGA TG GGG GGG GGG e GGG G G GGG GGG GGG diACA AGCA GCG GCG GCG ugG ACCG G G ACCG GCCGCGTCCGCGTCCGCGTQ0E61 2 3 4SDIO N36136 6 61313131151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGC CGC CGC CGC CGCG GTCG G GTCG G GTCG G GTCG G GTCG Q5E868788898SDIO N8282828282rAC AC AC AC AC egCGC GGGGGGGG nCGCtGC CCtGC CGCC CCcGC Cc G e ssCCCCCCC CCCCCcCCCCC CCCCCCCaaaggaaag CgpTCGCCTCGCCTCGCCTCGCCTgCGCCQ5E262728292SDIO N1212121212GCG GCG GCG GCG GCG GGA GGA GGA GGA GGA GGG GGG GGG GGG GGG e GGG GGG GGG GGG G G diGCG GCG GCG GCG GGCG ugCCGCGTCCGCGTCCGCGTCCGCGTCCGCGTQ5E66 7 8 9SDIO N36136 6 61313131151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGGCGTCCCGGCGTCCCGGCGTCCCGGCGTCCCGGCGTCCQ0E919293949SDIO N8282828282rCC C C C C C C Ceg CCCC C C C C C CCCneCCGg CC CCGa CC CGCC G CaCC CGCssGA GCG A GC aCG A GCCG A GC aCGCaCc C t C t C cG AcpGcCCTGaCCTGcCCTGaCCCTGtCCTQ0E313233343SDIO N1212121212GCGCGCGC CAGGCGCAGCGCAGCGCAGG CGCAGCGCeGCTG GG CTG GG CTG GG CTG GCTG di CGGCGCG GGCGCGCGCGCGGCGCG ugG G G G G G G G G G G G G G G G G G G G G G Q0E71 2 3 4SDIO N37137 7 71313131151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGGCGTCCCGGCGTCCCGGCGTCC CCG AGTCC CCG AGTCCQ5E969798999SDIO N8282828282rCeg CCCCCCCCCCCTTGC TTTGC TneCCG CgCC CGCC G CgCTCGgCTT G CssGA GC gCG GCCA GC a TCGAG GAG aCa CAtGC cpc C a C a CAatG AatG GC TGC TGC TG A G G A G Q5E363738393SDIO N1212121212GCGCGCCC CAGGCGCAGCGCAGCGC CTCT CCCTCTCeGCTG GG CTG GCTGCCCTGCCCTG di CGGCGCG GGCGGCGCG AGCA AGCA ugG G G G A G A G G G G G G G G G A G A A G A Q5E76 7 8 9SDIO N37137 7 71313131151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uC CfG AGTCCCCG AGTCC CCG AGTCC CCG AGTCC CCG AGTCCQ0E010203040SDIO N9292929292rTeg TGC TTTGTTTGTTTGC TTTGTneT C TCCTTCC a TTC g TTCCGa T CGaG C G CCG CTssGAG GAG GAG GAG GgG atatcpA G A G ActG AtaG AAttG G A G G A G G A G G A G G A G Q0E414243444SDIO N1212121212CCTCCT CCCCCC CC CTCTC CTCTC CTCT CCCTCTCeCCCTGCCCTGCCCTGCCCTGCCCTG diA GGCA A A GGCA AGCA AGCA AGCA ugA G A G A G A A G A A G A A G A A G A A G A Q0E81 2 3 4SDIO N38138 8 81313131151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uC CfG AGTCCCCG GGTCC CCG GGTCC CCG GGTCC CCG GGTCCQ5E060708090SDIO N9292929292rTG G GAGAGA eg TC T CTC C CTCTCTneTCGgCTA GTaCCACGTt CAC CACTCssGAG GGG GCGCGTGtCCGtGCCapActGAac GAta GA GtGtGAtc G G A GT CAT CGT CGT CG Q5E464748494SDIO N1212121212CCTCCCT ATGAATGAATGAATGA CCCC CC CTCC CCTCC CCTCC CCTCe TGC CCC CCC CCCdiAGuCA GC TGC TGC TGCCTgG A GA GA G A G A G GGCG GGCA G GGCGA G GGCQ5E86 7 8 9SDIO N38138 8 81313131151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uC CfG GGTCCCCG GGTCC CCG GGTCC CCG GGTCC C CCG GGTG Q0E111213141SDIO N9292929292rGA eg CT GCTC CGA CT GG CTT CCG A n ACeGTt CATcCCACTCATcCCGGCCCssGCG GcCG GcGCGGG GCGGGTG acpATtCG GAaTaCGGAAtTcCG GAcATcCGCggA A A G G Q0E515253545SDIO N1212121212ATG CCAATGAATGAATGAAC CGTCCTCC CCCTCC CCTCC CCTCTAGTeC C C CCC CCC CCA diGC TGC TGC TGC TGACCugGA GA GA GA G GGCG GGCG GGCG GGCGTGCCCQ0E91 2 3 4SDIO N39139 9 91313131151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uC C C CC C C C C C C C C C CfG GGTG G GGTG G GGTG G GGTG G GGTG Q5E161718191SDIO N9292929292rG egGT GT G A G T GT GT GG GA G A G A GGA nCeGa CCGCGa CsT CGGGCcCCGGGCcCCGCGc CCsATGAGATGTGTG aCca Cga CaaACcaACcgpA A A A A A G G A G G A G G A G G A G G Q5E565758595SDIO N1212121212AC CGTAC CGTAC GTAC GTAC GTTAGAGCAGCAGCAGCTTC TTTTTTTeACACCACCACCA diGACGACGACGACGACCugGTGCCCGTGCCCGTGCCCGTGCCCGTGCCCQ5E96 7 8 9SDIO N39139 9 91313131151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uC C C CC C CfG GGTG G GGTG GCCGTCCCGCCGTCCCGCCGTCCQ0E212223242SDIO N9292929292rGT G egG T TCGGA G ATCT TC T GA TCAnCeGg C GCGCs T CGCGg CCGAC CGCtACGAaG GAaG sAGTG GTG GTG G G aCagACca a aTtpA A G A G G A G G GaTG G A GgTACG GgTACQ0E616263646SDIO N1212121212AC CGTAC CGTGACCGACCGACCAGTAGTGTG G G G GeTCATCCCCAC C AC T CCC AC T CCCCdiGACGAC CGCGCAG ugGTGCCCGTGCCCCGTTCACACA AGTTCAGTTCA Q0E01 2 3 4SDIO N40140 0 01414141151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGCCGTCCCGCCGTCCCGCCGTCCCGCCGTCCCGCCGTCCQ5E262728292SDIO N9292929292rT egTC TCT ATCTC TC TC ATGA TGAnCG eAC CG G GACGC CG G GAC CG GACGa CAt c cG ssGATG GtG GTG GTG GTG apGcGaTACGTtGaTG GcA GgTACGaGgTACGcGgTACQ5E666768696SDIO N1212121212GACGACGACGACGACGTGCCGTGC C C CCGTG G G G GeCCACCC AC CCT CCT CCC ACC ACCCdi CCGCugGTTCACGCGCGCAG AGTTCACAGTTCACACA AGTTCAGTTCA Q5E06 7 8 9SDIO N40140 0 01414141151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uC CfG GGTCCCCG GGTCC CCG GGTCC CCG GGTCC CCG GGTCCQ0E313233343SDIO N9292929292rT TG TG TG TG e G gGGA GA GA GA GA ne CA G GCCA G GCCAG GCCAG GCCAGCssTTaCGTT gGTTaCGTTgCGTTgCG apTCttGACT CCttGACTCctGACTCatGACT acCGACQ0E717273747SDIO N1212121212CCG CCG CCG CCG CCG GTA A GTA A A A A GTA GTA GTA eTCATCATCTCTCCGCGCGACGACGA diGGGuCGGGGGGGGGGGGgCTTCACTTCCACTTC C CCACTTCACTTCA Q0E11 2 3 4SDIO N41141 1 11414141151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uC CfG GGTCCCCG GGTCC CCG GGTCCCG G GGTCCCG G GGTCCQ5E363738393SDIO N9292929292rTG egGGA TG GA TG GACCC GA CCC GAne CAG GssTC CAG GCCAGCC Ta CC Ta CTgCGTTgCGTTgC CG GG CC CGCCatcpTCGACTCctGACT ccCGACCgG CaCG ACaCaCG A Q5E767778797SDIO N1212121212CCG G G GGG GGG GTA CCA CCACA GTGT TCGCTCCGCeTCCGATCA CGATCA CGA GGCG GGCG diGGGuCGGGGGGGGG GGG gCTTCACTTCCACTTCCG G AGTACGGTACG Q5E16 7 8 9SDIO N41141 1 11414141151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfG G GGTCCCG G GGTCCCG G GGTCCCG G GGTCCCG G GGTCCQ0E414243444SDIO N9292929292rCeg CC ACCC GA CCC ACCC GA CCC G neCG CTa CC Ta CCG Tg CC Tg CAC Tg CssGG CC CGG CC CGCC CGG CC CGCCagpCCtCG ACgCcCGGACaCtCG ACaCcCGGACgCtCG A Q0E818283848SDIO N1212121212GGG G G G G G G G TCCG GCTCG GCTCG GCTCGGGCTCGCeGGC CG GGC CG GGC CG GGC CG GGCG diGGG GGG GGG GGG GGG ugGTACG GGTACG GGTACG G G GGTACGGTACG Q0E21 2 3 4SDIO N42142 2 21414141151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfG G GGTCCCGCCGTCCCGCCGTCCCGCCGTCCCGCCGTCCQ5E464748494SDIO N9292929292rCC eg CGA CCCCG CCCCCCCCCCCCnCCTg CCCGCTGCGCGGaCGCGCeC cGTaGTs CGTaG s GGCCCGCCG GCG ag TpCCcCGgtA A ACTCatA AC CTacCA AC CTCgtA ACCQ5E868788898SDIO N1212121212GGG GTTGTGTGTTCCGGCGTATTATTATTG G G G G G A G CG GG GG GG GG e GCGACGACGA GA diGGGCugGTACGAGCGCGCGCCG C GAGCGAGCGAGCG G G GCG GCG GCG G Q5E26 7 8 9SDIO N42142 2 21414141151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGCCGTCCCGCCGTCCCGCCGTCCCGCCGTCCCGCTGTCCQ0E515253545SDIO N9292929292reCgCCCG CCCCCCCCCCCCCCGCTneCG aCGCGCGCGCCGGgCC Ga TA sTsCCGTGcGTgGTGCCCGCGCG GGG aTgc TatCTgtCTgcgcpC C C C TG A ACA ACA ACA AC CG G Q0E919293949SDIO N1212121212GTGTGTGTG GTTA GTTA GTTA GTTA CCCGGG GG GG GGC ACeCGA G G GCGCGACGACGACG di CAuCGCgGCGAGCGCGCGCTG C GAGCCGAGCG AGCG G G G G G GCG G A G G Q0E31 2 3 4SDIO N43143 3 31414141151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGCTGTCCCGCTGTCCCGCTGTCCCGCTGTCCCGCTGTCCQ5E565758595SDIO N9292929292reCgCGCT CCGCT CCGCCCGCCCGCneCCGTaACCGa TTC Gs GAC a TACCG TgTTACCGg TA s GGG G G GGG GG GG apTCatG G GT gaCG G GTCgtG G G GT aaCG G G GT acCG G G Q5E969798999SDIO N1212121212CCG C G C G C G G CCCA CCCCA CCCCA CCCCACCCCCACeGCCGCGCCGCGCGCGCCGCCGCG di TAGCGTG AGCGTGCGTGCGCTGCG ugG A G A G A G A G G A G G A G G A G G A G G Q5E36 7 8 9SDIO N43143 3 31414141151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGCTGC C C CTG GCTGTG GGCGTCCCGGCGTCCCGGCGTCCQ0E616263646SDIO N9292929292reCgCGCT CCGCTTTCTCTCTC CTCnT TAACAACAA eCCGgC GgTs GACA GaG GTaG GTa CG s GgaG GG gcG GCcCCGCaCCGCaCapTGTG GaGaGgCCG GCG G GTG GTG GTG Q0E010203040SDIO N2222222222CCG GGACACACCCCACCGCCCAC CGGCGCC CGCGCCCGGCCCGGCCCeCGCGGGC GGC GG di TGuCGTGGCGT CGT CGCTgA G ACG GATA GATA GATA A G G A G G G A G A G A Q0E41 2 3 4SDIO N44144 4 41414141151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGGCGTCCCGGCGTCCCGGCGTCCCGGCGTCCCGGCGTCCQ5E666768696SDIO N9292929292rTeTCTCTg AACTACTCTCTC CTCTACnCA eaGTCAACAA G GgG GTCA G GTCGTGgTg gG ssGCtCCGCaCCGCtCCGCcCCGCcCapGgGgGgGaGgCGTG GTG GTG GTG GTG Q5E060708090SDIO N2222222222GCACGACGACGACGACGGCCGGC C CCCCCCGGCCCGGCCCGGCCCeGGC GGC GGC GGC GG di CGT CGT CGT CGT CGCTugGATA GATA GATA GAA GAA G A G A G A GTA GTA Q5E46 7 8 9SDIO N44144 4 41414141151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGCCTC CCG GCCTC CCG GCC C C C CCTCG GCCTCG GCCTCG Q0E717273747SDIO N9292929292rCTCC CC C CC egCC CC T C T C TC CC TnCeGCgAC CCC C C C C C CsCG GaA GCcA GCcACG GCcA sCGC CGC CGC CG G aCc C t C a C aC CtpGcCCCGaCGCGtCGCGcCCCCGaCGCQ0E111213141SDIO N2222222222AGCAGCAGCAGCAGCGCCG GCCG GCCG GCCG GCCG eGCGGCGCGGCGCGGCGCGGCGCGGCdiCuTAG AG AG AG AG g GGCTGGCTGGCTGGCTGG G G G G G G G G G G G G G G G Q0E51 2 3 4SDIO N45145 5 51414141151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGCCTC CCG GCCTC CCG GCCTC CCG GGTGTCCCGGTGTCCQ5E767778797SDIO N9292929292rCC C CCTegCT C TC CTCCCTGCCCG nCCeGCC CCcACC CCCGCAgGGCAaG scA G G GcA sCCGC CG G GC ACGC ACaCt C cCCCcpGcCGCGaCCCGtCGCGaGaCTCGaGcCTCQ5E161718191SDIO N2222222222AGCAGCAGCGGCGGCGCGCG GCGCG GCCG GACCG GCG GAGCGACAGCe CGCGCGCGGGGGdiCuTAG AG AG g GGCTGGCTGGTGCGTTGCTGCCGCCG G G G G G G G G G A G A Q5E56 7 8 9SDIO N45145 5 51414141151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGGTGTCCCGGTGTCCCGGTGTCC C C CCGGTGTG GGTGTG Q0E818283848SDIO N9292929292rTeCCgCTGCCCTGCCCTGCCCTGCCCG neGCAaGG AaGG AaGG AaGG AgG ssGC ACGa CGC ACGg CGC ACGg CGC ACGg CGCgACapGgCTCGaCTCGcCTCGgCTCG GcCTCQ0E212223242SDIO N2222222222GGCGGCGGCGGCGGCGACAGCGACAGCGACAGCGACAGCGACAGCeGGG GGG GGG GGGGGdi TGCuTgCCGTCGCTCGTCGCTCGTCGCGTGTCGCTG G A G A G ACG ACG A Q0E61 2 3 4SDIO N46146 6 61414141151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGGC CTGTG GTCGTCCCGTCGTCCCGTCGTCCCGTCGTCCQ5E868788898SDIO N9292929292TCCT CT CT CT r eCCgGT C T C T C T CCneGCAgGC CCC C CCssC A GtGGt C C CGG Ct C CGG Ct CG GCCGCCGCCGCCG apGgGgCCTCGaGaTACGaGgTACGgGaTACGgGgTACQ5E262728292SDIO N2222222222GGCGA GA A A GACACAGCCAGCCGCAGCGCAGCG G G G e GG GTGGCGTGGCGTGGCGTGGGCdiGTGCTGCTCG GACTCGCTCGCTCG ugCCGA GA GA G A G G G G G G G G G G G G Q5E66 7 8 9SDIO N46146 6 61414141151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGTCGTCCCGTCGTCCCGTCGTCCCGTCGTCC CCG GGTCCQ0E919293949SDIO N9292929292rC C eCCCCCGG gTCC CTC CTC C C C TnCTGG eGCcGCCcGCCcGCCcG ACaCsCGGGGGGGCCsCACCACCCCTCG apGaGaTCTGaGgTCTGgA GaTCTGgA GgTCTCaCaCGTQ0E313233343SDIO N2222222222GACGACGACGACCGG AGCAGCAGCAGCAA GGCG GCG G G G CGG G G G G A eTGTGTGC TGC CG diCTCGTGTGTG GAGGACCGACCCC TugGA GA G G G G G G G G G G G G G AGCCCQ0E71 2 3 4SDIO N47147 7 71414141151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uC CfG GGTCCCCG GGTCC CCG GGTCC CCG GGTCC CCG GGTCCQ5E969798999SDIO N9292929292rGG GG GG GG GG egGGTGGTGGTGGTGGTn A eCssCaCACaCACCCCCCcCCACCcCCACCcCCTGTCGTCGTCGTCCgCaC TCgCca a gG apGCGTCCaCGTCCcCGTCCaCGTQ5E363738393SDIO N2222222222CGG CGG CGG CGG CGG AAG AAG AAG AA AA G G G GG GG CCACCACACACA e GGGGCGGCGGCG diGATGATGATGATGAGugGTAGCCCG AGCCCG G G AGCCCAGCCCAGCCCQ5E76 7 8 9SDIO N47147 7 71414141151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uC CfG GGTCCCCG GGTCCCGGC C C C CTGTG GGTGTG GGTGTG Q0E010203040SDIO N0303030303rGG GG egGGTGGTAC CGGAC CGGAC CGG n A eCssCcCCACgC T GaGT GaGT GaG TCgGCC CTCG GGAC CGGAC CGACaaaG pCCgCGTCCaCGTCaCAGCC acCAGCC gcCAGCQ0E414243444SDIO N2222222222CGG CGG G G G AA AA GTCCGG ACCGG AGCG CGG TCGCG CGG TCGCCGGCeGGGG G CGG CGCG diGATGAT T CAT CAGT CA ugG AGCCCG AGCCCCCCCGTCCCCGTCCCCGTQ0E81 2 3 4SDIO N48148 8 81414141151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGGTGTCCCGGTGTCCCGGTGTCC C CCGGTGTG GGTGTCCQ5E060708090SDIO N0303030303reAgCC GGACCGAC CGGAC CGGACCG ne CGtG G G TT GtGT GtGT GcGT GcG ssGGAC CGGAC CGGAC CGGAC CGACaaaacgaaaG pCCAGCCCAGCCCAGCCCAGCCCatAGCQ5E464748494SDIO N2222222222GTG G G G G G G G GCCGG TCGCCGG TCGCCGG TCGCG CGG TCGCCGGCeGCGG CGG CGG CGCG di TCAT CAT CAT CAGT CA ugCCCCGTCCCCGTCCCCGTCCCCGTCCCCGTQ5E86 7 8 9SDIO N48148 8 81414141151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uC C C CCfG GGTG G GGTCC CCG GGTCC CCG GGTCC C CCG GGTG Q0E111213141SDIO N0303030303rAG AG AG A egCGCCGCCGCGCAG GCnCG eC TCaC C CGTC CCGt TC CGCGTC CGTGCCaCGCC CGCCtCGCCcC CssaagtgagtaG apA A AACA A AACA A AACA A AACAaA AACQ0E515253545SDIO N2222222222CT TCT TC C C GC TGC TGTCTTGTCTTGTCTTTCGGTCGGTGGTGGTGG eGGGGCGGCGGCG diGCG GCG GCG GCG GGCG ugA GCCGTA GCCGTA GCCGTA A GCCGTGCCGTQ0E91 2 3 4SDIO N49149 9 91414141151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uC CfG GGC CCTG G GGTCC C C C C CCG GGTG GGTGTG GGTGTCCQ5E161718191SDIO N0303030303rAG AG AG CC CC egCCG GCCGCGCGG GG cTC CCGTC CGT GCCcGGCCaG nesCsCCGCCcCGCCcC CGCTC ACC C ACapAgaAAgtAAgcA Cg Tg GCga G A ACA ACA AC C CGC CG Q5E565758595SDIO N2222222222C C C GGG GGG GTCTTGTCTTGTCTTAG AG TCGGTCGGTGGCCGACCGA eGGGGCGGG GGGG diGCG GCG GCG ugAT CG GT CGCCGTA GCCGTA GCCGCCGTCCGCGCCGCG Q5E96 7 8 9SDIO N49149 9 91414141151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGGTGTCCCGGTGTCCCGGTGTCCCGGTGTCCCGGTGTCCQ0E212223242SDIO N0303030303rCC CC CC CC CC egGCGG GG GG GG GG CtGGCCtGGCCtGGCCcGGCCcG nessCTCaACCTC ACCTC ACCTC ACC C ACC CGaGgGaGT aapCaGCCcCGCCgCGCCcCGCCgCG G Q0E616263646SDIO N2222222222GGG GGG GGG GGG GGG CAG CGCAG GCAG AG AG A A GACGACGA GCGC C CeGG G G G GGG GGGG di TCGuC T CGT CGT CG GT CGgCCGCGCC C C CCGCGCCGCGCCGCGCCGCG Q0E01 2 3 4SDIO N50150 0 01515151151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGGTGTCCCGTCGTCCCGTC CCGTG GTC CCGTG GTCCGTG Q5E262728292SDIO N0303030303rCC egGGGCCGCGCCGCGCCGCGC GCG CcGCCGGaG GGaG GGaG GGaG nesC ACCGCGCGCG sTCCG ACG ACGCGag a C a C gAC gACpCCaCG GTCaTGTCgTGTCaTGTCgTG Q5E666768696SDIO N2222222222GGG AG AG AG G CC C C CA AG GA A A A CGACGCG GCG G GCG e GGGGTCGGGTCGGGGGTCG TCGdiGTCGuC CGCC C C C C C CgCCGCCCGGCCGGCCGGCCG G G GCG GCG GCG G Q5E06 7 8 9SDIO N50150 0 01515151151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGTC CCGTG GTC CCGTG GTC CCGTG GTC CCGTG GTCGTCCQ0E313233343SDIO N0303030303reCgCGCGCGCGCGCCGCGC GCGGGTeGG GCGGCGA n GGsCgG G aCgG GGCgG G CgGGCa C g CGG gCcG sCG ACG ACG ACAC CCcAapTa T g T a T g T tCC TGC TGC TGC TGC CG Q0E717273747SDIO N2222222222CAG AG AG AG G CGACCGACCGACCGACGA GGCG GGCG GGG GGGCCGCG eT G T G TCG TCGTGdi CGCC CGGCC C C C CGGGCGGCCT T CugCCG GCCG GCCG GCCG G G ACCGCQ0E11 2 3 4SDIO N51151 1 11515151151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGTCGTCCCGTCGTCCCGTCGTCCCGTCGTCCCGTCGTCCQ5E363738393SDIO N0303030303reGgCGTGG CGGCG GTGCGTGCG GTGGA GGTA GA A nesCGtGC GtA G CGtG GGGGtCCtGCG sCC ACGCACC ACCaa CCt c C c C cACpTCtCGTCtCACTCaCGTCtCGTCcCG Q5E767778797SDIO N2222222222CCGG GG GG GG G CACGGCCACACACGA GCCGCCGCCG TCGT CGCGCGCeG G G GTG GTG GTGdiCuTT C T C T C T CGT CgACCG CTCAC CTCTCTCGCACCGCACCGCACCGCQ5E16 7 8 9SDIO N51151 1 11515151151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGTCGTCCCGTCGTCCCGGC C C C CTGTG GGTGTG GGTGTG Q0E414243444SDIO N0303030303reGG gCGTGG CTAA CGGACA GGACA G n G eGcA G GGcA GAG g A GAaA GAaA ssCG CC CG CC GCGACGCGACGCGACaaAC aACaaaapTCaCGTCcCGGCGGTGCGGTGCatGGTQ0E818283848SDIO N2222222222CCGG GG TGTGT CACGTCGCCACCCCC GCGT CGAC C CCCGACCGACCG e diCG G G G GCC GCCCCuTT CCT C TGC TGCGTGCgACCGTCACCGCTCTCGTTCTCGTTCTCGTQ0E21 2 3 4SDIO N52152 2 21515151151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGGTGC CTG GGTGC CTG GGC C C C CTGTG GGTGTG GGTGTG Q5E464748494SDIO N0303030303rAeg CA GGACA GGACA GGACA GGAA CGG n G e ssGAaA GAaA GAaA GAgA GAgA CGAtc CGCGAca CGCGAcc CGCGAtc CGCGAcCapGCGGTGCGGTGCGGTGCGGTGaCGGTQ5E868788898SDIO N2222222222TC GTGTGTGT AC CCC AC CCAC CCC CCCGCCCGCCCGCCGACCGACCG e diGTGCCGTGCCGCTGCCGCTGCCGCTGCCugTCTCGTTCTCGTTCTCGTTCTCGTTCTCGTQ5E26 7 8 9SDIO N52152 2 21515151151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGGCGTCCCGGCGTCCCGGCGTCCCGGCGTCCCGGCGTCCQ0E515253545SDIO N0303030303rGeg CACT GCACT GCACGCACGCACn G eCssGa CGCg CGTCa CGTCa CGTCa CCTgGCGCT GCGCT GCGCT GCG T GCapCCgCG GCgCaCG GCaCaCG GCa CCgCG GCgCaCG G Q0E919293949SDIO N2222222222TGG TGG TGG TGG TGG CG CGG GCG CGGCG G G CGGCCGGCCGG A AG G G G eG C G C GAC GAC GA di CGC CGC CGC CGC CGCCugGG GG GG GG A GGCA GGCA GGCA GGCGG A GGCQ0E31 2 3 4SDIO N53153 3 31515151151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGGCGTCCCGGCGTCCCGGC CCGTA G G GGTCCCA G GGTCCQ5E565758595SDIO N0303030303rGeg CACT GCACT GCACCTCTCCCTnG e ssGCg CGCg CGCg CGCaGTGCGCa TCT GCGCT GCG T GCA GGCTA GGCTaapCCaCG GCa CCgCG GCgCgCG GaaG GatG G A G G A G G Q5E969798999SDIO N2222222222TGG GG GG A A CG T T CGG GCG CGG GCGCC TCC TCGG GCCG C CCC CG CCCeGAC GAC GA ATATdi CGC CGC CGCCGGCGGCugGGGCGGGCGGGCAGGAGG A G A G A GCG GCG G Q5E36 7 8 9SDIO N53153 3 31515151151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfAC CAC CA G GGTG G GGTG G GGTCCCAC CA G GGTG G GGTCCQ0E616263646SDIO N0303030303rCT C T C C T C TeCg CGGC C CTC C C C CneACa TGCaGTGC GgTGCgGTGC GgTssGGCTA GGCTA GGCTA GGCTA GCTagagcpG G G G GatG GgaG G GgtG A G G A G G A G G A G G A G G Q0E010203040SDIO N3232323232ACTACTACTACTACCCGCC C C C TCCCC CG C CCC CG CCCCG CCCCG CCeATATACTACTACdiGGCGGCGGCGGCGGTCugACGGACGGACGGAGGAGG G G G G G GCG GCG G Q0E41 2 3 4SDIO N54154 4 41515151151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfAC CG GGTG GGC CCGTG GGC CCGTG GGCGTCCCGGCCGTG Q5E666768696SDIO N0303030303rCeCTCCG CG CG CG g GTAATAATA AA nCe AgGT CGaGCGaGCATGaGCGaG ssGGCTG AG GCG AG GCG AGCG AG GCapGgcG A G GGaTgCCCGaGTaCCCGtTaCCCGcTaCCCQ5E060708090SDIO N3232323232ACTCG CG C C CCCGACGACGACGACGCCA T A G T A GA e ACG TCGC CGCGC TGC TGC CGC C C CdiGGCug CGCGGCGGCGGGCGG A G G GCTCTA A A A GCTCTGCTCTGCTCTG Q5E46 7 8 9SDIO N54154 4 41515151151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGGC CCGTG GGC CCGTG GGC CCGTG GGC CCGTA G G GGTCCQ0E717273747SDIO N0303030303rCG CG CG CG AG egTCAA GTCAA GTA C ATCAAGCAGneGGgGgGgGGgG GTssAGaGCG AG GCG AG GCG AG GCGaCCTaCCaC Tca cGaa TapG GCCCGTgCCCGTcCCCTCGTTQ0E111213141SDIO N3232323232CG CG CG C CC AAAAGAAG GAG GCGC C CAG TT TA T A A G eCGC CGCGC CGCGCGCGC CGC CACdi CGG ug T TACGGCGGCGG GGCG CCGCTCTA A A GCTCTGCTCTGACCTCTQ0E51 2 3 4SDIO N55155 5 51515151151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfA G GGTCCCA G GGTCCCA G GGTCCCA G GGTCCCA G GGTCCQ5E767778797SDIO N0303030303rAG AG AG AG AG egGA CGG GA CGG GCAG GCAG GCAGneGaTs CCGaTG CCGtTG C GtTGTCGcsGTGTGCTCT CCTaagggagGgaGapTCGTTTCGTTTCGTTTCGTTTaCGTTQ5E161718191SDIO N3232323232CC CC CC CC C A G G G G CG G AG A A A A A A A AGA AGA AGA e AGCGCAGCGCGCGCGCAGCAGCACdiGCG GCG GCG GCG GGCG ugACCTCTACCTCTACCTCTACCTCTACCTCTQ5E56 7 8 9SDIO N55155 5 51515151151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfA G GGTCCCA G GGTCCCGGTGTCCCGGTGTCCCGGTGTCCQ0E818283848SDIO N0303030303rAG AG TG TG TG egGAGACGCGCGCnCGGe GcT CGGcT TAaACTAaACTAaA ssGCCG TCCTTTGACTTGACTTGACagaGggcgtatpTCGTTTCGTTG A GGCG A GGCGgA GGCQ0E212223242SDIO N3232323232C ACG CCG CCTCCTCCTG AGC C CA A G A AGGAGGAGGA e ACGCCTGCACGCACGTCACGTCA diG ugACG GGCCTCTACGTTGA CCTCTGTTGA GTTGA G GTCA GTCA GTCA Q0E61 2 3 4SDIO N56156 6 61515151151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGGTGTCCCGGTGTCCCGGTGTCCCGGTGTCC CCGGTGTG Q5E868788898SDIO N0303030303rTG TG TG TG TG egCGCGCGCGCGCnTeAssTaACTAgACTAgACTAgACTAgA TGACTTACTTGACTTGACTTGACacaGtatgcacp G A GGCG A GGCG A GGCG A GGCGgA GGCQ5E262728292SDIO N3232323232CCTCCTCCTCCTCCTGCGCAGGC C C CAGGAGGAGGA e GTCACGTCACGTCACGTCACTCA diTTGA GTTGA GTTGA GTTGA G TTGA ugTCTCTCTGTG G A G A G A GCA GCA Q5E66 7 8 9SDIO N56156 6 61515151151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGCTGC CTG GCTGC CTG GCC C C C CTGTG GCTGTG GCTGTG Q0E919293949SDIO N0303030303rACACACACAC eCgACACACCACA neGCCTa A AG CCTA a AG CCTa A AGC Ta AG CssaTAC TA g A GTgG GTaaG GTgaG GggG GTa G apG A AATG A AATG A AATG A AATGaA AATQ0E313233343SDIO N3232323232GT GTTTTTTTT TCGGCGG GG GGTAGAGAGC AGC AGCAC TAC T C T C T CediCTGGCC G CAG CAGAGugTTA GGTGCGCGCCGCTTTATATATA GGTTTGGTTTGGTTTGGTQ0E71 2 3 4SDIO N57157 7 71515151151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGCTGC CTG GCC C C CTGTG GCTGTG GTCGTCCCGTCGTCCQ5E969798999SDIO N0303030303rAeCCACAC gGCACACCACTCCCTCCCTAG CCTAGTA CgAC AG A CAtG negAgA sTAT tGTG s GTG GTG G GCAGA aaggagg CGtCcpGAGAGA aGCcG A ATA ATA ATACG ACG Q5E363738393SDIO N3232323232GTTTTTTGT TAG GG GG GC AGC AGCCG AGGGCG AG G eTCACGTCACGT CCTCTCAGTCATA di TGC TGC TGCCugTTA A AC TGCG ACC TA GGTTTGGTTTGGTGTTG GTTG Q5E76 7 8 9SDIO N57157 7 71515151151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGTCGTCCCGTCGTCCCGTCGTCCCGTCGTCCCGTCGTCCQ0E010203040SDIO N1313131313reCCCCCCCC C gTAC T C T C T CCTACAtG A A A CC AG G G cC AcC AcC AcG nesTG G G G G sCGT T T TcAC GACAGAGA aC C t CGtCC tCcpgGaGcGgGCaG ACG ACG ACG ACG ACG Q0E414243444SDIO N3232323232GTGTGTGT TCG AG GCG AG GG GGGGG GCAGCAGCAG eCTTCACT TCACT TCTCTCATCATA diCCTG ACC TG ACC TG ACC TGC CCTG ugTTTTTTTATA G G G G G G GTG GTG Q0E81 2 3 4SDIO N58158 8 81515151151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGTCGTCCCGCCGTCCCGCCGTCCCGCC CCGTG GCCGTCCQ5E060708090SDIO N1313131313reCC ACACACA gTACA G A G ACG ACG neCTAcG G ACGtG ACGGaG A GGaG ACGGaG s A G G G G G sCGAAG A G AAG A G aCcpAcCG GTcACcCCCTaCtCCCTaACcCCCTtCaCCCQ5E464748494SDIO N3232323232GTGGGGGGG CGG GCGCGCGGCG AG GAG GAG G GAGAeCTTCAC CT TCTCTCTCCTC CTC CTdiCCTGCACT CCT CCT CC CCCCC C C TugGTTGCGTT CGTTCCGTTCCGTTQ5E86 7 8 9SDIO N58158 8 81515151151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGCC CCGTG GCCGTCCCGCCGTCCCGCC CCGTG GGCG GCCQ0E111213141SDIO N1313131313rA egACCAC AC A G ACACACCGGCCA A GCGCG G AGG neGGaA G GGtA G GGAGcGGscG G GaGs AAG AAG A G AAG GCapTcCaCCCTtCaCGCT AtCtCGCTcCaCCCGAttA G A G Q0E515253545SDIO N3232323232GGGGGGG GCGCG GCGCGGCGTCGAGAG G GA A CTCCediCCT TCCC C CT TCTGCTCC CTC CTGTCCT CCT CCT CC CC CCCCCC T CGTug CGTT CGTT CGTT CGTTCTCCGCQ0E91 2 3 4SDIO N59159 9 91515151151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGGCG GCCCGGCG GCCCGGCGCGCG GCCGGCGCCGGCGCCQ5E161718191SDIO N1313131313rGeCC g GAGCCGA G AGACCAGCCAGCCA G AG AG AG neG GGGG G Gg gGgGgssGAGCG GAGCG GgGCG GAGCG GAGCaaataAp G A G A GttA GtcA GctA G A G G A G G A G G A G G A G Q5E565758595SDIO N3232323232GTCGCGCGC CCTCCC TTCCT CCC TTCCT CCC TCCT CG CC TCCT CCCCediGCGCTGCGCTGTCGCTGTCGCTGTCGCTugCTCCGCCTCCGCCTCCGCCTCCGCCTCCGCQ5E96 7 8 9SDIO N59159 9 91515151151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGGCG GCCCGGCGC CG G GGCGTCCCGGC CCGTG GGCGTCCQ0E212223242SDIO N1313131313rGeCC g GAGC CG C A GA CA CA A G GG GG neGGgG AGtGG TCATG AaTTG AaTTssGAGcCGA c GGaCCCAGGCat CAGGCac CAGGgCapG A G A G G A G G A G G GTCG G GTCGtG GTCQ0E616263646SDIO N3232323232GTC CTCTCTCCTCG CTCCCGCATCGCT ATCGCTTCTeCGT C TCCGT CG G AG CG CGG CGGG di CGT CGT C CCCuC CCCCCCgCTCCGCCTCCGCA ACACATCG ATCG ATCG Q0E01 2 3 4SDIO N60160 0 01616161151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGGCGTCCCGGCGTCCCGGCGTCCCGGCGTCCCGGCCGTG Q5E262728292SDIO N1313131313rCA CA CA CA CA egGGTGG GG GG GG neGCAt TG TAt TG AtTTG AcTTG AcTTssAGGCat CAGGCgt CAGGCgc CAGGCgt CAGGgCapG G GTCG G GTCG G GTCG G GTCGcG GTCQ5E666768696SDIO N3232323232TCTCTCTCT GCATGCTGCGCGCCCTCT TCT TCT TCTeGG A A A A CGGG CGGG G G CGG CGGG di CugACCCCACCCCACCCC CCCCCCCCATCG ATCG ATCA G ATCA G ATCG Q5E06 7 8 9SDIO N60160 0 01616161151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uC CfG AGTCCCCG AGTCC CCG AGTCC CCG AGTCC CCG AGTCCQ0E313233343SDIO N1313131313rGeCCGg GAT CC ATGCCGCGC AT CACA neGG G GTGGTtT GtT GtT GcTcTs GsCGTGTGTGTGTagGCGtgGCG caGCGtCG a GtG apA G ACTA G ACTA G ACTA G ACTAgG ACTQ0E717273747SDIO N3232323232GT GT GT GT G ACTACTACACATCG G GT T TG G GGGGG eGCCGC CC CGCGCGCCCCC CCC CCCdiA AT CA G AT CACACACCG ATG ATATugACT CACT CACT CACTGCACTGCQ0E11 2 3 4SDIO N61161 1 11616161151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uC CfG AGTCCCCG AGTCC C C CCA G AGTG G AGTCCCA G AGTCCQ5E363738393SDIO N1313131313rGeCC g A GTGCC ATGCATA GTA CG TCneGcTGGcTGGgTT CAaGT CA GaTsGsCGTGTG GGCGGC CGG CA TTGTTacacgGC aGCAapA G ACTA G ACTAG G ATCAaCGCAtCGCQ5E767778797SDIO N3232323232G ATCG T ATCG A T ATCTG GTAGTGCGGCG GGGGGC CeGCCGC CC CGCC C C CC CCCAT CAT CdiA AT CA G AT CACGAT CA G A GCTCTG ugACT CACT CACT CACGCTACGCTQ5E16 7 8 9SDIO N61161 1 11616161151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfA G AGTCCCA G AGTCCCA G AGTCCCA G AGTCCCA G AGTCCQ0E414243444SDIO N1313131313rATATAC A ATegGCCGTGC CGTGCTCG TCCG GC CGn AaAaA G Aa TAa TeG ssGA TTG GA TTG Ga TG GA TTG GA TTaCa C t CAtTT t cpAcCGCAaCGCAtCCG AcCGCCAaCGCQ0E818283848SDIO N3232323232ATATATATA GGCG GCG GCG G GTCGCGCGC CGGC CG e ACTCCACTCCACTCCACTCCACTCCdiA ugACTG A G A G A G A G C GCTA CTCGCTA CTCTCTCGCTACGCTACGCTQ0E21 2 3 4SDIO N62162 2 21616161151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfA G AGTCCCA G AGTCCCA G AGTCCCA G AGTCCCA G AGTCCQ5E464748494SDIO N1313131313rATCG CG CG C egGCACACACACTG nCeGAaGTGTCCtGGTCGGTCtGG CtGs GA TTGGG CtTGGCTGGGCTGGTs CctaGtttcc Tapc G G T G T G T Ga TAC C CGT CGT CGT CG G Q5E868788898SDIO N3232323232ATGGGGGG G GGCCC C CGC GC C C CACTCCACTCCACTCCAC Ce AC CT CT CACG ACG ACG A G diACuTG ATATATACTgACCTCCGCTCGCTCGCTCGCTG A GCA GCA GCA G Q5E26 7 8 9SDIO N62162 2 21616161151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfA G AGTCCCA G AGTCCCA G AGTCCCAC CG AGTG GACGTCCQ0E515253545SDIO N1313131313rCG C C CCeTGT g ACACTG ACTG ACGneGTCCtGG CtG G C CcG GgG G ACTA ssGGGC T C T CGTTGGGaG T GG GTCG apGCctGTTG cc TCG GG taTTCG GGCTTCGAttG G G GTTQ0E919293949SDIO N3232323232GCCGGCCGGCCGGCCG C C ACTCACTCCACTCACTCCACTCC CA eCCG ACG ACG ACGTG A diATATATATA CGCTGCTGCTGCT CGTugCCA GCCA GCCA GCCA GCTA GGCQ0E31 2 3 4SDIO N63163 3 31616161151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGACGTCCCGACGTCCCGACGTCCCGACGTCCCGACGTCCQ5E565758595SDIO N1313131313rGeCGg ACGACGACGT ACGCGCG GCGCeTA A ACA A A nTaGaGTgGT TgG sGsCAGTGCAGTGCAGTGC gGGCAGTatcccpG G GTTG G GTTGatG GTTGAttG G GTTGtcG GTTQ5E969798999SDIO N3232323232CC CCC CC C C ATCCAT CACTCCACTCCACTCCATG ACTG ACG ACG ACG e diACGCTA C ATC ATCTCugCTA GGCGTGTGTAGTCCTA GGCCCTA GGCCCTACA GGCCTGGCQ5E36 7 8 9SDIO N63163 3 31616161151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGACGTCCCGAC CCGTG GCCGTCCCGCCGTCCCGCCGTCCQ0E616263646SDIO N1313131313rGeCGg ACG GGTTGTGTAC C T TATAG G Gn TgGtGCGC CGC CGCACAC CeGsG GAG aAaA AcA sCAT C TGCGCGCG apGctCG GTTGTG GTCtaGT G AGCtcGT G AGCtaTG AGTQ0E010203040SDIO N4242424242CC CCC CATCATCATCAT CAT CACG A G A G A GTCTCTeCATACCTG CACGCTACGCTACGCTdi CGTAugCTA GGCGTAG AG AG CCTA GG CTCGG CTCTCCCGGCCCGGCCCQ0E41 2 3 4SDIO N64164 4 41616161151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGCCGTCCCGCCGTCCCGCCGTCCCGCCGTCCCGCCCGTG Q5E666768696SDIO N1313131313rGTegGTG GT GTG GT CGTGTCG GCnCGC CGCGC CGCACACA ACCACg A e scAgG GCGGC gA AgG A GGGGCGGCG sCtc CtaCt t cG aC t C c C apG AGTG ATTG AGTG ATTG ATTQ5E060708090SDIO N4242424242ATCATCATCATCATCACTG ACTG ACTG ACTG ACTG eACGCTACGCTACGCTACGCTACGCTdiCuTAG AG AG AG AG g GGCC CTCGG CTCTCTCCCGGCCCGGCCCGGCCCQ5E46 7 8 9SDIO N64164 4 41616161151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfG G AGTCCCG G AGTCCCG G AGTCCCG G AGTCCCG G AGTCCQ0E717273747SDIO N1313131313CT T r C eCC CCC gCCCCCC CCCCC CCnC CTT CTT CTCeGGtTGGtGGtGGc TGGcTsGGTT GG TCGG TCGG TCGTsapAacCAgaGAgcGAaGa GAaTtCGTG GT TGT TGT TGTG Q0E111213141SDIO N4242424242GCGCGCGCG AACC TA ACC TA ACC TA ACC TA A CCC TeGGCCCGGCCCGGCCCGGCCCGGCCCdiA ATCG A G ATCG ATCG ATCG ATCG ugG A G A G A G A G G A G G A G G A G G A G G Q0E51 2 3 4SDIO N65165 5 51616161151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfG G AGTCCCG G AGTCCCGC CG AGTG GACGTCCCGACGTCCQ5E767778797SDIO N1313131313rC CCCC CTegCCCCCC TTGCCC G G nCTe GGc T CTCGGGc T gT T GTGT GTA ssGG TCGG TG C GGC CaACaGGC CGTaa gCCpA GcTGTA GcTGTA GCTTCatGCG GTCacTG GTTQ5E161718191SDIO N4242424242G G G GCCGCCAACCCTA ACCCTA A CCC TATCG ATCG GCCG CCG CA G A G e GCGCGC CAGG GG diA ugATCG A G ATCG A G ATCG GCGA ACCGACA G G A G G A G GTCACGTCACG Q5E56 7 8 9SDIO N65165 5 51616161151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGACGTCCCGACGTCCCGACGTCCCGACGTCCCGACGTCCQ0E818283848SDIO N1313131313rCTCTeC CCTCC C g G GCC G G GGG G G neTCTGT GCTGT GCTGTC TAT GTA ssCaAaAaAaGCCGCCCCGCTgCCGTaCCtt Ctc CctGCcc CatpG GTTG GTTG GTTG GTTG GTTQ0E212223242SDIO N4242424242GCCGCCGCCGCCGCCATCG ATCG ATCG ATCG ATCG A G G G G G GG A A A A eA AGGAGGAGG GG di CGAuC CGACGACGA ACGAgTCACGTC C C CCACGTCACGTCACGTCACG Q0E61 2 3 4SDIO N66166 6 61616161151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGACGTCCCGCTGC CTG GCC CTGTG GCTGTCC CCGCTGTG Q5E868788898SDIO N1313131313rCC GC GC GCGC egGGTG A A AGA ACA A GGG G G GA GG neTCtCA G G sC GGaA GaG A GGG a G GG a A sTGCG GCG G A GCG aCCTpG GTTCCatGACC acCGACC CCttG G AC tcCGACQ5E262728292SDIO N4242424242GCCGCG GCG GCG GCG ATACG GG TCG G TCG G TCG G TCGGGT C T C T C T CediACGA CGC CGC CGCGCCTAC TAC TACCTA TA C T C T CCug C CGCT C CCT C CCT CTCCTCCTCQ5E66 7 8 9SDIO N66166 6 61616161151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGCTGC CTG GCTGC C C C C CTG G GCTGTG GCTGTG GCTGCCQ0E919293949SDIO N1313131313rG egAC GC G A A C GC CA GA A A A A GGGnGG e GGG GGG GG GG A saA GaGG GGCs CA GcA GcA GAaA GCG G G GCGCG GCG apCCctGACC ccCGACCCatG GACCCctGACAaGaTA G Q0E313233343SDIO N4242424242GCG CG CG CG A GTG CG G TG CG G TG CG G TT CG C C CCTe TCGCCTCGCCT C T C TCCGCGC CGCdi TAC TAC TACCTAC TGTugCTCCTCCTCCTCCTCCTCCTCCCTCGCTCG Q0E71 2 3 4SDIO N67167 7 71616161151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfG GCTGCCCG GCTGCCCG GCTGCCCG GCTGCCCG GCTGCCQ5E969798999SDIO N1313131313rCA CA CA CG CA e G g AGGGGGGGGA GGneACAACAG GACAG A GGAGCG A GaACGAA ssGa aACG GCG GCG GaA GaG apAatA Aac A Ata A ACtCtG Atc A GTG GTG GTG GTA GTG Q5E363738393SDIO N4242424242TA TA TA TA A CTC CCTC C CCTC C CCTC C CCTT CC CCTeCGCC TCGCC TCGCC TCGCC TGCCdi TGTuC TGTTGTTGT CTGTgGCTCGGC C C CCTCGGCTCGGCTCGGCTCG Q5E76 7 8 9SDIO N67167 7 71616161151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfG GCTGCCCG GCTGCC TCG AGTCC TCG AGTCC TCG AGTCCQ0E010203040SDIO N2323232323rC e GA CA g AGGGGG CTA CCA TCTCTA CnCACGTG GTeGAA GAtTt TTt T TssGgG GCA A CG GCTA GG CTA GTtCTapACctA ACAGGatAGac AG GttA GTG GTGC CGC CGC CG Q0E414243444SDIO N4242424242TA A GG GG GG CTC CCTT CCTC CCTGTT GTGTCCT CCCC TTCCCC TCCCeCGCGCC T C TTC Tdi TGT CuC TGTCAT CAT CAT CgGCTCGCTGAA GAA GAA GCG A A G A A G A A G Q0E81 2 3 4SDIO N68168 8 81616161151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uC TfG AGTCCTCG AGTCC TCG AGTCC TCG AGTCC T CCG AGTG Q5E060708090SDIO N2323232323rCeTA g GC CTTA CCA TCTCA TC CTCT TnTGTG GTGTe ATtTt TTt TTT gCTssGG CTA GCTA GG CTAcGCTA GGCA atpGCcCAGGGcCtCA GGcCcCAGGGaCtCA GGCTCG A Q5E464748494SDIO N4242424242GTGG GG GG GG G CT C GTGTGTGTG TC CC TTCCCC TCCCC TCCCC TCCCeC T C TTC TTC TTTdiAT CAT CAT CAT CACT CugGAA GAA GAA GAA GAA A A G A A G A A G A A G A A G Q5E86 7 8 9SDIO N68168 8 81616161151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfA G GGTCCCA G GGTCCCA G GGTCCCA G GGTCCCA G GGTCCQ0E111213141SDIO N2323232323rCAC G A CAC C egCCG CCCCC ACC AnT T TGT TGTGT CeGTaTaTa TTa TT GsAACTG AACTG AACTG AACTG Aa TsaaatactaAt CapG A G A G A G A Gt TG A G G A G G A G G A G G A A Q0E515253545SDIO N4242424242TT CTT CT T T CTC CCT C CC TTCCCC TTCCCC T CTC CeACTTCACTTCACTTCACTTCACTTCdiGAA GAA GAA GAA GAA ugACAGACAGACAGAAGAAG G G G G G GCG GCG G Q0E91 2 3 4SDIO N69169 9 91616161151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfA G GGTCCCA G GGTCCCA G GGTCCCG G AGTCCCG G AGTCCQ5E161718191SDIO N2323232323rC CACA AGAA eCACG CCCC CGCG g nTeGTa T TTaGT TTcGTCTACG CA TCG ssAACTG AACTG AACTGaT TGaGTatccacctaC Tp G A G A G A ATAttG A G G A G G A G G G A G GCTQ5E565758595SDIO N4242424242T CT CT T CCCCTC CC TTCCCC TTCCCCTCCTTTCC TeCTTCC T C TA AT CA AT CAT CGAA GAA diGAA GAA GAA AAG AAG ugACAG G GACAG AG G GACG GCCGTGTCCGTGTQ5E96 7 8 9SDIO N69169 9 91616161151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfG G AGTCCCG G AGTCCCG G AGTCCCG G AGTCCCG G AGTCCQ0E212223242SDIO N2323232323rAGAGAGAGAG eg CGCAGCGCGCG neCTACG CT CG CTACG C ATCG CTACGssGaT TatcCTGT TaTaTcTcaCTGTcCGTcCGTt Cat T c T a TpA A A A A G G A G G A G G A G G A G G A Q0E616263646SDIO N4242424242CTCCCCCCCC CAT CTAT CTCTCTC CT CCT CACTTCACTTCACTTCeGAA GAA GAA GAA GAA diAAG AAG AAG AAG AAG ugCCGTGTCCGTGTCCGTGTCCGTGTCCGTGTQ0E01 2 3 4SDIO N70170 0 01717171151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfG G AGTCCCCG AGTCC CCG AGTCC CCG AGTCC CCG AGTCCQ5E262728292SDIO N2323232323rAeg CG A GCTA T GCTA T GCTA T GCTneCTAGTCssc GGAaTGAaTGAaTGAaTTTATATATATGCAGCAGCAGCAG apAtcCTG G ACaTaTGTCaTcTGTCaTgTGTCgTaTGTQ5E666768696SDIO N4242424242CTCCG AAA GAA GAA GAA A AA A A ACTTCCG C G AG AG e GAACGTG TCGTGCTCGTGCTCGTG diAAG A ACT CA ACT CA ACT CATACT CugCCGTGTA ACTA ACTA ACTA ACTQ5E06 7 8 9SDIO N70170 0 01717171151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uC CfG AGTCCCCG AGTCC CCG AGTCC CCG AGTCCCA G AGTCCQ0E313233343SDIO N2323232323rA egGCTA T GCTAT AT TG T GCGCATG G GT TGT TGCneAaT AaT AtAtT CssATCAGATCAGACA TTACA TTGt TA ag g apCc G C g G C aGCac GC GtTaTT T T T T T T TGT TGC TG Q0E717273747SDIO N4242424242GA GA GA GA A A A A A A AG A AA A ACCG C G CAG AGCGTG eCGTG TCGTG TCGTGCTCGTG AC TCdiA ugACT CA CTACT CA CTACT CAC TCT CATCTTACAA A A A A A A A ATG G A Q0E11 2 3 4SDIO N71171 1 11717171151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfA G AGTCCCA G AGTCCCA G AGTCCCA G AGTCCCA G AGTCCQ5E363738393SDIO N2323232323rTG TG TG TG TG egATATATCATATCn GCeGTtCGCTtCGTtCGCTCGTcCsTGTG s AGtTTAGcTTAGTGcTTGTc TAGtTTAGtTapCg C a C g C a C gTC TGC TGC TGC TGC TG Q5E767778797SDIO N4242424242AA AA AA AA A C G G G G AG CGGCCGGCCGGCCGGCCGG e ATCTCATCTTCAC TTCAC TTCATCdiATugAACTATATATACTAACTAACTAACTAACTG G A G G A G G A G G A G G A Q5E16 7 8 9SDIO N71171 1 11717171151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfA G AGTCCCAC CA G AGTG G AGTCCCA G AGTCCCA G AGTCCQ0E414243444SDIO N2323232323rT TTeCT T G TG g ATGCCATGT GT CATATATATGATneGTc g TCaC CaC CA ssAG TTG AGTTTG GATG GATG GaCTacpCCaTG GCCGTG GAaCt TTCGAaCc TTCGA AtCtCTTQ0E818283848SDIO N4242424242A CAG AAGCCGTGCCGTGCCGTG CGTGCCGTG AT T TT T CT CACT CACCeACCACCACACATdiATCuTATCAATAATAACTgAA AATGTGAGTGAGTGA G G A G G A A A A A A A Q0E21 2 3 4SDIO N72172 2 21717171151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfA G AGTCCCA G AGTCCCA G AGTCCCA G AGTCCCA G AGTCCQ5E464748494SDIO N2323232323rTeTgGATTATGTTATGTTATGTTATGTA neGCaCACaCACaCACcCACcCsGATG T GATG G G T GATT GATGATs t T c T c T aTT cTapAc A t A c A t A tTC CGC CGC CGC CGC CG Q5E868788898SDIO N4242424242CCGTGCCGTGCCGGCCGGCCGG CT TTTT TAT CACT CACCAC TCAC TCeACACATCATCATdiAATAATAATAATAACTugGTGAGTGAGTGAGGAGGA A A A A A ATA ATA A Q5E26 7 8 9SDIO N72172 2 21717171151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGGTGTCCCGGTGTCCCGGTGTCCCGGTGTCCCGGTGTCCQ0E515253545SDIO N2323232323rAeg CT AAT CGAACT AAT CGAACT G neTG TGGTTGTG A GTGGTTGGTTGG ssAaCA aat CACAac CAaCA act CACAcc CAaCAgCapG G GTTG G GTTG G GTTG G GTTGtG GTTQ0E919293949SDIO N4242424242ACACACAC CACTCTACTCCTCTACTTACTACTACTeAA A A A A GGA A A A A GGAGGAGGA GA di TAATAATAATAAGTAA ugCTCCGTCTCCGTCTCCGTCTCCGTCTCCGTQ0E31 2 3 4SDIO N73173 3 31717171151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGGTGTCCCGGTGTCCCGGTGTCCCGCC CCGTG GCCCGTG Q5E565758595SDIO N2323232323rAT eg CGAATCT AAT CGGGGG ACGCG TG G a GTTGGTTGGG GCCGG GCG nes CA c A c A aGCaG s ACACACGCG GCG agcpG G GTTGat CG GTTGac CG GTTA aaCGGCA agCGGCQ5E969798999SDIO N4242424242ACCACCACCCCG CCG ATCTATCTG G T ACTG TCG TCeAA AA AACG G GGAGGA GACGGCCGGdi TAATAAGTAACGC CGCugCTCCGTCTCCGTCTCCGTCCGCGCCCGCGCQ5E36 7 8 9SDIO N73173 3 31717171151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGCC CCGTG GCC CCGTG GCC CCGTG GCC CCGTG GCCCGTG Q0E616263646SDIO N2323232323rGeg CG GGCG GGGCG GGCG GGGCG G GGCCa GGCCaGG GCCGGCGGGCG neG ssgCGgGCgGCgG GCaG GggG GCaaG GCagG GCg G apACGGCACGGCACGGCACGGCAaCGGCQ0E010203040SDIO N5252525252CCG CCG C C C GG C G C G C G CGTG CGGTG G G CGGTCGGTCGGTCGCGC C CeC G C G CGG CGGGGdi CGC CGC CGC CGCCCGCugCCGCGCCCGCGCCCGCGCCCGCGCCCGCGCQ0E41 2 3 4SDIO N74174 4 41717171151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGCC CCGTG GCC CCGTG GCCGTCCCGCC CCGTG GCCGTCCQ5E666768696SDIO N2323232323rGG eg CGG CT C GCAGAATA CT C AGA TA CtCGCCaACG CACCaAACG CA neG sAGAaGAGAaG s GGCCGCGCCGCG apACGGCG GCaCaCGCGCaCtCG GCaCCcCG GCtCaCG G Q5E060708090SDIO N5252525252CC GG GG GG GG GGG CGTA CC CCG A CCCG A CCCG A CCCG eCGGCGC GT CGC GT CGCGC GTGTdi CGCugCCGCGC CCTTG GT C CGT C CG CTC CGTCGTTGCGTTGCGTTGCG Q5E46 7 8 9SDIO N74174 4 41717171151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGCCGTCCCGCCGTCCCGCC CCGTG GCC CCGTG GGCGTCCQ0E717273747SDIO N2323232323rCGCT CT CT CTegATAAAGAAGACnCGACGACA AA GeCACGCa CCa CGa TssACaGAaCGAG CCGAG CCGCCGGCaCtpCCtCGCGCtCcCG GCcCaCG GCcCcCG GT aaCATTQ0E111213141SDIO N5252525252AGG GG GG G A G CCCG A CCCG A CCCG A G CCCG ATACA CGT CGT CGCG CG eCG C G C GTGTGCG di CCugTTG GT C CCGTTG GT C CG CTC CGT CCCGTCGTTGCGTTGCGACG G Q0E51 2 3 4SDIO N75175 5 51717171151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGGCGTCCCGGCGTCCCGGCGTCCCGGCGTCCCGGCGTCCQ5E767778797SDIO N2323232323rCTCTCTCT C egACCGTACCGTACCGTA TCCTACGn GaGaGaG GCGa TessCCGGCCCGGCCCGGCCa TCCCGGCapTCatATTT acCATTT taCATTT GCttG ACTT tcCATTQ5E161718191SDIO N5252525252ATG A G A G A G A CTCTCTA ATG A A A A A A A A A G A G AC CCCCCCG ACG ACG eGGGGGCGGCGCG di CCCGT CCCGT CCCGT CC GCGT CC GugACACACA AC TG G G G G GCG GCG G Q5E56 7 8 9SDIO N75175 5 51717171151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGGCGTCCCGGCGTCC CCG GGTCC CCG GGTCC CCG GGTCCQ0E818283848SDIO N2323232323rCTCT G T GTG TegAC C C T T CTT C T TnCeGaGTACGaGTGCAaC G ATG AaCs CCGGCCCGGC C aCGGG GCCCGGCsacaGaG pTaCATTT ccCATTGCaCCTGaCtCGCGCcCCTQ0E212223242SDIO N5252525252ATG ATG AGG AGG AGG A A A A A A A ACGC CCC CCC CCCeGCCA GG CCG GGCCCGGCCCGGCCCdi CCuCGT CCCGTGCGCGGCgACGCTCTCTG GACG G A AGCG A AGCG A AGCQ0E61 2 3 4SDIO N76176 6 61717171151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uC CfG GGTCCCCG GGTCC CCG GGTCC CCG GGTCC CCG GGTCCQ5E868788898SDIO N2323232323rGT eg CT GT CT GT CT GCTT TGCTT TneGTCAa TGTCATGTATG AaC G AaCssGG CC a CCGaCCGCCGGC C CG GGG apGtGCaCGCG GtCtCGCGtCcCGCGcCaCCTGcCcCCTQ5E262728292SDIO N5252525252A G A G A G A G A AGCAGCAGAGAGG CCCC CCC CCC CCCeGCCCGGCCCGGCCCGGCCCGGCCCdiG ugGCT CGCGCGCGGCGCTGCTCTCTA AGCA AGCA AGCG A AGCG A AGCQ5E66 7 8 9SDIO N76176 6 61717171151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfG G GGTCCCG G GGTCCCG G GGTCCCG G GGTCCCG G GGTCCQ0E919293949SDIO N2323232323rCC CC CC C egGT G T G TTG TCC TG TTnCTeTtAC TTtACTtACTcAT CTcAs GCGTGTGCCGCCGTGCGCCGCGTsat Cta Cc C a a CapG G Ga CGaGGt CG G G G G G G G G G GCG G G Q0E313233343SDIO N5252525252ACCACCACCACCACCGCCGC C C CCCCC GCC GCC GCCe GGCC CGGCC CGGCGCGCCGCCGCdiGTugATAGCGTATAGCGTGTGCTATAGCGAACGAACA G A G A GTA GTA G Q0E71 2 3 4SDIO N77177 7 71717171151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfG G AGTCCCG G AGTCCCG G AGTCCCG G AGTCCCG G AGTCCQ0E010203040SDIO N3333333333rGeg CCCGCCCGCCT CGCCCGCCT CneGTCTcA GTTcA G TcA GTTcA G TcAsT C T CsGCAtaCCGCAt C GAT C T C TcC GA cC GA cCac C C a C C t C C c CpG G G G G G G G G G G G G G G Q0E414243444SDIO N5252525252GCCCCGCGCGC CGGCCCCGCCCC GCCCCGC CGC CGCeGCTGCGGTGCGCGCGGTGGTGGTdiAuTACACACACAGCgAATAATAATATG AGCG AGCG AGCA G AGCA G AGCQ0E81 2 3 4SDIO N78178 8 81717171151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfG G AGTCCCCG AGTCC CCG AGTCC CCG AGTCC CCG AGTCCQ5E060708090SDIO N3333333333rGG eg CCCT CCCCCT TT CGTTTTTCG neGCTg C C CsG A C a GCT CCCCGCCa G CCGCaCGC c GTsT CGC C T C C T C CG aCApttG GCCA aaCAGCACatG A GA taCG A GA ccCAGCQ5E464748494SDIO N5252525252GCCCCAT AT AT AT GGGC GTGTGTGTCG GCCGCCGCCeGCT CCG G G CGGCCGGCCGGCCGG diAuTAGCAAG AAG AAG AAG g AGCCCGACCGACGACGA G A G G G GCG GCG G Q5E86 7 8 9SDIO N78178 8 81717171151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uC CfG AGTCCCCG AGTCC CCG AGTCC CCG AGTCCCGGCGTCCQ0E111213141SDIO N3333333333rCT CC CT CT T egTCCCGTCTCGTCCGTCCCGC CCAn GTCCGTGT CGa CessCCgCGCC gGTCCgCGCCgCGTCT GCaaaCpACAGCACttG A GA tcCAGCA ccCAGCGaGaCCTQ0E515253545SDIO N5252525252ATGATGATGATGGGCGCT T T TCG GCCGCCGCCACCC G G G GGC C CGCG eC CGGCGGCGG AA diAAG AAG AAG AAGGCG ugCCGACCGACCGACGACGCG G G G G G GCG GTG A Q0E91 2 3 4SDIO N79179 9 91717171151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGGCGTCCCGGCGTCCCGGCGTCCCGGCGTCCCGGCGTCCQ5E161718191SDIO N3333333333rTT T egCCCCC CCTT TT TT CCCC C C CeT ACAC C C C C Cn sCGa CT GaG T GaACT GaACT GaACsTGCTC CTGCGCG apGaGtCCCGaGcCCTGtGaCCCGTtTGtCCCGtGcCCCQ5E565758595SDIO N5252525252GGCGGCGGCGGCGGCA GCCCG ACC C C CCG ACCG ACCG ACCG A G A G G G eGAGAGAAGAA AA di CCuCGCgGTGCGCGCGCGGCG T GCGCTGCGCGCGCG G A G A G ATG ATG A Q5E96 7 8 9SDIO N79179 9 91717171151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGGCGTCCCGGCGTCCCGCCCGCCCGCC C CCGCCGCCGCCQ0E212223242SDIO N3333333333rT eCTT CA C CA gCCCA CCCCG AGA GAA G G AGG AGA nGa CACGtGtGtG eTsCG T GtA G A G A G sTC CG AGG A G AGG apGcGcCCTGTtGtCCCAaGCaCCCAaCtCCCAaCcCCCQ0E616263646SDIO N5252525252GGCGGCT T T ACACG GGG G GGGGGCCGCCGCTCTCTeGAA G GAA GCCC TTGCCC TTGCCTTdi CCuCGCgGTGCCG GC TTC TTCCTTG AGTG ACTCC C CCGCTCCGCTCCG Q0E01 2 3 4SDIO N80180 0 01818181151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGCCCGCCCGCCCGCC C C C C C CCGCCGCCGCCGCCGCCG G Q5E262728292SDIO N3333333333rC CC C CA CGA egGAA GA GAA G AG AGA AG AGA G G AGnG G AGtGtGtGgG e G AGtG A G A G A sGG s AGG A G A G AGG ACatGt cCpAa C A Gtt G A c C A c C A CCC C C C C C C C C C C C C CA Q5E666768696SDIO N5252525252TG TG TG TG T GC GCTGC GCTGC GCTGC GG CTGC GCTeG CC TTG CC TTG CC TTG CC TTG CTTdi CTTuC C TTC TTC TTCCTTgCTCCGCTCCCGCTCC C CCGCTCCGCTCCG Q5E06 7 8 9SDIO N80180 0 01818181151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGGTGTCCCGGTGTCCCGGTGTCCCGGTGTCCCGGTGTCCQ0E313233343SDIO N3333333333rCeg CGCGCC CGGCCGCGCCGGCCGnGCaA GCCaA GCaA GCCaA GCCG esACA A A A A A A AaA sGC CGC CGC C C CA apAaCaTTCAaCtTTCAaGCcTTCAtCaTTCA GtCtTCTQ0E717273747SDIO N5252525252CACACACAC GCGTGCGTGCGTGCGTAGCGTG G G G G e ACGCTACGCTACACACGCT GCTCTdi TGCGGTGCGCGCGGCGGTGGTGGTugTCTCTCT TGG G G G G G GCG GCG G Q0E11 2 3 4SDIO N81181 1 11818181151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGGTGTCCCGGTGTCC C C C C C CCGGTGTG G GGTG G GGTCCQ5E363738393SDIO N3333333333rCeg CGGCCGGCGCGCCGCGCACAGCAA GCtG GGCneCACaA ACCGGCCssACaGACACG ACACGCACAaCG AaCG at cAaapACcTTCACaTTCACCTTCCTG A G GCTatG G G Q5E767778797SDIO N5252525252CACGTCACGTCACGTTC C ATCA G G G GCCGCTCCGTeACGCTACGCG T ACCG TCCGT CCGTdi TGCugTCGGTGCGGGTGCGC CGGGCGGCG GTCG GTCG GGTGGCGTGGCQ5E16 7 8 9SDIO N81181 1 11818181151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uC C C CCfG GGTG G GGTCC CCG GGTCC CCG GGTCC C CCG GGTG Q0E414243444SDIO N3333333333rGeg CACAGCAAGCAAGCAAGCACA n GG eCAasC CGCAGCaCGCAGaCCGCAGCaCGGCAaCs A G ACG A G ACGCG aactaCpCTG G GCTG G GCTttG G GC tcTG A G GC caTG G G Q0E818283848SDIO N5252525252TC CCATC CCATC C ATC C ATC C A CCGCG CCG CCG CCGCTCC TCTCTCTeGTGTCGTCGTCG diGGuC CGGCGGCGGCGG TCgGTGGCCGTGGCCGTGGC CCGTGGCGTGGCQ0E21 2 3 4SDIO N82182 2 21818181151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uC C C CfG GGTG GCTCGCCCGCTCGCC T C TCGCCGCCGCCGCCQ5E464748494SDIO N3333333333rGeg CACT A C TCTC TC AAACAAAGAnGG e AtCCCAG GGCaAG G G GGaACA GGCaA G GGa CG ssACG A G A G A G AAG aCpCTGAG GCtATaCACC AtTtCG ACtTcCACCcTaCACQ5E868788898SDIO N5252525252TC CCA GGA GGA GGA GGA CGTGTCGGTCGGTCGG CG eCCGTTdiGG C T TC TCT TC TCT TTC TCTCuC C C C C C C C CTCgGTGGCGTC TTCAGTC TTTTTTCAGTCCAGTCCA Q5E26 7 8 9SDIO N82182 2 21818181151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGCTCGCCCGCTCGCC T C T C C CCGCCGCCGCCGCCG G GCCQ0E515253545SDIO N3333333333rTC TC TCegAGAAGAACTCACCTCCn ACACAG AG ACeGGaG GGaG GGtACACG ACssAAG AAG AAG GGtAaA G G G ac c tpCTtCACCTcCACCTaCG AC AtTtCG AA GCttG G A Q0E919293949SDIO N5252525252GGA GGA GGA GGA G GTCTGGTCGGTCGGTCGGTCTTCeCT TC TCT TC TCT TC TCTCCCTCTdi CCugGTC TT C CTT C CTT CTCTTGTCTCCA AGTCCAGTCCAGTCCA G G G Q0E31 2 3 4SDIO N83183 3 31818181151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uC CC CC C C C C C C C C C CfG G GCCG G GCCG G GCCG G GCCG G GCCQ5E565758595SDIO N3333333333rCeTCg AC CCTCCCTCC CCA TC CTCCneAGaACACAGaACA AGaAssGCAC CACAGtAAGtACGGG GGG G G GCGGG atcpACG G AACctG G AA ccCG G AA GCttG G GA tcCG G A Q5E969798999SDIO N5252525252GTCTG TGTCGGGGG G CTTTCTC GTCCTTC TTC TTCeCCTCT CCTCT CCTCT CCTCT CCTCdiGTCTCGTCTCGTCTCGTCTCG C TTugA A A AT CA G G G G G G G G G G G G G G G Q5E36 7 8 9SDIO N83183 3 31818181151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uC CCfG G GCCC CCG G GCCCA GGTGCCCACA GGTGCCGGTGCCQ0E616263646SDIO N3333333333rCeTgCCCTCG AC C CC AG CC C ACG CC AneAGTtACA AGtACCC TCa C T CCCCssGGG GG AaG AGACA AGACA AaACapACctG G AA ccCG GatG GacG GGttG G A A A G A A G A A G Q0E010203040SDIO N6262626262GTCTG G TT TT TT TGTCTT C TCTC CC TCTC CC TCTCeCCTC CTCCTC CTG C TTG C TT CCTTdiGuTCT T T CCAT CAGT CA g AGTCCA GG G G G G G G G GGCGG G GGCGG G GGCQ0E41 2 3 4SDIO N84184 4 41818181151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfA GGTGCCCA GGTGCCCA GGTGCCCA GGTGCCCA GGTGCCQ5E666768696SDIO N3333333333rG egCAG CC C AG CC C ACG G CC A C C AnT C T C T T C T CCe ACaCaCa CCt CCt CssAGACA AGACA AGACA AGACAGACatcpG G GctG GccG GatA G GacG A A G A A G A A G A A G A A G Q5E060708090SDIO N6262626262TT TT TT TT T CTCTC CC TCTC CC TCTCC T TCT CT TCeGC TTG C TT CGC TT C CGC TT C CCTTdi TCAT CAT CAT CAGT CA ugGG GG GG GG G GGCG GGCG GGCG GGCGG G GGCQ5E46 7 8 9SDIO N84184 4 41818181151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uC TfGCTGC TGC TGC TG G G GCCG G GCCG G GCCG G GCCG G GCCQ0E717273747SDIO N3333333333rAG AG AG AG A egGACGCGACGCGGCneCC C CA CC CA A TasGC TCa C T aCCCTCaCCCTCaCCs AaaACAG atACAG aAAGt AAGt Aac C a C t CpA A A A A G A G G A G G A G G A G G A G Q0E111213141SDIO N6262626262CCTC CCTCTCCCCCCTCTCTCTCTCT CTT CTT CTTeGTCCAGTCCAGTCCAGTCCAGTCCA diGG ugG G GGG GGG GGG GGG GGTCTG GGTCTG G G GGTCTGGTCTGGTCTQ0E51 2 3 4SDIO N85185 5 51818181151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uC TfGCTGC TGCGACGA G G GCCG G GCCG G GCCG G GCCG G GCCQ5E767778797SDIO N3333333333rA egGG AG AG AG AG ACGACGACAG A neCTCaCCCTCaCCCTCaCCGAGCGGGACssAGAAG AGCTaCCCCTaCCCatc CcaACpA A ActACAaaG A G G A G G A G A GACAatA GACQ5E161718191SDIO N6262626262CCTC CCTCTCCCC CC TCTCTTC CTTTGTCTG TTCTeGTCCAGTCCAGTCC CACA A GGGGG diGG G G GGG GGG GGCGGGGG GG T G TCugGTCTGGTCTGGTCT C CTT C CTTQ5E56 7 8 9SDIO N85185 5 51818181151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGACGACGACGACGA G G GCCG G GCCG G GCCG G GCCG G GCCQ0E818283848SDIO N3333333333rAG AG A AG AG egAGGAGGAG G AG AG n GA e ssCTaCGACGGCGGCGAGCCCCCTaCCCCTAaCA CCTaCCCCTaCCCaactaCp A A GACA A GACAttA GACAtcA GACAcaA GACQ0E212223242SDIO N6262626262CC CC CC CC C GTTCTG TTCTG TTCTG TTCTC GTTCTeGCA GGGCACACACA GGGGGGGGGG diGGCGGCGGCGGCGGGGT G T G T G TCug C CTT C CTT C CTT C CTTGCTCTTQ0E61 2 3 4SDIO N86186 6 61818181151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGA G G GCCCG G GGTCCCG G GGTCCCGCGCG GGTCCG GGTG Q5E868788898SDIO N3333333333rAG GC G GC GC egAG AGG ACG A G AGG n GGesCACA aCGGt GCAG GGt GCAG GGt GCAG GtCGCsTC CCCC CCCCC Ca ct Taa C Tat CCTac CCTga CpA A GACA G A A G A A G A A G A Q5E262728292SDIO N6262626262CC GT GTGTGT TTCTCCTGCATCGCATCGCGATCCA e G A G G G GG G diGGGG G G G G C GGTCG T GGTCG T GGTCG T GGTCGT C C T C C TTug C CTT C C C C C CCCCCTCCCCCTCQ5E66 7 8 9SDIO N86186 6 61818181151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfG G GGTCCCGC CGC CG G GGTG G GGTG G GGTCCCGGCCGTG Q0E919293949SDIO N3333333333rG egAC GC GC GC G GG AGG AGG A G GACG n AGGCAGt GCAGGAG GGAGaG e GtG ssCCC CCGcCGcCA CCCCCGAGCaTgt C Tgc CCTaa CCTat CaapA G A A G A A G A A G ACTGCCQ0E313233343SDIO N6262626262GTCC TGTCC TGTCC TGTCTTCA A A ACGG GG G G G A GGe G G GG GG GGGdiGGTCG T GGTCG T GGTCG T GGTCTGT CCC TTugCCCCTCCCCCTCCCCCCTCCCCCTCCCGCCQ0E71 2 3 4SDIO N87187 7 71818181151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGGC CCGTG GGC CCGTG GGC CCGTG GGC CCGTG GGCCGTG Q5E969798999SDIO N3333333333rG egGACG G GACGAG G G GCG GAGACneGAaGaGCG G A G A G AaG AGtG AGtG ssGAGCA GAGCA GAGCAAGCAAGCaaggaggGaaGapCTGCCCTGCCCTGCCCTGCCCgTGCCQ5E363738393SDIO N6262626262TC TC TC TC T GGA GGA G A G A C G A GGGGG G G G G GGGGeGGT CGT GT CGCGCGCTGTT GTT GTdi CCuC T CCT CCT CCT CC TTgCCGCCCC C C CCGCCCCGCCCCGCCCCGCCQ5E76 7 8 9SDIO N87187 7 71818181151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGGC CCGTG GGC CCGTG GCC CCGTG GCC CCGTG GCCCGTG Q0E010203040SDIO N4343434343rG egGAG CG GAG CG GC G A GC GC A G A neAGtG AGsGAtG GA A A A AGACaG G G ACaG G G ACaG G s GAC CA G AGG AGG agaGGpCTGCCC ggTGCCGtCaCCCGtCgCCCGcCaCCCQ0E414243444SDIO N6262626262TC TC GG GG G GGA GGA G G G G G G G GG GTCGG G GTCGTCTGGTCTGGTCTediGCC TTGCTTC C T C C T C TCCCC CCCC C CCC C CCC CCCug CGC CGCCTGT CCTGT CCTGTCCQ0E81 2 3 4SDIO N88188 8 81818181151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGCC CCGTG GCCGTCCCGCCGTCCCGCC CCGTG GCCCGTG Q5E060708090SDIO N4343434343rGC GCGCG egGAA GCGCGC G A GC G AA neACaG GA C sGG AtA GA G ACtA GA G ACtG G G ACtG G s A G A G A G AGG AGG GcGCgCCCGtGt c cap CaCGCGCgCGCGCaCCCGCgCCCQ5E464748494SDIO N6262626262GG GG GG GG G G G G G G GG GGTCTGGTCTGGTCTGGTCTGGTCTeG G G G diCCCCTCC C T C C T C C T C Tug T TCC C C C C C C C CCC C CCGCCTGTCCCTGTCCCTGTCCCTGTCCQ5E86 7 8 9SDIO N88188 8 81818181151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGCC CCGTG GCC CCGTG GCCGTCCCGCC CCGTG GCCCGTG Q0E111213141SDIO N4343434343rC eCCCCC CCC G g GC CGC CGCGCGCCA G GCnCGCGCeAG GAA G GAA A Ga aAaAassGG AGG AaA G G G G A G AGG A G apAaGtCGCAaGcCGCAGtGtCG AtGG GcCGCAcGtCGCQ0E515253545SDIO N6262626262GGGGGGGGG GTCTGTCTGTCTGTCTGGTCTeCCCCTCCCCCTCCCCCTCCCCCTCCCCCTCdiCTGTCCCTGTCCCTGTC C G C C G CuC T T C T T CgG G G G G G G G G G G G G G G Q0E91 2 3 4SDIO N89189 9 91818181151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGCC CCGTG GCC CCGTG GCC CCGTA G GCTGCCCA GCTGCCQ5E161718191SDIO N4343434343rC e GCC g GC CGCC A GC CGCC CCCCCCGCG GC AnCGCe GAaG GAgA G GAgA G GCtCACssAGG A G AGG GCA G G GtCA apAccGAGat GAacGAaaG AatG GC CGC CGC CA A G A A G Q5E565758595SDIO N6262626262G G G GTTGTTGGTCTGGTCTGGTCTCC CCTCC C T C C TCCCTCCCCCTCe C C C C C C CC G C G CdiCTGTCCCTGTCCCTGTCT T CCT T CuCgGGTGGGTGG G G G G G G G G G G G G Q5E96 7 8 9SDIO N89189 9 91818181151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfA GCTGCCCA GCTGCCCA GCTGCCCA GCTGCCCA GCTGCCQ0E212223242SDIO N4343434343rCCC G CGC G CC eCgGC AC C CCC C CAnCGCGCGCGCCeGCtss CA GCAtCGCtACGCAtCGCtA G G GCA G A GCA GCG aactaCp A G A G AttG AtcG AcaG A A G A A G A A G A A G A A G Q0E616263646SDIO N6262626262GTTGTTGTTGTTGTTCCCCTCCCCCTCCCCCTCCCCCTCCCCCTCeCG C C G C C G C C G C G Cdi TT C T T C T T C T T CCT T CugGTGGGTGGGTGGGGGGGG G G G G G GTG GTG G Q0E01 2 3 4SDIO N90190 0 01919191151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGCTA GCCCGGTGC CTG GGC C C C CTGTG GGTGTG GGTGTG Q5E262728292SDIO N4343434343rCeCGCG g AG G G AG G G G GG A GCCA G GG AGG CCC CGC GCCGCC CGCC CG neG ssGtCA GaCACGaCACaGCACaCACapActG GtaA GtgA GcaG A GcgA A A G G G G G G G G G G G G G Q5E666768696SDIO N6262626262GTTCCCCCCCCCCCCTC CCTGC C C TC C GTC C GTC C GTCGC TGC T C T CeCG C GGGGGGG GG di TT CugGTGGTGGTGGTGGGTGG G GCCGCTCCCGCTCCCGCTCCCGCTCQ5E06 7 8 9SDIO N90190 0 01919191151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGGTGC CTG GGTGC C C C C CTG GGTGTG GGTGTG GTCCGTG Q0E313233343SDIO N4343434343rG egAG G G AG GG GG G G A CG GG AGG GGG CCGC GCCGCC CGCC Cg G AG GG neg A g A g AstCA CaG s GC CaGCtCgGCcCaGcC CgCaAapG A G A G A G A GtCG G G G G G G G G G G G GCA Q0E717273747SDIO N6262626262CCCCCCCCCGCGC TCCC GC TC C GC TC C G CTCT TCCT T C C CG G GT TG G eGGGGGGGGGGTG di TGGTGGTGGTGGCGGTugCCGCTCCCGCTCCCGCTCCCGCTCCCCCCCQ0E11 2 3 4SDIO N91191 1 11919191151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGTC CCGTG GTC CCGTG GTC CCGTG GTC CCGTG GTCCGTG Q5E363738393SDIO N4343434343rGG G egGGG GG GG G G G G GG GG G G GGG A G AGG G GG G neCGaGsCG aCaA GC GaA GC GgA GC GgG sC ACCCgACCCgACCCaACCCaAapGcGtGcGtGcCGCA GCA GCA GCA GCA Q5E767778797SDIO N6262626262CTGTC G C G C G C GGCCT TGCCT TCTCTCGC TGC TGCeG G G G G G TG G GTG G G G GTGG TGG TG di CGT CGT CGT CGT CGGTugCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCQ5E16 7 8 9SDIO N91191 1 11919191151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGTC CCGTG GTC CCGTG GCC CCGTG GCC CCGTG GCCCGTG Q0E414243444SDIO N4343434343rG egGG GG CA CA CA G GGG GTGGTGTAG G G G A G G G G neCGgGC GgGG GG G AaG AaGG sCG AaG sCC ACC A CCG GCG ag C g C CaaC a C gp G GtCG A GcCA G AAC gCG AAC aCG AACQ0E818283848SDIO N6262626262CTGTCCCTGTCCTTCTTCTTCGGG GG GG G G G G G G G e G G G GTTGG TGCG GTTCG GTTCG GTdi CGT CGGTCuC CC CCC CCCgCCCC C C C CCCCCCCCCCACCG ACCG ACCG Q0E21 2 3 4SDIO N92192 2 21919191151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGCC CCGTG GCC CCGTG GCC CCGTG GCC CCGTG GCCCGTG Q5E464748494SDIO N4343434343rCA C egGGTGATC GATC GATCA GGTGGG GG GG GG G neAaGG GG sCG AtG AtG G AGtG G G AtG sCGCCGCCGCGCG aCgg Caa CagCCgaCCggpG AACG AACG AACG AACG AACQ5E868788898SDIO N6262626262TTCTTCTTCTTCTTCGGG GGG GGG GGG GGG G G G G G eTCG GTTCG GTTCG GTTCG GTTCGTdiCCCCCCC CCCCC CCCCC CC GCCCCugCCCCCCCCCCA G A G A G ACG ACG Q5E26 7 8 9SDIO N92192 2 21919191151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGCC CCGTG GCC CCGTG GCC CCGTG GCC CCGTG GCCCGTG Q0E515253545SDIO N4343434343rACC AG ACC AG ACC AG AC CAACC egn G e GGa TG G GGa TG G GGa TG G GG GaTGAGGssGG Gt TG AGG AGG AGG A GGG aapCCaCG ACaCgCG ACgCaCG ACgA CgCG ACaCaCG A Q0E919293949SDIO N6262626262GGG GGG GGG GGG GGG TCG GGTTCGGTTCGGTTCGGTTCGGTeG G G G Cdi CC C C C C C C C C C C C CugAC C C C C C C C C C C CCC CCCTGTACCTGTACCTGTACCTGTACCTGTQ0E31 2 3 4SDIO N93193 3 31919191151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGCC CCGTG GCC CCGTG GCC C C C C C CCGTG G AGTG G AGTG Q5E565758595SDIO N4343434343rAeg CC GACC GACC C AG A AC CGACG n GA e GGt TGA G GGt TG G GGt T CAAss aGG GaGT CGAaGTAGG AGG G GGG GGG CCGgA GgGaGaapCgACCaCACCgCAACaCGACgCG G Q5E969798999SDIO N6262626262GGG GGG GGG G G TCGGTTCGGTTCGTGCGGTTCGGTeG G G CTCC C C C C C CCCCCCCCCCCCdi CugAC C CCCTGTAC C CCCCTGTAC CA A CCTGTC CTGTCTGTCG GCCG G Q5E36 7 8 9SDIO N93193 3 31919191151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uC C C CC C C C C C C C C C CfG AGTG G AGTG G AGTG G AGTG G AGTG Q0E616263646SDIO N4343434343rC eACACACAC gACGACGACGCGAG nCA Ae GaGCGGT C C C CATAaGAaGTGAaG AtGsG GTGTs G G G G GGG G G GGG atpACaCGGGAtCgCG GAcCaCG GAcCgCG GAaCaCG G Q0E010203040SDIO N7272727272TCG GGTTCG GGTTCG GGTTCG G GGTTCGGTeCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCdiACTGTACTGTACTGTACTGTAC GugCCCCCCC CT TG G G G G GCG GCG G Q0E41 2 3 4SDIO N94194 4 41919191151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uC C C CfG AGTG GACGTCCCGACGTCCCGACGTCCCGACGTCCQ5E666768696SDIO N4343434343rC eA CGCGCGCgACGCAC C C C C CGCnCeGAtGTACCtGAA CGAA CtGAA CG ssGGaG GG GCT tGGCTGG GCT tGGTapACgCG GaG AaCG GGaG AtCG GaGG AcCG GtG AaCG G Q5E060708090SDIO N7272727272TCG CTCTCTCTGGTCG CCG C G G CCC CCCCCC C C C CCCC CC C C C C C C Ce CAC GAC GAC GAGdiACTGTCC T TGCC T TGCC T TC CCT TugCCGTGTGGGG G G G G G G GTG GTG Q5E46 7 8 9SDIO N94194 4 41919191151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGACGTCCCGACGTCCCGACGTCCCGACGTCCCGCCCGTG Q0E717273747SDIO N4343434343rCG eCGCCG gCCCGCCG AC CGCCGAneACA CCtGAA CCtGAsGCCtGAA GCCtGCAG Aa CAG s GGGGTGGTGGT CapGGttTGtc G Gca G GctG GaaGTACG ACG ACG ACG G G G Q0E111213141SDIO N7272727272CTCTCTCTCCG CC CG CCG GCCCCC C C C C CCCC CCCCCC C C C CA e AC GAC GAC GAG C CTGTdiCCT T T T T TCT T CGCCGCCGCCG GG ugGTGTGTG G TG G G G G G G GTGT CG Q0E51 2 3 4SDIO N95195 5 51919191151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGCC CCGTG GCC CCGTG GCC CCGTG GCCGTCCCGCCCGTG Q5E767778797SDIO N4343434343rCG CG CG C egCCGACCCGACCCGA CG CG CGA CCGAn AaAaAa CACAa CeAGAs AGAGAaGAG sCA atGCTacGCTAt GCAt GCAt Gaa T t T c TpG G G G G G G G G G G G G G G G G G G G Q5E161718191SDIO N7272727272CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCA A A A A eCCTGTC CTGTC CTGTC CTGTCTGTdi CGGCugGT CG GGCGGCGGCCGG T GGTTCG GGTTCG G G GGTTCGGTTCG Q5E56 7 8 9SDIO N95195 5 51919191151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGCC CCGTG GCC C CCGTG G GGTCC CCG GGTCC CCG GGTCCQ0E818283848SDIO N4343434343CG CGGT GTGT r egCCGACCCGAC CG GCGCG G GG GG neAaAaCCGCCCCG sAsCAGAGt A GGCAAC CAtACt AAC Caca TctGT Cta CCtt CtcpG G G G G G G G G G G G G G G G G G G G Q0E212223242SDIO N7272727272CCCCCCCCCCCCCCCCCCCCCA AC G CT AC GTCTGTA CCTGTA CCTGTeCTCT CGGCGGCG di CGGCugGT CG GG GTG GTG GGTG T GGTTCG GTCCCGCTCCCGCTCCCGCQ0E61 2 3 4SDIO N96196 6 61919191151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uC CfG GGTCCCCG GGTCC CCG GGTCC CCG GGTCC CCG GGTCCQ5E868788898SDIO N4343434343rGeg CGT CGGT GCGGGGG CGG GGCGCCGA CG CGGCCGA CG CGA CG CGG netssAC CGt A tCcCAC CACGACGcACaCca Cct Ccc CtaACCttpGGG GG G GTG G G G GTG GTG G G Q5E262728292SDIO N7272727272CCCCCCCCCCCCCCCA CCTGTAC GTAC GTAC GTAC GTGCTGCTCTCTe CGCGCGGCGGCG diGTG GTG GTG GTG GGTG ugTCCCGCTCCCGCTCCCGCTCCCGCTCCCGCQ5E66 7 8 9SDIO N96196 6 61919191151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGGTGC CTG GGTGC CTG GGC C C CTGTG GGTGTG GGTGTCCQ0E919293949SDIO N4343434343rGT GT GT GT G egGCGGGGGGGG GG TG GaGCGaGCGaGGCGaGGCG GtG nessCCAACCCAACCCAACCCAACCCACapACatG G GA acCG G GACgtG G GA gcA C G G GACatG G G Q0E313233343SDIO N7272727272AGAGAGAGA CCCT TCGCT TCTCTC GTGCTGCTGCTG e G GTGCG GTGCGCGCG GTGG TGTG di TCGT CGT CGT CGGT CG ugCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCQ0E71 2 3 4SDIO N97197 7 71919191151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGGTGC CTG GGTGTCC C CCGGTGTG GCCGTCCCGCCCGTG Q5E969798999SDIO N4343434343rGT GT GT A egGCGGGG GG GGCAG GGCGtGCG GtGGCGtG GG TaG GTaG nessCCAACCCAACCCAACGG C GGG CGG aacpACG G GACgtG G GA gcCGGG GCaCtCACCaCcCACQ5E363738393SDIO N7272727272A A A CGG CGG CCCTGTCGCTGTCGCTGTG GTCG GTCG e GCGCGTGTGG TGG TGCG CTCCG Cdi TCGT CGT CGCC C CCCCCC C C C CC Cug C C C C C CCCCCCCGACCTGACCTQ5E76 7 8 9SDIO N97197 7 71919191151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGCCGTCCCGCCGTCCCGCCGTCCCGCC CCGTG GCCGTCCQ0E010203040SDIO N5353535353rAC AG AG AG AC e GG GCGCGGCGG g n GG eTCG GG TaG GG TaG GTaG GG TCtssGCaG G G G GGCGGGCGGGCGGGCG aGt t cGpCCtCG ACCcCACCcCtCACCCcCACCaCtCG A Q0E414243444SDIO N7272727272CGG CGG CGG CGG CGG GTCG GTCG GTCG GTCG GTCG eTCG CTCCG CTGTGTG CCC CCC CCCdiCCC CCC CCC CCC CCCCACACAC C CugGCCTGCCTGCCTGACCTGACCTQ0E81 2 3 4SDIO N98198 8 81919191151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGCCGTCCCGCC CCGTG GCC CCGTG GCC CCGTG GCCCGTG Q5E060708090SDIO N5353535353rA egGGCCC C AGGAC CC C G AGGAC GnGG e ssGTtG G G GGa CGG GC CGCGG GaG G GGaG G GGaG CGG G G GGG GGG GG aaaapCCcCACCCG A ACCatG A AC acG C G A AC taCG A A Q5E464748494SDIO N7272727272CGG G G G G G G GTCGT TCCGT TCCG GT TCCG GT TCCG eTCG CC CCCCC CCCCC CCCCC CCCCdiCuCCCg GAC CACACACA CCTGCC CTCTCTCTCGGCCCGGCCCGGCCCG Q5E86 7 8 9SDIO N98198 8 81919191151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGCCGTCCCGCC CCGTG GCC CCGTG GCC C C CCGTG G GGTG Q0E111213141SDIO N5353535353rC egAC C G AC CC C G AGGAC GACAC Cn GG e GGCGGC CGCA saG GGaG G GGaG G GGaG GG aGCsGGG GGG GGG GGG GTG apCCttG A AC tcCG A AC caCG A ACCctG A AG aaCG G G Q0E515253545SDIO N7272727272GTCG G G G G G G C GTCGTCTCTCG TCC TCCCC TCCG CTCCGCC C CC CCCeCCCC CCC CCC CA di CACACACAG C CTugGCC CTCTCTCT C CCGGCCCGGCCCGGCCCG G GGTQ0E91 2 3 4SDIO N99199 9 91919191151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uC C C CC C C C C C CfG GGTG G GGTG G GGTG G GGTCC C CCG GGTG Q5E161718191SDIO N5353535353rAeCAg AC CACAC CAG CACACA ACACeGGA ACAC CACn GCGGCGGCGGGCssGaTG GaGTG G GaTG G GaGCG GaTG apGCatG G GG acCG G GG taCG G GG TCttG G GG tcCG G G Q5E565758595SDIO N7272727272TCC CCGTCC CGTCCGTCCGTCCG CCCCCC CCCC CCCCC CCCCC CCCCeACACCACCACCA diGCCC TGCCC TGCCC TGCCC TG C CTugG GGTG GGTG GGTG GGC CTG GGTQ5E96 7 8 9SDIO N99199 9 91919191151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uC C C CC C CfG GGTG G GGTG GGCG GCCCGGCGCG GCCGGCGCCQ0E212223242SDIO N5353535353rAeCAg AC CACACGG G AAC AG GG CAA n G e Ga GC CCAGGCCa C CA Ca C CCCa CssGTG GaTA G GGGCA GGGCA GGGCacaG pGCG G GGCctG GaaG GatG GacG G G G G G G G G G G G Q0E616263646SDIO N7272727272TCC CGTCG C C C CCCCCC C CCCCCC CCCCCC CCCCCeCCACCCCACA GC CTA GC CTA GC CTdiGuCCC TG CCCC T C CgG GC CGC CG G GGTG GGTGGTTCG G GGTTCGGTTCQ0E01 2 3 4SDIO N00200 0 02020202151t / eoi1g tis9r3atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA ll uCfGGCG GCCCGGCG GCCCGGCGCGCG GCCGGCGCCGGCGCCQ5E262728292SDIO N5353535353rGG G egAAC AG GG GG GG CAAC AAC AnC C CAC C C CACe ACaCaCa CCa CCa CssGGGCA GGGCA GGGCA GGGCA GGCacapG G GctG GccG GgaG G GgtG G G G G G G G G G G G G G G G Q5E666768696SDIO N7272727272CCCCCCCCC CCCC CCCCCC CCCCCC CCC CCC CCC CA eGC CTA GC CTA GC CTA GC CTA GCTdi CCugG GC CGC CGC CGCCCG GGTTCG GGTTCG GGTTCG G GGTTCGGTTCQ5E06 7 8 9SDIO N00200 0 02020202151t / eoi1grtis93atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA Q ESDI N6 6 6 6 6 6 6rTGGA G TG TG GTG egCTAATGATATACTAAC AAATATATA n ACGCTA a ACG c ACGT CG A ACG c ACG a A eaTCTATGTT TGcTCTcTCTTT TGTT TG ssGcaA GgaCTAagA GaaG AcaggAagA apACG A A G A G ACTACG AACA A G A G ACTA G ACTQ9203132 3 4 5ESDIO N767673673673673676CCCGTTCTAT ACTCCCGTCCCGTAT ACTAT ACTTATACTAGT TA ATeCAA ATACTACGA GA AATA GA ATATGA GA diAGATA A A A ATATA GA gT TGCGGCCG GA GA ATTCACC TG GCCCGCCCG uC G T TATCCTGTACTGTATTATCTTATCQ7 8 9 0 1 2E8 8 8 9 93SDIO N66666669 96666666151t / eoi1grtis93atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA Q ESDI N6 6 6 6 6 6 6rGA GT GA A TG TG G eg TGAATT TGAGTGAC CTAACTAATACneCTA g ACGA t AA ACTCTAA GCG A G ACATssATGTTTgGaG G ATATcTCTgTCTGaCTapGgcCTAgcACGaaCTGacCTG ACgtG AA acATcCA G AC tA A G A G A A G A A G A G AT TA Q6373839 0 1 2ESDIO N767673674674674676TCTTACATCCTCTCC GCC G TAA e AATAATTGTA AC TAAT TA ACTTC TTAC TC TTACCCCGTAA GA A A A ATATTTA diGCGGTA CCGGA CGGGA A C G AA A AA AACTugTT C CTCG G G TATATCTTTCACTTTCACCTGTG ACTGTG AGCAA G G Q4 5 6 7 8 9E9 9 9 9 90SDIO N66666669 06666676151t / eoi1grtis93atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA Q ESDI N6 6 6 6 6 6 6rGA TGGA GTGT A G eg TGACTAATGAATAA TTGTGACATACneCTA ssAaA G TG ACCTA a ACG a ACG AA A G ACTTGgTCTATGTT TGTTtTAgTG GaCTapGcaCTACatA GaaCTAgaA CaaGacCTATtTAACG G AC aA A G A G A A G A G A G A AT TA Q3444546 7 8 9ESDIO N767674674674674676TCTTACCC GCTATCATCCTTAA e AATTC TTTACTACAATAATGA AATTGTA ACAAT CCCGTAA AATA GA GA ATTA diGCGG GAAGA CGGTA CCGTA CGA C G AACTugTT C CCTGTATT CACTCCG G TAGTTATCTCTATCTTTCACGCAA G G Q1 2 3 4 5 6E0 0 0 0 07SDIO N76767670 06767676151t / eoi1grtis93atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA Q ESDI N6 6 6 6 6 6 6rTGCGCG GTT G GA egCTAATAC TACATACG TAACTACGAG neACa G A sCGTG A G CCGA G A GTA g GTcC T cG ACcCGTcC C GtA s GT T T T T TGT T T TCa aATtATtA ATt aG pAaCA A A AgaG ACTaTACTcTA G ACTACctA A A G ACTaTA GgTCTQ0515253 4 5 6ESDIO N767675675675675676CC GAA AA ATCCC GAA TACTC TTTCC TCGCCCGAATTC TTCCCGAATA e AC TTCTTGATACTAA AT TATA GA ATTTA G diGTCTTA ACTC GG AA AA AACAA AAT TA ugCTGTG AGCAA G GGCAACG GTCG G T ATCCTGTG AGCAA G GTCCTCCQ8 9 0 1 2 3E0 0 1 1 14SDIO N76767671 16767676151t / eoi1grtis93atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA Q ESDI N6 6 6 6 6 6 6rGAC CT eCGA GA GA gGTAGTACGTACG ATCTGAGGAGGAG neC GtA ATTCA GgCTATTaCTGTa TGtATGtATGcA A G TAAA GACTCACTCACTCA ssAgG A aC CaA c AaAC cg G AaG AaG AgG apGT T T TGCTaTGTT CA GaTCTGcTCTGcTCTQ7585950 1 2 3ESDIO N767676676676676676TACAA AA GA TACTACTACAATTACC TCGT CCG CG TAA AATAATAATGAT TT CCGAA AA AA e GTATACGTG G G G G diCTGTA AACTAACTTTAC CTGTCTGTCTGTug CCTCCGCG GGTA A A T AA CAA AA G G G A ATCCTCCTCCTCCTCCTCCQ5 6 7 8 9 0E1 1 1 1 11SDIO N76767672 26767676151t / eoi1grtis93atop63O W10 / 220-ETA K:.o NtekQcoESDIDyenrottA Q ESDI N6 6 6 6 6 6 6rGACAA GA GA TA T egGnTAGTACGCAAGAGGAG ACTACTCTessC GcA ATTCA GgCT TGCC TGtATGcA GTTaCTGTaATTaTGCTCACTCAAAAA GA apAcG A GccTCTCTaTA GctG AcG AgGCGtG G G G GcTCTgTCTTTcCACTaTgCG G G A Q4656667 8 9 0ESDIO N767676676676677676TACAA CCTACTACGGA GA ATT TC T TG AACCCGT CTTAA AATAATAA e GAGTTACCA A GAA G GAA GCCCGT CCCGTdiCTGTA AACTA G ACTGTACTGTTTATTA uT C C GAA G A GC G T C C T C CAACTAACTg C T C CG GT T T C T C C T CG A A G A A Q2 3 4 5 6 7E2 2 2 2 28SDIO N76767672 267676761 851DI001010180te 4 4 4 4 4 / 19 gr363O W10 / 220-ETA K:.o NtekcoDyenrottA s ecneu q esAtCc c t T G GcCTTTCTCTGCTTTNrRieTGAg AGCT ATCT ATCTT TG A mneGTTCTGTTGTTG GGTA A ACyrssG aapAcA CAcCTGGaG GGcA A G GGaA G GaA GCcA GCaA GCaAAlCAcCTpmeDI465 6 7 8969696 6xe Q: 6 6 696960EO 1SN 1pTC C CT o AACACACA AA TCCA AGAGAG CA :7AGTATATAT CAC GT ACTACTATeleA bdiACTGTGC C CA TAC GAGACTGTaTugGTA GCCCTGT TCA ACTGT TCA ACTGTA A A AGTGCCQ :556 7 8858585985ESDIO N6 6 6 6861 0 5 7 8 6 051 / 19363O W10 / 220-ETA K:.o NtekcoDyenroQttESA eg C TCTG G G ACTTneTTG G ATGA GCA GGTCTGTTG ssA apGaA GCA ATc CGCAAGCgG AAa aA AGaA CTcGCCCGcTTAaCAtACG ATgA G G GCaG A DI960Q:971727374769696969696ESO N CCA GA GCTT ATGCCAG TACA A G A TCTACACCACA GTA TCAGC ATeACGT TC GATA ACACACA AGATG ACTG GATGT Cdi TugCTGCTGTCCTG AT CACT TACTTACTATCGTACCTTACG A A A G A G G ATA A Q:061626364 5ESDI86 6O8 8 8 8 8N6 6 6 6 6 61 1 5 0 5 1 851 / 19363O W10 / 220-ETA K:.o NtekcoDyenroQttESA egA CTGCTTCTGAnCeTTTTGCTTAGTTAATAATG ssGA GCA AGapAc cA GCATGcA GCcA GTaA GAcCTaGCG GCaG AAcCTcGCA GTgA GACAaCTDI576Q:977787970869696969696ESO N C A GACCT A GA C AA AGTTCG A A AG TGGTCA ATCCA ACTTATACTGGTCCACTCG ATediTA CGCTATAG GCACG TACTACTGA GAT TA A GCTGAT CG ATugTTACACTACTCTA ACTACTTTACA AGTA GCCQ :667686960 1ESDI87 7O8 8 8 8 8N6 6 6 6 6 61 1 6 0 1 8 651 / 19363O W10 / 220-ETA K:.o NtekcoDyenroQttESA egACCATAC TAGA neTTTCTGTTGTTCG TA TT TGTssGaA AgA AGaAGtGCaA AAA apATA GTA GCG ATAA A CGgTA GaG AgG GgA GgAC a TAaG DI182 3Q:98 848586869696969696ESO N C C T ATGCCA A AATG AGT CAC TA TCAG GT ATCCACTA TeGTACA AC G CCTACTGA ACTGTATA ATGACTACTACTG GATdi CG ugTTACACTTACT TCTGCT CG ATTCACTTACAGTAC TA A G A A A A GC TG A Q:273747576 7ESDI87 7O8 8 8 8 8N6 6 6 6 6 61 6 7 5 5 4 751 / 19363O W10 / 220-ETA K:.o NtekcoDyenroQttESA egA GGCTGCTG G G neCTG GTsCAA AA A GA GTsA CG ACaaA ATcGCcA GCgA ATATtpG ATaA GCCGtCTACTgGCACTaGCCTaTGCCCGcCTDI788 9 0Q:98 8 9192969696969696ESO N TCG GCTGA GA AT GCTTA A TC CATCGTG GA A ACATG A CCATTTCCCA e AG CGAC TCCTTAGATA ATG AAGAAG CCA ATG di CACTACTG GATGTA G ACTG ugTTG A G ATCCTACTCTA ACTGCA ATCA G ATCQ :879708182 3ESDI88 8O8 8 8 8 8N6 6 6 6 6 61 7 0 6 5 6 851 / 19363O W10 / 220-ETA K:.o NtekcoDyenroQttESA eg CTGGTACTG A A neGTsCTTGCTG AACTG GGTsATAGaA AAaA GCgA AAaA GCaA apCcCGtCTG GCcG G A ATcA GACTaGCG ATaA GACAaCTDI394 5Q:99 969798969696969696ESO N GCTCCT ATG GATG A ACTCA A A A G A CGTTT CAT CCA CA ACCTTCCGGACTATCCA ATeATGCATA ATA diAGAGA AG G CTGACTGTGCT CCTGT CACTATugG ATCCTA ATTA G ACTA ACTTTA G AGTA GCCQ :485868788 9ESDI88 8O8 8 8 8 8N6 6 6 6 6 61 7 7 1 1 6 451 / 19363O W10 / 220-ETA K:.o NtekcoDyenroQttESA egGG GCACT ATA G neGTCGTgC TT CTTTCTG A GA ssATAGT TGaaATGtAAgA ACTpCtCGtCTCTCGTTA GTgA A G GTaA G A ATaA GCTaTGCDI990 1Q:90 020304060707070707ESO N GCTGCTC C A A ATG T A AGTGT CA GA CA CACA A ATCA ACTACT TC TG e AC CTA AG GG GTATG A ATGTACTTACTGATCCA diACTG ACTGCG ACGCACTA G ugG ATCG ATCTTACATTACA ATTA G AGCA ATCQ :091929394 5ESDI89 9O8 8 8 8 8N6 6 6 6 6 61 5 4 1 4 1 751 / 19363O W10 / 220-ETA K:.o NtekcoDyenroQttESA egCTG G GCGACGG neAA A GATAATssGC CATGTTC TGCaaA ATGg TAT TGA A pACTaGCCTgTGCGCGCCTCTcTGCAcTGTgA GCtCGtCTDI506 7 8 9Q:00 0 0 00170707070707ESO N G TA A C A C CG GT A AA GT A AGGCTATTA CGGTGTCG A A TTeCACTTACG ACTT TA GTCCA G AG CCA ACGTCCATACTATG diGATA AG GCT CA AGCG ACTG ugCTACTGCATCA ACTGCATCTTACA A A G ATCQ :697989990 1ESDI80 0O8 8 8 9 9N6 6 6 6 6 61 2 5 7 1 1 151 / 19363O W10 / 220-ETA K:.o NtekcoDyenroQttESA egCTA CTG GG GA GA A e A GTsCACG n GCATAC Cs ATTATacG GCcA ATtGTtG p G GAcTCACTcGCCCGcCTGCGcTCGCTtGTGTCGtCGcTCDI112 3 4Q:01 1 1516170707070707ESO N GCC C C TG GA GTAA AA AA GTCG A TTA AGGGGGG CCTTCAT T TeACCG G G CCCG CTT CTT C TdiGTCA A AGATG ACGACGT CGATCGTCTGCT CCT CACT CugACA ACTA ACTA G ATCG A ACTG A ACTG A ACTQ :203040506 7ESDI90 0O9 9 9 9 9N6 6 6 6 6 61 8 4 1 7 751 / 19363O W10 / 220-ETA K:.o NtekcoDyenroQttESA egAG G GAGA AGCGA n A e GGTGACTC ATCAG TTtCA ssGCaATGTt TGtGCAATGtG apACACC c G G G TACA GCG ACA AT T C C t CGaA GTG GgA DI718 9 0 1Q:01 1 2 22270707070707ESO N T AA A C T GT AA CAGCA CCATATCGGTGTCC CGCTTCCAGTA G A A ACA eC T CATA A diATGTTACTTG G CACG AC GCCA TACTACCTCCCA TACTugGTACCGCATCGTCTTCGTACGG T GA G A A A GTAC C TG Q:809001112 3ESDI91 1O9 9 9 9 9N6 6 6 6 6 61 4 4 1 3 751 / 19363O W10 / 220-ETA K:.o NtekcoDyenroQttESA egG A A n A GGTAGCTTeAGCA GACACTGCATTCTA AG ssATgG ATaG GTt C aC GtGG CapC TC C T C G G T T GTACAC aCCT a T T a T C a C T cA GaA GtA DI324 5Q:02 262728270707070707ESO N A GT AT C AT AA CA CGCTA GA ACTTCGTCGGTG GATCCA ACTA A GTA eTTC T CTTCG GAA CCATCCA ACG TTACACT C T CdiA AG A AG GCT CCCATACTGG ugGCATCGCATCA ACTA A G A GTCGTA A G G GCTQ :415161718 9ESDI91 1O9 9 9 9 9N6 6 6 6 6 61 1 7 2 7 251 / 19363O W10 / 220-ETA K:.o NtekcoDyenroQttESA egGG CTGAGCTTCTneACT TA CTA GAC TCAACTAG G ssGTapGc TGtG ATaGGcGG CATaG CGaCTA GCaA G A GAaTCA GCgAC gA GCCtG A GAcTCDI920Q:031323334370707070707ESO N C AA CAGG CA CGCG GTTGTCC TGTCTCCAGTACTG eCG A TTCGATTCACCGAA CTTCCG CACTACT CCACT C T CACT CdiA ugGCTC TA GTCC TACTGG GTCTTCGTAACATCGTA ACTAA A A G A A G G GCA A Q:021222324 5ESDI92 2O9 9 9 9 9N6 6 6 6 6 61 2 6 2 1 351 / 19363O W10 / 220-ETA K:.o NtekcoDyenroQttESA egCTG CCTGCGA A G neGACG ATGACACTGGCCTCTA ssATaGCAa TATG GTt gA GCG apG GAaTCCTAaTTGaGAtTCGCGaTCG GAcG AaG GTcGTDI536Q:037383930470707070707ESO N C T GTG AC G AA G GCTGTGG GTG GGCGCCG CTTA C ACTTTCG ACTTC CCAC C TATACeACTCGA ACT C T CG A CTCGCT CdiG A ugACATCATG GTCCACT C C CATCTGTACA GCTCTGGCCA A A A A A A A ACA A Q:627282920 1ESDI93 3O9 9 9 9 9N6 6 6 6 6 61 2 7 6 4 251 / 19363O W10 / 220-ETA K:.o NtekcoDyenroQttESA egCTG G AGTAC CTG neGAsCsAT G Ga GC CTCA G gTGcGATAACAGCa TATgGTA TA apG GAtTCG GAtA A G GCcA ACTAaTTCTTcCTGG GaTACDI142 3Q:04 444546470707070707ESO N T C A GTG GGC CGA A A CCTTCGTCTA TTCGCATTA C ACGTCG C ACTA A GAC TCATACCeACdiGTCA CTC CACTGATCCACTTugACATC C CCTGGTA A CTCGTA ATG A G GCCCTGTGAT GA A A A G ACAC TG A Q:233343536 7ESDI93 3O9 9 9 9 9N6 6 6 6 6 61 7 7 7 3 6 751 / 19363O W10 / 220-ETA K:.o NtekcoDyenroQttESA egTCCC T GA G AT CneCT CTCC TCG GCCCATAATCTss CCaC CCgGTGtG GCCAt CCCpACgCG GACCcGTA GCcA AaA GTtG GCTAaTTACgCG G DI748 9Q:04 405152570707070707ESO N GA GA CAGTC G ACGA AGATTCG GTA GTGGT CCTAGTeCCCCGTCCCCGA T G ATCCA G A AC C GdiA A GCA TACG ACC CAC C TGG GT TTAGTG AGG ugCCAGCCAGTCGTACCCA ACTGTCAG G G G G G A A ACG G Q:839304142 3ESDI94 4O9 9 9 9 9N6 6 6 6 6 61 7 3 3 351 / 19363O W10 / 220-ETA K:.o NtekcoDyenroQttESA egGCnTA A A AA AGCTTeCACTG AGCG G GCA CTATAG ss TGacG GCAAtTCTCTaC G CapACA AcTG GGTTaC T GT CCCGgA GtG GaGTGT T aA GtA DI354 5Q:05 565758570707070707ESO N C TAGTTGC CCT CAT AT ACTACTCGCACCTG T GG GA G A ACAC T TATeGA AC T CGCGA CCACTGCT CGCGCTTATTAC T Cdi TA A ATC CCTCCACCACTGG ugTCGTGCCA A A A A A A A A ACTG G A G G A G G GCTQ :445464748 9ESDI94 4O9 9 9 9 9N6 6 6 6 6 61 6 651 / 19363O W10 / 220-ETA K:.o NtekcoDyenroQttESA egACAGCG G GA A GCGCneGG GGCGGT TssGGA GA GC CA A A AGgGgA AaTTTa C a T C a TapGAcG G G GAtG G G GGaG G GAtA GCTAaTTCTAgTTDI950 1 2 3 4Q0606 6 6 6: 7 707070707ESO N CCCTCCCTC CCT AC AC G CGGTGGCGCGCTGCTT CC GCG ACACA A T A A eTTTTACdiGC CACCA CCTCGCCGCCGCA CTCTC CA A AGAGACCT CG ATG ATG ugCTGCCCTGCCACTGCTAGCACTGTACTGTQ :05152535455ESDI9 95O9 9 9 9N6 6 6 6 6 61 6 6 3 651 / 19363O W10 / 220-ETA K:.o NtekcoDyenroQttESA egG G ACA GCn GCeG CAG ATGCA AT CGCTG GTAAGGA ss C a T CAtAAaTGC CAa TGgG apCTAgTTCTAaTTG GGTgA G GaTG GCTAgTTGA GtaGCDI566 7Q:06 686960770707070707ESO N AC AC CCCGTACCCCGCTGCTG GCTA ATGGCTGTGGeCA A A CAACCA ACATATCCA ACT CT AGAG GCGCGCT C CA AG GCdiATG ATG ACCTATC TGCCT CugACTGTACTGTACTGCCA A A A ACTGTCTGCCQ :657585950 1ESDI96 6O9 9 9 9 9N6 6 6 6 6 6151 / 19363O W10 / 220-ETA K:.o Ntekco Dye9 0nr : 8292oQO7 7ttESDIN A GGGg GAT GGGg G T GCTtcCCGCA TatCTATTAC TCACTGGGCACTGGG CTAC TGCG AGTGG CC GCCTAC CGCTGA C C GA CTATAG AC GCGT C CGC C TACC A G C G GCT C C CCACGGGC CTCTGACGAGGGCGATCT CT CG GCGTACGCGTATC 4TCGGCCGATGGCGA22GACCCGT GGC ATGCA CCGTG TTTTCGCCTGGATTTTCllCCGTAGC CTCCCG AGCufGCGACCTGGA CCG A G GCAC TG : O0818QN1717ESDIcGt G GT rGTTG TeC T C TgA nessG GCCAGGCCTGTg gA apAA GAG GtG GaG DI172Q:07707ESO N T T GCGCGCGCACA ATACTeA CTC A CTCdi C C CGCugCTAGCCTG AGCQ :263ESDIO969 N6 6 Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application Brief Description of the Drawings FIG.1 shows a schematic of knockdown of DUX4 mRNA. FIG.2 is a schematic of lentiviral constructs used to screen miRNAs. FIG.3 is a graph of FACS sorting of positive and negative populations with miRNA sequences. FIG.4 is a graph showing top miRNA sequences based on enrichment. FIG.5A-B show graphs of DUX4 expression of DUX4 and DUX4 downstream gene hZSCAN4 in FSHD patient myotubes transduced with miRNA candidates. FIG.6A-D show graphs of DUX4 and DUX4 target gene expression in patient myotubules following lead candidate transduction. FIG.7A-B show volcano plots of RNAseq results of off-targets by candidate miRNAs in human primary myotubes. FIG.8A-6B are graphs of skeletal muscle mRNA and liver capsid DNA expression following MyoAAV administration to non-human primates (NHPs). FIG.9 shows immunofluorescent imaging of bicep tissue following MyoAAV administration to non-human primates (NHPs). FIG.10 shows a study design in mice after injection with a candidate miRNA. FIG.11 shows a graph of FSHD composite gene expression following tamoxifen induced DUX4 expression and administration of vehicle and a lead candidate. FIG.12A-B show graphs of DUX4 and mKif4 expression in mouse triceps following administration of candidate miRNA sequence. FIG.13 shows images of muscle degeneration in mice following tamoxifen induced DUX4 expression and administration of vehicle and the lead candidate. Arrows show area of active degeneration. FIG.14A-B show graphs of results from treadmill assessments of mice following tamoxifen induced DUX4 expression and administration of vehicle and the lead candidate. FIG.15 shows a study design in older mice after injection with a candidate miRNA. FIG.16 shows a graph of FSHD composite gene expression following tamoxifen induced DUX4 expression and administration of vehicle and the lead candidate. FIG.17 shows images of muscle degeneration in mice following administration of vehicle and the lead candidate. Arrows show area of active degeneration. Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application Detailed Description The present invention provides novel nucleic acid molecules and methods that result in changes to expression of DUX4 that result in treatment of FSHD. Nucleic acid molecules of the invention comprise an miR scaffold and a miR guide sequence that targets a double homeobox 4 (DUX4) transcript. By targeting DUX4 transcripts, the nucleic acid molecules of the invention result in an appropriate expression profile for the DUX4 gene. Adeno Associated Virus Vector AAVs are particularly appropriate viral vectors for delivery of genetic material into mammalian cells. AAVs are not known to cause disease in mammals and cause a very mild immune response. Additionally, AAVs are able to infect cells in multiple stages whether at rest or in a phase of the cell replication cycle. Advantageously, AAV DNA is not regularly inserted into the host’s genome at random sites, reducing the oncogenic properties of this vector. AAVs have been engineered to deliver a variety of treatments, especially for genetic disorders caused by single nucleotide polymorphisms (“SNP”). Genetic diseases that have been studied in conjunction with AAV vectors include Cystic fibrosis, hemophilia, arthritis, macular degeneration, muscular dystrophy, Parkinson’s disease, congestive heart failure, and Alzheimer’s disease. The AAV can be used as a vector to deliver engineered nucleic acid to a host and utilize the host’s own ribosomes to transcribe that nucleic acid into the desired proteins. See, e.g., West et al., Virology 160:38-47 (1987); U.S. Pat. No.4,797,368; WO 93 / 24641; Kotin, Human Gene Therapy 5:793-801 (1994); and Muzyczka, J. Clin. Invest.94:1351 (1994). AAVs have some deficiency in their replication and / or pathogenicity and thus can be safer that adenoviral vectors. In some embodiments, the AAV can integrate into a specific site on chromosome 19 of a human cell with no observable side effects. In some embodiments, the capacity of the AAV vector, system thereof, and / or AAV particles can be up to about 4.7 kb. The AAV vector or system thereof can include one or more engineered capsid polynucleotides described herein. AAVs are small, replication-defective, nonenveloped viruses that infect humans and other primate species and have a linear single-stranded DNA genome. Naturally occurring AAV serotypes exhibit liver tropism. As a result, transfection of non-liver tissue with traditional AAV vectors is impeded by the virus’s natural liver tropism. Moreover, because the liver acts to break Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application down substances delivered to a subject, transfection of non-liver tissue with unmodified AAV vectors requires higher dosing to provide sufficient viral load to overcome the liver and reach non-liver tissue. More than 30 naturally occurring serotypes of AAV are available. Many natural variants in the AAV capsid exist. AAV serotypes include, but are not limited to, AAV serotypes AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV 12, AAV13. AAVs may be engineered using conventional molecular biology techniques, making it possible to optimize these particles, for example, for cell specific delivery, for minimizing immunogenicity, for tuning stability and particle lifetime, for efficient degradation, for accurate delivery to the nucleus. AAV vectors can be specifically targeted to one or more types of cells by choosing the appropriate combination of AAV serotype, promoter, and delivery method. Previous approaches to identify AAV sequences correlated with tropism have relied upon the comparison of highly related extant serotypes with distinct characteristics, random domain swaps between unrelated serotypes, or consideration of higher-order structure, to identify motifs that define liver tropism. For example, mapping determinants of AAV tropism have been carried out by comparing highly related serotypes. One such example is the single-amino acid change (E531K) between AAV1 and AAV6 that improves murine liver transduction in AAV1. See Wu et al. (2006) J. Virol., 80(22):11393-7, incorporated by reference herein. Another example is a reciprocal domain swap between AAV2 and AAV8 that alters tropism, but fails to define any robust specific tissue-targeting motifs. See Raupp et al. (201) J. Virol., 86(l7):9396-408, incorporated by reference herein. Further, global consideration of structure has only highlighted gross differences between better- or worse-liver-transducers that are more observational than useful in practice. Nam et al (2007) J. Virol., 81(22):12260-71. AAVs exhibiting modified tissue tropism that may be used with the present invention are described in U.S. Patent No.9,695,220, U.S. Patent No.9,719,070; U.S. Patent No.10,119,125; U.S. Patent No.10,526,584; U.S. Patent Application Publication No.2018-0369414; U.S. Patent Application Publication No.2020-0123504; U.S. Patent Application Publication No.2020- 0318082; PCT International Patent Application Publication No. WO 2015 / 054653; PCT International Patent Application Publication No. WO 2016 / 179496; PCT International Patent Application Publication No. WO 2017 / 100791; and PCT International Patent Application Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application Publication No. WO 2019 / 217911, the entirety of the contents of each of which are incorporated by reference herein. The AAV vector or system thereof may include one or more regulatory molecules, such as promoters, enhancers, repressors and the like. In some embodiments, the AAV vector or system thereof can include one or more polynucleotides that can encode one or more regulatory proteins. In some embodiments, the one or more regulatory proteins can be selected from Rep78, Rep68, Rep52, Rep40, variants thereof, and combinations thereof. In some embodiments, the muscle specific promoter can drive expression of an engineered AAV capsid polynucleotide. The AAV vector or system thereof can include one or more polynucleotides that can encode one or more capsid proteins, such as the engineered AAV capsid proteins described elsewhere herein. The engineered capsid proteins can be capable of assembling into a protein shell (an engineered capsid) of the AAV virus particle. The engineered capsid can have a cell-, tissue-, and / or organ-specific tropism. The AAV vector or system thereof can be configured to produce AAV particles having a specific serotype. In some embodiments, the serotype can be AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-8, AAV-9 or any combinations thereof. In some embodiments, the AAV can be AAV1, AAV-2, AAV-5, AAV-9 or any combination thereof. One can select the AAV of the AAV with regard to the cells to be targeted; e.g., one can select AAV serotypes 1, 2, 5, 9 or a hybrid capsid AAV-1, AAV-2, AAV-5, AAV-9 or any combination thereof for targeting brain and / or neuronal cells; and one can select AAV-4 for targeting cardiac tissue; and one can select AAV-8 for delivery to the liver. Thus, in some embodiments, an AAV vector or system thereof capable of producing AAV particles capable of targeting the brain and / or neuronal cells can be configured to generate AAV particles having serotypes 1, 2, 5 or a hybrid capsid AAV-1, AAV- 2, AAV-5 or any combination thereof. In some embodiments, an AAV vector or system thereof capable of producing AAV particles capable of targeting cardiac tissue can be configured to generate an AAV particle having an AAV-4 serotype. In some embodiments, an AAV vector or system thereof capable of producing AAV particles capable of targeting the liver can be configured to generate an AAV having an AAV-8 serotype. See also Srivastava.2017. Curr. Opin. Virol.21:75-80. It will be appreciated that while the different serotypes can provide some level of cell, tissue, and / or organ specificity, each serotype still is multi-tropic and thus can result in tissue- Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application toxicity if using that serotype to target a tissue that the serotype is less efficient in transducing. Thus, in addition to achieving some tissue targeting capacity via selecting an AAV of a particular serotype, it will be appreciated that the tropism of the AAV serotype can be modified by an engineered AAV capsid described herein. As described elsewhere herein, variants of wild-type AAV of any serotype can be generated via a method described herein and determined to have a particular cell-specific tropism, which can be the same or different as that of the reference wild- type AAV serotype. In some embodiments, the cell, tissue, and / or specificity of the wild-type serotype can be enhanced (e.g., made more selective or specific for a particular cell type that the serotype is already biased towards). For example, wild-type AAV-9 is biased towards muscle and brain in humans (see e.g., Srivastava.2017. Curr. Opin. Virol.21:75-80.) By including an engineered AAV capsid and / or capsid protein variant of wild-type AAV-9 as described herein, the tropism for nervous cells might be reduced or eliminated and / or the muscle specificity increased such that the nervous specificity appears reduced in comparison, thus enhancing the specificity for muscle as compared to the wild-type AAV-9. As previously mentioned, inclusion of an engineered capsid and / or capsid protein variant of a wild-type AAV serotype can have a different tropism than the wild-type reference AAV serotype. For example, an engineered AAV capsid and / or capsid protein variant of AAV-9 can have specificity for a tissue other than muscle or brain in humans. In some embodiments, the AAV vector is a hybrid AAV vector or system thereof. Hybrid AAVs are AAVs that include genomes with elements from one serotype that are packaged into a capsid derived from at least one different serotype. For example, if it is the rAAV2 / 5 that is to be produced, and if the production method is based on the helper-free, transient transfection method discussed above, the 1st plasmid and the 3rd plasmid (the adeno helper plasmid) will be the same as discussed for rAAV2 production. However, the 2nd plasmid, the pRepCap will be different. In this plasmid, called pRep2 / Cap5, the Rep gene is still derived from AAV2, while the Cap gene is derived from AAV5. The production scheme is the same as the above-mentioned approach for AAV2 production. The resulting rAAV is called rAAV2 / 5, in which the genome is based on recombinant AAV2, while the capsid is based on AAV5. It is assumed the cell or tissue-tropism displayed by this AAV2 / 5 hybrid virus should be the same as that of AAV5. It will be appreciated that wild-type hybrid AAV particles suffer the same specificity issues as with the non-hybrid wild-type serotypes previously discussed. Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application Advantages achieved by the wild-type based hybrid AAV systems can be combined with the increased and customizable cell-specificity that can be achieved with the engineered AAV capsids can be combined by generating a hybrid AAV that can include an engineered AAV capsid described elsewhere herein. It will be appreciated that hybrid AAVs can contain an engineered AAV capsid containing a genome with elements from a different serotype than the reference wild-type serotype that the engineered AAV capsid is a variant of. For example, a hybrid AAV can be produced that includes an engineered AAV capsid that is a variant of an AAV-9 serotype that is used to package a genome that contains components (e.g., rep elements) from an AAV-2 serotype. As with wild-type based hybrid AAVs previously discussed, the tropism of the resulting AAV particle will be that of the engineered AAV capsid. In some embodiments, the AAV vector or system thereof is configured as a “gutless” vector, similar to that described in connection with a retroviral vector. In some embodiments, the “gutless” AAV vector or system thereof can have the cis-acting viral DNA elements involved in genome amplification and packaging in linkage with the heterologous sequences of interest (e.g., the engineered AAV capsid polynucleotide(s)). The vectors described herein can be constructed using any suitable process or technique. In some embodiments, one or more suitable recombination and / or cloning methods or techniques can be used to the vector(s) described herein. Suitable recombination and / or cloning techniques and / or methods can include, but not limited to, those described in U.S. Application publication No. US 2004-0171156 A1. Other suitable methods and techniques are described elsewhere herein. Construction of recombinant AAV vectors are described in a number of publications, including U.S. Pat. No.5,173,414; Tratschin et al., Mol. Cell. Biol.5:3251-3260 (1985); Tratschin, et al., Mol. Cell. Biol.4:2072-2081 (1984); Hermonat & Muzyczka, PNAS 81:6466- 6470 (1984); and Samulski et al., J. Virol.63:03822-3828 (1989). Any of the techniques and / or methods can be used and / or adapted for constructing an AAV or other vector described herein. AAV vectors are discussed elsewhere herein. In some embodiments, the vector can have one or more insertion sites, such as a restriction endonuclease recognition sequence (also referred to as a “cloning site”). In some embodiments, one or more insertion sites (e.g., about or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application 10, or more insertion sites) are located upstream and / or downstream of one or more sequence elements of one or more vectors. Delivery vehicles, vectors, particles, nanoparticles, formulations and components thereof for expression of one or more elements of a engineered AAV capsid system described herein are as used in the foregoing documents, such as International Patent Application Publications WO 2021 / 050974 and WO 2021 / 077000 and PCT International Application No. PCT / US2021 / 042812, the contents of which are incorporated by reference herein. Additional AAV vectors are described in International Patent Application Publication WO 2019 / 2071632, the contents of which are incorporated by reference herein. Further AAV vectors are described in International Patent Application Publications WO 2020 / 086881 and WO 2020 / 235543, the contents of each of which are incorporated by reference herein. Further AAV vectors are described in International Patent Application Publications WO 2005 / 033321; WO 2006 / 110689; WO 2007 / 127264; WO 2008 / 027084; WO 2009 / 073103; WO 2009 / 073104; WO 2009 / 105084; WO 2009 / 134681; WO 2009 / 136977; WO 2010 / 051367; WO 2010 / 138675; WO 2001 / 038187; WO 2012 / 112832; WO 2015 / 054653; WO 2016 / 179496; WO 2017 / 100791; WO 2017 / 019994; WO 2018 / 209154; WO 2019 / 067982; WO 2019 / 195701; WO 2019 / 217911; WO 2020 / 041498; WO 2020 / 210839; U.S. Patent No.7,906,111; U.S. Patent No. 9,737,618; U.S. Patent No.10,265,417; U.S. Patent No.10,485,883; U.S. Patent No.10,695,441; U.S. Patent No.10,722,598; U.S. Patent No.8,999,678; U.S. Patent No.10,301,648; U.S. Patent No.10,626,415; U.S. Patent No.9,198,984; U.S. Patent No.10,155,931; U.S. Patent No. 8,524,219; U.S. Patent No.9,206,238; U.S. Patent No.8,685,387; U.S. Patent No.9,359,618; U.S. Patent No.8,231,880; U.S. Patent No.8,470,310; U.S. Patent No.9,597,363; U.S. Patent No.8,940,290; U.S. Patent No.9,593,346; U.S. Patent No.10,501,757; U.S. Patent No. 10,786,568; U.S. Patent No.10,973,928; U.S. Patent No.10,519,198; U.S. Patent No.8,846,031; U.S. Patent No.9,617,561; U.S. Patent No.9,884,071; U.S. Patent No.10,406,173; U.S. Patent No.9,596,220; U.S. Patent No.9,719,010; U.S. Patent No.10,117,125; U.S. Patent No. 10,526,584; U.S. Patent No.10,881,548; U.S. Patent No.10,738,087; U.S. Patent Publication No.2011-023353; U.S. Patent Publication No.2019-0015527; U.S. Patent Publication No.2020- 155704; U.S. Patent Publication No 2017-0191079; U.S. Patent Publication No.2019-0218574; U.S. Patent Publication No.2020-0208176; U.S. Patent Publication No.2020-0325491; U.S. Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application Patent Publication No.2019-0055523; U.S. Patent Publication No.2020-0385689; U.S. Patent Publication No.2009-0317417; U.S. Patent Publication No.2016-0051603; U.S. Patent Publication No.2016-00244783; U.S. Patent Publication No.2017-0183636; U.S. Patent Publication No.2020-0263201; U.S. Patent Publication No.2020-0101099; U.S. Patent Publication No.2020-0318082; U.S. Patent Publication No.2018-0369414; U.S. Patent Publication No.2019-0330278; U.S. Patent Publication No.2020-0231986, the contents of each of which are incorporated by reference herein. Promoter The invention may contain a muscle specific promoter or another promoter. The promoter may be linked to the nucleic acid sequence so that the transcription preferably occurs within myocytes. Promoter regions enable the host cells to replicate the AAV delivered nucleic acid only in those cell types and tissues or organs in which the desired protein should be created. Here, the muscle specific promoter is included because it is principally desired that the proteins only be translated in myocytes. Specificity of the cell type into which the nucleic acid is delivered and thus the proteins translated is desired because of the adverse effects that may ensue from delivering the nucleic acid and having it translated in cells in which that nucleic acid and thus protein is not needed. The myocyte specific promoter may be coupled or otherwise associated with a truncated DUX4 sequence. In some embodiments, the promoter may be directly attached, and in others there may be a linker molecule or another indirect coupling method to attach to the truncated DUX4 sequence. In some embodiments, there may be an associated polypeptide or other particle that is coupled to the truncated DUX4 sequence. In some embodiments, the muscle specific promoter yields increased muscle cell potency, muscle cell specificity, reduced immunogenicity, or any combination thereof. As used herein the terms “muscle-specific”, “muscle cell specificity”, “muscle cell potency,” “myocyte specific” and the like, refer to the increased specificity, selectivity, or potency, of the muscle- specific targeting moieties and compositions incorporating said muscle-specific targeting moieties of the present invention for myocytes relative to non-muscle cells. In some embodiments, the cell specificity, or selectivity, or potency, or a combination thereof of a muscle-specific targeting moiety or composition incorporating a muscle-specific targeting Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application moiety described herein is at least 2 to at least 500 times more specific, selective, and / or potent for / in a muscle cell relative to a non-muscle cell. In some embodiments, the myocyte-selective promoter utilized is MHCK7. MHCK7is a 770 base pair length promoter that is small enough to be included in an AAV vector. MHCK7 directs expression in fast and slow skeletal and cardiac muscle, with low expression in the liver, lung, and spleen. It is less active in smooth muscle. The MHCK7 promoter is associated with high levels of expression in skeletal muscles, including the diaphragm, and includes an enhancer to especially drive expression in the heart, whereas expression in off-target tissues is minimal. In some embodiments, the promoters described herein are inserted into an AAV protein (e.g., an AAV capsid protein) that has reduced specificity (or no detectable, measurable, or clinically relevant interaction) for one or more non-muscle cell types. Exemplary non-muscle cell types include, but are not limited to, liver, kidney, lung, heart, spleen, central or peripheral nervous system cells, bone, immune, stomach, intestine, eye, skin cells and the like. In some embodiments, the non-muscle cells are liver cells. The term “operably linked” refers to the association of two or more nucleic acid molecules on a single nucleic acid fragment so that the function of one is affected by the other. Further exemplary tissue specific promoters include U6 promoter sequence, MHCK7 promoter sequence, CK6 promoter sequence, tMCK promoter sequence, CK5 promoter sequence, MCK promoter sequence, HAS promoter sequence, MPZ promoter sequence, desmin promoter sequence, APOA2 promoter sequence, hAAT promoter sequence, INS promoter sequence, IRS2 promoter sequence, MYH6 promoter sequence, MYL2 promoter sequence, TNNI3 promoter sequence, SYN1 promoter sequence, GFAP promoter sequence, NES promoter sequence, MBP promoter sequence, or TH promoter sequence. Muscle specific promoters are described in International Patent Application Publications WO 2020 / 006458 and WO 2021 / 126880, the contents of each of which are incorporated by reference herein. Further muscle specific promoters are described in U.S. Patent No.9,133,482; U.S. Patent No.10,105,453; U.S. Patent No.10,301,367; U.S. Patent Publication No.2020-0360534; PCT International Patent Publication Nos. WO 2020 / 006458; WO 2021 / 035120; WO 2021 / 053124; and WO 2021 / 077000, the contents of each of which are incorporated by reference herein. Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application It may be convenient to use an RNA polymerase II or III promoter; these are known to the person skilled in the art and reviewed in e.g. Kornberg 1999. However, transcripts from an RNA II polymerase often have complex transcription terminators and transcripts are polyadenylated; this may hamper with the requirements of the miRNA strand which because both its 5' and 3' ends need to be precisely defined in order to achieve the required secondary structure to produce a functional molecule. These drawbacks can however be circumvented. In case an RNA polymerase II or III promoter is used, the polynucleotide encoding the miRNA strand may also encode self-processing ribozymes and may be operably linked to an RNA polymerase II or III promoter; as such the polynucleotide encodes a pre- miRNA strand comprising the miRNA strand and self-processing ribozymes, wherein, when transcribed, the miRNA strand is released by the self-processing ribozymes from the pre- miRNA strand de transcript. Preferably, in a composition according to the present invention the AAV vector is comprised of an RNA polymerase II promoter or III promoter, and encodes a pre- miRNA strand comprising the miRNA strand and self-processing ribozymes, wherein, when transcribed, the miRNA strand is released by the self-processing ribozymes from the pre- miRNA strand transcript. Conveniently, multiple pre-miRNA strands and multiple self-processing ribozymes may be encoded by a single polynucleotide, operably linked to one or more RNA polymerase II promoters. RNA polymerase II or III promoters that are inducible and / or tissue-specific have been previously described. RNA polymerase promoters are known in the art and further described in U.S. Patent Publication 11,149,288, the contents of which is incorporated by reference herein. Capsid Protein The capsid protein is the shell or coating of the virus that enables its delivery into the host. Without the protein, the nucleic acids would be destroyed by the host without entering into the host cells and beginning transcription and translation. The capsid protein may be in the natural conformation of a naturally occurring AAV, or it may be modified. In certain example embodiments, the AAV capsid protein is an engineered AAV capsid protein having reduced or eliminated uptake in a non-muscle cell as compared to a corresponding Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application wild-type AAV capsid polypeptide, for example an AAV9 capsid polypeptide described in SEQ ID NO: 1. In some embodiments, the engineered AAV capsid encoding polynucleotide can be included in a polynucleotide that is configured to be an AAV genome donor in an AAV vector system that can be used to generate engineered AAV particles described elsewhere herein. In some embodiments, the engineered AAV capsid encoding polynucleotide can be operably coupled to a poly adenylation tail. In some embodiments, the poly adenylation tail can be an SV40 poly adenylation tail. In some embodiments, the AAV capsid encoding polynucleotide can be operably coupled to a promoter. In some embodiments, the promoter can be a tissue specific promoter. In some embodiments, the tissue specific promoter is specific for muscle (e.g., cardiac, skeletal, and / or smooth muscle), neurons and supporting cells (e.g., astrocytes, glial cells, Schwann cells, etc.), fat, spleen, liver, kidney, immune cells, spinal fluid cells, synovial fluid cells, skin cells, cartilage, tendons, connective tissue, bone, pancreas, adrenal gland, blood cell, bone marrow cells, placenta, endothelial cells, and combinations thereof. In some embodiments, the promoter can be a constitutive promoter. Suitable tissue specific promoters and constitutive promoters are discussed elsewhere herein and are generally known in the art and can be commercially available. Suitable muscle specific promoters include, but are not limited to CK8, MHCK7, Myoglobin promoter (Mb), Desmin promoter, muscle creatine kinase promoter (MCK) and variants thereof, and SPc5-12 synthetic promoter. Described herein are various embodiments of engineered viral capsids, such as adeno- associated virus (AAV) capsids, that can be engineered to confer cell-specific tropism, such as muscle specific tropism, to an engineered viral particle. Engineered viral capsids can be lentiviral, retroviral, adenoviral, or AAV capsids. The engineered capsids can be included in an engineered virus particle (e.g., an engineered lentiviral, retroviral, adenoviral, or AAV virus particle), and can confer cell-specific tropism, reduced immunogenicity, or both to the engineered viral particle. The engineered viral capsids described herein can include one or more engineered viral capsid proteins described herein. The engineered viral capsids described herein can include one or more engineered viral capsid proteins described herein that can contain a muscle-specific targeting moiety containing or composed of an n-mer motif described elsewhere herein. Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application The engineered viral capsid and / or capsid proteins can be encoded by one or more engineered viral capsid polynucleotides. In some embodiments, the engineered viral capsid polynucleotide is an engineered AAV capsid polynucleotide, engineered lentiviral capsid polynucleotide, engineered retroviral capsid polynucleotide, or engineered adenovirus capsid polynucleotide. In some embodiments, an engineered viral capsid polynucleotide (e.g., an engineered AAV capsid polynucleotide, engineered lentiviral capsid polynucleotide, engineered retroviral capsid polynucleotide, or engineered adenovirus capsid polynucleotide) can include a 3’ polyadenylation signal. The polyadenylation signal can be an SV40 polyadenylation signal. The engineered viral capsids can be variants of wild-type viral capsid. For example, in some embodiments, the engineered AAV capsids can be variants of wild-type AAV capsids. In some embodiments, the wild-type AAV capsids can be composed of VP1, VP2, VP3 capsid proteins or a combination thereof. In other words, the engineered AAV capsids can include one or more variants of a wild-type VP1, wild-type VP2, and / or wild-type VP3 capsid proteins. In some embodiments, the serotype of the reference wild-type AAV capsid can be AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-8, AAV-9 or any combination thereof. In some embodiments, the serotype of the wild-type AAV capsid can be AAV-9. The engineered AAV capsids can have a different tropism than that of the reference wild-type AAV capsid. The engineered viral capsid can contain 1-60 engineered capsid proteins. In some embodiments, the engineered viral capsids can contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 engineered capsid proteins. In some embodiments, the engineered viral capsid can contain 0-59 wild-type viral capsid proteins. In some embodiments, the engineered viral capsid can contain 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, or 59 wild-type viral capsid proteins. In some embodiments, the engineered AAV capsid can contain 1-60 engineered capsid proteins. In some embodiments, the engineered AAV capsids can contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 engineered capsid proteins. In some embodiments, the engineered AAV capsid can contain 0-59 Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application wild-type AAV capsid proteins. In some embodiments, the engineered AAV capsid can contain 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, or 59 wild-type AAV capsid proteins. In some embodiments, the engineered viral capsid protein can have an n-mer amino acid motif, where n can be at least 3 amino acids. In some embodiments, n can be 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 amino acids. In some embodiments, an engineered AAV capsid can have a 6-mer or 7-mer amino acid motif. In some embodiments, the n-mer amino acid motif can be inserted between two amino acids in the wild-type viral protein (VP) (or capsid protein). In some embodiments, the n-mer motif can be inserted between two amino acids in a variable amino acid region in a viral capsid protein. In some embodiments, the n-mer motif can be inserted between two amino acids in a variable amino acid region in an AAV capsid protein. The core of each wild-type AAV viral protein contains an eight-stranded beta-barrel motif (betaB to betaI) and an alpha-helix (alphaA) that are conserved in autonomous parvovirus capsids (see e.g., DiMattia et al.2012. J. Virol. 86(12):6947-6958). Structural variable regions (VRs) occur in the surface loops that connect the beta-strands, which cluster to produce local variations in the capsid surface. AAVs have 12 variable regions (also referred to as hypervariable regions) (see e.g., Weitzman and Linden. 2011. “Adeno-Associated Virus Biology.” In Snyder, R.O., Moullier, P. (eds.) Totowa, NJ: Humana Press). In some embodiments, one or more n-mer motifs can be inserted between two amino acids in one or more of the 12 variable regions in the wild-type AVV capsid proteins. In some embodiments, the one or more n-mer motifs can be each be inserted between two amino acids in VR-I, VR-II, VR-III, VR-IV, VR-V, VR-VI, VR-VII, VR-III, VR-IX, VR-X, VR-XI, VR-XII, or a combination thereof. In some embodiments, the n-mer can be inserted between two amino acids in the VR-III of a capsid protein. In some embodiments, the engineered capsid can have an n-mer inserted between any two contiguous amino acids between amino acids 262 and 269, between any two contiguous amino acids between amino acids 327 and 332, between any two contiguous amino acids between amino acids 382 and 386, between any two contiguous amino acids between amino acids 452 and 460, between any two contiguous amino acids between amino acids 488 and 505, between any two contiguous amino acids between amino acids 545 and 558, between any two contiguous amino acids between amino acids 581 and 593, Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application between any two contiguous amino acids between amino acids 704 and 714 of an AAV9 viral protein. In some embodiments, the engineered capsid can have an n-mer inserted between amino acids 588 and 589 of an AAV9 viral protein. In some embodiments, the engineered capsid can have a 7-mer motif inserted between amino acids 588 and 589 of an AAV9 viral protein. In other embodiments, the motif inserted is a 10-mer motif, with replacement of amino acids 586-88 and an insertion before 589. It will be appreciated that n-mers can be inserted in analogous positions in AAV viral proteins of other serotypes. In some embodiments as previously discussed, the n- mer(s) can be inserted between any two contiguous amino acids within the AAV viral protein and in some embodiments the insertion is made in a variable region. In some embodiments, the first 1, 2, 3, or 4 amino acids of an n-mer motif can replace 1, 2, 3, or 4 amino acids of a polypeptide into which it is inserted and preceding the insertion site. In some embodiments, the amino acids of the n-mer motif that replace 1 or more amino acids of the polypeptide into which the n-mer motif is inserted come before or immediately before an “RGD” in an n-mer motif. For example, in one or more of the 10-mer inserts shown in e.g., Tables 2-3, the first three amino acids shown can replace 1-3 amino acids into a polypeptide to which they may be inserted. Using an AAV as another non-limiting example, one or more of the n-mer motifs can be inserted into e.g., and AAV9 capsid prolylpeptide between amino acids 588 and 589 and the insert can replace amino acids 586, 587, and 588 such that the amino acid immediately preceding the n-mer motif after insertion is residue 585. It will be appreciated that this principle can apply in any other insertion context and is not necessarily limited to insertion between residues 588 and 589 of an AAV9 capsid or equivalent position in another AAV capsid. It will further be appreciated that in some embodiments, no amino acids in the polypeptide into which the n-mer motif is inserted are replaced by the n-mer motif. In some embodiments, the AAV capsids or other viral capsids or compositions can be muscle-specific. In some embodiments, muscle-specificity of the engineered AAV or other viral capsid or other composition is conferred by a muscle specific n-mer motif incorporated in the engineered AAV or other viral capsid or other composition described herein. While not intending to be bound by theory, it is believed that the n-mer motif confers a 3D structure to or within a domain or region of the engineered AAV capsid or other viral capsid or other composition such that the interaction of the viral particle or other composition containing the engineered AAV capsid or other viral capsid or other composition described herein has increased or improved Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application interactions (e.g., increased affinity) with a cell surface receptor and / or other molecule on the surface of a muscle cell. In some embodiments, the cell surface receptor is AAV receptor (AAVR). In some embodiments, the cell surface receptor is a muscle cell specific AAV receptor. In some embodiments, the cell surface receptor or other molecule is a cell surface receptor or other molecule selectively expressed on the surface of a muscle cell. In some embodiments, the cell surface receptor or molecule is an integrin or dimer thereof. In some embodiments, the cell surface receptor or molecule is an Vb6 integrin heterodimer. In some embodiments, a muscle specific engineered viral particle or other composition described herein containing the muscle-specific capsid, n-mer motif, or muscle-specific targeting moiety described herein can have an increased uptake, delivery rate, transduction rate, efficiency, amount, or a combination thereof in a muscle cell as compared to other cells types and / or other virus particles (including but not limited to AAVs) and other compositions that do not contain the muscle-specific n-mer motif of the present invention. First- and second-generation muscle specific AAV capsids were developed using a muscle specific promoter and the resulting capsid libraries were screened in mice and non- human primates as described elsewhere herein and / or in e.g., U.S. Provisional Application Serial Nos.62 / 899,453, 62 / 916,207, 63 / 018,454, and 63 / 242,008. First and second generation myoAAV capsids were further optimized in mice and non-human primates as previously described to generate enhanced myoAAV capsids. Capsids that may be used in together with the invention may be as described in PCT application no. PCT / US2024 / 044341. Tables 1 and 2 show the top hits of enhanced muscle specific n-mer motifs and their encoding sequence in rank order within each table. Enhanced MyoAAV (eMyoAAV) capsid variants can transduce mouse muscle more effectively as compared to the first generation MyoAAV after systemic delivery. First and second generation myoAAV capsid variants are dependent on the aVb6 integrin heterodimer for transduction of human primary myotubes. Tables 3 and 4 show top-ranking capsid variants produced in rounds of directed evolution of capsid variants for skeletal muscle specificity. As shown in the Tables above with respect to those variant n-mer inserts containing P-motifs, the first three amino acids of the variant sequences shown are amino acids that replaced amino acids corresponding to positions 596, 597, and 598 of an AAV9 capsid polypeptide. Thus, the P-motif, for example, was inserted between amino acids at positions 598 and 599 of an AAV9 vector. Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application Tables 5a and 5b show top-ranked capsid variants products in rounds of directed evolution of capsid variants for skeletal muscle specificity. The capsid protein variant may comprise substitutions at amino acids 451-455 relative to a wild-type AAV9 vector capsid. For example, the substitutions at amino acids 451-455 relative to a wild-type AAV9 vector capsid may be an amino acid sequence selected from column 1 of Table 6b. In aspects of the invention, the capsid protein variant may further comprise an insert. For example, the capsid protein may comprise a 7-mer insert selected from column 2 of Table 6b. The insert may be in the location after amino acid 455 relative to a wild-type AAV9 vector. For HVR IV variants, the 5 amino acids upstream are at positions 451-455, shown in column 1 of Table 6b. The 7-mer insert for HVR IV variants starts with "RGD" and is inserted after amino acid 455, shown in column 2 of Table 6b. Micro RNA MicroRNA (miRNA) are small, single-stranded, non-coding RNA molecules. miRNAs base-pair to complementary sequences in mRNA molecules, thereby silencing post- transcriptional regulation of gene expression. Typically, miRNA molecules silence mRNA translation by cleavage of mRNA strand into two pieces or destabilization of the mRNA by shortening its poly(A) tail. miRNAs resemble small interfering RNAs (siRNAs), however miRNAs derive from regions of RNA transcripts that fold back on themselves to form short hairpins. Animal miRNAs are initially transcribed as part of one arm of an RNA stem-loop that in turn forms part of a several hundred nucleotide-long miRNA precursor termed a pri-miRNA. A single pri-miRNA may contain from one to six miRNA precursors. These hairpin loop structures are typically composed of about 70 nucleotides each. Each hairpin is flanked by sequences necessary for efficient processing. The pre-miRNA hairpin is typically cleaved by the RNase enzyme Dicer. The RNase interacts with 5' and 3' ends of the hairpin and cuts away the loop joining the 3' and 5' arms, resulting in an miRNA:miRNA duplex about 22 nucleotides in length. Overall hairpin length and loop size influence the efficiency of Dicer processing. Although either strand of the duplex may potentially act as a functional miRNA, only one strand is generally incorporated into the RNA- induced silencing complex (RISC) where the miRNA and its mRNA target interact. Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application For example, pri-miR scaffolds together with their guide and passenger sequence may form a hairpin loop structure. The hairpin loop structure may be greater than 250 nucleotides in length (for example between 250-270 nucleotides in length). The pri-miR may have the structure, in order, of a first (“upstream”) scaffold sequence , the guide sequence, a hairpin loop, a sequence complimentary or partially complementary to the guide sequence (called a “passenger” sequence), and second (“downstream”) scaffold sequence. The guide sequence and passenger sequence form a double stranded RNA (dsRNA), with the first and second scaffold sequence being single stranded RNA (sRNA) on either end of the double stranded molecule (referred to as “arms”). The passenger strand may be fully complementary to the guide sequence or may have one or more mismatched nucleotides to the guide strand. For example, mismatches or additional nucleotides may result in ”bulges” in the pre-miRNA, while maintaining overall hybridization between the guide strand and passenger strand. The hairpin loop is found at the opposite end of the dsRNA from the first and second scaffold sequences, connecting the 5’ and 3’ end of the guide and passenger. An example a pri-miR scaffold and its guide is shown below: The hairpin structure may be processed by cleaving near the junction between dsRNA and ssRNA arms. After processing, which may result in substantially cleaving of the ssRNA arms, the pri-miRNAs loop structure is generally 60-100 nucleotides long, and is referred to as a precursor miRNA (pre-miRNA). The pre-miRNA may be exported to the cytoplasm and further processed by an enzyme, for example (Dicer). The enzyme may process the pre-miRNA at the 5' and 3' ends of the hairpin by cutting away the loop joining the 3' and 5' arms, resulting in an miRNA(guide):miRNA (passenger) duplex about 21 nucleotides in length. The duplexed miRNA may then by processed to form a precursor to an RNA-induced silencing complex (RISC). The complex may unwind the duplex and the passenger RNA strand may then be discarded, leaving behind a mature RISC carrying the mature, single stranded guide miRNA. Advantageously, artificial miRNA molecules may be engineered to comprise the scaffold of an endogenous miRNA and a targeting sequence to a gene of interest. Aspects of the invention comprise miRNA molecules that target DUX4 transcripts. The pri-miRNA scaffold may be selected from any scaffold, for example based on cell or tissue specificity of the mature miRNA. For example, the pri-miRNA scaffold may be derived from the pri-miRNA selected from the Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application group consisting of pri-miR-21, pri-miR-22, pri-miR-26a, pri-miR-30a, pri-miR-33, pri-miR- 122, pri-miR-375, pri-miR-199, pri-miR-99, pri-miR-194, pri-miR-155, and pri-miR-451. In preferred aspects of the invention, the miRNA scaffold is derived pri-miR-33. MiRNA-based therapies, including miRNA inhibition and miRNA replacement, may be used to treat many diseases such as hepatitis C viral infection, muscular dystrophies, neurodegenerative diseases, peripheral neuropathies, chronic heart failure and post-myocardial infarction remodeling and cancers. In addition, miRNA directed regulation of gene expression may improve traditional gene therapy approaches in which the vector payload is a protein coding gene. microRNA sequences are described in U.S. Patent Publication Nos.2020-0248179, 2019- 0300903, 2019-0136235, 2019-0024083, 2017-0029849, and 2014-0322169, the contents of each of which are incorporated by reference herein. Pharmaceutical Composition Some embodiments of the invention may include any acceptable form of providing the AAV vector to a subject. For example, the AAV vector may be provided to the subject in the form of a composition or formulation comprising the AAV vector. The expression vector of this invention can be formulated and administered to treat a variety of disease states by any means that produces contact of the active ingredient with the agent's site of action in the body of the subject. The compositions, polynucleotides, polypeptides, particles, cells, vector systems and combinations thereof described herein can be contained in a formulation, such as a pharmaceutical formulation. In some embodiments, the formulations can be used to generate polypeptides and other particles that include one or more muscle-specific targeting moieties described herein. In some embodiments, the formulations can be delivered to a subject in need thereof. In some embodiments, component(s) of the engineered AAV capsid system, engineered cells, engineered AAV capsid particles, and / or combinations thereof described herein can be included in a formulation that can be delivered to a subject or a cell. In some embodiments, the formulation is a pharmaceutical formulation. One or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein can be provided to a subject in need thereof or a cell alone or as an active ingredient, such as in a pharmaceutical formulation. As such, also described herein are pharmaceutical formulations containing an amount of one or Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application more of the polypeptides, polynucleotides, vectors, cells, or combinations thereof described herein. In some embodiments, the pharmaceutical formulation can contain an effective amount of the one or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein. The pharmaceutical formulations described herein can be administered to a subject in need thereof or a cell. In some embodiments, the amount of the one or more of the polypeptides, polynucleotides, vectors, cells, virus particles, nanoparticles, other delivery particles, and combinations thereof described herein contained in the pharmaceutical formulation can range from about 1 pg / kg to about 10 mg / kg based upon the bodyweight of the subject in need thereof or average bodyweight of the specific patient population to which the pharmaceutical formulation can be administered. The amount of the one or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein in the pharmaceutical formulation can range from about 1 pg to about 10 g, from about 10 nL to about 10 ml. In embodiments where the pharmaceutical formulation contains one or more cells, the amount can range from about 1 cell to 1 x 102, 1 x 103, 1 x 104, 1 x 105, 1 x 106, 1 x 107, 1 x 108, 1 x 109, 1 x 1010or more cells. In embodiments where the pharmaceutical formulation contains one or more cells, the amount can range from about 1 cell to 1 x 102, 1 x 103, 1 x 104, 1 x 105, 1 x 106, 1 x 107, 1 x 108, 1 x 109, 1 x 1010or more cells per nL, μL, mL, or L. In embodiments, were engineered AAV capsid particles are included in the formulation, the formulation can contain 1 to 1 x 102, 1 x 103, 1 x 104, 1 x 105, 1 x 106, 1 x 107, 1 x 108, 1 x 109, 1 x 1010, 1 x 1011, 1 x 1012, 1 x 1013, 1 x 1014, 1 x 1015, 1 x 1016, 1 x 1017, 1 x 1018, 1 x 1019, or 1 x 1020transducing units (TU) / mL of the engineered AAV capsid particles. In some embodiments, the formulation can be 0.1 to 100 mL in volume and can contain 1 to 1 x 102, 1 x 103, 1 x 104, 1 x 105, 1 x 106, 1 x 107, 1 x 108, 1 x 109, 1 x 1010, 1 x 1011, 1 x 1012, 1 x 1013, 1 x 1014, 1 x 1015, 1 x 1016, 1 x 1017, 1 x 1018, 1 x 1019, or 1 x 1020transducing units (TU) / mL of the engineered AAV capsid particles. Pharmaceutically Acceptable Carriers and Auxiliary Ingredients and Agents In embodiments, the pharmaceutical formulation containing an amount of one or more of the polypeptides, polynucleotides, vectors, cells, virus particles, nanoparticles, other delivery particles, and combinations thereof described herein can further include a pharmaceutically Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application acceptable carrier. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, gum arabic, vegetable oils, benzyl alcohols, polyethylene glycols, gelatin, carbohydrates such as lactose, amylose or starch, magnesium stearate, talc, silicic acid, viscous paraffin, perfume oil, fatty acid esters, hydroxy methylcellulose, and polyvinyl pyrrolidone, which do not deleteriously react with the active composition. The pharmaceutical formulations can be sterilized, and if desired, mixed with auxiliary agents, such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, flavoring and / or aromatic substances, and the like which do not deleteriously react with the active composition. In some embodiments, the pharmaceutical formulations described herein may be in a dosage form. The dosage forms can be adapted for administration by any appropriate route. Appropriate routes include, but are not limited to, oral (including buccal or sublingual), rectal, epidural, intracranial, intraocular, inhaled, intranasal, topical (including buccal, sublingual, or transdermal), vaginal, intraurethral, parenteral, intracranial, subcutaneous, intramuscular, intravenous, intraperitoneal, intradermal, intraosseous, intracardiac, intraarticular, intracavernous, intrathecal, intravitreal, intracerebral, gingival, subgingival, intracerebroventricular, and intradermal. Such formulations may be prepared by any method known in the art. Dosage forms adapted for oral administration can be discrete dosage units such as capsules, pellets or tablets, powders or granules, solutions, or suspensions in aqueous or non- aqueous liquids; edible foams or whips, or in oil-in-water liquid emulsions or water-in-oil liquid emulsions. In some embodiments, the pharmaceutical formulations adapted for oral administration also include one or more agents which flavor, preserve, color, or help disperse the pharmaceutical formulation. Dosage forms prepared for oral administration can also be in the form of a liquid solution that can be delivered as foam, spray, or liquid solution. In some embodiments, the oral dosage form can contain about 1 ng to 1000 g of a pharmaceutical formulation containing a therapeutically effective amount or an appropriate fraction thereof of the targeted effector fusion protein and / or complex thereof or composition containing the one or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein. The oral dosage form can be administered to a subject in need thereof. Where appropriate, the dosage forms described herein can be microencapsulated. Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application The dosage form can also be prepared to prolong or sustain the release of any ingredient. In some embodiments, the one or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein can be the ingredient whose release is delayed. In other embodiments, the release of an optionally included auxiliary ingredient is delayed. Suitable methods for delaying the release of an ingredient include, but are not limited to, coating or embedding the ingredients in material in polymers, wax, gels, and the like. Delayed release dosage formulations can be prepared as described in standard references such as "Pharmaceutical dosage form tablets," eds. Liberman et. al. (New York, Marcel Dekker, Inc., 1989), "Remington - The science and practice of pharmacy", 20th ed., Lippincott Williams & Wilkins, Baltimore, MD, 2000, and "Pharmaceutical dosage forms and drug delivery systems", 6th Edition, Ansel et al., (Media, PA: Williams and Wilkins, 1995). These references provide information on excipients, materials, equipment, and processes for preparing tablets and capsules and delayed release dosage forms of tablets and pellets, capsules, and granules. The delayed release can be anywhere from about an hour to about 3 months or more. Examples of suitable coating materials include, but are not limited to, cellulose polymers such as cellulose acetate phthalate, hydroxypropyl cellulose, hydroxypropyl methylcellulose, hydroxypropyl methylcellulose phthalate, and hydroxypropyl methylcellulose acetate succinate; polyvinyl acetate phthalate, acrylic acid polymers and copolymers, and methacrylic resins that are commercially available under the trade name EUDRAGIT® (Roth Pharma, Westerstadt, Germany), zein, shellac, and polysaccharides. Coatings may be formed with a different ratio of water-soluble polymer, water insoluble polymers, and / or pH dependent polymers, with or without water insoluble / water soluble non- polymeric excipient, to produce the desired release profile. The coating is either performed on the dosage form (matrix or simple) which includes, but is not limited to, tablets (compressed with or without coated beads), capsules (with or without coated beads), beads, particle compositions, "ingredient as is" formulated as, but not limited to, suspension form or as a sprinkle dosage form. Dosage forms adapted for topical administration can be formulated as ointments, creams, suspensions, lotions, powders, solutions, pastes, gels, sprays, aerosols, or oils. In some embodiments for treatments of the eye or other external tissues, for example the mouth or the skin, the pharmaceutical formulations are applied as a topical ointment or cream. When Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application formulated in an ointment, the one or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein can be formulated with a paraffinic or water-miscible ointment base. In some embodiments, the active ingredient can be formulated in a cream with an oil-in-water cream base or a water-in-oil base. Dosage forms adapted for topical administration in the mouth include lozenges, pastilles, and mouth washes. Dosage forms adapted for nasal or inhalation administration include aerosols, solutions, suspension drops, gels, or dry powders. In some embodiments, the one or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein is contained in a dosage form adapted for inhalation is in a particle-size-reduced form that is obtained or obtainable by micronization. In some embodiments, the particle size of the size reduced (e.g., micronized) compound or salt or solvate thereof, is defined by a D50 value of about 0.5 to about 10 microns as measured by an appropriate method known in the art. Dosage forms adapted for administration by inhalation also include particle dusts or mists. Suitable dosage forms wherein the carrier or excipient is a liquid for administration as a nasal spray or drops include aqueous or oil solutions / suspensions of an active ingredient (e.g., the one or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein and / or auxiliary active agent), which may be generated by various types of metered dose pressurized aerosols, nebulizers, or insufflators. In some embodiments, the dosage forms can be aerosol formulations suitable for administration by inhalation. In some of these embodiments, the aerosol formulation can contain a solution or fine suspension of the one or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein and a pharmaceutically acceptable aqueous or non-aqueous solvent. Aerosol formulations can be presented in single or multi-dose quantities in sterile form in a sealed container. For some of these embodiments, the sealed container is a single dose or multi-dose nasal, or an aerosol dispenser fitted with a metering valve (e.g., metered dose inhaler), which is intended for disposal once the contents of the container have been exhausted. Where the aerosol dosage form is contained in an aerosol dispenser, the dispenser contains a suitable propellant under pressure, such as compressed air, carbon dioxide, or an organic propellant, including but not limited to a hydrofluorocarbon. The aerosol formulation dosage forms in other embodiments are contained in a pump-atomizer. The pressurized aerosol Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application formulation can also contain a solution or a suspension of one or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein. In further embodiments, the aerosol formulation can also contain co-solvents and / or modifiers incorporated to improve, for example, the stability and / or taste and / or fine particle mass characteristics (amount and / or profile) of the formulation. Administration of the aerosol formulation can be once daily or several times daily, for example 2, 3, 4, or 8 times daily, in which 1, 2, or 3 doses are delivered each time. For some dosage forms suitable and / or adapted for inhaled administration, the pharmaceutical formulation is a dry powder inhalable formulation. In addition to the one or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein, an auxiliary active ingredient, and / or pharmaceutically acceptable salt thereof, such a dosage form can contain a powder base such as lactose, glucose, trehalose, mannitol, and / or starch. In some of these embodiments, the one or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein is in a particle-size reduced form. In further embodiments, a performance modifier, such as L-leucine or another amino acid, cellobiose octaacetate, and / or metals salts of stearic acid, such as magnesium or calcium stearate. In some embodiments, the aerosol dosage forms can be arranged so that each metered dose of aerosol contains a predetermined amount of an active ingredient, such as the one or more of the one or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein. Dosage forms adapted for vaginal administration can be presented as pessaries, tampons, creams, gels, pastes, foams, or spray formulations. Dosage forms adapted for rectal administration include suppositories or enemas. Dosage forms adapted for parenteral administration and / or adapted for any type of injection (e.g. intravenous, intraperitoneal, subcutaneous, intramuscular, intradermal, intraosseous, epidural, intracardiac, intraarticular, intracavernous, gingival, subgingival, intrathecal, intravitreal, intracerebral, and intracerebroventricular) can include aqueous and / or non-aqueous sterile injection solutions, which can contain anti-oxidants, buffers, bacteriostats, solutes that render the composition isotonic with the blood of the subject, and aqueous and non- aqueous sterile suspensions, which can include suspending agents and thickening agents. The dosage forms adapted for parenteral administration can be presented in a single- unit dose or Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application multi-unit dose containers, including but not limited to sealed ampoules or vials. The doses can be lyophilized and resuspended in a sterile carrier to reconstitute the dose prior to administration. Extemporaneous injection solutions and suspensions can be prepared in some embodiments, from sterile powders, granules, and tablets. Dosage forms adapted for ocular administration can include aqueous and / or nonaqueous sterile solutions that can optionally be adapted for injection, and which can optionally contain anti-oxidants, buffers, bacteriostats, solutes that render the composition isotonic with the eye or fluid contained therein or around the eye of the subject, and aqueous and nonaqueous sterile suspensions, which can include suspending agents and thickening agents. For some embodiments, the dosage form contains a predetermined amount of the one or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein per unit dose. In some embodiments, the predetermined amount of the Such unit doses may therefore be administered once or more than once a day. Such pharmaceutical formulations may be prepared by any of the methods well known in the art. DUX4 and Facioscapulohumeral Muscular Dystrophy Muscular dystrophies (MDs) are a group of genetic diseases. The group is characterized by progressive weakness and degeneration of the skeletal muscles that control movement or breathing. Some forms of MD develop in infancy or childhood, while others may not appear until middle age or later. The disorders differ in terms of the distribution and extent of muscle weakness (some forms of MD also affect cardiac muscle), the age of onset, the rate of progression, and the pattern of inheritance. Facioscapulohumeral muscular dystrophy (FSHD) is a complex autosomal dominant disorder characterized by progressive and asymmetric weakness of facial, shoulder and limb muscles. Symptoms typically arise in adulthood with most patients showing clinical features before age thirty. About five percent of patients develop symptoms as infants or juveniles and these are generally more severely affected. Clinical presentation can vary from mild (some limited muscle weakness) to severe (wheelchair dependence). Historically, FSHD was classified as the third most common MD, affecting one in 20,000 individuals worldwide. However, recent data indicate FSHD is the most common MD in Europe, suggesting its worldwide incidence could be as high as 1 in 8,333.Typical FSHD cases (FSHD1A, heretofore referred to as FSHD) Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application are linked to heterozygous chromosomal deletions that decrease the copy number of 3.3 kilobase (kb) D4Z4 repeats on human chromosome 4q35. Simplistically, normal individuals have 11-100 tandemly-repeated D4Z4 copies on both 4q35 alleles, while patients with FSHD have one normal and one contracted allele containing 1-10 repeats. In addition, FSHD-associated D4Z4 contractions must occur on specific disease-permissive chromosome 4q35 backgrounds (called 4qA). Importantly, no genes are completely lost or structurally mutated as a result of FSHD- associated deletions. Instead, genetic changes associated with FSHD give rise to expression of the toxic DUX4 gene, which is damaging to muscle. FSHD2 (also known as FSHD1B) is phenotypically identical to FSHD1, is associated with DUX4 expression, and requires the 4qA chromosomal background. FSHD2 is not associated with D4Z4 repeat contraction, but is instead caused by mutation in the SMCHD1 gene, which is a chromatin regulator normally involved in repressing the DUX4 locus at 4qA. Mutated SMCHD1 proteins fail to participate in adding heterochromatin to the 4qA DUX4 allele, thereby allowing DUX4 gene expression. In the leading FSHD pathogenesis model, D4Z4 contractions are proposed to cause epigenetic changes that permit expression of the DUX4 gene. As a result, the aberrant over- expression of otherwise silent or near-silent DUX4 gene, and the genes it regulates, may ultimately cause FSHD. This model is consistent with data showing normal 4q35 D4Z4 repeats have heterochromatin characteristics, while FSHD-linked D4Z4 repeats contain marks more indicative of actively transcribed euchromatin. These transcription-permissive epigenetic changes, coupled with the observation that complete monosomic D4Z4 deletions (i.e., zero repeats) do not cause FSHD, support the hypothesis that D4Z4 repeats harbor potentially myopathic open reading frames (ORFs), which are abnormally expressed in FSHD muscles. This notion was initially considered in 1994, when a D4Z4-localized ORF, called DUX4, was first identified. However, the locus had some characteristics of an unexpressed pseudogene and DUX4 was therefore summarily dismissed as an FSHD candidate. For many years thereafter, the search for FSHD-related genes was mainly focused outside the D4Z4 repeats, and although some intriguing candidates emerged from these studies, no single gene had been conclusively linked to FSHD development. This slow progress led to the re-emergence of DUX4 as an FSHD candidate in 2007. The role of DUX4 in FSHD pathogenesis can be explained as follows. First, D4Z4 repeats contain identical DUX4 coding regions, and D4Z4 repeats also harbor smaller sense and Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application antisense transcripts, including some resembling microRNAs. Over-expressed DUX4 transcripts and a .about.50 kDa full-length DUX4 protein are found in biopsies and cell lines from FSHD patients. These data are consistent with a transcriptional de-repression model of FSHD pathogenesis. In addition, unlike pseudogenes, D4Z4 repeats and DUX4 likely have functional importance, since tandemly-arrayed D4Z4 repeats are conserved in at least eleven different placental mammalian species (non-placental animals lack D4Z4 repeats), with the greatest sequence conservation occurring within the DUX4 ORF. Second, over-expressed DUX4 is toxic to tissue culture cells and embryonic progenitors of developing lower organisms in vivo. This toxicity occurs at least partly through a pro-apoptotic mechanism, indicated by Caspase-3 activation in DUX4 transfected cells, and presence of TUNEL-positive nuclei in developmentally arrested Xenopus embryos injected with DUX4 mRNA at the two-cell stage. These findings are consistent with studies showing some pro-apoptotic proteins, including Caspase-3, are present in FSHD patient muscles. In addition to stimulating apoptosis, DUX4 may negatively regulate myogenesis. Human DUX4 inhibits differentiation of mouse C2C12 myoblasts in vitro, potentially by interfering with PAX3 and / or PAX7, and causes developmental arrest and reduced staining of some muscle markers when delivered to progenitor cells of zebrafish or Xenopus embryos. Finally, aberrant DUX4 function is directly associated with potentially important molecular changes seen in FSHD patient muscles. Specifically, full-length human DUX4 encodes an approximately 50 kDa double homeodomain transcription factor, and DUX4 targets can be found at elevated levels in FSHD patient muscles. These data support that DUX4 catalyzes numerous downstream molecular changes that are incompatible with maintaining normal muscle integrity. Exemplary guides and capsids The present invention provides novel nucleic acid molecules and methods that result in changes to expression of DUX4 that result in treatment of FSHD. Nucleic acid molecules of the invention comprise an miR scaffold and a miR guide sequence that targets a double homeobox 4 (DUX4) transcript. By targeting DUX4 transcripts, the nucleic acid molecules of the invention result in an appropriate expression profile for the DUX4 gene. Preferential exemplary guides are described in Table 7 below. Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application In exemplary aspects of the invention, the guide sequence may comprise a sequence having at least 95% sequence identity to a sequence selected from SEQ ID NOs: 6860-6865. For example, SEQ ID NOs: 6860, 6861, 6862, 6863, 6864, or 6865. The nucleic acid molecule may comprise an miRNA having at least 95% sequence identity to a sequence selected from the group of SEQ ID NOs: 2770-3597 or 6670-6812, each of which incorporates a guide sequence targeting DUX4. The nucleic acid molecule may target a DUX4 transcript at a position shown in Table 6 (with exemplary guide sequences described in Table 7). In preferred aspects of the invention, the miRNA guide sequence comprises a sequence having at least 95% sequence identity to a sequence selected from SEQ ID NO: 1250-2769, SEQ ID NOs: 6855-6963, SEQ ID NOs: 6855-6955, SEQ ID NOs: 6855-6945, SEQ ID NOs: 6855- 6935, SEQ ID NOs: 6855-6925, SEQ ID NOs: 6855-6915, SEQ ID NOs: 6855-6905, SEQ ID NOs: 6855-6895, SEQ ID NOs: 6855-6885, SEQ ID NOs: 6855-6875, SEQ ID NOs: 6855-6870, SEQ ID NOs: 6855-6865, or SEQ ID NOs: 6860-6865. For example, SEQ ID NO: 6861, 6862, 6863, 6864, or 6865, for example, SEQ ID NOs: 6860, 6861, 6862, 6863, 6864, or 6865. In preferred aspects of the invention, the guide sequence may be encapsidated in an AAV vector comprising an engineered AAV vector capsid. The vector capsid may be engineered from an AAV9 capsid protein. The AAV vector capsid may comprise an amino acid sequence as shown as described in Tables 1-5 below, with Table 5a / b describing preferred engineered capsid sequences. In exemplary aspects of the invention, the capsid may comprise a sequence selected from among SEQ ID NO: 4479, 4486, 4487, 4503, 4544, 4667, 4832, 4838, or 5036. In aspects of the invention, the capsid protein may comprise a sequence selected from among sequences 4470-4490, 4500-4520, 4540-4560, 4660-4680, 4830-4850, 5630-5650. The capsid may comprise a sequence selected from among sequences 4475-4480, 4480- 4490, 4500-4510, 4540-4550, 4660-4670, 4830-4840, 5030-5040. The capsid may comprise a sequence selected from among sequences 4475-4480, 4485- 4490, 4500-4505, 4540-4545, 4665-4670, 4830-4835, 5035-5040, for example SEQ ID NO: 4479, 4486, 4487, 4503, 4544, 4667, 4832, 4838, or 5036. Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application Altogether, exemplary guide miRNAs (for example as part of a construct) may be encapsidated by exemplary capsids described herein. For example: In exemplary aspects of the invention, the guide sequence may comprise a sequence having at least 95% sequence identity to a sequence selected from SEQ ID NOs: 6860, 6861, 6862, 6863, 6864, or 6865. The guide sequence may be encapsidated by an AAV capsid comprising a sequence selected from among SEQ ID NO: 4479, 4486, 4487, 4503, 4544, 4667, 4832, 4838, or 5036. For example, exemplary miRNA guide sequences may be encapsidated by exemplary engineered capsids as shown below: miRNA Capsid miRNA Capsid miRNA Capsid guide SEQ comprising guide SEQ comprising guide SEQ comprising : O: 8676 329 386 36710 728696734728696734 Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application Accordingly, in preferred aspects of the invention, the miRNA guide sequence may comprise a sequence having at least 95% sequence identity to a sequence selected from SEQ ID NO: 1250-2769 and the AAV vector capsid encapsidating the miRNA guide may comprise a sequence selected from Tables 1-5. For example, in embodiments of the invention the miRNA guide sequence may comprise a sequence having at least 95% sequence identity to a sequence selected from SEQ ID NOs: 6855-6963 and the capsid protein encapsidating the miRNA guide may comprise a sequence selected from among sequences 4470-4490, 4500-4510, 4540-4550, 4660-4670, 4830-4840, 5630-5640. In further exemplary aspects of the invention the guide sequence may comprise a sequence having at least 95% sequence identity to a sequence selected from SEQ ID NOs: 6855- 6955 and the capsid protein encapsidating the miRNA guide may comprise a sequence selected from among sequences 4470-4490, 4500-4510, 4540-4550, 4660-4670, 4830-4840, 5630-5640. The guide sequence may comprise a sequence having at least 95% sequence identity to a sequence selected from SEQ ID NOs: 6855-6945 and the capsid protein encapsidating the miRNA guide may comprise a sequence selected from among sequences 4475-4490, 4500-4505, 4540-4505, 4665-4670, 4830-4840, 5035-5040. The guide sequence may comprise a sequence having at least 95% sequence identity to a sequence selected from SEQ ID NOs: 6855-6935 and the capsid protein encapsidating the miRNA guide may comprise a sequence selected from among sequences 4475-4490, 4500-4505, 4540-4505, 4665-4670, 4830-4840, 5035-5040. In further exemplary aspects of the invention, the guide sequence may comprise a sequence having at least 95% sequence identity to a sequence selected from SEQ ID NOs: 6855- 6925 and the capsid protein encapsidating the miRNA guide may comprise a sequence selected from among sequences 4475-4490, 4500-4505, 4540-4505, 4665-4670, 4830-4840, 5035-5040. The guide sequence may comprise a sequence having at least 95% sequence identity to a sequence selected from SEQ ID NOs: 6855-6915 and the capsid protein encapsidating the miRNA guide may comprise a sequence selected from among sequences 4475-4490, 4500-4505, 4540-4505, 4665-4670, 4830-4840, 5035-5040. The guide sequence may comprise a sequence having at least 95% sequence identity to a sequence selected from SEQ ID NOs: 6855-6895 and the capsid protein encapsidating the miRNA guide may comprise a sequence selected from Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application among sequences 4475-4490, 4500-4505, 4540-4505, 4665-4670, 4830-4840, 5035-5040. The guide sequence may comprise a sequence having at least 95% sequence identity to a sequence selected from SEQ ID NOs: 6855-6885 and the capsid protein encapsidating the miRNA guide may comprise a sequence selected from among sequences 4475-4490, 4500-4505, 4540-4505, 4665-4670, 4830-4840, 5035-5040. In further exemplary aspects of the invention, the guide sequence may comprise a sequence having at least 95% sequence identity to a sequence selected from SEQ ID NOs: 6855- 6875 and the capsid protein encapsidating the miRNA guide may comprise a sequence selected from among sequences 4475-4490, 4500-4505, 4540-4505, 4665-4670, 4830-4840, 5035-5040. The guide sequence may comprise a sequence having at least 95% sequence identity to a sequence selected from SEQ ID NOs: 6855-6865 and the capsid protein encapsidating the miRNA guide may comprise a sequence selected from among SEQ ID NO: 4479, 4486, 4487, 4503, 4544, 4667, 4832, 4838, or 5036. In preferred aspects of the invention, the guide sequence may comprise a sequence having at least 95% sequence identity to a sequence selected from SEQ ID NOs: 6860-6865, for example, SEQ ID NOs: 6861, 6862, 6863, 6864, or 6865, and the capsid protein encapsidating the miRNA guide may comprise a sequence selected from among SEQ ID NO: 4479, 4486, 4487, 4503, 4544, 4667, 4832, 4838, or 5036. Experimental Examples Facioscapulohumeral muscular dystrophy (FSHD) is an autosomal-dominant genetic disorder affecting an estimated 1 in 8,000 individuals. Patients with FSHD typically exhibit progressive wasting of muscles in the face, shoulders, upper arms, legs, and abdomen; approximately 20% of patients will eventually require the use of a wheelchair, and the majority experience debilitating pain and fatigue. De-repression of the transcription factor DUX4 has been identified as the pathogenetic mechanism in FSHD: insufficient epigenetic silencing of the DUX4 gene in patient muscles results in aberrant expression of DUX4, which is toxic to mature myofibers. Knockdown of DUX4 transcripts using gene therapy as a therapeutic strategy for FSHD was analyzed. FIG.1 shows a schematic of knockdown of DUX4 mRNA. Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application A high throughput tiling screen of artificial miRNAs targeting DUX4 identified the most potent miRNA targeting the transcript. Stringent in vitro and in vivo screening was utilized to identify the most potent and selective miRNA knockdown sequences to target DUX4, resulting in the identification of a lead and backup miRNA knockdown sequence. Greater than 14,000 candidate miRNA sequences were screened in a cell-based DUX4 knockdown assay. An in silico selection of candidate sequences was conducted to exclude sequences that had a perfect 21-mer match to an off-target RNA. The top 13 lead sequences for potency (DUX4 kD) and selectivity (RNAseq) were identified. The top 5 leads were tested in ACTA1-MCC;FLExDUX4 mice confirming in vivo potency. Lead miRNA candidates of the invention were advanced to NHP biodistribution / safety studies. In vitro tiling screen identifies the most potent artificial miRNA sequences targeting DUX4 HEK293 cell line were generated stably expressing mCherry-tagged DUX4 (Hox1 mutant). FIG.2 is a schematic of lentiviral constructs used to screen miRNAs. Transduction of the stable cell line at low MOI. Fluorescence-activated cell sorting (FACS) and next generation sequencing (NGS) was conducted of the miRNA sequences. A lentiviral / FACS-based screen was performed to identify the most potent artificial miRNA sequences targeting DUX4. FIG.3 is a graph of FACS sorting of positive and negative populations with miRNA sequences. Several potent sequences were selected for individual testing in FSHD patient-derived myotubes. FIG.4 is a graph showing top miRNA sequences based on enrichment. Primary human myotubule expression Top miRNA hits from the screen knock down DUX4 when tested individually in FSHD1 patient myotubes. Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application FIG.5A-B show graphs of DUX4 expression of DUX4 and DUX4 downstream gene hZSCAN4 in FSHD patient myotubes transduced with miRNA candidates. An FSHD lead candidate was selected with potently knocks down DUX4 and decreases expression of DUX4 downstream genes, regardless of the timing of transduction. FIG.6A-D show graphs of DUX4 and DUX4 target gene expression in patient myotubules following lead candidate transduction. The FSHD lead candidate knocked down DUX4 in FSHD patient myotubes in a dose dependent manner when cells were transduced at the time of inducing differentiation as shown in FSHD composite gene expression calculated by averaging normalized expression of several DUX4 downstream genes (CCNA1, MBD3L2, ZSCAN4, TRIM43, KHDC1L). The FSHD lead candidate knocked down DUX4 in FSHD patient myotubes in a dose dependent manner when myotubes were transduced after differentiation. The FSHD lead candidate effectively knocked down DUX4 and decreased expression of DUX downstream genes in FSHD patient cells RNAseq and small RNAseq in control cells was used as a measure of relative selectivity based on off-target expression changes in human myotubes to assess differential gene and endogenous miRNA expression between myotubes transduced with the lead candidate and scrambled control. FIG.7A-B show volcano plots of RNAseq results of differentially expressed genes and differentially expressed endogenous miRNAs in human myotubes transduced with FSHD lead miRNA candidates vs scrambled control based on RNAseq. Lead miRNAs were expressed at therapeutic levels. Lead candidates did not result in off- target effects based on RNAseq and small RNAseq, with no endogenous mRNA or miRNAs meeting criteria of adjusted p<0.001, 33% decrease or 50% increase. Candidate capsids Muscle tropic liver de-targeted capsid described herein encapsidating the FSHD lead candidates were engineered to transduce all muscle fibers after systemic administration in NHPs. The new class of muscle targeted and liver de-targeted MyoAAV-LD capsid variants were evolved, with top MyoAAV-LD variants from directed evolution benchmarked against naturally Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application occurring and engineered AAV capsids in NHPs. MyoAAV-LD 6.1 was identified as the lead capsid. Transgene mRNA expression from MyoAAV-LD 6.1 was compared to different naturally occurring and engineered capsids in non-human primate (NHP) skeletal muscles. Barcoded hFXN was packaged in different capsids and injected into NHPs as a pool. Abundance of transgene mRNA was measured by NGS. MyoAAV-LD-6.1 showed ~60 times higher transgene expression compared to AAVrh74. FIG.8A-B are graphs of skeletal muscle mRNA and liver capsid DNA expression following MyoAAV administration to non-human primates (NHPs). MyoAAV-LD-6.1 showed ~10 times lower vector genome levels in the liver compared to AAVrh74. FIG.9 shows immunofluorescent imaging of bicep tissue following MyoAAV administration to Cynomolgus macaques systemically injected with MyoAAV-LD-6.1–KEP1.1- microDystrophin-FLAG at 4E+13 vg / kg. MyoAAV-LD-6.1 transduced all muscle fibers after systemic administration in NHPs. Mouse expression The lead candidates were tested in ACTA1-MCM;FLExDUX4 mice. Bitransgenic ACTA1-MCM;FLExDUX4 mice express DUX4 and DUX4 downstream genes following tamoxifen induction. ~3 month old mice FIG.10 shows a study design in mice after injection with a candidate miRNA. ACTA1-MCM;FLExDUX4 mice (~3 months old) were injected with MyoAAV delivering different top DUX4 miRNAs.3 weeks later, mice were injected with tamoxifen to induce DUX4 expression. Expression of DUX4 and DUX4 target genes were quantified 10 days after tamoxifen induction. FIG.11 shows a graph of FSHD composite gene expression following tamoxifen induced DUX4 expression and administration of vehicle and a lead candidate. DUX4 downstream gene expression was decreased in induced mice treated with the lead candidate. FSHD composite gene expression is the average of DUX4 downstream genes SLN, KIF4, WFDC3, and ENTPD3. Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application FIG.12A-B show graphs of DUX4 and mKif4 expression in mouse triceps following administration of candidate miRNA sequence. FIG.13 shows images of muscle degeneration in mice following tamoxifen induced DUX4 expression and administration of vehicle and the lead candidate. Arrows show area of active degeneration. Muscle histology was improved in induced mice treated with the lead candidate compared to vehicle injected induced animals. FIG.14A-B show graphs of results from treadmill assessments of mice following tamoxifen induced DUX4 expression and administration of vehicle and the lead candidate. ACTA1-MCM;FLExDUX4 mice treated with the lead candidate run longer on the treadmill compared to vehicle injected induced animals. Older mice FIG.15 shows a study design in older mice after injection with a candidate miRNA. ACTA1-MCM;FLExDUX4 mice (~14 months old) were injected with MyoAAV delivering different top DUX4 miRNAs. FIG.16 shows a graph of FSHD composite gene expression following tamoxifen induced DUX4 expression and administration of vehicle and the lead candidate. DUX4 downstream gene expression was decreased in older ACTA1-MCM;FLExDUX4 mice treated with the lead candidate. FIG.17 shows images of muscle degeneration in mice following administration of vehicle and the lead candidate. Arrows show area of active degeneration. Muscle histology was improved in old ACTA1-MCM;FLExDUX4 mice treated with the lead candidate compared to vehicle injected animals The FSHD lead candidate resulted in a reduction of DUX4 downstream gene expression and improvement of muscle histology in old ACTA1-MCM; FLExDUX4 mice Conclusions The MyoAAV Engineered AAV significantly outperformed competitor capsids in transducing NHP muscle and is de-targeted from the liver after systemic administration. The lead candidate knocked down DUX4 and DUX4 downstream genes in FSHD patient myotubes, regardless of timing of transduction. Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application The lead candidate knocked down DUX4 downstream genes and rescues functional phenotypes and histopathology in a severe mouse model of FSHD. The FSHD lead candidate did not result in off-target effects on endogenous mRNA and miRNA expression in human myotubes. Incorporation by Reference References and citations to other documents, such as patents, patent applications, patent publications, journals, books, papers, web contents, have been made throughout this disclosure. All such documents are hereby incorporated herein by reference in their entirety for all purposes. Equivalents Various modifications of the invention and many further embodiments thereof, in addition to those shown and described herein, will become apparent to those skilled in the art from the full contents of this document, including references to the scientific and patent literature cited herein. The subject matter herein contains important information, exemplification and guidance that can be adapted to the practice of this invention in its various embodiments and equivalents thereof.

Claims

Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application Claims 1. A nucleic acid molecule comprising an miR scaffold and a miR guide sequence that targets a double homeobox 4 (DUX4) transcript.

2. The nucleic acid molecule of claim 1, wherein the nucleic acid molecule comprises a miRNA guide sequence having at least 95% sequence identity to a sequence selected from SEQ ID NOs: 1250-2769 or 6687-6770.

3. The nucleic acid molecule of claim 2, wherein the nucleic acid molecule comprises a miRNA guide sequence selected from SEQ ID NOs: 1250-2769 or 6687-6770.

4. The nucleic acid molecule of claim 1, wherein the nucleic acid molecule comprises a miRNA having at least 95% sequence identity to a sequence selected from the group of SEQ ID NOs: 2770-3597 or 6671-6812.

5. The nucleic acid molecule of claim 4, wherein the miRNA targets a double homeobox 4 (DUX4) transcript at the position shown in Table 6.

6. The nucleic acid molecule of claim 1, wherein the miRNA scaffold is derived from the pri- miRNA selected from the group consisting of pri-miR-21, pri-miR-22, pri-miR-26a, pri-miR- 30a, pri-miR-33, pri-miR-122, pri-miR-375, pri-miR-199, pri-miR-99, pri-miR-194, pri-miR- 155, and pri-miR-451.

7. The nucleic acid molecule of claim 6, wherein the miRNA scaffold is derived from pri-miR- 33.

8. The nucleic acid of claim 1, wherein the miRNA further comprises 5-6 thymidines at the 5’ end.

9. The nucleic acid of claim 1, further comprising a promoter sequence.Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application 10. The nucleic acid of claim 9, wherein the promoter sequence is a U6 promoter sequence, MHCK7 promoter sequence, CK6 promoter sequence, tMCK promoter sequence, CK5 promoter sequence, MCK promoter sequence, HAS promoter sequence, MPZ promoter sequence, desmin promoter sequence, APOA2 promoter sequence, hAAT promoter sequence, INS promoter sequence, IRS2 promoter sequence, MYH6 promoter sequence, MYL2 promoter sequence, TNNI3 promoter sequence, SYN1 promoter sequence, GFAP promoter sequence, NES promoter sequence, MBP promoter sequence, or TH promoter sequence.

11. A adeno-associated virus (AAV) vector comprising: a promoter sequence, an nucleic acid molecule comprising a miR scaffold and a miR guide sequence that targets a double homeobox 4 (DUX4) transcript; and a capsid protein.

12. The AAV vector of claim 11, wherein the nucleic acid molecule comprises a miRNA guide sequence having at least 95% sequence identity to a sequence selected from SEQ ID NOs:.2010- 2769.

13. The AAV vector of claim 12, wherein the nucleic acid molecule comprises a miRNA guide sequence selected from SEQ ID NOs: 1250-2769 or 6687-6770.

14. The AAV vector of claim 13, wherein the nucleic acid molecule comprises a miRNA having at least 95% sequence identity to a sequence selected from the group of SEQ ID NOs: 2770-3597 or 6670-6812.

15. The AAV vector of claim 14, wherein the nucleic acid molecule comprises a miRNA guide sequence selected from SEQ ID NOs: 2770-3597 or 6670-6812.

16. The AAV vector of claim 11, wherein the miRNA targets a double homeobox 4 (DUX4) transcript at the position shown in Table 6.Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application 17. The AAV vector of claim 11, wherein the miRNA scaffold is derived from the pri-miRNA selected from the group consisting of pri-miR-21, pri-miR-22, pri-miR-26a, pri-miR-30a, pri- miR-33, pri-miR-122, pri-miR-375, pri-miR-199, pri-miR-99, pri-miR-194, pri-miR-155, and pri-miR-451.

18. The AAV vector of claim 17, wherein the miRNA scaffold is derived from pri-miR-33.

19. The AAV vector of claim 11, wherein the miRNA further comprises 5-6 thymidines at the 5’ end.

20. The AAV vector of claim 1, further comprising a promoter sequence.

21. The AAV vector of claim 20, wherein the promoter sequence is a U6 promoter sequence, MHCK7 promoter sequence, CK6 promoter sequence, tMCK promoter sequence, CK5 promoter 22. The AAV vector of claim 11, wherein the capsid protein comprises at least one modification that results in reduced liver-tropism of the AAV vector and / or preferential targeting of the AAV vector to muscle tissue.

23. The AAV vector of claim 11, wherein the vector further comprises a nuclear export sequence enabling nuclear spreading.

24. The AAV vector of claim 11, wherein the capsid protein comprises at least one modification that is an insertion between any two contiguous amino acids between amino acids 262-269, 327- 332, 382-386, 452-460, 488-505, 527-539, 545-558, 581-593, 704-714, or any combination thereof in an AAV9 capsid polypeptide or in an analogous position in an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV rh.74, AAV rh.10 capsid polypeptide.

25. The AAV vector of claim 24, wherein the capsid protein may be selected from the sequences in Tables 1-5.Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application 26. A method of inhibiting expression of a gene or gene product in a cell, the method comprising administering to a subject a composition that results in expression within the cell of a nucleic acid molecule comprising a pri-miR scaffold and a miR guide sequence that targets a double homeobox 4 (DUX4) transcript.

27. The method of claim 26, wherein the nucleic acid molecule comprises a miRNA guide sequence having at least 95% sequence identity to a sequence selected from SEQ ID NOs: 1250- 2769.

28. The method of claim 27, wherein the nucleic acid molecule comprises a miRNA guide sequence selected from SEQ ID NOs: 2010-2769 or 2770-3597.

29. The method of claim 28 wherein the nucleic acid molecule comprises a miRNA having at least 95% sequence identity to a sequence selected from the group of SEQ ID NOs: 2770-3529 or 6670-6812.

30. The method of claim 29, wherein the miRNA targets a double homeobox 4 (DUX4) transcript at the position shown in Table 6.

31. The method of claim 1, wherein the miRNA scaffold is derived from the pri-miRNA selected from the group consisting of pri-miR-21, pri-miR-22, pri-miR-26a, pri-miR-30a, pri- miR-33, pri-miR-122, pri-miR-375, pri-miR-199, pri-miR-99, pri-miR-194, pri-miR-155, and pri-miR-451.

32. The method of claim 31, wherein the miRNA scaffold is derived from pri-miR-33.

33. The method of claim 1, wherein the miRNA further comprises 5-6 thymidines at the 5’ end.

34. The method of claim 1, further comprising a promoter sequence.Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application 35. The method acid of claim 34, wherein the promoter sequence is a U6 promoter sequence, MHCK7 promoter sequence, CK6 promoter sequence, tMCK promoter sequence, CK5 promoter sequence, MCK promoter sequence, HAS promoter sequence, MPZ promoter sequence, desmin promoter sequence, APOA2 promoter sequence, hAAT promoter sequence, INS promoter sequence, IRS2 promoter sequence, MYH6 promoter sequence, MYL2 promoter sequence, TNNI3 promoter sequence, SYN1 promoter sequence, GFAP promoter sequence, NES promoter sequence, MBP promoter sequence, or TH promoter sequence.

36. The method of claim 26, wherein the composition comprises an adeno-associated virus (AAV) vector comprising a promoter sequence, the nucleic acid molecule comprising the pri- miR scaffold and miR guide sequence, and a capsid protein.

37. The method of claim 26, wherein the capsid protein comprises at least one modification that results in reduced liver-tropism of the AAV vector and / or preferential targeting of the AAV vector to muscle tissue.

38. The method of claim 36, wherein the AAV vector comprises at least one modification that is an insertion between any two contiguous amino acids between amino acids 262-269, 327-332, 382-386, 452-460, 488-505, 527-539, 545-558, 581-593, 704-714, or any combination thereof in an AAV9 capsid polypeptide or in an analogous position in an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV rh.74, AAV rh.10 capsid polypeptide.

39. The method of claim 38, wherein the capsid protein may be selected from the sequences in Tables 1-5.

40. The method of claim 36, wherein the vector further comprises a nuclear export sequence enabling nuclear spreading.

41. The method of claim 26, wherein inhibition of the gene or gene product results in treatment of muscular dystrophy.Attorney Docket No.: KATE-022 / 01WO 36391 / 151 Patent Application 42. The method of claim 41, wherein the muscular dystrophy is Facioscapulohumeral Muscular Dystrophy 1.

43. The method of claim 42, wherein the treatment may comprise arresting the muscular effects of muscular dystrophy.

44. The method of claim 43, wherein the treatment may comprise reversing the muscular effects of the muscular dystrophy.

Images