Compositions including small-molecule tert activator compounds and uses thereof

EP4770625A1Pending Publication Date: 2026-07-08BOARD OF RGT THE UNIV OF TEXAS SYST +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
BOARD OF RGT THE UNIV OF TEXAS SYST
Filing Date
2024-08-30
Publication Date
2026-07-08

AI Technical Summary

Technical Problem

Current treatments for aging, aging-related diseases, and neurodegenerative conditions are limited, and there is an urgent need for clinically actionable therapies that can effectively address telomere dysfunction and associated pathologies by activating telomerase reverse transcriptase (TERT).

Method used

The development of compositions comprising small-molecule TERT activator compounds, such as TAC-67-001 and TAC-64-001, which upregulate TERT transcription, thereby promoting telomere synthesis and alleviating aging hallmarks.

Benefits of technology

These compounds effectively increase TERT levels, leading to reduced cellular senescence, inflammatory cytokines, and senescent cell-associated secretory phenotype, while also improving cognitive function and neuroprotection in models of aging and neurodegenerative diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2024044897_06032025_PF_FP_ABST
    Figure US2024044897_06032025_PF_FP_ABST
Patent Text Reader

Abstract

The present disclosure provides compositions for activating TERT expression and methods of using the same for treating or ameliorating aging, aging-related diseases, and neurodegenerative conditions.
Need to check novelty before this filing date? Find Prior Art

Description

COMPOSITIONS INCLUDING SMALL-MOLECULE TERT ACTIVATOR COMPOUNDS AND USES THEREOFCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of and priority to U.S. Provisional Appl. No. 63 / 580,217, filed September 1, 2023, which is incorporated herein by reference in its entirety for any and all purposes.TECHNICAL FIELD

[0001] The present technology relates generally to compositions comprising smallmolecule TERT activator compounds and uses thereof for treating or ameliorating aging, aging-related diseases, and neurodegenerative conditions.STATEMENT OF FEDERALLY FUNDED RESEARCH

[0002] This invention was made with government support under CA084628 awarded by the National Institutes of Health. The government has certain rights in the invention.BACKGROUND

[0003] The following description of the background of the present technology is provided simply as an aid in understanding the present technology and is not admitted to describe or constitute prior art to the present technology.

[0004] Telomere dysfunction is a primary hallmark of aging, causing molecular and cellular damage and acts as an instigator or amplifier of the molecular circuitries driving the aging process and its associated diseases. Insufficient telomerase activity, stemming from low telomerase reverse transcriptase (TERT) gene transcription, leads to telomere dysfunction and aging pathologies. In addition to its classical role in synthesizing telomeres, TERT serves as a transcriptional co-regulator of genes relevant to aging, age- associated diseases and neurodegenerative conditions, including Alzheimer’s and chemotherapy induced peripheral neuropathy. Aging, age-associated diseases and neurodegenerative conditions pose a substantial public health challenge, and there are limited treatments available to address them. For example, at least 55 million people are estimated to be living with Alzheimer’s or other dementias, and there is no cure for the condition.

[0005] Accordingly, there is an urgent need to identify clinically actionable therapies that can treat or ameliorate aging, age-associated diseases, and neurodegenerative disorders via TERT activation.SUMMARY OF THE PRESENT TECHNOLOGY

[0006] In one aspect, the present disclosure provides a composition comprising one or more compounds selected from the group consisting of: a A-(3-chloro-4-fluorophenyl)-4- fluoro-3,5-dimethylbenzenesulfonamide compound (referred to herein as TAC-67-001) represented by formula (I):a A-(3,5-dichlorophenyl)-2,3,4,5,6-pentamethylbenzenesulfonamide compound (referred to herein as TAC-64-001) represented by formula (II):or a combination thereof.

[0007] In some embodiments, the one or more compounds are in the form of a pharmaceutically acceptable salt.

[0008] In another aspect, the present disclosure provides a pharmaceutical composition comprising the composition of any of the preceding embodiments and a pharmaceutically acceptable carrier.

[0009] In some embodiments, the pharmaceutically acceptable carrier comprises phosphate buffered saline, preservatives, or combinations thereof.

[0010] Additionally or alternatively, in some embodiments the pharmaceutical further comprises one or more additional agents.

[0011] In certain embodiments, the one or more additional agents is selected from the group consisting of aducanumab, solanezumab, CSP-1103, Mannitol, Osmitrol, Resectisol, Phenytoin, Dilantin, Phenytek, valproic acid, Depakote, Gabapentin, Neurontin, Topiramate, Topamax, Carbamazepine, Equetro, anti-platelet medications, aspirin, Clopidogrel, Ticagrelor, warfarin, prasugral, beta blockers, Angiotensin-converting enzyme (ACE) inhibitors, benazepril, Lisinopril, Ramipril, calcium channel blockers, diuretics, aspirin, Levodopa, carbidopa, tetrabenazine, deuterabenazine, zonisamid, Zonegran, levetiracetam, Keppra, clonazepam, Klonopin, rufmamide, Banzel, lamotrigine, Lamictal, pregabalin, Lyrica, lacosamide, Vimpat, vigabatrin, Sabril, oxcarbazepine, Trileptal, phenobarbital, Donepezil, galantamine, memantine, rivastigmine, memantine extended- release and donepezil, Namzaric, verubecestat, AADvacl, intepirdine, or any combination thereof.

[0012] In certain embodiments, the one or more additional agents is selected from the group consisting of Lonafarnib, zokinvy, aspirin, Androgen, G-CSF, GM-CSF, and any combination thereof.

[0013] In certain embodiments, the one or more additional agents is selected from the group consisting of insulin, metformin, amylin analogs, glucagon, sulfonylureas, glimepiride, glipizide, glyburide, chlorpropamide, tolazamide, tolbutamide, meglitinides, nateglinide, mitiglinide, repaglinide, thiazolidinediones, pioglitazone, rosiglitazone, alphaglucosidase inhibitors, acarbose, miglitol, dipeptidyl peptidase (DPP -4) inhibitors, alogliptin, linagliptin, sitagliptin, saxagliptin, sodium-glucose co-transporter 2 (SGLT2) inhibitors, canagliflozin, dapagliflozin, empagliflozin, ertugliflozin, incretin mimetics, exenatide, liraglutide, dulaglutide, lixisenatide, semaglutide, PPAR-antagonists, interleukin- 10, furosemide, pirfenidone, Esbriet, nintedanib, Ofev, statins, Atorvastatin, Fluvastatin, Lovastatin, Pitavastatin, Pravastatin Rosuvastatin calcium, Simvastatin, fibrates, Gemfibrozil, Fenofibrate, niacin, ezetimibe, bile acid sequestrants, cholestyramine, colestipol, colesevelam, proprotein convertase subtilisin kexin type 9 (PCSK9) inhibitors, endothelin inhibitors, pentoxifylline, phosphate binders, calcium acetate, calcium carbonate,hyaluronic acid, a-Tocopherol, colchicine, TGF-pi inhibitors, erythropoietin, S-adenosyl- methionine, colecalciferol, ergocalciferol, analgesics, acetaminophen, tramadol, oxycodone, hydrocodone, nonsteroidal anti-inflammatory drugs, aspirin, ibuprofen, naproxen, celecoxib, cyclooxygenase-2 inhibitors, corticosteroids, interferon-a, phosphatidylcholine, cyclophosphamide, or any combination thereof.

[0014] In any of the preceding embodiments, the composition is formulated for oral, intranasal, intrathecal, parenteral intravenous, intramuscular, intraperitoneal, subcutaneous, rectal, intrathecal, intraocular, intradermal, transmucosally, iontophoretical, or topical administration.

[0015] In certain embodiments, the composition formulated for oral administration is a capsule, tablet, pill, powder, or granule.

[0016] In certain embodiments, the composition formulated for topical administration is a roll-on, a cream, a lotion, a gel, a powder, a water activated cream, a water activated power, an injectable, a patch, or a spray.

[0017] In another aspect, the present disclosure provides a method of treating aging, an aging-related disease, or a neurodegenerative disease in a subject in need thereof, comprising administering to the subject an effective amount of the composition of any of the preceding embodiments or the pharmaceutical composition of any one of the preceding embodiments.

[0018] In some embodiments, the aging-related disease or the neurodegenerative disease is selected from the group consisting of Alzheimer’s disease, epilepsy, Huntington's Disease, Parkinson's Disease, stroke, spinal cord injury, traumatic brain injury, Lewy body dementia, Pick's disease, Niewmann-Pick disease, amyloid angiopathy, cerebral amyloid angiopathy, systemic amyloidosis, hereditary cerebral hemorrhage with amyloidosis of the Dutch type, mild cognitive impairment, chemotherapy induced peripheral neuropathy, Hutchinson-Gilford progeria syndrome (HGPS), Nestor-Guillermo progeria syndrome, Werner syndrome, Cockayne syndrome, Bloom syndrome, xeroderma pigmentosum, ataxia telangiectasia, trichothiodystrophy, dyskeratosis congenital, mosaic variegated aneuploidy syndrome, diabetes, liver fibrosis, liver cirrhosis, lung fibrosis, atherosclerosis, chronic kidney disease, inclusion body myositis, or osteoarthritis, or any combination thereof.

[0019] In certain embodiments, the aging-related disease or neurodegenerative disease is Alzheimer’s disease.

[0020] In certain embodiments, the aging-related disease or neurodegenerative disease is chemotherapy induced peripheral neuropathy.

[0021] In some embodiments, dermatological ageing, including skin wrinkles and / or hair loss, may be treated with TAC-67-001.

[0022] Additionally or alternatively, in some embodiments the aging-related disease or the neurodegenerative disease comprises senescent cells, neuroinflammation, neuronal loss, loss of dendritic spines, decreased expression of learning and memory genes, and amyloid plaque formation.

[0023] In any of the preceding embodiments, the composition or pharmaceutical composition is administered orally, intranasally, intrathecally, parenterally, intravenously, intramuscularly, intraperitoneally, subcutaneously, rectally, intrathecally, intraocularly, intradermally, transmucosally, iontophoretically, or topically.

[0024] In any of the preceding embodiments, the composition or pharmaceutical composition is administered sequentially, simultaneously, or separately with one or more additional agents.

[0025] In certain embodiments, the one or more additional agents is selected from the group consisting of aducanumab, solanezumab, CSP-1103, Mannitol, Osmitrol, Resectisol, Phenytoin, Dilantin, Phenytek, valproic acid, Depakote, Gabapentin, Neurontin, Topiramate, Topamax, Carbamazepine, Equetro, anti-platelet medications, aspirin, Clopidogrel, Ticagrelor, warfarin, prasugral, beta blockers, Angiotensin-converting enzyme (ACE) inhibitors, benazepril, Lisinopril, Ramipril, calcium channel blockers, diuretics, aspirin, Levodopa, carbidopa, tetrabenazine, deuterabenazine, zonisamid, Zonegran, levetiracetam, Keppra, clonazepam, Klonopin, rufmamide, Banzel, lamotrigine, Lamictal, pregabalin, Lyrica, lacosamide, Vimpat, vigabatrin, Sabril, oxcarbazepine, Trileptal, phenobarbital, Donepezil, galantamine, memantine, rivastigmine, memantine extended- release and donepezil, Namzaric, verubecestat, AADvacl, intepirdine, or any combination thereof.

[0026] In certain embodiments, the one or more additional agents is selected from the group consisting of Lonafarnib, zokinvy, aspirin, Androgen, G-CSF, GM-CSF, and any combination thereof.

[0027] In certain embodiments, the one or more additional agents is selected from the group consisting of insulin, metformin, amylin analogs, glucagon, sulfonylureas, glimepiride, glipizide, glyburide, chlorpropamide, tolazamide, tolbutamide, meglitinides, nateglinide, mitiglinide, repaglinide, thiazolidinediones, pioglitazone, rosiglitazone, alphaglucosidase inhibitors, acarbose, miglitol, dipeptidyl peptidase (DPP -4) inhibitors, alogliptin, linagliptin, sitagliptin, saxagliptin, sodium-glucose co-transporter 2 (SGLT2) inhibitors, canagliflozin, dapagliflozin, empagliflozin, ertugliflozin, incretin mimetics, exenatide, liraglutide, dulaglutide, lixisenatide, semaglutide, PPAR-antagonists, interleukin- 10, furosemide, pirfenidone, Esbriet, nintedanib, Ofev, statins, Atorvastatin, Fluvastatin, Lovastatin, Pitavastatin, Pravastatin Rosuvastatin calcium, Simvastatin, fibrates, Gemfibrozil, Fenofibrate, niacin, ezetimibe, bile acid sequestrants, cholestyramine, colestipol, colesevelam, proprotein convertase subtilisin kexin type 9 (PCSK9) inhibitors, endothelin inhibitors, pentoxifylline, phosphate binders, calcium acetate, calcium carbonate, hyaluronic acid, a-Tocopherol, colchicine, TGF-pi inhibitors, erythropoietin, S-adenosyl- methionine, colecalciferol, ergocalciferol, analgesics, acetaminophen, tramadol, oxycodone, hydrocodone, nonsteroidal anti-inflammatory drugs, aspirin, ibuprofen, naproxen, celecoxib, cyclooxygenase-2 inhibitors, corticosteroids, interferon-a, phosphatidylcholine, cyclophosphamide, or any combination thereof.

[0028] In some embodiments, the one or more additional agents are administered orally, intranasally, intrathecally, parenterally, intravenously, intramuscularly, intraperitoneally, subcutaneously, rectally, intrathecally, intraocularly, intradermally, transmucosally, iontophoretically, or topically.

[0029] In one aspect, the present disclosure provides a kit comprising the composition of any of the preceding embodiments or the pharmaceutical composition of any of the preceding embodiments and instructions for treating aging, an aging-related disease, or a neurodegenerative disease.

[0030] In some embodiments, the aging-related disease or the neurodegenerative disease is selected from the group consisting of Alzheimer’s disease, epilepsy, Huntington's Disease, Parkinson's Disease, stroke, spinal cord injury, traumatic brain injury, Lewy bodydementia, Pick's disease, Niewmann-Pick disease, amyloid angiopathy, cerebral amyloid angiopathy, systemic amyloidosis, hereditary cerebral hemorrhage with amyloidosis of the Dutch type, mild cognitive impairment, chemotherapy induced peripheral neuropathy, Hutchinson-Gilford progeria syndrome (HGPS), Nestor-Guillermo progeria syndrome, Werner syndrome, Cockayne syndrome, Bloom syndrome, xeroderma pigmentosum, ataxia telangiectasia, trichothiodystrophy, dyskeratosis congenital, mosaic variegated aneuploidy syndrome, diabetes, liver fibrosis, liver cirrhosis, lung fibrosis, atherosclerosis, chronic kidney disease, inclusion body myositis, or osteoarthritis, or any combination thereof.

[0031] In another aspect, the present disclosure provides a method for identifying a candidate agent for activating human TERT expression comprising (a) contacting a recombinant cell comprising a human TERT reporter transgene with a candidate agent (b) detecting expression levels of the human TERT reporter transgene in the recombinant cell, wherein an increase in the expression levels of the human TERT reporter transgene in the recombinant cell of step (a) compared to that observed in the recombinant call in the absence of the candidate agent indicates that the candidate agent increases TERT expression.

[0032] In some embodiments, the candidate agent that increases TERT expression further increases ERK activity in the recombinant cell of step (a) compared to the ERK activity observed in the recombinant cell in the absence of the candidate agent.

[0033] Additionally or alternatively, in some embodiments the human TERT reporter transgene comprises a TERT regulatory sequence or promoter that is operably linked to a reporter gene.

[0034] In some embodiments, the reporter gene comprises an open reading frame that encodes a fluorescent protein, a chemiluminescent protein, a bioluminescent protein, or any combination thereof.

[0035] In certain embodiments, the fluorescent protein is TagBFP, Azurite, EBFP2, mKalamal, Sirius, Sapphire, T-Sapphire, ECFP, Cerulean, SCFP3A, mTurquoise, monomeric Midoriishi-Cyan, TagCFP, mTFPl, EGFP, Emerald, Superfolder GFP, Monomeric Azami Green, TagGFP2, mUKG, mWasabi, EYFP, Citrine, Venus, SYFP2, Tag YFP, Monomeric Kusabira-Orange, mKOx, mK02, mOrange, mOrange2, mRaspberry, mCherry, dsRed, mStrawberry, mTangerine, tdTomato, TagRFP, TagRFP-T, mApple,mRuby, mPlum, HcRed-Tandem, mKate2, mNeptune, NirFP, TagRFP657, IFP1.4, iRFP, mKeima Red, LSS-mKatel, LSS-mKate2, PA-GFP, PAmCherryl, PATagRFP, Kaede (green), Kaede (red), KikGRl (green), KikGRl (red), PS-CFP2, PS-CFP2, mEos2 (green), mEos2 (red), PSmOrange, or Dronpa.

[0036] In certain embodiments, the chemiluminescent protein is 3 -galactosidase, horseradish peroxidase (HRP), or alkaline phosphatase.

[0037] In certain embodiments, the bioluminescent protein is Aequorin, firefly luciferase, Renilla luciferase, red luciferase, luxAB, or nanoluciferase.BRIEF DESCRIPTION OF THE DRAWINGS

[0038] FIGs. 1A-1I: Identification of a small molecule activator of TERT. FIG.1 A: The workflow of high-throughput and confirmation screening strategy used to identify novel small molecule TERT activators. FIG. IB: Plate-based Z scores of hTERT-RLUC luminance measurements of all test compounds screened in primary adult mouse fibroblasts of hTERT-Rluc transgenic mouse. FIG. 1C: Molecular structure of TAC-67-001. FIG. ID: TERT mRNA levels in MRC-5 fibroblasts treated with the indicated concentration of TAC-67-001 for 4 h. FIG. IE: The chromatin occupancy of active enhancer / promoter mark H3K27ac and repressive histone mark H3K9me3 in the TERT gene of vehicle- or TAC -treated MRC-5 fibroblasts. FIG. IF: hTERT promoter activity in the indicated tissues of hTERT-Rluc reporter transgenic mice upon TAC-67-001 administration. FIG. 1G: Immunoblots for the indicated endogenous proteins in vehicle- or TAC -treated primary WS fibroblasts, with tubulin used as a loading control. FIG. 1H: Relative telomere length of primary WS fibroblasts treated with vehicle or TAC-67-001. Relative telomere length was determined as the ratio of telomere repeat copy numbers to single copy gene 36B4 copy number measured by quantitative PCR. FIG. II: Left, representative FISH images for telomeres (red) in interphase nuclei of vehicle- or TAC -treated WS fibroblasts. Right, quantification of telomere FISH. Each value represents average intensity of each nuclei (n = 50 nuclei per group). For all panels, data are mean ± s.e.m. *P < 0.05, **P < 0.01, *** < 0.001, ****p < 0.0001.

[0039] FIGs. 2A-2C. Compound screening in hTERT-Rluc transgenic mouse and human fibroblasts. FIG. 2A: mTert and hTERT mRNA levels in compound-treated primary ear fibroblasts isolated from adult hTERT-Rluc transgenic mice. FIG. 2B: hTERTmRNA expression levels in compound-treated MRC-5 human fibroblasts. FIG. 2C: Cumulative growth curve of vehicle- or TAC-treated WS fibroblasts (n = 3~4 per group). Data are mean ± s.e.m.

[0040] FIGs. 3A-3J. TAC-67-001 activates the MEK / ERK / AP-1 cascade to upregulate TERT transcription. FIG. 3A: Alteration of cellular signaling in TAC-treated MRC-5 cells. MRC-5 cells were treated with vehicle or TAC-67-001 for 1.5 h and the cell lysates were subjected to the human phosphokinase array. FIG. 3B: Quantification of p- ERK1 / 2 and p-S6K from the phosphokinase array in FIG. 3A. FIG. 3C: TERT and ERK levels in MRC-5 cells treated with TAC-67-001 and / or trametinib, a selective MEK inhibitor. FIG. 3D: RNA-seq heatmap of genes up-regulated upon TAC-67-001 treatment in human MRC-5 fibroblasts and human iPSC-derived neurons (n = 3). FIGs. 3E-3F: Quantification of the expression of FOS genes in human MRC-5 fibroblasts (FIG. 3E) and human iPSC-derived neurons (FIG. 3F) treated with vehicle or TAC-67-001 (n = 3). FIG. 3G: Sequence comparison of a putative FOS binding site in human and mouse TERT 5’- UTR region. FIG. 3H: Schematic representation and transcriptional activity of human-4 kb TERT promoter-Luc reporter constructs and deletion mutants in MRC-5 cells (n = 4). Putative AP-1 binding sites are boxed. FIG. 31: c-FOS ChlP-qPCR enrichment at the endogenous promoter region of TERTm ' MRC-5 cells after TAC-67-001 treatment (n = 4). FIG. 3 J: TERT levels in MRC-5 cells treated with TAC-67-001 and / or T-5224, a selective c-FOS / AP-1 inhibitor. For all panels, data are mean ± s.e.m. *P < 0.05, **P < 0.01, ***p < 0 ooi, 0.0001.

[0041] FIGs. 4A-4I. TAC-67-001 attenuates diverse aging hallmarks in vivo. FIG. 4A: GSEA plots showing downregulated GO pathways in the PBMC of TAC-treated C57BL / 6 mice relative to vehicle-treated controls (n = 4 per group; 10-12-month-old).FIG. 4B: mRNA levels of senescence-related genes downregulated in TAC-treated PBMCs compared to control. FIG. 4C: GSEA plots showing upregulated GO pathways in the PBMC of TAC-treated mice relative to vehicle-treated controls. FIGs. 4D-4E: pi6Ink4amRNA levels in the multiple tissues of TAC-treated wildtype (Tert+ / +) (FIG. 4D) or 7 <77- KO Tert7) (FIG. 4E) mice relative to each control group (n = 4 per group; 10-12-month- old). FIG. 4F: mRNA levels of Dnmt3b gene in wild-type (Tert . Tert heterozygous (7c77 ~) and Tert homozygous knockout Tert7', first-generation [G1 ]) mouse brains. FIG. 4G: TERT occupancy in the DNMT3B gene of human iPSC-derived neurons. FIG. 4H:pl6Ink4apromoter methylation levels in the kidney and liver tissues of vehicle- or TAC- treated C57BL / 6 mice (n = 4 mice per group; 10~12-month-old). FIG. 41: Representative images of SA-P-gal staining in the tissues of vehicle- or TAC -treated aged C57BL / 6 mice (n = 4, 26~27-month-old). For all panels, data are mean ± s.e.m. *P < 0.05, **P < 0.01, ***p < 0.001.

[0042] FIGs. 5A-5D. The pharmacokinetic profiles of TAC-67-001 in mice. FIG.5A: Pharmacokinetic assessment of TAC-67-001 after i.p. administration to mouse. Pharmacokinetic values are the mean of three animals per dose route. FIGs. 5B-5D: Plasma concentration (FIG. 5B), brain concentration (FIG. 5C), and brain / plasma ratio of TAC-67-001 in male CD1 mice (FIG. 5D). Data are mean ± s.e.m. n = 3.

[0043] FIGs. 6A-6D: The correlation of TERT with DNMT3b and p!6INK4a. FIG. 6A: p21CipImRNA levels in the multiple tissues of TAC -treated wildtype mice relative to each control group (n = 4 per group; 10-12-month-old). FIG. 6B: Representative images of p^giNK4a immunosaining in the indicated tissues of vehicle- or TAC -treated mice (n = 4, 10~12-month-old). Scale bar, 100 pm. FIGs. 6C-6D: The mRNA levels of epigenetic regulators (FIG. 6C) and transcription factors (FIG. 6D), which are known to regulate p^ink4a expression, in wild-type (WT) and TerP~ G1 mouse.

[0044] FIGs. 7A-7I: Chronic TAC-67-001 administration ameliorates brain aging. FIG. 7A: Immunoblots of mature BDNF in mouse hippocampus of middle-aged C57BL / 6 mice (10~12-month-old) treated with vehicle or TAC-67-001 for 1 week. FIG. 7B: Mature BDNF levels measured by ELISA in vehicle- or TAC -treated mouse hippocampal lysates. FIGs. 7C-7D: Representative images of DCX immunoreactivity by immunohistochemistry (FIG. 7C) or immunofluorescence (FIG. 7D) in the dentate gyrus of middle-aged (10-12- month-old) mice that were treated with vehicle or TAC-67-001 for 1 month. Scale bar, 100 pm. FIG. 7E: Quantifications of DCX+and DCX+PSA-NCAM+cells in both groups (n = 4). FIG. 7F: Representative images of IBA1 labelled microglia (left) and quantifications of microglial density (middle) and cell soma size (right) in the hippocampus of middle-aged (10-12-month-old) mice that were treated with vehicle or TAC-67-001 for 1 month. FIG. 7G: mRNA levels of pro-inflammatory cytokines 11-10, 11-6 and Tnf-a in the hippocampus of middle-aged mice (10-12-month-old) treated with vehicle or TAC-67-001 for 1 month (n = 4). FIG. 7H: Escape latency in Barnes maze trials over training days for aged (26-27- month-old) mice that were treated with vehicle or TAC-67-001 for 6 months (n = 6 for eachgroup). FIG. 71: Discrimination index for vehicle- or TAC -treated aged (26~27-month-old) mice in the novel-location recognition test (n = 6 for each group). For all panels, data are mean ± s.e.m. *P < 0.05, **P < 0.01, ***P < 0.001.

[0045] FIGs. 8A-8B: TAC-induced adult hippocampal neurogenesis of naturally aged mice. FIG. 8A: Representative images of PSA-NCAM+DCX+cells in the DG of middle-aged mice (arrows) treated with vehicle or TAC-67-001 for a month (n = 4). Scale bar, 25 pm. FIG. 8B: Body weight in mice after TAC-67-001 dosing (n = 4 per group).

[0046] FIG. 9: Schematic illustration of TAC / TERT-driven anti-aging effects. The expression of TERT, a catalytic subunit of telomerase, is tightly suppressed in normal somatic cells. Novel small molecules TAC-67-001 and TAC-64-001 can trigger transcriptional activation of somatic TERT expression via activation of MEK / ERK / AP-1 signaling cascade. Somatic TERT induction not only reduces tissue senescence by silencing p^giNK4a through promoter hypermethylation via DNMT3B, but also enhances adult hippocampal neurogenesis and cognitive function by promoting bioactive BDNF production.

[0047] FIG. 10: Efficacy of benzenesulfonamides in TERT activation. A panel of six benzenesulfonamides was tested for efficacy in TERT promoter activation. FIG. 10: TERT mRNA levels in MRC-5 fibroblasts treated with vehicle or candidate compounds 64 (TAC- 64-001), 65, 66, 67 (TAC), 68, or 69 for 4 h. Data are mean ± s.e.m. n = 3.

[0048] FIGs. 11A-11F: Long-term TAC-67-001 treatment ameliorates neuroinflammation and amyloid pathology and improves the synaptic vesicle pool in the hippocampus of Alzheimer’s disease mouse model. Representative images of IB Al labelled microglia (FIG.11A) and quantifications of microglial density and cell soma size (FIG.11B) in the hippocampus of 3xTg-AD mice that were treated with vehicle (DMSO) or TAC-67-001 (6 mg / kg / day) three times a week for 3 months. FIG.11C: Ap immunostaining in the CAI (left) and CA3 (right) subfields of adult 3xTg-AD mice that were treated with vehicle (DMSO) or TAC-67-001 (6mg / kg / day) three times a week for 6 months. FIG.11D: Quantitative comparison of Ap immunoreactive pyramidal neurons in the CAI regions. FIG.11E: Representative images of synapses from hippocampal neurons of adult 3xTg-AD mice that were treated with vehicle (DMSO) or TAC-67-001 (6mg / kg / day) three times a week for 6 months. FIG.11F: Quantification of synapticvesicles at presynaptic terminals in hippocampal neurons of adult 3xTg-AD mice treated with vehicle or TAC-67-001.

[0049] FIGs. 12A-12F: In vivo pharmacokinetic profiles of TAC-67-001 following oral administration. FIG. 12A: Pharmacokinetic parameters for TAC-67-001 in C57BL / 6 mice following oral favage at 20 mg / kg body weight. FIGs. 12B-12F: Plasma (FIG. 12B), small intestine (FIG. 12C) and brain (FIG. 12E) concentration-time profiles, and intestine / plasma (FIG. 12D) and brain / plasma (FIG. 12F) ratios of TAC-67-001 after oral administration of TAC-67-001 to C57BL / 6 mice. Data are mean ± s.e.m. n = 3.

[0050] FIGs. 13A-13E: TAC-67-001 protects against chemotherapy-induced peripheral neuropathy (CIPN) and the neuroinflammatory response. FIG.13A: Effect of TAC-67-001 on loss of intraepidermal nerve fibers induced by cisplatin. Mice were pretreated with daily i.p. injection of vehicle (DMSO) or TAC-67-001 (6 mg / kg / day) for 5 days, followed by 5 days with vehicle, cisplatin (2.3 mg / kg / day) and / or TAC-67-001 (6 mg / kg / day), for two cycles. Biopsies from the hind paw at 5 weeks after the start of treatment were stained for intraepidermal nerve fibers (PGP9.5; red) and collagen (green). White arrows indicate the intraepidermal nerve fibers. FIG.13B: Quantification of intraepidermal nerve fiber density. FIG.13C: H&E staining of kidney tissues from each group. White arrows indicate interstitial bleeding and yellow arrow indicates tubular damage. FIG.13D: mRNA levels of pro-inflammatory cytokines Tnf-a and Il-la and chemokine Cxcll in the kidney of mice treated with cisplatin (2.3 mg / kg / day) and / or TAC- 67-001 (6 mg / kg / day) after two cycles of administration (n = 3). FIG.13E: Representative images of IB Al labelled microglia in the cerebral cortex of mice that were treated with cisplatin (2.3 mg / kg / day) and / or TAC-67-001 (6 mg / kg / day) after two cycles of treatment.DETAILED DESCRIPTION

[0051] It is to be appreciated that certain aspects, modes, embodiments, variations and features of the present methods are described below in various levels of detail in order to provide a substantial understanding of the present technology. The present disclosure is not to be limited in terms of the particular embodiments described in this application, which are intended as single illustrations of individual aspects of the disclosure. All the various embodiments of the present disclosure will not be described herein. Many modifications and variations of the disclosure can be made without departing from its spirit and scope, as will be apparent to those skilled in the art. Functionally equivalent methods and apparatuseswithin the scope of the disclosure, in addition to those enumerated herein, will be apparent to those skilled in the art from the foregoing descriptions. Such modifications and variations are intended to fall within the scope of the appended claims. The present disclosure is to be limited only by the terms of the appended claims, along with the full scope of equivalents to which such claims are entitled.

[0052] It is to be understood that the present disclosure is not limited to particular uses, methods, reagents, compounds, compositions or biological systems, which can, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.

[0053] In practicing the present methods, many conventional techniques in molecular biology, protein biochemistry, cell biology, immunology, microbiology and recombinant DNA are used. See, e.g., Sambrook and Russell eds. (2001) Molecular Cloning: A Laboratory Manual, 3rd edition; the series Ausubel et al. eds. (2007) Current Protocols in Molecular Biology, the series Methods in Enzymology (Academic Press, Inc., N.Y.); MacPherson et al. (1991) PCR 1: A Practical Approach (IRL Press at Oxford University Press); MacPherson et al. (1995) PCR 2: A Practical Approach,' Harlow and Lane eds. ( \ 999 Antibodies, A Laboratory Manual,' Freshney (2005) Culture of Animal Cells: A Manual of Basic Technique, 5th edition; Gait ed. (1984) Oligonucleotide Synthesis,' U.S. Patent No. 4,683,195; Hames and Higgins eds. (1984) Nucleic Acid Hybridization,' Anderson (1999) Nucleic Acid Hybridization,' Hames and Higgins eds. (1984) Transcription and Translation; Immobilized Cells and Enzymes (IRL Press (1986)); Perbal (1984) A Practical Guide to Molecular Cloning; Miller and Calos eds. (1987) Gene Transfer Vectors for Mammalian Cells (Cold Spring Harbor Laboratory); Makrides ed. (2003) Gene Transfer and Expression in Mammalian Cells; Mayer and Walker eds. (1987) Immunochemical Methods in Cell and Molecular Biology (Academic Press, London); and Herzenberg et al. eds (1996) Weir ’s Handbook of Experimental Immunology. Methods to detect and measure levels of polypeptide gene expression products (i.e., gene translation level) are well-known in the art and include the use of polypeptide detection methods such as antibody detection and quantification techniques. (See also, Strachan & Read, Human Molecular Genetics, Second Edition. (John Wiley and Sons, Inc., NY, 1999)).

[0054] Insufficient telomerase activity, stemming from low telomerase reverse transcriptase (TERT) gene transcription, leads to telomere dysfunction and agingpathologies. In addition to its classical role in synthesizing telomeres, TERT serves as a transcriptional co-regulator of genes relevant to aging and age-associated diseases. Indeed, a recent study provided additional genetic evidence that somatic TERT maintenance alters the expression of genes governing the pathogenesis of Alzheimer’s disease and restrains the pathological hallmarks of Alzheimer’s disease, including amyloid pathology, neuro inflammation, dendritic spine deficits and cognitive decline (Shim et al., 2021).

[0055] The present disclosure identifies two TERT activator compounds (T AC-67-001 and TAC-64-001) of the benzenesulfonamide class that upregulate TERT transcription. In primary human cells and naturally aged mice, TAC -induced increase in TERT levels promotes telomere synthesis, blunts tissue aging hallmarks with reduced cellular senescence and inflammatory cytokines, and silences plfP -40expression via upregulation of DNMT3B-mediated promoter hypermethylation. In the brain, TAC-67-001 alleviates neuroinflammation, increases BDNF levels, stimulates adult neurogenesis and preserves cognitive function without evidence of toxicity including cancer. TAC-64-001 possesses equivalent TERT upregulating capabilities to TAC-67-001 in vivo. These results were remarkable because not all benzenesulfonamide compounds capable of activating TERT expression, pointing the uniqueness of these two compounds in this class.

[0056] In the chronic setting of aging, small molecule therapeutics may offer advantages over biologies, as the former are less immunogenic and more cost-effective (Olivera et al., 2017; Perez-Jeldres et al., 2019). TAC-67-001 and TAC-64-001 have low molecular weights (<400 Da) and lipophilicity that favor drug uptake across all tissues including the CNS (Bharate et al., 2018). In particular, TAC -induced alleviation of age- associated brain increases in proinflammatory cytokines (Il-l , Tl-6 and Tnf-a) and induction of the key neurotrophic factor (BDNF) governing synaptic plasticity and memory indicates the clinical potential of TAC-67-001 and TAC-64-001 as neuroprotective agents in normal aging and in neurodegenerative diseases, such as Alzheimer’s Disease. Additional data supports the application of TAC-67-001 and TAC-64-001 to chemotherapy-induced peripheral neuropathy and premature aging syndromes. Together, these findings reinforce the key role of TERT in aging hallmarks and provide support for physiological TERT activation to quell multiple aging hallmarks and associated pathology, including aging- related diseases and neurodegenerative conditions such as Alzheimer’s disease.Definitions

[0057] Unless defined otherwise, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this technology belongs. As used in this specification and the appended claims, the singular forms “a”, “an” and “the” include plural referents unless the content clearly dictates otherwise. For example, reference to “a cell” includes a combination of two or more cells, and the like. Generally, the nomenclature used herein and the laboratory procedures in cell culture, molecular genetics, organic chemistry, analytical chemistry and nucleic acid chemistry and hybridization described below are those well-known and commonly employed in the art.

[0058] As used herein, the term “about” or “approximately” means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, z.e., the limitations of the measurement system. For example, “about” can mean within 3 or more than 3 standard deviations, per the practice in the art. Alternatively, “about” can mean a range of up to 20%, up to 10%, up to 5%, or up to 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, within 5-fold, or within 2-fold, of a value.

[0059] As used herein, the “administration” of an agent or drug to a subject includes any route of introducing or delivering to a subject a compound to perform its intended function. Administration can be carried out by any suitable route, including but not limited to, orally, intranasally, intrathecally, parenterally (intravenously, intramuscularly, intraperitoneally, or subcutaneously), rectally, intrathecally, intraocularly, intradermally, transmucosally, iontophoretically, or topically. Administration includes self-administration and the administration by another.

[0060] As used herein, the term “analog” refers to a structurally related polypeptide or nucleic acid molecule having the function of a reference polypeptide or nucleic acid molecule.

[0061] As used herein, the phrase “and / or” as used in the present disclosure will be understood to mean any one of the recited members individually or a combination of anytwo or more thereof - for example, “A, B, and / or C” would mean “A, B, C, A and B, A and C, B and C, or the combination of A, B, and C ”

[0062] As used herein, a "control" is an alternative sample used in an experiment for comparison purpose. A control can be "positive" or "negative." For example, where the purpose of the experiment is to determine a correlation of the efficacy of a therapeutic agent for the treatment for a particular type of disease, a positive control (a compound or composition known to exhibit the desired therapeutic effect) and a negative control (a subject or a sample that does not receive the therapy or receives a placebo) are typically employed.

[0063] “Comprising” shall mean that the methods and compositions include the recited elements, but not exclude others. “Consisting essentially of’ when used to define methods and compositions, shall mean excluding other elements of any essential significance to the combination for the stated purpose. Thus, a composition consisting essentially of the elements as defined herein would not exclude trace contaminants from the isolation and purification method and pharmaceutically acceptable carriers, such as phosphate buffered saline, preservatives and the like. “Consisting of’ shall mean excluding more than trace elements of other ingredients and substantial method steps for administering the compositions of this invention or process steps to produce a composition or achieve an intended result. Embodiments defined by each of these transitional terms and phrases are within the scope of this invention.

[0064] As used herein, the term “cell population” refers to a group of at least two cells expressing similar or different phenotypes. In non-limiting examples, a cell population can include at least about 10, at least about 100, at least about 200, at least about 300, at least about 400, at least about 500, at least about 600, at least about 700, at least about 800, at least about 900, at least about 1000 cells, at least about 10,000 cells, at least about 100,000 cells, at least about 1 x 106cells, at least about 1 x 107cells, at least about 1 x 108cells, at least about 1 x 109cells, at least about 1 x 1010cells, at least about 1 x 1011cells, at least about 1 x 1012cells, or more cells expressing similar or different phenotypes.

[0065] As used herein, the term “disease” refers to any condition or disorder that damages or interferes with the normal function of a cell, tissue, or organ.

[0066] As used herein, the term “effective amount” refers to a quantity sufficient to achieve a desired therapeutic and / or prophylactic effect, e.g., an amount which results in the prevention of, or a decrease in a disease or condition described herein or one or more signs or symptoms associated with a disease or condition described herein. In the context of therapeutic or prophylactic applications, the amount of a composition administered to the subject will vary depending on the composition, the degree, type, and severity of the disease and on the characteristics of the individual, such as general health, age, sex, body weight and tolerance to drugs. The skilled artisan will be able to determine appropriate dosages depending on these and other factors. The compositions can also be administered in combination with one or more additional therapeutic compounds. In the methods described herein, the therapeutic compositions may be administered to a subject having one or more signs or symptoms of a disease or condition described herein. As used herein, a "therapeutically effective amount" of a composition refers to composition levels in which the physiological effects of a disease or condition are ameliorated or eliminated. A therapeutically effective amount can be given in one or more administrations.

[0067] As used herein, the term “expression” refers to the process by which polynucleotides are transcribed into mRNA and / or the process by which the transcribed mRNA is subsequently being translated into peptides, polypeptides, or proteins. If the polynucleotide is derived from genomic DNA, expression can include splicing of the mRNA in a eukaryotic cell. The expression level of a gene can be determined by measuring the amount of mRNA or protein in a cell or tissue sample. In one aspect, the expression level of a gene from one sample can be directly compared to the expression level of that gene from a control or reference sample. In another aspect, the expression level of a gene from one sample can be directly compared to the expression level of that gene from the same sample following administration of the compositions disclosed herein. The term “expression” also refers to one or more of the following events: (1) production of an RNA template from a DNA sequence (e.g., by transcription) within a cell; (2) processing of an RNA transcript (e.g., by splicing, editing, 5’ cap formation, and / or 3’ end formation) within a cell; (3) translation of an RNA sequence into a polypeptide or protein within a cell; (4) post-translational modification of a polypeptide or protein within a cell; (5) presentation of a polypeptide or protein on the cell surface; and (6) secretion or presentation or release of a polypeptide or protein from a cell. The level of expression of a polypeptide can be assessed using any method known in art, including, for example, methods of determining the amountof the polypeptide produced from the host cell. Such methods can include, but are not limited to, quantitation of the polypeptide in the cell lysate by ELISA, Coomassie blue staining following gel electrophoresis, Lowry protein assay and Bradford protein assay.

[0068] As used herein, the term “heterologous nucleic acid molecule or polypeptide” refers to a nucleic acid molecule (e.g., a cDNA, DNA or RNA molecule) or polypeptide that is not normally present in a cell or sample obtained from a cell. This nucleic acid may be from another organism, or it may be, for example, an mRNA molecule that is not normally expressed in a cell or sample.

[0069] As used herein, the term “increase” means to alter positively by at least about 5%, including, but not limited to, alter positively by about 5%, by about 10%, by about 25%, by about 30%, by about 50%, by about 75%, or by about 100%.

[0070] As used herein, the term “isolated,” “purified,” or “biologically pure” refers to material that is free to varying degrees from components which normally accompany it as found in its native state. “Isolate” denotes a degree of separation from original source or surroundings. “Purify” denotes a degree of separation that is higher than isolation. A “purified” or “biologically pure” protein is sufficiently free of other materials such that any impurities do not materially affect the biological properties of the protein or cause other adverse consequences. That is, a nucleic acid or polypeptide of the presently disclosed subject matter is purified if it is substantially free of cellular material, viral material, or culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized. Purity and homogeneity are typically determined using analytical chemistry techniques, for example, polyacrylamide gel electrophoresis or high performance liquid chromatography. The term “purified” can denote that a nucleic acid or protein gives rise to essentially one band in an electrophoretic gel. For a protein that can be subjected to modifications, for example, phosphorylation or glycosylation, different modifications may give rise to different isolated proteins, which can be separately purified.

[0071] “Mammal” includes both humans and non-human mammals, such as companion animals (dogs, cats and the like), laboratory animals (such as mice, rats, guinea pigs, and the like) and farm animals (cattle, horses, sheep, goats, swine, and the like). In some embodiments, the mammal is a human. In some embodiments, the mammal is a dog or a cat.

[0072] As used herein, the term “modulate” means to positively or negatively alter. Exemplary modulations include an about 1%, about 2%, about 5%, about 10%, about 25%, about 50%, about 75%, or about 100% change.

[0073] As used herein the term “pharmaceutically acceptable carrier” includes saline, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Supplementary active compounds can also be incorporated into the compositions.

[0074] As used herein, the terms “polypeptide,” “peptide,” and “protein” are used interchangeably herein to mean a polymer comprising two or more amino acids joined to each other by peptide bonds or modified peptide bonds, z.e., peptide isosteres. Polypeptide refers to both short chains, commonly referred to as peptides, glycopeptides or oligomers, and to longer chains, generally referred to as proteins. Polypeptides may contain amino acids other than the 20 gene-encoded amino acids. Polypeptides include amino acid sequences modified either by natural processes, such as post-translational processing, or by chemical modification techniques that are well known in the art.

[0075] As used herein, the term “reduce” means to alter negatively by at least about 5% including, but not limited to, alter negatively by about 5%, by about 10%, by about 25%, by about 30%, by about 50%, by about 75%, or by about 100%.

[0076] As used herein, “regulatory region” of a nucleic acid molecule means a cisacting nucleotide sequence that influences expression, positively or negatively, of an operably linked gene. Regulatory regions include sequences of nucleotides that confer inducible (z.e., require a substance or stimulus for increased transcription) expression of a gene. When an inducer is present or at increased concentration, gene expression can be increased. Regulatory regions also include sequences that confer repression of gene expression (z.e., a substance or stimulus decreases transcription). When a repressor is present or at increased concentration, gene expression can be decreased. Regulatory regions are known to influence, modulate or control many in vivo biological activities including cell proliferation, cell growth and death, cell differentiation and immune modulation.Regulatory regions typically bind to one or more trans-acting proteins, which results in either increased or decreased transcription of the gene.

[0077] Particular examples of gene regulatory regions are promoters and enhancers. Promoters are sequences located around the transcription or translation start site, typically positioned 5' of the translation start site. Promoters usually are located within 1 Kb of the translation start site, but can be located further away, for example, 2 Kb, 3 Kb, 4 Kb, 5 Kb or more, up to and including 10 Kb. Enhancers are known to influence gene expression when positioned 5' or 3' of the gene, or when positioned in or a part of an exon or an intron. Enhancers also can function at a significant distance from the gene, for example, at a distance from about 3 Kb, 5 Kb, 7 Kb, 10 Kb, 15 Kb or more. Regulatory regions also include, but are not limited to, in addition to promoter regions, sequences that facilitate translation, splicing signals for introns, maintenance of the correct reading frame of the gene to permit in-frame translation of mRNA and, stop codons, leader sequences and fusion partner sequences, internal ribosome binding site (IRES) elements for the creation of multigene, or polycistronic, messages, polyadenylation signals to provide proper polyadenylation of the transcript of a gene of interest and stop codons, and can be optionally included in an expression vector.

[0078] As used herein, a “sample” or “biological sample” refers to a body fluid or a tissue sample isolated from a subject. In some cases, a biological sample may consist of or comprise whole blood, platelets, red blood cells, white blood cells, plasma, sera, urine, feces, epidermal sample, vaginal sample, skin sample, cheek swab, sperm, amniotic fluid, cultured cells, bone marrow sample, tumor biopsies, aspirate and / or chorionic villi, cultured cells, endothelial cells, synovial fluid, lymphatic fluid, ascites fluid, interstitial or extracellular fluid and the like. The term "sample" may also encompass the fluid in spaces between cells, including gingival crevicular fluid, bone marrow, cerebrospinal fluid (CSF), saliva, mucus, sputum, semen, sweat, urine, or any other bodily fluids. Samples can be obtained from a subject by any means including, but not limited to, venipuncture, excretion, ejaculation, massage, biopsy, needle aspirate, lavage, gavage, scraping, surgical incision, or intervention or other means known in the art. A blood sample can be whole blood or any fraction thereof, including blood cells (red blood cells, white blood cells or leukocytes, and platelets), serum and plasma.

[0079] As used herein, the term “separate” therapeutic use refers to an administration of at least two active ingredients at the same time or at substantially the same time by different routes.

[0080] As used herein, the term “sequential” therapeutic use refers to administration of at least two active ingredients at different times. More particularly, sequential use refers to the whole administration of one of the active ingredients before administration of the other or others commences. It is thus possible to administer one of the active ingredients over several minutes, hours, or days before administering the other active ingredient or ingredients. There is no simultaneous treatment in this case.

[0081] As used herein, the term “simultaneous” therapeutic use refers to the administration of at least two active ingredients by the same route and at the same time or at substantially the same time.

[0082] As used herein, the terms “subject”, “patient”, or “individual” can be an individual organism, a vertebrate, a mammal, or a human. In some embodiments, the subject, patient or individual is a human.

[0083] As used herein, a “synergistic therapeutic effect” refers to a greater-than-additive therapeutic effect which is produced by a combination of at least two agents, and which exceeds that which would otherwise result from the individual administration of the agents. For example, lower doses of one or more agents may be used in treating a disease or disorder, resulting in increased therapeutic efficacy and decreased side-effects.

[0084] As used herein, the term “telomeres” is intended to mean the specialized structures that cap and maintain chromosomal integrity. Telomeres are protein-DNA structures, including chromatin, that protect the genome from nucleolytic degradation, unnecessary recombination, repair, and inter-chromosomal fusion. Telomeres can shorten via a number of mechanisms, including natural cell replication and external lifestyle factors. Shortening of telomeres is a hallmark of aging and results in telomere dysfunction which activates DNA damage signaling and associated cellular checkpoints such as senescence and apoptosis. Telomere dysfunction can also promote genomic instability which fuels the development of cancer. Together, these pathophysiological processes have been implicated in aging-related diseases and neurodegenerative conditions, including Alzheimer’s disease. Telomeres are elongated by the catalytic telomerase reverse transcriptase (TERT), which is typically constitutively active in germline cells and tightly repressed in somatic cells. In the context of premature aging, telomerase reactivation can restore telomere function and TERT can also interact with transcription factors regulating genes central to anti-aging. Together, these classical and non-canonical TERT activities can alleviate age-related pathologies.

[0085] As used herein, the term “therapeutic agent” is intended to mean a compound that, when present in an effective amount, produces a desired therapeutic effect on a subject in need thereof.

[0086] “Treating” or “treatment” as used herein covers the treatment of a disease or disorder described herein, in a subject, such as a human, and includes: (i) inhibiting a disease or disorder, z.e., arresting its development; (ii) relieving a disease or disorder, z.e., causing regression of the disorder; (iii) slowing progression of the disorder; and / or (iv) inhibiting, relieving, or slowing progression of one or more symptoms of the disease or disorder. In some embodiments, treatment means that the symptoms associated with the disease are, e.g., alleviated, reduced, cured, or placed in a state of remission.

[0087] It is also to be appreciated that the various modes of treatment of disorders as described herein are intended to mean “substantial,” which includes total but also less than total treatment, and wherein some biologically or medically relevant result is achieved. The treatment may be a continuous prolonged treatment for a chronic disease or a single, or few time administrations for the treatment of an acute condition.Aging, Aging-Related Diseases, Neurodegenerative Diseases, and Inflammatory Bowel Disease

[0088] Aging is characterized by time-dependent loss of physiological integrity in living organisms (Chakravarti et al., 2021a; Lopez-Otin et al., 2013). This progressive reduction in fitness stems from multiple converging mechanisms that drive the accumulation of cellular damage, leading to age-dependent loss of organ function and tissue homeostasis. Cumulative evidence indicates that alterations in genetic and epigenetic control are the major contributors to its functional and physiological decline with aging. Human and model organism studies have documented global changes in DNA damage and mutation, genomic instability, DNA methylation patterns, post-translational modifications of histones, and chromatin remodeling with advancing age. These dynamic regulatory changes affect gene expression and protein functions governing diverse cellular pathways central to aging and age-related diseases (Carmona and Mi chan, 2016). In particular, age-associated epigenomic alterations including DNA methylation can trigger significant transcription drift and instigate cellular aging processes, pointing to altered epigenetic signatures as key contributors in pathophysiology of aging and aging-related diseases (Booth and Brunet,2016; Frenk and Houseley, 2018). Notably, modulating the activity of chromatin modifierscan mitigate or reverse the levels of multiple risk factors for aging and age-dependent disease phenotypes at the organismal level (Benayoun et al., 2015).

[0089] Telomere dysfunction is another primary hallmark of aging causing molecular and cellular damage and acts as an instigator or amplifier of the molecular circuitries driving the aging process and its associated diseases (Chakravarti et al., 2021a; Lopez-Otin et al., 2013; Sahin and DePinho, 2010). Telomeres are specialized chromatin structures that cap and maintain chromosomal integrity. During aging, continual tissue renewal is associated with progressive telomere attrition, resulting in loss of telomere capping function. Telomere dysfunction is itself an aging hallmark and can also contribute to other hallmarks such as genome instability, stem cell exhaustion, mitochondrial dysfunction and cellular senescence (Chakravarti et al., 2021a; Sahin and DePinho, 2010). Telomere dysfunction has been causally implicated as a rate-limiting pathogenetic step in age-related diseases including premature aging (progeroid) syndromes, cardiovascular diseases, inflammatory bowel disease, pulmonary fibrosis, metabolic diseases and neurodegenerative diseases (Chakravarti et al., 2021a; Sahin and DePinho, 2010; Sharpless and DePinho, 2007).

[0090] Telomerase is a ribonucleoprotein complex that extends the ends of telomeres, and its presence is responsible for the maintenance of telomere length and genome integrity. Although it is essential for cell viability in normal healthy tissues, telomerase activity is tightly regulated in most adult somatic cells, primarily due to transcriptional repression of the core catalytic subunit of telomerase, TERT. Indeed, defects in telomerase activity due to germ-line mutations in core telomerase components are linked to the premature loss of tissue renewal and premature death, such as dyskeratosis congenita (Vulliamy et al., 2001), aplastic anemia (Yamaguchi et al., 2005) and idiopathic pulmonary fibrosis (Armanios et al., 2007). Conversely, enforced expression of TERT has been shown to stabilize endogenous telomeres, reduce senescence associated markers and restore the proliferative lifespan in mammals (Bernardes de Jesus et al., 2012; Bodnar et al., 1998; Tomas-Loba et al., 2008). Moreover, in genetically-engineered mice, TERT reactivation studies revealed the dual role of TERT in the reversal of aging via telomere synthesis in proliferative tissues as well as via modulation of gene expression in post-mitotic tissues in a telomereindependent manner. Indeed, in post-mitotic neurons, increased physiological TERT levels improve capacity for neural stem cell regeneration, enhance synaptic plasticity and preservecognitive function in two models of Alzheimer’s disease (Jaskelioff et al., 2011; Shim et al., 2021). Accordingly, natural or synthetic compounds that induce TERT activity have been shown to promote cellular survival and metabolic fitness (Bernardes de Jesus et al., 2011; Eitan et al., 2012).

[0091] In some embodiments, the aging-related disease or condition is characterized by or associated with a hallmark of aging, such as neuroinflammation, neuronal loss, loss of dendritic spines, decreased expression of learning and memory genes, and / or amyloid plaque formation. Learning and memory genes are those genes involved in the memory formation system, including genes associated with encoding memories, storing memories, and retrieving information. Genes known to be associated with learning and memory include, but are not limited to, BDNF, MAPK, PKA, CZEBP, c-Fos, CREB, Chgb, Homer3, Bok, Lsml l, Prdm8, Cfh, Coll la2, Orai2, Ndst3, Trhde, Mndal, Pdel la, Tenm3, Selenow, Cdh24, Dlk2, Ywhah, Brinpl, Cdl09, Npdcl, Nrnl, 2900052N01Rik, Camkk2, Ccdc3, Efnb2, Fnbpll, Kcnip2, Nbll, Nptxl, Prkcd, Rph3a, Slc25a22, Slc7al l, Slc8a2, Spns2, Tspan9, Adoral, Ccbel, R3hdm4, Hs3st4, Ldb2, Limd2, Gpcl, Rerg, Rein, Smpd3, Chll, Cpne4, Spata21, Cpne9, Ifi203, Itga7, Meis2, Mt2, Rgs8, Rxra, Etvl, Hapln4, Selenop, Calnl, Camkid, Encl, Pxn, Pgbd5, Prkce, Napa, Zdbf2, Camk2b, Mppedl, Ncald, Pfkfb3, Sparc, Gm2824, Syt7, Nr4a2, St8sia6, Nrgn, Otubl, Pip4k2c, Adami 1, Hpca, M5C1000I18Rik, Polr2m, 1116, Coll5al, Ephb2, Islr2, Krt77, and NR2B. For example, BDNF is a neurotrophic gene that is known to be involved in promoting neuronal viability and plasticity, which are both key to the formation and retention of memory.

[0092] Senescence is the loss of a cell’s power to divide and grow, and is a natural part of the aging process. The aberrant accumulation of senescent cells has been linked to a variety of pathologies associated with chronic tissue damage or age, including fibrosis, atherosclerosis, and Alzheimer’s disease, and experimental or pharmacological elimination of these cells has shown the ability to ameliorate some of these pathologies and extend lifespan in mice (He, S. & N.E. Sharpless, Cell 169(6): p. 1000-1011 (2017); Xu, M., et al., Nat Medley, p. 1246-1256 (2018); Baar, M.P., et al., Cell, 169(1): p. 132-147 el6 (2017); Baker, D.J., et al., Nature, M9(J3r12y. p. 232-6 (2011); Childs, B.G., et al., Science 354(6311): p. 472-477 (2016); Childs, B.G. et al., Nat Med, 21(12): p. 1424-35 (2015); Lasry, A. & Y. Ben-Neriah, Trends Immunol, 36(4): p. 217-28 (2015); Munoz-Espin, D., et al., EMBO Mol Med, 10(9) (2018)). In addition to the stable cell cycle arrest, senescentcells secrete an array of immune-cell attracting cytokines, chemokines, adhesion molecules, and metalloproteases collectively termed the “SASP” (Senescence-Associated Secretory Phenotype). The composition of the SASP as well as the surface proteins specifically upregulated in the membrane of senescent cells is heterogeneous and dependent on cell type as well as on the nature of the senescence trigger. See Lasry & Ben-Neriah, Trends Immunol. 36;217-228 (2015); Kim etal., Genes and Dev. 31; 1529-1534 (2017).

[0093] In inflammatory bowel disease (IBD), telomere dysfunction may drive tissue inflammation. Specifically, telomere shortening has been observed in GI epithelial cells in IBD. Genetic evidence linking telomeres and IBD have been reinforced by increased inflammatory and fibrotic conditions in patients with germline TERT / TERC defects. Telomerase reactivation in the gastrointestinal epithelium may suppress intestinal inflammation. Chakravarti et al.. Nat. Commun. 11, 4766 (2020).Compounds of the Present Disclosure

[0094] At least two compounds, TAC-67-001 and TAC-64-001, of the present disclosure were found to increase TERT expression. TAC-67-001 (also referred to herein as TAC), A-(3-chloro-4-fluorophenyl)-4-fluoro-3,5-dimethylbenzenesulfonamide, is represented by formula (I):

[0095] TAC-64-001 (also referred to herein as TAC2), A-(3,5-dichlorophenyl)-2,3,4,5,6-pentamethylbenzenesulfonamide, is represented by formula (II):

[0096] Pharmaceutically acceptable salts of compounds described herein are within the scope of the present technology and include acid or base addition salts which retain the desired pharmacological activity and is not biologically undesirable (e.g., the salt is not unduly toxic, allergenic, or irritating, and is bioavailable). When the compound of the present technology has a basic group, such as, for example, an amino group, pharmaceutically acceptable salts can be formed with inorganic acids (such as hydrochloric acid, hydroboric acid, nitric acid, sulfuric acid, and phosphoric acid), organic acids (e.g. alginate, formic acid, acetic acid, benzoic acid, gluconic acid, fumaric acid, oxalic acid, tartaric acid, lactic acid, maleic acid, citric acid, succinic acid, malic acid, methanesulfonic acid, benzenesulfonic acid, naphthalene sulfonic acid, and p toluenesulfonic acid) or acidic amino acids (such as aspartic acid and glutamic acid). When the compound of the present technology has an acidic group, such as for example, a carboxylic acid group, it can form salts with metals, such as alkali and earth alkali metals (e.g. Na+, Li+, K+, Ca2+, Mg2+, Zn2+), ammonia or organic amines (e.g. dicyclohexylamine, trimethylamine, triethylamine, pyridine, picoline, ethanolamine, diethanolamine, triethanolamine) or basic amino acids (e.g arginine, lysine and ornithine). Such salts can be prepared in situ during isolation and purification of the compounds or by separately reacting the purified compound in its free base or free acid form with a suitable acid or base, respectively, and isolating the salt thus formed.

[0097] The compounds of the present technology may exist as solvates, especially hydrates. Hydrates may form during manufacture of the compounds or compositions comprising the compounds, or hydrates may form over time due to the hygroscopic nature of the compounds. Compounds of the present technology may exist as organic solvates aswell, including DMF, ether, and alcohol solvates among others. The identification and preparation of any particular solvate is within the skill of the ordinary artisan of synthetic organic or medicinal chemistry.Formulations and Administration of the Compositions of the Present Technology

[0098] The pharmaceutical compositions of the present technology can be manufactured by methods well known in the art such as conventional granulating, mixing, dissolving, encapsulating, lyophilizing, or emulsifying processes, among others. Compositions may be produced in various forms, including granules, precipitates, or particulates, powders, including freeze dried, rotary dried or spray dried powders, amorphous powders, tablets, capsules, syrup, suppositories, injections, emulsions, elixirs, suspensions or solutions. Formulations may optionally contain solvents, diluents, and other liquid vehicles, dispersion or suspension aids, surface active agents, pH modifiers, isotonic agents, thickening or emulsifying agents, stabilizers and preservatives, solid binders, lubricants and the like, as suited to the particular dosage form desired. In certain embodiments, the compositions disclosed herein are formulated for administration to a mammal, such as a human.

[0099] Liquid dosage forms for oral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups and elixirs. In addition to the active compounds, the liquid dosage forms may contain inert diluents commonly used in the art such as, for example, water or other solvents, solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, cyclodextrins, dimethylformamide, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor, and sesame oils), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof. Besides inert diluents, the oral compositions can also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and perfuming agents.

[0100] Injectable preparations, for example, sterile injectable aqueous or oleaginous suspensions may be formulated according to the known art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be a sterile injectable solution, suspension or emulsion in a nontoxic parenterally acceptable diluent or solvent, for example, as a solution in 1,3 -butanediol. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution, U.S.P. and isotonicsodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose any bland fixed oil can be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid are used in the preparation of injectables. The injectable formulations can be sterilized, for example, by filtration through a bacterial-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use. Compositions formulated for parenteral administration may be injected by bolus injection or by timed push, or may be administered by continuous infusion. The compositions can also be lyophilized. The compositions can contain auxiliary substances such as wetting, dispersing, or emulsifying agents (e.g., methylcellulose), pH buffering agents, gelling or viscosity enhancing additives, preservatives, flavoring agents, colors, and the like, depending upon the route of administration and the preparation desired. Standard texts, such as “REMINGTON1S PHARMACEUTICAL SCIENCE”, 17th edition, 1985, incorporated herein by reference, may be consulted to prepare suitable preparations, without undue experimentation.

[0101] The compositions can be isotonic, z.e., they can have the same osmotic pressure as blood and lacrimal fluid. The desired isotonicity of the compositions of the presently disclosed subject matter may be accomplished using sodium chloride, or other pharmaceutically acceptable agents such as dextrose, boric acid, sodium tartrate, propylene glycol or other inorganic or organic solutes. Sodium chloride is suitable particularly for buffers containing sodium ions.

[0102] Viscosity of the compositions, if desired, can be maintained at the selected level using a pharmaceutically acceptable thickening agent. Methylcellulose can be used because it is readily and economically available and is easy to work with. Other suitable thickening agents include, for example, xanthan gum, carboxymethyl cellulose, hydroxypropyl cellulose, carbomer, and the like. The concentration of the thickener can depend upon the agent selected. The important point is to use an amount that will achieve the selected viscosity. The choice of suitable carriers and other additives will depend on the exact route of administration and the nature of the particular dosage form, e.g., liquid dosage form (e.g., whether the composition is to be formulated into a solution, a suspension, gel or another liquid form, such as a time release form or liquid-filled form).

[0103] In order to prolong the effect of a compound of the present disclosure, it may be desirable to slow the absorption of the compound from subcutaneous or intramuscular injection. This may be accomplished by the use of a liquid suspension of crystalline or amorphous material with poor water solubility. The rate of absorption of the compound then depends upon its rate of dissolution that, in turn, may depend upon crystal size and crystalline form. Alternatively, delayed absorption of a parenterally administered compound form is accomplished by dissolving or suspending the compound in an oil vehicle. Injectable depot forms are made by forming microencapsule matrices of the compound in biodegradable polymers such as polylactide-polyglycolide. Depending upon the ratio of compound to polymer and the nature of the particular polymer employed, the rate of compound release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations are also prepared by entrapping the compound in liposomes or microemulsions that are compatible with body tissues.

[0104] Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. In such solid dosage forms, the active compound is mixed with at least one inert, pharmaceutically acceptable excipient or carrier such as sodium citrate or dicalcium phosphate and / or a) fillers or extenders such as starches, lactose, sucrose, glucose, mannitol, and silicic acid, b) binders such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidinone, sucrose, and acacia, c) humectants such as glycerol, d) disintegrating agents such as agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate, e) solution retarding agents such as paraffin, f) absorption accelerators such as quaternary ammonium compounds, g) wetting agents such as, for example, cetyl alcohol and glycerol monostearate, h) absorbents such as kaolin and bentonite clay, and i) lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof. In the case of capsules, tablets and pills, the dosage form may also comprise buffering agents such as phosphates or carbonates. In some embodiments, the compositions formulated for oral administration are further modified for slow release of the composition. Slow release of the composition from an oral administration allows for a long-acting treatment regimen with fewer doses. Slow release of the composition may comprise continuous release of the composition over hours, days, weeks, or months. Slow release of the composition may comprise release of the composition at a constant rate or at a changing rate, wherein therelease of the composition may increase or decrease or both increase and decrease over time.

[0105] Compositions of the present technology can be formulated for topical administration, including for administration to a subject as a cutaneous treatment. In some embodiments, topical compositions are formulated for slow release administration, wherein the compositions of the present technology are slowly released to the subject from the composition upon administration. Topical formulations comprising the compounds of the present technology can be applied to any dermal location on a subject, including, but not limited to, areas exhibiting visible signs of aging. Additionally, topical compositions can be formulated using any appropriate means, including as a roll-on, a cream, a lotion, a gel, a powder, a water activated cream, a water activated power, an injectable, a patch, or a spray. In some embodiments, the topical compositions of the present technology include an acceptable carrier. In some embodiments, the acceptable carrier comprises oleic acid, stearic acid, almond butter, avocado butter, babassu butter, beeswax, cocoa butter, coconut butter, coconut oil, cupuacu butter, hemp seed butter, kokum butter, macadamia butter, mango butter, mowrah butter, olive butter, sal seed butter, shea butter, propylene glycol, glycerin, stearyl alcohol, myristyl alcohol, capric triglyceride, or any combination thereof. Additional components of the compositions of the present technology may include a preservative selected from the group consisting of sucrose, sodium ascorbate, and glutathione. In some embodiments the preservative is a cryoprotectant selected from the group consisting of a nucleotide, a disaccharide, a polyol, and a polysaccharide. In some embodiments, the cryoprotectant is selected from the group consisting of inosine-5’- monophosphate (IMP), guanosine-5 ’-monophosphate (GMP), adenosine-5’ -monophosphate (AMP), uranosine-5’ -monophosphate (UMP), cytidine-5’ -monophosphate (CMP), adenine, guanine, uracil, cytosine, guanosine, uridine, cytidine, hypoxanthine, xanthine, orotidine, thymidine, inosine, trehalose, maltose, lactose, sucrose, sorbitol, mannitol, dextrin, inulin, sodium ascorbate, glutathione, and skim milk. In some embodiments, the composition comprises a lyoprotectant. In some embodiments, the lyoprotectant is a protein, a carbohydrate, or a combination thereof. In some embodiments, the lyoprotectant is a milk protein, and in particular a micellar casein. In some embodiments, the carbohydrate is sucrose.

[0106] Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polyethylene glycols and the like. The solid dosage forms of tablets, powders, dragees, capsules, pills, and granules can be prepared with coatings and shells such as enteric coatings, release controlling coatings and other coatings well known in the pharmaceutical formulating art. They may optionally contain opacifying agents and can also be of a composition that they release the active ingredient(s) only, or in a certain part of the intestinal tract, optionally, in a delayed manner. Examples of embedding compositions that can be used include polymeric substances and waxes.

[0107] The active compounds can also be in micro-encapsulated form with one or more excipients as noted above. In such solid dosage forms the active compound may be admixed with at least one inert diluent such as sucrose, lactose or starch. Such dosage forms may also comprise, as is normal practice, additional substances other than inert diluents, e.g., tableting lubricants and other tableting aids such a magnesium stearate and microcrystalline cellulose. In the case of capsules, tablets and pills, the dosage forms may also comprise buffering agents. They may optionally contain opacifying agents and can also be of a composition that they release the active ingredient(s) only, or in a certain part of the intestinal tract, optionally, in a delayed manner. Examples of embedding compositions that can be used include polymeric substances and waxes.

[0108] Those skilled in the art will recognize that the components of the compositions should be selected to be chemically inert and will not affect the viability or efficacy of the compounds or compositions as described in the presently disclosed subject matter. This will present no problem to those skilled in chemical and pharmaceutical principles, or problems can be readily avoided by reference to standard texts or by simple experiments (not involving undue experimentation), from this disclosure and the documents cited herein.

[0109] The skilled artisan can readily determine the amount of compounds and optional additives, vehicles, and / or carrier in compositions to be administered in methods of the presently disclosed subject matter. Typically, any additives (in addition to the active compound(s) and / or agent(s)) are present in an amount of from about 0.001% to about 50% by weight) solution in phosphate buffered saline, and the active ingredient is present in the order of micrograms to milligrams, such as from about 0.0001 wt % to about 5 wt %, from about 0.0001 wt% to about 1 wt %, from about 0.0001 wt% to about 0.05 wt%, from about0.001 wt% to about 20 wt %, from about 0.01 wt% to about 10 wt %, or from about 0.05 wt% to about 5 wt %. For any composition to be administered to an animal or human, and for any particular method of administration, toxicity should be determined, such as by determining the lethal dose (LD) and LD50 in a suitable animal model e.g., rodent such as mouse; and, the dosage of the composition(s), concentration of components therein and timing of administering the composition(s), which elicit a suitable response. Such determinations do not require undue experimentation from the knowledge of the skilled artisan, this disclosure and the documents cited herein. And, the time for sequential administrations can be ascertained without undue experimentation.

[0110] In certain embodiments, the compositions and compounds of the present technology are directly injected into an organ of interest (e.g., an organ affected by a senescence-associated pathology). Additionally or alternatively, the compositions and compounds of the present technology are provided indirectly to the organ of interest, for example, by administration into the circulatory system or into the tissue of interest.Methods of Treatment of the Present Technology for Aging, Aging-Related Diseases, and Neurodegenerative Conditions[OHl] For treatment, the amount of the compounds and compositions provided herein administered is an amount effective in producing the desired effect, for example, treatment or amelioration of the effects of aging, aging-related diseases, or neurodegenerative conditions, such as Alzheimer’s disease, epilepsy, Huntington's Disease, Parkinson's Disease, stroke, spinal cord injury, traumatic brain injury, Lewy body dementia, Pick's disease, Niewmann-Pick disease, amyloid angiopathy, cerebral amyloid angiopathy, systemic amyloidosis, hereditary cerebral hemorrhage with amyloidosis of the Dutch type, mild cognitive impairment, chemotherapy induced peripheral neuropathy, Hutchinson- Gilford progeria syndrome (HGPS), Nestor-Guillermo progeria syndrome, Werner syndrome, Cockayne syndrome, Bloom syndrome, xeroderma pigmentosum, ataxia telangiectasia, trichothiodystrophy, dyskeratosis congenital, mosaic variegated aneuploidy syndrome, diabetes, liver fibrosis, liver cirrhosis, lung fibrosis, atherosclerosis, chronic kidney disease, inclusion body myositis, or osteoarthritis, or one or more symptoms thereof. An effective amount can be provided in one or a series of administrations of the compounds and compositions provided herein. An effective amount can be provided in a bolus or by continuous perfusion.

[0112] In one aspect, the present disclosure provides a method for treating aging, aging- related diseases, or neurodegenerative conditions in a subject in need thereof comprising administering to the subject an effective amount of TAC-67-001, TAC-64-001, or a combination thereof, or compositions comprising TAC-67-001, TAC-64-001, or a combination thereof. In another aspect, the present disclosure provides methods for treating or ameliorating the effects of aging, aging-related diseases, or neurodegenerative conditions in a subject in need thereof comprising administering to the subject an effective amount of any of the compounds or compositions of the present technology, wherein the subject exhibits an increased accumulation of senescent cells or other hallmark features of aging or degenerative conditions compared to that observed in a healthy or younger control subject prior to treatment. Hallmark features of aging include, but are not limited to, neuroinflammation, neuronal loss, loss of dendritic spines, decreased expression of learning and memory genes, and / or amyloid plaque formation. In some embodiments, the aging- related disease, premature aging condition, or neurodegenerative condition is Alzheimer’s disease, epilepsy, Huntington's Disease, Parkinson's Disease, stroke, spinal cord injury, traumatic brain injury, Lewy body dementia, Pick's disease, Niewmann-Pick disease, amyloid angiopathy, cerebral amyloid angiopathy, systemic amyloidosis, hereditary cerebral hemorrhage with amyloidosis of the Dutch type, mild cognitive impairment, chemotherapy induced peripheral neuropathy, Hutchinson-Gilford progeria syndrome (HGPS), Nestor- Guillermo progeria syndrome, Werner syndrome, Cockayne syndrome, Bloom syndrome, xeroderma pigmentosum, ataxia telangiectasia, trichothiodystrophy, dyskeratosis congenital, mosaic variegated aneuploidy syndrome, diabetes, liver fibrosis, liver cirrhosis, lung fibrosis, atherosclerosis, chronic kidney disease, inclusion body myositis, or osteoarthritis. Additionally or alternatively, in certain embodiments, the senescent cells exhibit a Senescence-Associated Secretory Phenotype (SASP). The Senescence-Associated Secretory Phenotype may be induced by an oncogene (e.g., HRASG12D, NRASG12D, NRASG12D; D38Agfc.) or a drug (e.g., Cdk4 / 6 inhibitors (e.g., palbociclib), MEK inhibitors (e.g., trametinib), doxorubicin). Additionally or alternatively, in some embodiments, the methods further comprise sequentially, separately, or simultaneously administering to the subject at least one additional agent selected from the group consisting of statins (e.g., Atorvastatin, Fluvastatin, Lovastatin, Pitavastatin, Pravastatin, Rosuvastatin calcium, Simvastatin), fibrates (e.g, Gemfibrozil, Fenofibrate), niacin, ezetimibe, bile acid sequestrants (e.g, cholestyramine, colestipol, colesevelam), proprotein convertase subtilisinkexin type 9 (PCSK9) inhibitors, anti-platelet medications (e.g., aspirin, Clopidogrel, Ticagrelor, warfarin, prasugral), beta blockers, Angiotensin-converting enzyme (ACE) inhibitors (e.g., benazepril, Lisinopril, Ramipril), calcium channel blockers, diuretics, donepezil, galantamine, memantine, rivastigmine, memantine extended-release and donepezil (Namzaric), aducanumab, solanezumab, insulin, verubecestat, AADvacl, CSP- 1103, Androgen, G-CSF, GM-CSF, Lonafamib (zokinvy), Mannitol (Osmitrol, Resectisol), Phenytoin (Dilantin, Phenytek), Valproate sodium (Depakote), Gabapentin (Neurontin), Topiramate (Topamax), Carbamazepine (Equetro), Levodopa, Carbidopa, tetrabenazine, deuterabenazine, zonisamide (Zonegran), levetiracetam (Keppra), clonazepam (Klonopin), rufinamide (Banzel), lamotrigine (Lamictal), pregabalin (Lyrica), lacosamide (Vimpat), vigabatrin (Sabril), oxcarbazepine (Trileptal), phenobarbital, intepirdine, insulin, metformin, amylin analogs, glucagon, sulfonylureas (e.g., glimepiride, glipizide, glyburide, chlorpropamide, tolazamide, tolbutamide), meglitinides (e.g., nateglinide, repaglinide), thiazolidinediones (e.g., pioglitazone, rosiglitazone), alpha-glucosidase inhibitors (e.g., acarbose, miglitol), dipeptidyl peptidase (DPP-4) inhibitors (e.g., alogliptin, linagliptin, sitagliptin, saxagliptin), sodium-glucose co-transporter 2 (SGLT2) inhibitors (e.g., canagliflozin, dapagliflozin, empagliflozin, ertugliflozin), incretin mimetics (e.g., exenatide, liraglutide, dulaglutide, lixisenatide, semaglutide), analgesics (e.g., acetaminophen, tramadol, oxycodone, hydrocodone), nonsteroidal anti-inflammatory drugs (e.g., aspirin, ibuprofen, naproxen, celecoxib), cyclooxygenase-2 inhibitors, corticosteroids, hyaluronic acid, a-Tocopherol, interferon-a, PPAR-antagonists, colchicine, endothelin inhibitors, interleukin- 10, pirfenidone (Esbriet), nintedanib (Ofev), pentoxifylline, phosphatidylcholine, S-adenosyl-methionine, TGF-pi inhibitors, furosemide, erythropoietin, phosphate binders (e.g., calcium acetate, calcium carbonate), colecalciferol, ergocalciferol, cyclophosphamide, or any combination thereof.

[0113] In some embodiments, the additional agent treats a neurodegenerative condition and is CSP-1103, Mannitol (Osmitrol, Resectisol), Phenytoin (Dilantin, Phenytek), valproic acid (Depakote), Gabapentin (Neurontin), Topiramate (Topamax), Carbamazepine (Equetro) anti-platelet medications (e.g., aspirin, Clopidogrel, Ticagrelor, warfarin, prasugral), beta blockers, Angiotensin-converting enzyme (ACE) inhibitors (e.g., benazepril, Lisinopril, Ramipril), calcium channel blockers, diuretics, aspirin, Levodopa, carbidopa, tetrabenazine, deuterabenazine, zonisamide (Zonegran), levetiracetam (Keppra), clonazepam (Klonopin), rufinamide (Banzel), lamotrigine (Lamictal), pregabalin (Lyrica),lacosamide (Vimpat), vigabatrin (Sabril), oxcarbazepine (Trileptal), phenobarbital, Donepezil, galantamine, memantine, rivastigmine, memantine extended-release and donepezil (Namzaric), aducanumab, solanezumab, verubecestat, AADvacl, intepirdine, or any combination thereof.

[0114] In some embodiments, the additional agent treats a premature aging condition as is Lonafarnib (zokinvy), aspirin, Androgen, G-CSF, GM-CSF, or any combination thereof.

[0115] In some embodiments, the additional agent treats a condition that is associated with aging or aging itself, and is insulin, metformin, amylin analogs, glucagon, sulfonylureas (e.g., glimepiride, glipizide, glyburide, chlorpropamide, tolazamide, tolbutamide), meglitinides (e.g., nateglinide, mitiglinide, repaglinide), thiazolidinediones (e.g., pioglitazone, rosiglitazone), alpha-glucosidase inhibitors (e.g., acarbose, miglitol), dipeptidyl peptidase (DPP-4) inhibitors (e.g., alogliptin, linagliptin, sitagliptin, saxagliptin), sodium-glucose co-transporter 2 (SGLT2) inhibitors (e.g., canagliflozin, dapagliflozin, empagliflozin, ertugliflozin), incretin mimetics (e.g., exenatide, liraglutide, dulaglutide, lixisenatide, semaglutide), PPAR-antagonists, interleukin- 10, furosemide, pirfenidone (Esbriet), nintedanib (Ofev), statins (e.g., Atorvastatin, Fluvastatin, Lovastatin, Pitavastatin, Pravastatin Rosuvastatin calcium, Simvastatin), fibrates (e.g., Gemfibrozil, Fenofibrate), niacin, ezetimibe, bile acid sequestrants (e.g., cholestyramine, colestipol, colesevelam), proprotein convertase subtilisin kexin type 9 (PCSK9) inhibitors, endothelin inhibitors, pentoxifylline, phosphate binders (e.g., calcium acetate, calcium carbonate), hyaluronic acid, a-Tocopherol, colchicine, TGF-pi inhibitors, erythropoietin, S-adenosyl-methionine, colecalciferol, ergocalciferol, analgesics (e.g., acetaminophen, tramadol, oxycodone, hydrocodone), nonsteroidal anti-inflammatory drugs (e.g., aspirin, ibuprofen, naproxen, celecoxib), cyclooxygenase-2 inhibitors, corticosteroids, interferon-a, phosphatidylcholine, and cyclophosphamide.

[0116] In some embodiments, the additional agent is administered orally, intranasally, intrathecally, parenterally, intravenously, intramuscularly, intraperitoneally, subcutaneously, rectally, intrathecally, intraocularly, intradermally, transmucosally, iontophoretically, or topically.

[0117] Additionally or alternatively, in some embodiments of the methods disclosed herein, the subject is non-responsive to at least one prior line of therapy targeting aging, anaging-related disease, or a neurodegenerative condition. In certain embodiments, the subject is human.

[0118] Additionally or alternatively, in some embodiments of the methods disclosed herein, the compositions and compounds of the present disclosure, including TAC-67-001 and TAC-64-001, are administered sequentially, simultaneously, or separately. The compositions and compounds of the present disclosure may be administered orally, parenterally, by inhalation spray, intranasally, buccally, or via an implanted reservoir. The term “parenteral” as used herein includes subcutaneous, intravenous, intramuscular, intraarticular, intra-synovial, intrasternal, intrathecal, intrahepatic, intralesional and intracranial injection or infusion techniques. In some embodiments, the compositions are administered orally, intravenously, or subcutaneously. Formulations including the compositions and compounds of the present disclosure may be designed to be short-acting, fast-releasing, or long-acting. In other embodiments, compounds can be administered in a local rather than systemic means, such as administration (e.g., by injection) at a tissue site.

[0119] Additionally or alternatively, in some embodiments of the methods disclosed herein, the compositions and compounds of the present disclosure can be administered prior to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks before), simultaneously with, or subsequent to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks after) the administration of an additional agent selected from the group consisting of statins (e.g., Atorvastatin, Fluvastatin, Lovastatin, Pitavastatin, Pravastatin, Rosuvastatin calcium, Simvastatin), fibrates (e.g., Gemfibrozil, Fenofibrate), niacin, ezetimibe, bile acid sequestrants (e.g., cholestyramine, colestipol, colesevelam), proprotein convertase subtilisin kexin type 9 (PCSK9) inhibitors, anti-platelet medications (e.g., aspirin, Clopidogrel, Ticagrelor, warfarin, prasugral), beta blockers, Angiotensinconverting enzyme (ACE) inhibitors (e.g., benazepril, Lisinopril, Ramipril), calcium channel blockers, diuretics, donepezil, galantamine, memantine, rivastigmine, memantine extended-release and donepezil (Namzaric), aducanumab, solanezumab, insulin, verubecestat, AADvacl, CSP-1103, Androgen, G-CSF, GM-CSF, Lonafarnib (zokinvy), Mannitol (Osmitrol, Resectisol), Phenytoin (Dilantin, Phenytek), Valproate sodium(Depakote), Gabapentin (Neurontin), Topiramate (Topamax), Carbamazepine (Equetro), Levodopa, Carbidopa, tetrabenazine, deuterabenazine, zonisamide (Zonegran), levetiracetam (Keppra), clonazepam (Klonopin), rufinamide (Banzel), lamotrigine (Lamictal), pregabalin (Lyrica), lacosamide (Vimpat), vigabatrin (Sabril), oxcarbazepine (Trileptal), phenobarbital, intepirdine, insulin, metformin, amylin analogs, glucagon, sulfonylureas (e.g., glimepiride, glipizide, glyburide, chlorpropamide, tolazamide, tolbutamide), meglitinides (e.g., nateglinide, repaglinide), thiazolidinediones (e.g., pioglitazone, rosiglitazone), alpha-glucosidase inhibitors (e.g., acarbose, miglitol), dipeptidyl peptidase (DPP-4) inhibitors (e.g., alogliptin, linagliptin, sitagliptin, saxagliptin), sodium -glucose co-transporter 2 (SGLT2) inhibitors (e.g., canagliflozin, dapagliflozin, empagliflozin, ertugliflozin), incretin mimetics (e.g., exenatide, liraglutide, dulaglutide, lixisenatide, semaglutide), analgesics (e.g., acetaminophen, tramadol, oxycodone, hydrocodone), nonsteroidal anti-inflammatory drugs (e.g., aspirin, ibuprofen, naproxen, celecoxib), cyclooxygenase-2 inhibitors, corticosteroids, hyaluronic acid, a-Tocopherol, interferon-a, PPAR-antagonists, colchicine, endothelin inhibitors, interleukin- 10, pirfenidone (Esbriet), nintedanib (Ofev), pentoxifylline, phosphatidylcholine, S-adenosyl- methionine, TGF-pi inhibitors, furosemide, erythropoietin, phosphate binders (e.g., calcium acetate, calcium carbonate), colecalciferol, ergocalciferol, cyclophosphamide, or any combination thereof.

[0120] It will be appreciated that the frequency with which any of these therapeutic agents of the present technology can be administered can be once or more than once over a period of about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days, about 11 days, about 12 days, about 13 days, about 14 days, about 20 days, about 28 days, about a week, about 2 weeks, about 3 weeks, about 4 weeks, about a month, about every 2 months, about every 3 months, about every 4 months, about every 5 months, about every 6 months, about every 7 months, about every 8 months, about every 9 months, about every 10 months, about every 11 months, about every year, about every 2 years, about every 3 years, about every 4 years, or about every 5 years.

[0121] For example, the compositions and compounds of the present technology may be administered daily, weekly, biweekly, or monthly for a particular period of time. The compositions and compounds of the present technology may be dosed daily over a 14 daytime period, or twice daily over a seven day time period. The compositions and compounds of the present technology may be administered daily for 7 days.

[0122] Alternatively, the compositions and compounds of the present technology may be administered daily, weekly, biweekly, or monthly for a particular period of time followed by a particular period of non-treatment. In some embodiments, the compositions and compounds of the present technology can be administered daily for 14 days followed by seven days of non-treatment, and repeated for two more cycles of daily administration for 14 days followed by seven days of non-treatment. In some embodiments, the compositions and compounds of the present technology can be administered twice daily for seven days followed by 14 days of non-treatment, which may be repeated for one or two more cycles of twice daily administration for seven days followed by 14 days of non-treatment.

[0123] In some embodiments, the compositions and compounds of the present technology are administered daily over a period of 14 days. In another embodiment, the compositions and compounds of the present technology are administered daily over a period of 12 days, or 11 days, or 10 days, or nine days, or eight days. In another embodiment, the compositions and compounds of the present technology are administered daily over a period of seven days. In another embodiment, the compositions and compounds of the present technology are administered daily over a period of six days, or five days, or four days, or three days.

[0124] In some embodiments, the treatment period during which the therapeutic agents are administered is then followed by a non-treatment period of a particular time duration, during which the therapeutic agents are not administered to the patient. This non-treatment period can then be followed by a series of subsequent treatment and non-treatment periods of the same or different frequencies for the same or different lengths of time. In some embodiments, the treatment and non-treatment periods are alternated. It will be understood that the period of treatment in cycling therapy may continue until the patient has achieved a complete response or a partial response, at which point the treatment may be stopped. Alternatively, the period of treatment in cycling therapy may continue until the patient has achieved a complete response or a partial response, at which point the period of treatment may continue for a particular number of cycles. In some embodiments, the length of the period of treatment may be a particular number of cycles, regardless of patient response. Insome other embodiments, the length of the period of treatment may continue until the patient relapses.

[0125] In some embodiments, the compositions and compounds of the present technology are cyclically administered to a patient. Cycling therapy involves the administration of a first agent (e.g., a first prophylactic or therapeutic agent) for a period of time, followed by the administration of a second agent and / or third agent (e.g., a second and / or third prophylactic or therapeutic agent) for a period of time and repeating this sequential administration. Cycling therapy can reduce the development of resistance to one or more of the therapies, avoid or reduce the side effects of one of the therapies, and / or improve the efficacy of the treatment.

[0126] Dosage, toxicity and therapeutic efficacy of any therapeutic agent can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50 / ED50. Compounds that exhibit high therapeutic indices are advantageous. While compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.

[0127] The data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds may be within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the methods, the therapeutically effective dose can be estimated initially from cell culture assays. A dose can be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (z.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to determine useful doses in humans accurately. Levels in plasma may be measured, for example, by high performance liquid chromatography.

[0128] Typically, an effective amount of the compositions and compounds of the present technology, sufficient for achieving a therapeutic or prophylactic effect, may rangefrom about 0.000001 mg per kilogram body weight per day to about 10,000 mg per kilogram body weight per day. Suitably, the dosage ranges are from about 0.0001 mg per kilogram body weight per day to about 100 mg per kilogram body weight per day. For example dosages can be 1 mg / kg body weight or 10 mg / kg body weight every day, every two days or every three days or within the range of 1-10 mg / kg every week, every two weeks or every three weeks. In one embodiment, a single dosage of one of the compositions and compounds of the present technology ranges from 0.001-10,000 micrograms per kg body weight. In one embodiment, the concentrations of the compositions and compounds of the present technology in a carrier range from 0.2 to 2000 micrograms per delivered milliliter. An exemplary treatment regime entails administration once per day or once a week. In therapeutic applications, a relatively high dosage at relatively short intervals is sometimes required until progression of the disease is reduced or terminated, or until the subject shows partial or complete amelioration of symptoms of disease. Thereafter, the patient can be administered a prophylactic regime.

[0129] In some embodiments, a therapeutically effective amount of the compositions and compounds of the present technology may be defined as a concentration of the compositions and compounds of the present technology at the target tissue of 10'12to 10'6molar, e.g., approximately 10'7molar. This concentration may be delivered by systemic doses of 0.001 to 100 mg / kg or equivalent dose by body surface area. The schedule of doses would be optimized to maintain the therapeutic concentration at the target tissue, such as by single daily or weekly administration, but also including continuous administration (e.g., parenteral infusion or transdermal application).

[0130] The skilled artisan will appreciate that certain factors may influence the dosage and timing required to effectively treat a subject, including but not limited to, the severity of the disease or disorder, previous treatments, the general health and / or age of the subject, and other diseases present. Moreover, treatment of a subject with a therapeutically effective amount of the therapeutic compositions described herein can include a single treatment or a series of treatments.

[0131] The mammal treated in accordance with the present methods can be any mammal, including, for example, farm animals, such as sheep, pigs, cows, and horses; pet animals, such as dogs and cats; laboratory animals, such as rats, mice and rabbits. In some embodiments, the mammal is a human.Kits of the Present Technology

[0132] In one aspect, the kits of the present technology comprise a therapeutic or prophylactic composition including an effective amount of any of the compounds disclosed herein in unit dosage form, including TAC-67-001, TAC-64-001, and combinations thereof. In some embodiments, the kit comprises a sterile container which contains a therapeutic or prophylactic; such containers can be boxes, ampules, bottles, vials, tubes, bags, pouches, blister-packs, or other suitable container forms known in the art. Such containers can be made of plastic, glass, laminated paper, metal foil, or other materials suitable for holding medicaments.

[0133] If desired, the compositions and compounds of the present technology can be provided together with instructions for administration to a subject who is aging or a subject having or at risk of developing aging-related diseases or neurodegenerative conditions, such as Alzheimer’s disease, epilepsy, Huntington's Disease, Parkinson's Disease, stroke, spinal cord injury, traumatic brain injury, Lewy body dementia, Pick's disease, Niewmann-Pick disease, amyloid angiopathy, cerebral amyloid angiopathy, systemic amyloidosis, hereditary cerebral hemorrhage with amyloidosis of the Dutch type, mild cognitive impairment, chemotherapy induced peripheral neuropathy, Hutchinson-Gilford progeria syndrome (HGPS), Nestor-Guillermo progeria syndrome, Werner syndrome, Cockayne syndrome, Bloom syndrome, xeroderma pigmentosum, ataxia telangiectasia, trichothiodystrophy, dyskeratosis congenital, mosaic variegated aneuploidy syndrome, diabetes, liver fibrosis, liver cirrhosis, lung fibrosis, atherosclerosis, chronic kidney disease, inclusion body myositis, or osteoarthritis. The instructions will generally include information about the use of the composition for the treatment or prevention of aging, aging related diseases, or neurodegenerative conditions. In other embodiments, the instructions include at least one of the following: description of the therapeutic agent; dosage schedule and administration for treatment or prevention of a senescence-associated pathology or symptoms thereof; precautions; warnings; indications; counter-indications; overdose information; adverse reactions; animal pharmacology; clinical studies; and / or references. The instructions may be printed directly on the container (when present), or as a label applied to the container, or as a separate sheet, pamphlet, card, or folder supplied in or with the container. A device capable of delivering the kit components through an administrative route may be included. Examples of such devices include syringes (for parenteral administration) or inhalation devices.

[0134] Additionally or alternatively, in some embodiments the kit further comprises one or more additional agents selected from the group consisting of statins (e.g., Atorvastatin, Fluvastatin, Lovastatin, Pitavastatin, Pravastatin, Rosuvastatin calcium, Simvastatin), fibrates (e.g., Gemfibrozil, Fenofibrate), niacin, ezetimibe, bile acid sequestrants (e.g., cholestyramine, colestipol, colesevelam), proprotein convertase subtilisin kexin type 9 (PCSK9) inhibitors, anti -platelet medications (e.g., aspirin, Clopidogrel, Ticagrelor, warfarin, prasugral), beta blockers, Angiotensin-converting enzyme (ACE) inhibitors (e.g., benazepril, Lisinopril, Ramipril), calcium channel blockers, diuretics, donepezil, galantamine, memantine, rivastigmine, memantine extended-release and donepezil (Namzaric), aducanumab, solanezumab, insulin, verubecestat, AADvacl, CSP-1103, Androgen, G-CSF, GM-CSF, Lonafarnib (zokinvy), Mannitol (Osmitrol, Resectisol), Phenytoin (Dilantin, Phenytek), Valproate sodium (Depakote), Gabapentin (Neurontin), Topiramate (Topamax), Carbamazepine (Equetro), Levodopa, Carbidopa, tetrabenazine, deuterabenazine, zonisamide (Zonegran), levetiracetam (Keppra), clonazepam (Klonopin), rufmamide (Banzel), lamotrigine (Lamictal), pregabalin (Lyrica), lacosamide (Vimpat), vigabatrin (Sabril), oxcarbazepine (Trileptal), phenobarbital, intepirdine, insulin, metformin, amylin analogs, glucagon, sulfonylureas (e.g., glimepiride, glipizide, glyburide, chlorpropamide, tolazamide, tolbutamide), meglitinides (e.g., nateglinide, repaglinide), thiazolidinediones (e.g., pioglitazone, rosiglitazone), alpha-glucosidase inhibitors (e.g., acarbose, miglitol), dipeptidyl peptidase (DPP-4) inhibitors (e.g., alogliptin, linagliptin, sitagliptin, saxagliptin), sodium-glucose co-transporter 2 (SGLT2) inhibitors (e.g., canagliflozin, dapagliflozin, empagliflozin, ertugliflozin), incretin mimetics (e.g., exenatide, liraglutide, dulaglutide, lixisenatide, semaglutide), analgesics (e.g., acetaminophen, tramadol, oxycodone, hydrocodone), nonsteroidal anti-inflammatory drugs (e.g., aspirin, ibuprofen, naproxen, celecoxib), cyclooxygenase-2 inhibitors, corticosteroids, hyaluronic acid, a-Tocopherol, interferon-a, PPAR-antagonists, colchicine, endothelin inhibitors, interleukin- 10, pirfenidone (Esbriet), nintedanib (Ofev), pentoxifylline, phosphatidylcholine, S-adenosyl-methionine, TGF-pi inhibitors, furosemide, erythropoietin, phosphate binders (e.g, calcium acetate, calcium carbonate), colecalciferol, ergocalciferol, cyclophosphamide, or any combination thereof. The additional agent may be formulated as separate pharmaceutical compositions either in a single package, or in separate packages.

[0135] The kits may further comprise pharmaceutically acceptable excipients, diluents, or carriers that are compatible with one or more kit components described herein.Optionally, the above described components of the kits of the present technology are packed in suitable containers and labeled for the treatment of aging, aging-related diseases, and neurodegenerative conditions. Examples of aging-related diseases or neurodegenerative conditions include, but are not limited to Alzheimer’s disease, epilepsy, Huntington's Disease, Parkinson's Disease, stroke, spinal cord injury, traumatic brain injury, Lewy body dementia, Pick's disease, Niewmann-Pick disease, amyloid angiopathy, cerebral amyloid angiopathy, systemic amyloidosis, hereditary cerebral hemorrhage with amyloidosis of the Dutch type, mild cognitive impairment, chemotherapy induced peripheral neuropathy, Hutchinson-Gilford progeria syndrome (HGPS), Nestor-Guillermo progeria syndrome, Werner syndrome, Cockayne syndrome, Bloom syndrome, xeroderma pigmentosum, ataxia telangiectasia, trichothiodystrophy, dyskeratosis congenital, mosaic variegated aneuploidy syndrome, diabetes, liver fibrosis, liver cirrhosis, lung fibrosis, atherosclerosis, chronic kidney disease, inclusion body myositis, or osteoarthritis. In some embodiments, aging, aging-related diseases, or neurodegenerative conditions comprise(s) a deficiency in TERT expression. The kits may optionally include instructions customarily included in commercial packages of therapeutic products, that contain information about, for example, the indications, usage, dosage, manufacture, administration, contraindications and / or warnings concerning the use of such therapeutic products.Methods of Identifying TERT Activating Agents

[0136] In one aspect, the present disclosure provides a method for identifying TERT activating agents. In one aspect, the method comprises identifying a candidate agent for activating TERT expression comprising (a) contacting a recombinant cell comprising a TERT reporter transgene with a candidate agent and (b) detecting expression levels of the TERT reporter transgene in the recombinant cell, wherein an increase in the expression levels of the TERT reporter transgene in the recombinant cell of step (a) compared to that observed in the recombinant call in the absence of the candidate agent indicates that the candidate agent increases TERT expression. In some embodiments, the candidate agent that increases TERT expression further increases ERK activity in the recombinant cell of step (a) compared to the ERK activity observed in the recombinant cell in the absence of the candidate agent. In some embodiments, the method for identifying TERT activating agentsidentifies a candidate agent which activates TERT expression by increasing ERK activity in the recombinant cell.

[0137] In any of the preceding embodiments, the TERT reporter transgene can comprise a TERT regulatory sequence or promoter that is operably linked to a reporter gene. In one embodiment, the reporter gene comprises an open reading frame that encodes a fluorescent protein, a chemiluminescent protein, a bioluminescent protein, or any combination thereof. In certain embodiments, the fluorescent protein is TagBFP, Azurite, EBFP2, mKalamal, Sirius, Sapphire, T-Sapphire, ECFP, Cerulean, SCFP3A, mTurquoise, monomeric Midoriishi-Cyan, TagCFP, mTFPl, EGFP, Emerald, Superfolder GFP, Monomeric Azami Green, TagGFP2, mUKG, mWasabi, EYFP, Citrine, Venus, SYFP2, TagYFP, Monomeric Kusabira-Orange, ITIKOK, mK02, mOrange, mOrange2, mRaspberry, mCherry, dsRed, mStrawberry, mTangerine, tdTomato, TagRFP, TagRFP-T, mApple, mRuby, mPlum, HcRed-Tandem, mKate2, mNeptune, NirFP, TagRFP657, IFP1.4, iRFP, mKeima Red, LSS-mKatel, LSS-mKate2, PA-GFP, PAmCherryl, PATagRFP, Kaede (green), Kaede (red), KikGRl (green), KikGRl (red), PS-CFP2, PS-CFP2, mEos2 (green), mEos2 (red), PSmOrange, or Dronpa. In certain embodiments, the chemiluminescent protein is 3- galactosidase, horseradish peroxidase (HRP), or alkaline phosphatase. Peroxidases generate peroxide that oxidizes luminol in a reaction that generates light, whereas alkaline phosphatases remove a phosphate from a substrate molecule, destabilizing it and initiating a cascade that results in the emission of light. In certain embodiments, the biolumiscent protein is Aequorin, firefly luciferase, Renilla luciferase, red luciferase, luxAB, or nanoluciferase. These bioluminescent proteins have also been genetically separated into two distinct functional domains that will generate light only when the protein domains are closely co-localized. A variety of emission spectrum-shifted mutant derivatives of both of these bioluminescent proteins have been generated over the past decade and have been used for multi-color imaging and co-localization within a living cell. One of skill in the art will appreciate that the TERT reporter transgene could comprise any gene encoding a product that produces a detectable signal upon exposure to the appropriate stimuli.

[0138] Additionally, one of skill in the art will appreciate that the recombinant cell can be of any cell type and can originate from multiple organisms, including, for example, mice or humans. In some embodiments, the recombinant cell is a fibroblast from a transgenic mouse. In some embodiments, the TERT reporter transgene comprises a bacterial artificialchromosome which spans the human TERT gene locus and which contains a reporter gene cassette inserted into the TERT initiation codon.

[0139] The method for identifying TERT activating agents can be a high throughput method which is capable of screening many candidate agents in a relatively short amount of time. In some embodiments, a candidate agent which is identified by the method can further be assayed in one or more human cell lines to determine whether the candidate agent increases TERT expression from the human TERT gene. TERT expression can be quantified by any appropriate means, including analysis of mRNA levels (e.g., RT-qPCR, nuclease protection assays, Northern blotting, in situ hybridization, etc.) or protein levels (e.g., TERT activity assays, ELISA, Western blots, mass spectrometry, etc.).EXAMPLES

[0140] The present technology is further illustrated by the following Examples, which should not be construed as limiting in any way.Example 1: Materials and methodsAnimals

[0141] All animal procedures used in this study were reviewed and approved by the University of Texas MD Anderson Cancer Center Institutional Animal Care and Use Committee. C57BL / 6 mice (stock #000664) were purchased from the Jackson Laboratory. Tert deficient (LSL-mTert) and hTERT-Rluc transgenic mice were generated as previously described (Chakravarti et al., 2020; Jia et al., 2011). Male mice were used in the present study as these have been widely used for the aging studies and shown to correspond more closely to the phenotype of human aging (Graber et al., 2015; Yanai and Endo, 2021). All animals were housed in pathogen-free, ambient temperature (21-23 °C), 45-55% humidity, and 12-h dark / light cycle conditions, and cared for in accordance with the International Association for Assessment and Accreditation of Laboratory Animal Care policies and certification.Human and mouse fibroblast cells

[0142] Human MRC-5 (CCL-171, ATCC) fibroblasts were maintained in EMEM (ATCC) supplemented with 10% FBS and lx penicillin / streptomycin (Invitrogen). WS fibroblasts (AG03141, Coriell Institute) were maintained in EMEM (ATCC) supplemented with 15% FBS and lx penicillin / streptomycin (Invitrogen). Primary mouse ear fibroblastswere prepared from adult hTERT-Rluc transgenic mouse, as previously described (Khan and Gasser, 2016; Moore and Allen, 2013), and maintained in DMEM supplemented with 10% FBS, 1% nonessential amino acids, and lx penicillin / streptomycin (Invitrogen).Human iPSC-derived NPC and neuronal culture

[0143] For human neural culture, neural progenitor cells (NPCs) (Raja et al., 2016) derived from non-demented control individual were used and maintained in neural stem cell maintenance medium (Millipore) supplemented with 20 ng / ml bFGF (Peprotech). For neuronal differentiation as previously described (Brennand et al., 2011; Hu and Zhang, 2009), NPCs were plated onto poly-L-ornithine (PLO) / laminin-coated plates, and incubated in neural differentiation media (DMEM / F12 (Invitrogen), lx GlutaMax (Invitrogen), lx N2 (Invitrogen), lx B27 (Invitrogen), 20 ng / ml BDNF (Peprotech), 20 ng / ml GDNF (Peprotech), 1 pM dibutyryl-cyclic AMP (Sigma), and 0.2 pM ascorbic acid (Sigma). iPSCs-derived neurons were differentiated for 1~4 months.High-throughput compound screening and hits confirmation

[0144] For primary high-throughput screening, 8,000 primary ear fibroblasts derived from hTERT-Rluc transgenic reporter mice were seeded into 1536-well plates (Greiner) in 6 pL of growth medium in wells pre-spotted with DMSO stocks of each screening compound such that each well contained a final concentration of 5 pM of each test article. 1 pM SAHA was used as a positive stimulation control. After 24 hours, 3 pL of Renilla-Glo reagent (Promega) was dispensed per well. Plates were shaken and then read on an Envision plate reader (Perkin Elmer).Measurements of Renilla Luciferase activity in adult mouse tissues

[0145] The mouse tissues were freshly isolated from vehicle- or TAC -treated hTERT-Rluc transgenic male mice for the indicated times and the tissue lysates were prepared in Luciferase Lysis Buffer (Promega). Renilla luciferase activity reflecting changes in transcriptional activity of transgenic hTERT promoter was determined by using Renilla-Glo Luciferase Assay system (Promega) as described in the manufacturer’s protocol. The protein concentrations of the cell lysates were determined using Pierce BCA Protein Assay Kit (Thermo Fisher) and the bioluminescence was normalized to protein contents.Human phospho-kinase array

[0146] A human phospho-kinase array (ARY003B, R&D Systems) was used to detect the relative phosphorylation levels of human kinases in vehicle- or TAC -treated MRC-5 cells according to the manufacturer’s instruction. Phosphorylation levels were detected using SuperSignal Chemiluminescent Substrate (Pierce) and quantitative densitometric analysis of each signal was carried out using ImageJ software.RNA isolation and quantitative real-time PCR

[0147] Total RNA was isolated using TRIzol Reagent (Invitrogen), reverse-transcribed with SuperScript III First-Strand Synthesis System (Invitrogen), and amplified with SYBR Green PCR Master Mix (Invitrogen), according to the manufacturers’ protocols. The expression levels were normalized with mouse Hprtl or human HPRT1 mRNA in each sample. The primer sequences are: human TERTY'. GCCCTCAGACTTCAAGACCA (SEQ ID NO: 1); R: GCTGCTGGTGTCTGCTCTC (SEQ ID NO: 2), mouse p!6 F CCCAACGCCCCGAACT (SEQ ID NO: 3); R: GCAGAAGAGCTGCTACGTGAA (SEQ ID NO: 4), mouse p21 F: GCAGATCCACAGCGATATCCA (SEQ ID NO: 5); R: AACAGGTCGGACATCACCAG (SEQ ID NO: 6), mouse Dnmtl F: TGAGGAAGGCTACCTGGCTA (SEQ ID NO: 7); R: GTCTGCCATTTCTGCTCTCC (SEQ ID NO: 8), mouse Dnmt3a F: ACCAGGCCACCTACAACAAG (SEQ ID NO: 9); R: TTGTTCTGCACTTCCACAGC (SEQ ID NO: 10), mouse Dnmt3b F: ACTTGGTGATTGGTGGAAGC (SEQ ID NO: 11); R: CCAGAAGAATGGACGGTTGT (SEQ ID NO: 12), mouse Bmil F: AGAAGAGATTTTTATGCAGCTCA (SEQ ID NO: 13); R: CAACTTCTCCTCGGTCTTCA (SEQ ID NO: 14), mouse Yyl F: ACCCTAAGCAACTGGCAGAA (SEQ ID NO: 15); R: GGTGTGCAGATGCTTTCTCA (SEQ ID NO: 16), mouse Idl F: CATGAACGGCTGCTACTCAC (SEQ ID NO: 17); R: GACTCCGAGTTCAGCTCCAG (SEQ ID NO: 18).RNA-sequencing

[0148] Total RNA was extracted from collected samples as described above. For mouse samples, peripheral blood was taken from vehicle- or TAC -treated mice, and PBMCs were separated by Ficoll (GE17-5446-02, Sigma) density gradient centrifugation. For human samples, human neurons differentiated from iPSC-derived NPCs or primary fibroblasts were treated with vehicle or TAC-67-001 for the indicated times. RNA quantity was determined to be optimal for each sample before further processing. For each RNA seq,purified RNA was amplified to construct Illumina sequencing libraries using standard mRNA-seq guide (the PE protocol), and the libraries were sequenced on Illumina HiSeq 4000 instrument. Gene-level quantification was implemented with htseqcount package (Anders et al., 2015). Data normalization and differential expression analysis were conducted using DESeq2 package (Love et al., 2014). Gene set enrichment analysis (GSEA) on gene ontology biological processes were done using GSEA java package (gsea2-2.2.1.jar) from the Broad Institute (Mootha et al., 2003; Subramanian et al., 2005).Human TERT reporter constructs and luciferase assay

[0149] A 4-kb fragment upstream of the human TERT transcription start site was amplified from human BAC clone (RP11-117B23) and cloned into pGL4.10 luciferase vector (Promega). Mutations which lack the AP-1 binding sequences were generated using QuikChange II XL Site-Directed Mutagenesis kit (Cat# 200521, Agilent). The mutations were confirmed by sequencing. The wild-type or mutant reporter plasmids were transiently transfected into MRC-5 cells using X-tremeGENE HP DNA Transfection reagent (Cat# 6366236001, Millipore Sigma), and the cells were treated with vehicle or TAC-67-001. Relative luciferase activities in cell lysates were normalized to control Renilla luciferase activity and measured using a Dual-Luciferase Reporter Assay System (Promega).ChlP -sequencing and ChIP -quantitative PCR

[0150] Cells were fixed and cross-linked with 1.42% formaldehyde. The cross-linking was quenched with 125 mM glycine, and cells were washed and collected with ice-cold PBS containing lx protease & phosphatase inhibitor (Pierce). The nuclei were isolated by lysing the cell pellets in RIPA buffer (50 mM HEPES [pH 7.4], 150 mM NaCl, 1% NP-40, 1 mM EDTA, lx protease and phosphatase inhibitor cocktail [Pierce]). The chromatin was then sheared by sonication using Bioruptor Pico (Diagenode). The lysates were cleared by centrifugation.

[0151] For chromatin immunoprecipitation, the lysates were pre-cleared by incubation with Protein A / G Plus Agarose (Pierce). Clear lysates were incubated overnight at 4 °C with appropriate primary antibodies. The antibody complexes were obtained with ChlP- Grade Protein A / G Plus Agarose (Pierce) and washed five times with RIPA buffer. The DNA was recovered as described (Terranova et al., 2018). For ChlP-seq, control immunoprecipitation was done in parallel without antibodies. Raw fastq reads for allexperiments were processed using FastQC (http: / / www.bioinformatics.babraham.ac.uk / projects / fastqc / ), low-quality reads were removed with trimmomatic (DOI: 10.1093 / bioinformatics / btul70) v0.33 with SLIDINGWINDOW:4:30 and quality reads were aligned to the mm9 (mouse) and hgl9 (human) reference genome using Bowtie version 1.2.2 (Langmead et al., 2009) with the following criteria: —best — chunkmbs 320. To directly compare ChlP-seq between samples, uniquely mapped reads for each mark were normalized by total reads per condition, sorted, and indexed using SAMtools version 1.9 (Li et al., 2009). Model -based analysis of ChlP- seq (MACS version 1.4.2) (Zhang et al., 2008) was used to identify antibody-IP enrichment over input background. MACS2 was used to identify the differential binding of each protein in different conditions with the following criteria: bdgdiff-g 60 -1 120. To visualize ChlP-seq libraries on the IGV browser, we used deepTools version 2.7.15 to generate bigwig files by scaling the bam files to reads per kilobase per million (RPKM) using the following criteria: bamCoverage -b-normalizeUsing RPKM-smoothLength 300- binSize 30-extendReads 200 -o. For ChlP-qPCR, sonicated chromatin was subjected to ChIP by using specific antibodies or normal rabbit IgG and qPCR analysis was performed using target specific primers (AZE7?7 / ?-3725-F: TGAAGAGGAACATGCCGTTT (SEQ ID NO: 19), R: GCCATGGGGTGAAATTCTTT (SEQ ID NO: 20); hTERTp-\6I2-^-.TGTGGTGTTTTAAGCCAATGA (SEQ ID NO: 21), R: CCCCAGTATTATGGGTGCAG (SEQ ID NO: 22)).Immunoprecipitation and immunoblot

[0152] Immunoprecipitation and immunoblotting were carried out as previously described (Shim et al., 2015) with a minor modification. For coimmunoprecipitation, the differentiated neuronal cells were lysed on ice in a modified RIPA buffer. The cell supernatant was incubated at 4 °C overnight with appropriate primary antibodies, and ChlP- Grade Protein A / G Plus Agarose (Pierce) was then added and incubated for an additional hour at 4 °C. Immunoprecipitants were washed five times with RIPA buffer, recovered with SDS sample buffer, and subjected to immunoblot analysis. Protein samples were subjected to NuPAGE (Invitrogen), transferred to PVDF membrane (Bio-Rad), and probed with primary antibodies. Immunoreactivity was visualized with appropriate HRP- conjugated secondary antibodies (Cell Signaling Tech) followed by SuperSignalChemiluminescent Substrate (Pierce). Quantitative densitometric analysis of select gel band intensities was carried out using ImageJ software.Mouse pl 6Ink4a promoter DNA methylation

[0153] The DNA methylation levels of mouse pl6Ink4apromoter region were measured by bisulfite modification of genomic DNA and subsequent methylation-specific PCR, as previously described (Sauer et al., 2010; Sharpless et al., 2001). Briefly, 1 pg genomic DNA isolated from fresh mouse tissues was bisulfite treated, desulfonated and recovered using EZ DNA Methylation Gold kit (Zymo Research). Bisulfite-modified DNA was amplified with the methylated / unm ethylated pl6-specific primer sets using real-time methylation-specific PCR as described previously (Lo et al., 1999; Sharpless et al., 2001).ELISA analysis

[0154] The tissue lysates of the hippocampus freshly isolated from the mice treated with DMSO or TAC-67-001 were prepared in RIPA buffer and mature BDNF were quantified with sandwich enzyme-linked immunosorbent assay (ELISA) kit (BEK-2211, Biosensis) according to the manufacturer’s instructions and normalized to total protein levels determined by BCA assay (Pierce).Immunohistochemistry (IHC) and immuno fluorescence (IF)

[0155] Mice under anesthesia were transcardially perfused with saline and then with 4% paraformaldehyde in PBS (pH 7.4). For IHC, the brains were post-fixed in the same fixative and embedded in paraffin. Subsequently, the brain sections were deparaffinized, hydrated, and blocked with Biocare blocking reagent (Biocare Medical) according to standard manufacturer procedures. After the epitope unmasking, the sections were incubated with primary antibodies, followed by secondary Envision plus antibodies with HRP-labeled polymer (Dako). The antigen was visualized using DAB chromogen system (Dako). Quantitative analysis of immunohistochemical staining intensities was carried out using ImageJ software. For IF, the staining was performed on paraffin-embedded tissue sections as described previously (Zaqout et al., 2020).

[0156] SA-P-gal staining was performed as previously described (Yousefzadeh et al., 2020). Fresh tissues from vehicle- or TAC-treated mice (26~27-month-old) mice were fixed in 10% neutral buffered formalin (NBF) for 4 hr and then transferred to 30% sucroseovernight. Tissues were then embedded in OCT and cryosectioned at 6 gm. SA-P-gal staining (pH 5.8-6.0) of tissue sections was performed at 37°C for 16-24 hr in SA-P-gal staining solution (#9860, Cell Signaling Technology), according to manufacturer’s protocol. Images were captured using bright-field microscopy at 20x magnification.Telomere measurement by FISH and quantitative real-time PCR

[0157] Telomere length was analyzed by FISH and qPCR-based methods, as previously described (Herbert et al., 2006). For telomere FISH, Werner syndrome (WS) fibroblasts were treated with DMSO or TAC-67-001 (0.5 pM), and the telomere FISH was performed by using Cy5-labeled peptide nucleic acid (PNA) probe from Agilent (Cat# K532711-8) as previously described (Chakravarti et al., 2021b). Telomere intensity was measured from 50 cells from each group. For real-time qPCR assay, genomic DNA isolated from vehicle- or TAC -treated WS fibroblasts was analyzed using telomeric primers, primers for the reference control gene (mouse 36B4 single copy gene) and PCR settings as previously described (Cawthon, 2002, 2009).Mouse behavioral tests

[0158] The evaluation of learning and memory in mice was carried out using Barnes Maze and Novel Location Recognition tasks as previously reported (Shim et al., 2021; Yuan et al., 2020). For the Barnes maze task, the mice were given 180 s for each trial to identify and enter the escape hole on the apparatus consisting of a clear grey circular open disk (92 cm diameter) with 20 circular holes (5 cm diameter) (Panlab Harvard Apparatus). The holes were equally spaced around the perimeter and located 2 cm from the edge of the maze. A black escape box (20 cm x 9 cm x 9 cm) was positioned beneath one of these holes, and distinct visual cues were placed at three points around the maze. The mice received three trials per day with a 15-min inter-trial interval on four consecutive days during the acquisition and retention phases. The latency to enter the escape hole was recorded. For the novel location recognition test, it is based on the ability of mice to show preference for novel versus familiar objects. On day 1, mice were individually habituated to two objects. In the recognition session (day 2), mice were placed back in the same arena in which one of the objects was moved, and the exploration behavior was assessed by quantifying the time spent exploring each object. Between each trial, the maze and all objects were thoroughly cleaned with 70% ethanol to remove any other clues that might affect performance in subsequent trials.Transmission Electron Microscopy (TEM)

[0159] Fresh mouse brain tissues were fixed with a solution containing 3% glutaraldehyde plus 2% paraformaldehyde in 0.1 M cacodylate buffer, pH 7.3, then washed in 0.1 M sodium cacodylate buffer and treated with 0.1% Millipore-filtered cacodylate buffered tannic acid, post-fixed with 1% buffered osmium tetroxide, and stained en bloc with 1% Millipore-filtered uranyl acetate. The samples were dehydrated in increasing concentrations of ethanol, infiltrated, and embedded in LX-112 medium. The samples were polymerized in a 60°C oven for approximately 3 days. Ultrathin sections were cut in a Leica Ultracut microtome (Leica, Deerfield, IL), stained with uranyl acetate and lead citrate, and examined in a JEM 1010 transmission electron microscope (JEOL, USA, Inc., Peabody, MA) at an accelerating voltage of 80 kV. Digital images were obtained using AMT Imaging System (Advanced Microscopy Techniques Corp, Danvers, MA).In vivo pharmacokinetics and tissue distribution

[0160] Mice were fasted overnight before administration of vehicle or TAC-67-001. Mice were administered compounds intraperitoneally ( / . / ?.) at 5 mg / kg or orally at 20 mg / kg (0.5% HPMC F4M / 0.1% Tween 80 in water) (n = 3). Blood, small intestine, and brain samples were collected from each animal at 0.25, 0.5, 1, 2, 4, and 8 h after dose administration. The concentration of TAC-67-001 in each sample was determined by LC- MS / MS assay, and pharmacokinetic analysis was performed using noncompartmental analysis (NCA) and Phoenix WinNonlin.Immunostainins for intraepidermal nerve fibers (lENFs)

[0161] Mice were perfused with lx PBS, followed by Zamboni’s solution (2% paraformaldehyde, 0.2% picric acid in PBS, pH 7.4). Biopsies from the hind paws were immediately placed in the same fixative for 24 hr, cryoprotected in 30% sucrose in lx PBS (pH 7.4) overnight, and stored at 4°C for batch processing of samples. For sectioning, tissues were immersed in Cryo-gel OCT compound (Electron Microscopy Sciences) and cut into 25-pm thick sections. The sections were stained with an antibody against the pan neuronal marker PGP9.5 (Abeam) along with anti -Collagen IV antibody (Southern Biotech). Nerve fibers that crossed the collagen stained dermal / epidermal junction into the epidermis were counted using Leica fluorescence microscope, and IENF density was determined as the total number of fibers.Statistical analysis

[0162] No statistical methods were used to predetermine sample sizes, but our sample sizes are similar to those reported in previous publications (laccarino et al., 2016; Jaskelioff et al., 2011; Sahin et al., 2011). All data distributions were assumed to be normal, but this was not formally tested. The mice and cells were randomly assigned to control or experimental groups, except in experiments that required specific genotypes and ages. The investigators were generally not blinded to allocation during experiments and outcome assessment. No animal or sample was excluded from the analysis. All statistical analyses were performed using GraphPad Prism 8; the statistic tests and p values are described in the indicated figure legends.Key Resources and Reagents

[0163] Various commercially and publically available resources are referenced throughout the Experimental Examples. A non-exhaustive listing of such resources is provided below:REAGENT or SOURCE IDENTIFIERanti-TERT Abeam Cat#: ab32020 anti-H3K9me3 Abeam Cat#: ab8898 anti-H3K27ac Abeam Cat#: ab4729 anti-pERK Cell Signaling Tech Cat#: 9101 anti-ERK Cell Signaling Tech Cat#: 4695 anti-FOS Cell Signaling Tech Cat#: 2250 anti-pl6 Abeam Cat#: ab211542 anti-DCX Abeam Cat#: ab 18723 anti-DCX Santa Cruz Biotech Cat#: sc-271390 anti-PSA-NCAM EMD Millipore Cat#: MAB5324 anti-IBAl Wako Cat#: 019-19741 anti-Tubulin Sigma Cat#: T5168Chemicals, Peptides, and Recombinant ProteinsDulbecco's phosphate-buffered saline GIBCO 14190144Hanks' balanced salt solution GIBCO 14170112 poly-D-lysine Sigma P6407 poly-L-omithine EMD Millipore A-004-CLaminin Sigma L2020Eagle’s MEM ATCC 30-2003Fetal Bovine Serum GIBCO 10082147Penicillin / Streptomycin GIBCO 15140122Neurobasal medium GIBCO 12348-017B-27 Supplement GIBCO 35050-061N-2 Supplement GIBCO 17502-048GlutaMAX Supplement GIBCO 35050-061DMEM / F12 GIBCO 11330-032Human BDNF Peprotech 450-02Human GDNF Peprotech 450-10Dibutyryl cyclic AMP Sigma D0627L-Ascorbic acid Sigma A4544NSC maintenance media EMD Millipore SCM005Recombinant human FGF -basic Peprotech AF-100-18BChlP-Grade Protein A / G Plus Agarose Thermo Scientific 26159Halt protease and phosphatase inhibitor Thermo Scientific 78442 cocktailTRIzol Reagent Invitrogen 15596026SuperScript III First-Strand Synthesis Invitrogen 18080-051SystemS YBR Green PCR Master Mix Invitrogen 4309155Trametinib Selleck Chemicals S2673T-5224 Selleck Chemicals S8966Critical Commercial AssaysEZ DNA Methylation-Gold™ Kit Zymo Research ZD5005Senescence [3-Galactosidase Staining Kit Cell Signaling Tech 9860 mature BDNF mouse rapid ELISA assay Biosensis BEK-2211Deposited DataRNA-seq data of WT and TerE' mouse Shim et al., 2021 GSE163524 brainsRNA-seq and ChlP-seq data This paper N / AExperimental Models: Cell LinesMouse: Primary ear fibroblasts from Jia et al., 2011 N / A hTERT-Rluc transgenic mouseHuman: MRC-5 fibroblasts ATCC Cat#: CCL-171Human: Werner syndrome (WS) Coriell Institute Cat#: AG03141 fibroblastsHuman: NPCs derived from NDC's iPSCs Raja et al., 2016 N / AExperimental Models: Organisms / StrainsC57BL / 6 The Jackson JAX: 000664LaboratoryLSL-mTERT (B6 background) Chakravarti et al., N / A2020 hTERT-Rluc transgenic mouse Jia et al., 2011 N / ARecombinant DNA pGL4-hTERT-promoter-4kb-WT This study N / A pGL4-hTERT-promoter-4kb-AAPl-#l This study N / A pGL4-hTERT-promoter-4kb-AAPl-#2 This study N / ApGL4-hTERT-promoter-4kb-AAPl- This study N / A#1Software and AlgorithmsImageJ vl.53a NIHGraphPad Prism v8 GraphPad Software htseq -count package Anders et al., 2015DESeq2 package Love et al., 2014Bowtie vl.2.2 Langmead et al., 2009SAMtools vl.9 Li et al., 2009MACS vl.4.2 Zhang et al., 2008GSEA v4.1.0 Broad InstituteBioRender BioRenderOtherBarnes Maze apparatus (basic mouse) Panlab Harvard Cat#: 989999ApparatusBioruptor Pico sonication system DiagenodeHiSeq 4000 IlluminaExample 2: Identification of small molecule activators of TERT

[0164] Given the established benefits of genetic TERT activation on diseases of aging (Chakravarti et al., 2021a; Jaskelioff et al., 2011; Sahin et al., 2011; Shim et al., 2021), we sought to identify small molecules that could induce transient expression of the human and mouse TERT gene in somatic cells. To this end, a cell-based high-throughput screening (HTS) assay was developed to enable large-scale screening of small molecules that modulate in vivo transcriptional activity of the human TERT transgene in adult mouse ear fibroblasts (FIGs. 1A-1B and FIG. 2A). These cells were derived from mice transgenic for a 160-kb bacterial artificial chromosome (BAC) spanning the hTERT locus which contains a Renilla luciferase (Rluc) reporter cassette inserted into the hTERT initiation codon; this human hTERT reporter transgene mirrors the expression patterns of hTERT in human tissues (Jia et al., 2011). Following an initial screen of 653,000 compounds, approximately 100 hits were further characterized by measuring reporter bioluminescence, yielding several potential TACs capable of modestly inducing the transcription activity of TERT gene (FIG. 2B). Immunoblot analysis demonstrated that the screening hit TAC-67-001 (FIG. 1C) induced the highest level of protein expression and therefore it was chosen for further analyses. TAC-67-001 treatment resulted in a dose-dependent induction of TERT mRNA in primary human fibroblasts MCR-5 (FIGs. 1C-1D). Consistent with TAC-induced TERT gene expression, TAC-67-001 treatment led to the accumulation of the activeenhancer / promoter mark H3K27ac and loss of repressive mark H3K9me3 upstream of the transcriptional start site of the TERT gene (FIG. IE), indicating that TAC-67-001 can override the repressive chromatin state of the human TERT locus. Moreover, TAC-67-001 (6mg / kg) increased human TERT gene expression across multiple tissues of hTERT-Rluc transgenic mice including brain, heart and skeletal muscle (FIG. IF). TAC-67-001 activity was also assessed in primary Werner syndrome (WS) fibroblasts which normally undergo rapid senescence that can be reversed by enforced hTERT expression (Wyllie et al., 2000). It was found that TAC-67-001 (0.5 pM) was able to induce TERT expression in WS fibroblasts (FIG. 1G). In this WS model, both quantitative PCR and fluorescent in situ hybridization (FISH) analyses showed that TAC-67-001 treatment led to an increase in endogenous telomere length relative to the control group (FIGs. 1H and II). TAC -treated WS fibroblasts also displayed enhanced proliferative potential relative to the vehicle control group (FIG. 2C). Thus, TAC-67-001 up-regulates human TERT transcription independently of cell- or tissue-types.Example 3: TAC-67-001 Activates the MEK / ERK / AP-1 Cascade to Directly Upregulate TERT Gene Transcription

[0165] To gain insight into the downstream-signaling cascades and TERT promoter elements linked to TAC-induced TERT expression, the phosphorylation profiles of an array of kinases and their substrates were analyzed using phospho-kinase arrays. It was found that phosphorylation of extracellular signal-regulated kinase (ERK) and its downstream effector S6 kinase was consistently increased by TAC-67-001 treatment in primary human MRC-5 cells (FIGs. 3A-3B). Accordingly, inhibition of ERK with the MEK inhibitor trametinib abolished TAC-induced ERK phosphorylation and TERT upregulation in MRC- 5 cells (FIG. 3C).

[0166] Next, the transcriptomic changes across different somatic cell types was examined with the goal of identifying transcription factors and their binding elements that may link ERK activation to TERT transcriptional control. RNA sequencing (RNA-seq) analysis of human normal fibroblasts and induced pluripotent stem cell (iPSC)-derived neurons demonstrated that TAC-67-001 treatment upregulated FOS gene expression (FIGs. 3D-3F) FOS is a major component of the activator protein 1 (AP-1) transcription factor complex that binds to specific c / .s-acting elements of target gene promoters and stimulates the expression of these genes (Angel and Karin, 1991). We found that two AP-1 binding sites reside within the 4-kb upstream regulatory region of the human TERT gene and thatone of the binding motifs is well conserved between human and mouse (FIGs. 3G-3H). To explore whether AP-1 motifs are required for TERT promoter activation, a human TERT promoter-luciferase reporter that contains 4 kb upstream sequences from the transcription start site of the TERT gene was constructed. MRC-5 cells were transiently transfected with the luciferase reporter construct and then stimulated with TAC-67-001. Consistent with our observation of endogenous TERT levels, TAC-67-001 was able to induce TERT reporter activity in human fibroblasts (FIG. 3H). Of note, deletion of either AP-1 binding motifs within this construct abolished TAC-induced TERT promoter activity and deletion of both motifs resulted in a further decrease in promoter activity (FIG. 3H). We next assessed whether the AP-1 complex is specifically recruited to the TERT promoter in response to TAC-67-001 treatment in their endogenous chromatin context. Chromatin immunoprecipitation followed by real-time quantitative PCR (ChlP-qPCR) analysis showed that TAC-67-001 treatment leads to recruitment of endogenous FOS, a subunit of AP-1 complex, to two AP-1 binding motifs in the endogenous TERT promoter (FIG. 31). A selective AP-1 inhibitor T-5224 that specifically blocks FOS / AP-1 binding to DNA without affecting their expression (Aikawa et al., 2008) impaired TAC-induced expression of TERT (FIG. 3 J). Together, these data indicate that TAC-67-001 specifically activates the transcriptional activation of TERT via the MEK / ERK / AP-1 pathway.Example 4: TAC-67-001 Attenuates Multiple Aging Hallmarks In Vivo

[0167] The capacity of genetic TERT reactivation to rejuvenate prematurely aged mice with telomere dysfunction (Jaskelioff et al., 2011; Sahin et al., 2011; Sherr and DePinho, 2000) prompted us to assess whether TAC -mediated TERT induction could attenuate organismal aging in naturally aged mice with intact telomeres. Intraperitoneal administration of TAC-67-001 followed by the time-dependent quantification of TAC-67- 001 levels by mass spectrometry -based pharmacokinetics showed good plasma exposure for TAC-67-001 (T1 / 2 0.568 h, AUC: 285 h ng / ml) (FIGs. 5A-5B). Notably, TAC-67-001 additionally demonstrated central nervous system exposure with roughly two-fold partitioning of the compound in the central nervous system (CNS) relative to plasma, which increased mTERT transcription 0.5 to 3 hr after administration, which mirrors the rapid induction of hTERT promoter activity in brain tissues of TAC -treated transgenic mice (FIG. IF). TAC-67-001 is cleared from the plasma by 3 hr and plasma levels track with those in brain (FIGs. 5C-5D).

[0168] To further explore transcriptomic changes upon TAC-67-001 treatment, we performed RNA-seq of peripheral blood mononuclear cells (PBMCs) from 12-month-old mice. Following a one-week treatment course (daily i.p. injection of 6 mg / kg / day), transcriptome analysis revealed a reversal of aging gene signatures including cell cycle arrest and PML body, which are established key cellular changes associated with aging PBMCs of middle-aged C57BL / 6 mice (FIG. 4A). Specifically, relative to vehicle-treated controls, TAC-treated PBMCs exhibited repression of Cdkn2a / pl6Ink4a, a key driver and biomarker of in vivo senescence and aging, as well as other senescence-associated secretory phenotype (SASP) components -Il-la, Il-lf, Mmp-13 n Mmp-14 (FIG. 4B).Conversely, TAC-67-001 treatment concurrently induced signatures of organism growth and natural killer cell activation (FIG. 4C), which are known to decline with age (Brauning et al., 2022). Notably, across a broad spectrum of tissues, a one-week course of TAC-67- 001 treatment decreased expression of the classical senescence marker, pl6!nk4a.ibut not p21CipIin the brain, skeletal muscle, kidney, heart and liver of middle-aged (10~12-month- old) mice (FIG. 4D and FIGs. 6A-6B). TAC-mediated repression of pi6Ink4awas abolished in age- and sex-matched Tert-null mice (FIG. 4E), indicating that TERT is required for TAC-induced silencing of p!6Ink4a.

[0169] To determine the molecular mechanism of TAC-mediated pi6Ink4arepression, we examined known regulators governing p!6Ink4atranscription. Along these lines, our previous transcriptomic analysis of the brains of adult Tert+ / +and first generation (Gl) Tert / _mice (with intact telomeres) (Shim et al., 2021) showed significant and specific reduction in the expression of Dnmt3b (FIGs. 6C-6D), a DNA methyltransferase responsible for the hypermethylation of pl6Ink4apromoter (Rhee et al., 2002). Quantitative RT-PCR analysis of Tert+ / ~ and Tert4~ mouse brains confirmed marked down-regulation of Dnmt3b levels in Tert+ / ~ mice which was further reduced in Tert4' mice (FIG. 4F), indicating that TERT levels positively correlate with Dnmt3b expression in vivo. Correspondingly, chromatin IP followed by sequencing (ChlP-Seq) analysis showed that TERT binds to the DNMT3b promoter in human iPSC-derived neurons (FIG. 4G). These results are consistent with previous findings that TERT can act as a transcriptional modulator not only in highly proliferating cells but also in terminally differentiated cells (Park et al., 2009; Shim et al., 2021).

[0170] As de novo DNA methylation mediated by DNMT3b is associated with repression of pl6INK4atranscription (Rhee et al., 2002), we examined whether TAC-67-001 treatment could induce hypermethylation of the pl6Ink4apromoter in vivo. Real-time methylation-specific PCR (MSR) was used to detect the methylation of CpG islands flanking the translation start site of murine pl6Ink4aCo et al., 1999; Sharpless et al., 2001), revealing a significant increase in methylated CpG sites at the promoter region of pl6Ink4ain middle-aged mouse tissues after TAC-67-001 treatment compared with vehicle controls (FIG. 4H) Further, chronic administration of TAC-67-001 for 6 months reduced senescence cell burden in multiple tissues of naturally aged (26~27-month-old) mice (FIG. 41). Thus, TAC-driven TERT upregulation reduces age-dependent tissue senescence and regulates major genetic drivers of cellular senescence including pl6,nk4aand SASP components.Example 5: Chronic TAC-67-001 Administration Ameliorates Brain Aging

[0171] Genetic re-activation of TERT can restore the neurogenic and cognitive capacities in rodent models of premature aging and Alzheimer’s Disease and can increase levels of mature brain-derived neurotrophic factor (BDNF), a key molecule promoting the growth, survival and differentiation of newborn neurons in the normal mouse brain (Jaskelioff et al., 2011; Shim et al., 2021). Consistent with these reports, immunoblotting and mature BDNF (mBDNF)-specific enzyme-linked immunosorbent assay (ELISA) demonstrated a marked increase in the levels of mature BDNF in adult hippocampus following one-week administration of TAC-67-001 (FIGs. 7A-7B). To further determine whether TAC-67-001 treatment affects the regenerative capacity of the aging brain, middle- aged (12-14-month-old) C57BL / 6 mice were treated daily for 4 weeks with TAC-67-001 or vehicle. Notably, TAC-67-001 treatment increased the number of doublecortin (DCX)- expressing newborn neurons in the hippocampal dentate gyrus (DG) (FIGs. 7C-7D).Further confirmation of TAC-induced adult neurogenesis was obtained with the immature neuron marker PSA-NCAM, revealing a higher number of DCX+PSA-NCAM+immature neurons in TAC -treated mice relative to controls (FIG. 7E and FIG. 8A). No change in body weight was detected between the two groups throughout the study (FIG. 8B). Thus, pharmacological activation of TERT induces mature BDNF production and stimulates adult hippocampal neurogenesis in adult mice.

[0172] Chronic neuroinflammation is a pervasive feature of the aging brain and is thought to contribute to diminished brain function. Microglia, the resident immune cells of the brain, are the primary players in neuroinflammation and microglial activation is considered a hallmark of neuroinflammation seen in most brain aging and neurodegenerative conditions (Leng and Edison, 2021; von Bemhardi et al., 2015). In line with our recent work showing that genetic TERT induction results in a marked reduction of brain inflammation (Shim et al., 2021), TAC-67-001 administration significantly attenuated the levels of IB Al -positive activated microglia in the brains of aging mouse relative to vehicle-treated controls (FIG. 7F). TAC -treated animals displayed a prominent reduction in the cell density and soma size of IB Al -positive microglia in the hippocampus.Consistent with a crucial role for activated microglia as the primary source of pro- inflammatory cytokines in the brain (Lynch, 2009), the age-related increases in expression of pro-inflammatory cytokines including II- 1 f , 11-6, and Tnf-a were also attenuated in TAC- treated hippocampus relative to vehicle-treated controls (FIG. 7G).

[0173] The observation that TAC -induced neurogenesis and reduced neuroinflammation prompted us to assess the role of TAC-67-001 in modulating memory in aged mice approaching end of life. Naturally aged (20-21 -month-old) C57BL / 6 mice were randomized into TAC-67-001 and vehicle treatment groups. Following a six-month treatment course, 26~27-month-old (aged) mice treated with TAC-67-001 showed improved performance on two hippocampal-dependent cognitive tests - Barnes maze and novel-location recognition tasks (FIGs. 7H-7I). Thus, TAC -induced TERT activation increases mature BDNF levels, spurs neurogenesis and enhances hippocampal -dependent cognitive function in aged mice.Example 6: TAC-67-001 Regulatory Structure and TAC-64-001

[0174] TERT levels are tightly regulated in normal adult somatic cells, and have been found to be further repressed in advanced age and in the setting of diseases such as Alzheimer’s disease (Shim et al., 2021). TAC-67-001 can de-repress the epigenetically silenced TERT gene in adult somatic cells. Among the aging hallmarks, TAC-67-001 treatment significantly decreased the presence of senescent cells in diverse tissues along with DMNT3B-mediated repression of the master cellular mortality gene pl6Ink4a, in a TERT-dependent manner. Notably, long-term administration of brain-penetrant TAC-67- 001 in aged mice reduced neuroinflammation and inflammatory cytokines, enhanced bioactive BDNF production and adult neurogenesis and preserved cognitive functionwithout overt side effects. Thus, physiological TERT activation can assuage aging phenotypes during natural aging (FIG. 9).

[0175] TAC-67-001 is a member of the benzenesulfonamide class of small molecules.To test for the ZEAT-activation capacity of other benzenesulfonamides, several further compounds having similar chemical structures were tested using the methods first described in Example 1 and FIG. ID. Briefly, human fibroblast cells MRC-5 were treated with either DMSO as a vehicle control or any one of compounds 64-69 (FIG. 10) and after 4 hours hTERT mRNA levels were quantified and normalized to the vehicle control baseline. FIG. 10 shows that compound 67, which is TAC-67-001, was effective at increasing expression of TERT. Surprisingly, multiple benzenesulfonamides, compounds 65, 66, 68, and 69, were not effective at increasing TERT expression. However, a single additional compound, compound 64 hereinafter referred to as TAC-64-001, was identified as effective at increasing TERT expression to comparable levels as was observed after TAC-67-001 treatment. Therefore TAC-64-001 is anticipated to possess similar biological functions to TAC-67-001, and is also useful for the treatment of aging, aging-related diseases, and neurodegenerative conditions.

[0176] Accordingly, the compositions and methods disclosed herein are useful for treating aging, aging-related diseases, and neurodegenerative conditions in a subject in need thereof.Example 7: TAC-67-001 administration protects against neuroinflammation and Alzheimer’s Disease (AD} pathology

[0177] A modest increase in TERT levels can alter the gene expression signatures involved in brain health and AD pathogenesis in in vivo animal models (Shim et al., 2021). To examine whether TAC-67-001 is able to mimic the biochemical and physiological effects of TERT induction, a well-established AD model, 3xTg-AD, was treated with TAC- 67-001. 3xTg-AD mice develop overt extracellular amyloid deposits starting at 9-12 months of age (Oddo et al., 2003). Accordingly, TAC-67-001 treatment (6 mg / kg / day) and vehicle control treatment (DMSO) began at 5~6 months of age, prior to plaque formation, and continued for 3 months at 3 times per week. Notably, immunohistochemical analyses revealed that TAC-67-001 treatment effectively reduced the levels of classical markers of neuroinflammation, including the number of microglia cells as well as microglial soma sizein the hippocampal region, which is especially susceptible to AD, relative to vehicle-treated control groups (FIGs. 11A and 11B).

[0178] The effects of prolonged TAC-67-001 administration on protection against amyloid pathogenesis were next examined. Emerging evidence suggests that chronic neuroinflammation is a major contributor in Alzheimer’s neuropathology (Singhal et al., 2014). Notably, longer-term administration of TAC-67-001 for six months (6 mg / kg / day, 3 days per week) markedly reduced both intracellular and extracellular amyloid pathology in both cortical and hippocampal regions of 3xTg-AD mouse brains relative to the ones of control groups (FIGs. 11C and 11D). These findings demonstrate that TAC-driven somatic TERT activation reduces AD pathology, by targeting multiple disease mechanisms including reducing AD-associated neuroinflammation.

[0179] Transgenic expression of TERT in mature neurons of AD mouse brains enhances synaptic pathways and cognitive function (Shim et al., 2021). To assess the ultrastructural consequences of pharmacological TERT activation via TAC-67-001 on the presynaptic terminal, the morphological characteristics of synapses in the hippocampus from vehicle and TAC -treated 3xTg-AD mice were analyzed using transmission electron microscopy. Strikingly, ultrastructural and quantitative analyses revealed that prolonged TAC-67-001 administration for 6 months dramatically enhanced the synaptic vesicle pools in the mouse hippocampus relative to the controls (FIGs. HE and HF), which supports the regulation of synaptic strength, plasticity, and leaming / memory. Accordingly, these results demonstrate that TAC-67-001 administration ameliorates multiple aspects of Alzheimer’s disease pathology by reducing amyloid accumulation, reducing brain inflammation, and improving synaptic function in AD mouse models.Example 8: In vivo pharmacokinetic profile of TAC-67-001 following oral administration

[0180] The pharmacokinetic profile of TAC-67-001 administered intraperitoneally is disclosed in FIGs. 5A-5C. Next, the oral bioavailability potential, including intestinal permeability, half-life and brain penetration, of TAC-67-001 in vivo was determined. The pharmacokinetic parameters following oral dose of TAC-67-001 are listed in FIG. 12A. The pharmacokinetic analysis showed that TAC-67-001 was rapidly absorbed from the gastrointestinal track, with the TAC-67-001 observed in the small intestine and plasma observed 15 min after dosing with a concentration peak at 30 min in plasma (FIGs. 12B- 12D). The half-life for TAC-67-001 was found to be 2.28 h (FIG. 12A). Notably, TAC-67-001 was able to cross the blood-brain barrier (BBB) and quickly penetrate into the mouse brain in vivo after a single dose (FIGs. 12E and 12F). The brain to plasma ratio was greater than 1 for TAC-67-001 (FIGs. 12A and 12F), indicating that TAC-67-001 can easily enter the CNS and exert pharmacologic action therein.Example 9: TAC-67-001 protects against chemotherapy-induced peripheral neuropathy (CIPN} and the neuroinflammatory response and alleviates chemotherapy-induced nephrotoxicity

[0181] Chemotherapy-induced peripheral neuropathy (CIPN) and cognitive impairments are common negative side effects of cancer treatment that are frequently reported by patients treated for malignant tumors (Nurgali et al., 2018). Thus, identification of novel agents and interventions to mitigate chemotherapy-induced adverse effects may benefit patients undergoing chemotherapy. The loss of intra-epidermal nerve fibers (IENF) has been reported in animal models of chemotherapy-induced neuropathy with widely used platinum-based agents, such as cisplatin (Mao- Ying et al., 2014; Zhou et al., 2016). To determine the role of TAC-67-001 on cisplatin-induced IENF loss, mice were pre-treated with TAC-67-001 (6 mg / kg) or vehicle daily for 5 days, followed by co-treatment with TAC-67-001 (6 mg / kg) and cisplatin (2.3 mg / kg) or vehicle and cisplatin (2.3 mg / kg) for the next 5 days, for two cycles with a total cumulative dose of 23 mg / kg cisplatin over 10 days (Mao- Ying et al., 2014; Ta et al., 2010). The effect of cisplatin with or without TAC- 67-001 on the lENFs was determined using the pan-neuronal marker PGP9.5. As reported previously, administration of cisplatin markedly decreased IENF density (FIGs. 13A and 13B). Notably, TAC-67-001 co-administration significantly protected against cisplatin- induced IENF loss (FIGs. 13A and 13B).

[0182] In addition to neuronal injury, cancer patients treated with cisplatin often develop nephrotoxicity, such as acute kidney injury (AKI) (Li et al., 2016). To examine the role of TAC-67-001 on cisplatin-induced AKI, histopathological examination was performed using kidney samples of mice co-treated with cisplatin and vehicle or cisplatin and TAC-67-001. H&E staining showed that the kidneys from mice receiving cisplatin alone had tubular damage and interstitial bleeding (FIG. 13C). Moreover, cisplatin administration resulted in the upregulation of a number of proinflammatory cytokines (TNF-a and IL-la) and chemokines (Cxcll) in the kidney (FIG. 13D). Remarkably, TAC- 67-001 co-treatment significantly attenuated the cisplatin-induced AKI phenotype (FIGs. 13C and 13D), indicating that TAC-67-001 can protect the kidney from cisplatin-inducednephrotoxicity. Similarly, TAC-67-001 co-treatment significantly attenuated the upregulation of cisplatin -induced matrix metalloproteinase-3 (MMP-3) (data not shown).

[0183] Chemotherapy has also been reported to induce chemotherapy-related cognitive impairment (CRCI) or chemo-brain through a variety of mechanisms including DNA damage, oxidative stress, and inflammation (Nguyen and Ehrlich, 2020). The inventors examined the ability of TAC-67-001 to protect against cisplatin-induced damage to the brains. Brain histology in mice that were treated with cisplatin with or without TAC-67-001 revealed that co-administration of TAC-67-001 prevents cisplatin-induced neuroinflammation (number of IBA1+ microglia and their activated morphology) (FIG. 13E). Taken together, these results indicate that TAC-67-001 can protect against cisplatin- induced adverse effects in peripheral and central nervous system, as well as preserve kidney function.Example 10: TAC-67-001 protects against age-related sarcopenia

[0184] Sarcopenia is a musculoskeletal disease in which muscle mass, strength, and performance are significantly compromised with age. Sarcopenia affects 10-30% of elderly patients. It can manifest as muscle weakness with reduced grip strength and lower body strength, difficulty performing activities of daily living, and decreased physical performance including slower gait speed, reduced endurance, and exercise capacity.

[0185] Sarcopenia presents as muscle fiber atrophy with loss of type II (fast-twitch- muscle fibers, decreased muscle mass and strength, mitochondrial dysfunction with decreased ATP and increased oxidative stress contributing to muscle degradation, chronic inflammation with increased levels of pro-inflammatory cytokines (e.g., IL-6, TNF-a) which accelerates muscle protein breakdown, decreased anabolic hormones (e.g., testosterone, growth hormone), and / or reduced sensitivity to insulin leading to impaired protein synthesis.

[0186] TAC-67-001 may be used to protect against age-related sarcopenia by activating myogenic factors. In vivo investigation of mRNA expression after treatment with TAC-67- 001 of indicated that TAC-67-001 treatment turned on transcriptional factors and master regulators of skeletal muscle functions (data not shown). Specifically, the results indicated that TAC-67-001 induced Pax3, an early myogenic transcription factor and the master regulators of skeletal muscle proliferation and differentiation Myf5, MyoD, and MyoG.

[0187] In vivo investigation of very old mice (aged 28 months) treated with TAC-67- 001 as compared to mice treated with DMSO alone indicated that TAC-67-001 improved neuromuscular function. Specifically rotarod testing of motor coordination and balance and grip strength testing of muscle strength indicated that TAC-67-001 treatment increased motor coordination, balance, and grip strength in very old mice (data not shown).EQUIVALENTS

[0189] The present technology is not to be limited in terms of the particular embodiments described in this application, which are intended as single illustrations of individual aspects of the present technology. Many modifications and variations of this present technology can be made without departing from its spirit and scope, as will be apparent to those skilled in the art. Functionally equivalent methods and apparatuses within the scope of the present technology, in addition to those enumerated herein, will be apparent to those skilled in the art from the foregoing descriptions. Such modifications and variations are intended to fall within the scope of the present technology. It is to be understood that this present technology is not limited to particular methods, reagents, compounds compositions or biological systems, which can, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.

[0190] In addition, where features or aspects of the disclosure are described in terms of Markush groups, those skilled in the art will recognize that the disclosure is also thereby described in terms of any individual member or subgroup of members of the Markush group.

[0191] As will be understood by one skilled in the art, for any and all purposes, particularly in terms of providing a written description, all ranges disclosed herein also encompass any and all possible subranges and combinations of subranges thereof. Any listed range can be easily recognized as sufficiently describing and enabling the same range being broken down into at least equal halves, thirds, quarters, fifths, tenths, etc. As a nonlimiting example, each range discussed herein can be readily broken down into a lower third, middle third and upper third, etc. As will also be understood by one skilled in the art all language such as “up to,” “at least,” “greater than,” “less than,” and the like, include the number recited and refer to ranges which can be subsequently broken down into subranges as discussed above. Finally, as will be understood by one skilled in the art, a range includes each individual member. Thus, for example, a group having 1-3 cells refers to groups having 1, 2, or 3 cells. Similarly, a group having 1-5 cells refers to groups having 1, 2, 3, 4, or 5 cells, and so forth.

[0192] All patents, patent applications, provisional applications, and publications referred to or cited herein are incorporated by reference in their entirety, including allfigures and tables, to the extent they are not inconsistent with the explicit teachings of this specification.REFERENCESAikawa, Y., Morimoto, K., Yamamoto, T., Chaki, H., Hashiramoto, A., Narita, H., Hirono, S., and Shiozawa, S. (2008). Treatment of arthritis with a selective inhibitor of c-Fos / activator protein- 1. Nat Biotechnol 26, 817-823.Anders, S., Pyl, P.T., and Huber, W. (2015). HTSeq— a Python framework to work with high- throughput sequencing data. Bioinformatics 31, 166-169.Angel, P., and Karin, M. (1991). The role of Jun, Fos and the AP-1 complex in cell-proliferation and transformation. Biochim Biophys Acta 1072, 129-157.Armanios, M.Y., Chen, J.J., Cogan, J.D., Alder, J.K., Ingersoll, R.G., Markin, C., Lawson, W.E., Xie, M., Vulto, I., Phillips, J.A., 3rd, et al. (2007). Telomerase mutations in families with idiopathic pulmonary fibrosis. N Engl J Med 356, 1317-1326.Artandi, S.E., Chang, S., Lee, S.L., Alson, S., Gottlieb, G.J., Chin, L., and DePinho, R.A. (2000). Telomere dysfunction promotes non-reciprocal translocations and epithelial cancers in mice. Nature 406, 641-645.Ayaz, M., Sadiq, A., Junaid, M., Ullah, F., Ovais, M., Ullah, I., Ahmed, J., and Shahid, M. (2019). Flavonoids as Prospective Neuroprotectants and Their Therapeutic Propensity in Aging Associated Neurological Disorders. Front Aging Neurosci 11, 155.Benayoun, B.A., Pollina, E.A., and Brunet, A. (2015). Epigenetic regulation of ageing: linking environmental inputs to genomic stability. Nat Rev Mol Cell Biol 16, 593-610.Bemardes de Jesus, B., Schneeberger, K., Vera, E., Tejera, A., Harley, C.B., and Blasco, M.A. (2011). The telomerase activator TA-65 elongates short telomeres and increases health span of adult / old mice without increasing cancer incidence. Aging Cell 10, 604-621.Bemardes de Jesus, B., Vera, E., Schneeberger, K., Tejera, A.M., Ayuso, E., Bosch, F., and Blasco, M.A. (2012). Telomerase gene therapy in adult and old mice delays aging and increases longevity without increasing cancer. Embo Mol Med 4, 691-704.Bharate, S.S., Mignani, S., and Vishwakarma, R.A. (2018). Why Are the Majority of Active Compounds in the CNS Domain Natural Products? A Critical Analysis. J Med Chem 61, 10345-10374Bodnar, A.G., Ouellette, M., Frolkis, M., Holt, S.E., Chiu, C.P., Morin, G.B., Harley, C.B., Shay, J.W., Lichtsteiner, S., and Wright, W.E. (1998). Extension of life-span by introduction of telomerase into normal human cells. Science 279, 349-352.Booth, L.N., and Brunet, A. (2016). The Aging Epigenome. Mol Cell 62, 728-744.Brauning, A., Rae, M., Zhu, G., Fulton, E., Admasu, T.D., Stolzing, A., and Sharma, A. (2022). Aging of the Immune System: Focus on Natural Killer Cells Phenotype and Functions. Cells 11.Brennand, K.J., Simone, A., Jou, J., Gelboin-Burkhart, C., Tran, N., Sangar, S., Li, Y., Mu, Y., Chen, G., Yu, D., etal. (2011). Modelling schizophrenia using human induced pluripotent stem cells. Nature 473, 221-225.Carmona, J.J., and Michan, S. (2016). Biology of Healthy Aging and Longevity. Rev Invest Clin 68, 7-16.Cawthon, R.M. (2002). Telomere measurement by quantitative PCR. Nucleic Acids Res 30, e47.Cawthon, R.M. (2009). Telomere length measurement by a novel monochrome multiplex quantitative PCR method. Nucleic Acids Res 37, e21.Chakravarti, D., Hu, B., Mao, X., Rashid, A., Li, J., Li, J., Liao, W.T., Whitley, E.M., Dey, P., Hou, P., etal. (2020). Telomere dysfunction activates YAP 1 to drive tissue inflammation. Nat Commun 77, 4766.Chakravarti, D., LaBella, K.A., and DePinho, R.A. (2021a). Telomeres: history, health, and hallmarks of aging. Cell 184, 306-322.Chakravarti, D., Lee, R., Multani, A.S., Santoni, A., Keith, Z., Hsu, W.H., Chang, K., Reyes, L., Rashid, A., Wu, C.J., et al. (2021b). Telomere dysfunction instigates inflammation in inflammatory bowel disease. Proc Natl Acad Sci U S A 118.Chappell, W.H., Steelman, L.S., Long, J.M., Kempf, R.C., Abrams, S.L., Franklin, R.A., Basecke, J., Stivala, F„ Donia, M„ Fagone, P„ et al. (2011). Ras / Raf / MEK / ERK and PI3K / PTEN / Akt / mTOR inhibitors: rationale and importance to inhibiting these pathways in human health. Oncotarget 2. 135- 164.Deschenes-Simard, X., Kottakis, F., Meloche, S., and Ferbeyre, G. (2014). ERKs in cancer: friends or foes? Cancer Res 74, 412-419.Eitan, E., Tichon, A., Gazit, A., Gitler, D., Slavin, S., and Priel, E. (2012). Novel telomeraseincreasing compound in mouse brain delays the onset of amyotrophic lateral sclerosis. Embo Mol Med 4, 313-329.Frenk, S., and Houseley, J. (2018). Gene expression hallmarks of cellular ageing. Biogerontology 79, 547-566.Graber, T.G., Kim, J.H., Grange, R.W., McLoon, L.K., and Thompson, L.V. (2015). C57BL / 6 life span study: age-related declines in muscle power production and contractile velocity. Age (Dordr) 37, 9773.Herbert, B.S., Hochreiter, A.E., Wright, W.E., and Shay, J.W. (2006). Nonradioactive detection of telomerase activity using the telomeric repeat amplification protocol. Nat Protoc 7, 1583-1590.Hu, B.Y., and Zhang, S.C. (2009). Differentiation of spinal motor neurons from pluripotent human stem cells. Nat Protoc 4, 1295-1304. laccarino, H.F., Singer, A.C., Martorell, A. J., Rudenko, A., Gao, F., Gillingham, T.Z., Mathys, H., Seo, J., Kritskiy, O., Abdurrob, F., et al. (2016). Gamma frequency entrainment attenuates amyloid load and modifies microglia. Nature 540, 230-235.Jalencas, X., and Mestres, J. (2013). On the origins of drug polypharmacology. Medchemcomm 4, 80- 87.Jaskelioff, M., Muller, F.L., Paik, J.H., Thomas, E., Jiang, S., Adams, A.C., Sahin, E., Kost-Alimova, M., Protopopov, A., Cadinanos, J., etal. (2011). Telomerase reactivation reverses tissue degeneration in aged telomerase-deficient mice. Nature 469, 102-106.Jia, W., Wang, S., Homer, J.W., Wang, N., Wang, H., Gunther, E.J., DePinho, R.A., and Zhu, J. (2011). A BAC transgenic reporter recapitulates in vivo regulation of human telomerase reverse transcriptase in development and tumorigenesis. FASEB J 25, 979-989.Khan, M., and Gasser, S. (2016). Generating Primary Fibroblast Cultures from Mouse Ear and Tail Tissues. J Vis Exp.Langmead, B., Trapnell, C., Pop, M., and Salzberg, S.L. (2009). Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol 10, R25.Leng, F., and Edison, P. (2021). Neuroinflammation and microglial activation in Alzheimer disease: where do we go from here? Nat Rev Neurol 17, 157-172.Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G., Abecasis, G., Durbin, R., and Genome Project Data Processing, S. (2009). The Sequence Alignment / Map format and SAMtools. Bioinformatics 25, 2078-2079.Lo, Y.M., Wong, I.H., Zhang, J., Tein, M.S., Ng, M.H., and Hjelm, N.M. (1999). Quantitative analysis of aberrant pl6 methylation using real-time quantitative methylation-specific polymerase chain reaction. Cancer Res 59, 3899-3903.Lopez-Otin, C., Blasco, M.A., Partridge, L., Serrano, M., and Kroemer, G. (2013). The hallmarks of aging. Cell 153, 1194-1217.Love, M.I., Huber, W., and Anders, S. (2014). Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 75, 550.Lynch, M.A. (2009). The multifaceted profile of activated microglia. Mol Neurobiol 40, 139-156.Moore, C.B., and Allen, EC. (2013). Primary ear fibroblast derivation from mice. Methods Mol Biol 1031, 65-70.Mootha, V.K., Lindgren, C.M., Eriksson, K.F., Subramanian, A., Sihag, S., Lehar, J., Puigserver, P., Carlsson, E., Ridderstrale, M., Laurila, E., et al. (2003). PGC-1 alpha-responsive genes involved in oxidative phosphorylation are coordinately downregulated in human diabetes. Nat Genet 34, 267-273.Olivera, P., Danese, S., and Peyrin-Biroulet, L. (2017). Next generation of small molecules in inflammatory bowel disease. Gut 66, 199-209.Park, J.I., Venteicher, A.S., Hong, J.Y., Choi, J., Jun, S., Shkreli, M., Chang, W., Meng, Z., Cheung, P., Ji, H., et al. (2009). Telomerase modulates Wnt signalling by association with target gene chromatin. Nature 460, 66-72.Perez-Jeldres, T., Tyler, C.J., Boyer, J.D., Karuppuchamy, T., Yarur, A., Giles, D.A., Yeasmin, S., Lundborg, L., Sandborn, W.J., Patel, D.R., et al. (2019). Targeting Cytokine Signaling and Lymphocyte Traffic via Small Molecules in Inflammatory Bowel Disease: JAK Inhibitors and SI PR Agonists. Front Pharmacol 10, 212.Raja, W.K., Mungenast, A.E., Lin, Y.T., Ko, T., Abdurrob, F., Seo, J., and Tsai, L.H. (2016). SelfOrganizing 3D Human Neural Tissue Derived from Induced Pluripotent Stem Cells Recapitulate Alzheimer's Disease Phenotypes. PLoS One 77, e0161969.Rhee, L, Bachman, K.E., Park, B.H., Jair, K.W., Yen, R.W., Schuebel, K.E., Cui, H., Feinberg, A.P., Lengauer, C., Kinzler, K.W., etal. (2002). DNMT1 and DNMT3b cooperate to silence genes in human cancer cells. Nature 416, 552-556.Sahin, E., Colla, S., Liesa, M., Moslehi, J., Muller, F.L., Guo, M., Cooper, M., Kotton, D., Fabian, A.J., Walkey, C., et al. (2011). Telomere dysfunction induces metabolic and mitochondrial compromise. Nature 470, 359-365.Sahin, E., and DePinho, R.A. (2010). Linking functional decline of telomeres, mitochondria and stem cells during ageing. Nature 464, 520-528.Sauer, J., Jang, H., Zimmerly, E.M., Kim, K.C., Liu, Z., Chanson, A., Smith, D.E., Mason, J.B., Friso, S., and Choi, S.W. (2010). Ageing, chronic alcohol consumption and folate are determinants of genomic DNA methylation, pl6 promoter methylation and the expression of p 16 in the mouse colon. Br J Nutr JtM, 24-30.Sharpless, N.E., Bardeesy, N., Lee, K.H., Carrasco, D., Castrillon, D.H., Aguirre, A.J., Wu, E.A., Homer, J.W., and DePinho, R.A. (2001). Loss ofpl6Ink4awith retention of pl9Arf predisposes mice to tumorigenesis. Nature 413, 86-91.Sharpless, N.E., and DePinho, R.A. (2007). How stem cells age and why this makes us grow old. Nat Rev Mol Cell Biol 8, 703-713.Sherr, C.J., and DePinho, R.A. (2000). Cellular senescence: mitotic clock or culture shock? Cell 102, 407-410.Shim, H.S., Homer, J.W., Wu, C.J., Li, J., Lan, Z.D., Jiang, S„ Xu, X., Hsu, W.H., Zal, T„ Flores, II, et al. (2021). Telomerase Reverse Transcriptase Preserves Neuron Survival and Cognition in Alzheimer's Disease Models. Nat Aging 1, 1162-1174.Shim, H.S., Wei, M., Brandhorst, S., and Longo, V.D. (2015). Starvation Promotes REV1 SUMOylation and p53-Dependent Sensitization of Melanoma and Breast Cancer Cells. Cancer Res 75, 1056-1067.Steelman, L.S., Chappell, W.H., Abrams, S.L., Kempf, R.C., Long, J., Laidler, P., Mijatovic, S., Maksimovic-Ivanic, D., Stivala, F., Mazzarino, M.C., et al. (2011). Roles of the Raf / MEK / ERK and PI3K / PTEN / Akt / mTOR pathways in controlling growth and sensitivity to therapy-implications for cancer and aging. Aging (Albany NY) 3, 192-222.Subramanian, A., Tamayo, P., Mootha, V.K., Mukheijee, S., Ebert, B.L., Gillette, M.A., Paulovich, A., Pomeroy, S.L., Golub, T.R., Lander, E.S., et al. (2005). Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A 102, 15545-15550.Terranova, C., Tang, M., Orouji, E., Maitituoheti, M., Raman, A., Amin, S., Liu, Z., and Rai, K. (2018). An Integrated Platform for Genome-wide Mapping of Chromatin States Using High-throughput ChlP- sequencing in Tumor Tissues. J Vis Exp.Tomas-Loba, A., Flores, I., Fernandez-Marcos, P.J., Cayuela, M.L., Maraver, A., Tejera, A., Borras, C., Mathen, A., Klatt, P., Flores, J.M., et al. (2008). Telomerase reverse transcriptase delays aging in cancer-resistant mice. Cell 135, 609-622.Venigalla, M., Gyengesi, E., and Munch, G. (2015). Curcumin and Apigenin - novel and promising therapeutics against chronic neuroinflammation in Alzheimer's disease. Neural Regen Res 10, 1181- 1185. von Bemhardi, R., Eugenin-von Bemhardi, L., and Eugenin, J. (2015). Microglial cell dysregulation in brain aging and neurodegeneration. Front Aging Neurosci 7, 124.Vulliamy, T., Marrone, A., Goldman, F., Dearlove, A., Bessler, M., Mason, P.J., and Dokal, I. (2001). The RNA component of telomerase is mutated in autosomal dominant dyskeratosis congenita. Nature 413, 432-435.Wyllie, F.S., Jones, C.J., Skinner, J.W., Haughton, M.F., Wallis, C., Wynford-Thomas, D., Faragher, R.G., and Kipling, D. (2000). Telomerase prevents the accelerated cell ageing of Werner syndrome fibroblasts. Nat Genet 24. 16-17.Yamaguchi, H., Calado, R.T., Ly, H., Kajigaya, S., Baerlocher, G.M., Chanock, S.J., Lansdorp, P.M., and Young, N.S. (2005). Mutations in TERT, the gene for telomerase reverse transcriptase, in aplastic anemia. N Engl J Med 352, 1413-1424.Yanai, S., and Endo, S. (2021). Functional Aging in Male C57BL / 6J Mice Across the Life-Span: A Systematic Behavioral Analysis of Motor, Emotional, and Memory Function to Define an Aging Phenotype. Front Aging Neurosci 13, 697621.Yousefzadeh, M.J., Zhao, J., Bukata, C., Wade, E.A., McGowan, S.J., Angelini, L.A., Bank, M.P., Gurkar, A.U., McGuckian, C.A., Calubag, M.F., et al. (2020). Tissue specificity of senescent cell accumulation during physiologic and accelerated aging of mice. Aging Cell 19, el 3094.Yuan, J., Chang, S.Y., Yin, S.G., Liu, Z.Y., Cheng, X., Liu, X.J., Jiang, Q., Gao, G., Lin, D.Y., Kang, X.L., etal. (2020). Two conserved epigenetic regulators prevent healthy ageing. Nature 579, 118-122.Zaqout, S., Becker, L.L., and Kaindl, A.M. (2020). Immunofluorescence Staining of Paraffin Sections Step by Step. Front Neuroanat 14, 582218.Zhang, L., Fang, Y ., Xu, Y ., Lian, Y ., Xie, N., Wu, T., Zhang, H., Sun, L., Zhang, R., and Wang, Z. (2015). Curcumin Improves Amyloid beta-Peptide (1-42) Induced Spatial Memory Deficits through BDNF-ERK Signaling Pathway. PLoS One 10, e0131525.Zhang, Y ., Liu, T., Meyer, C.A., Eeckhoute, J., Johnson, D.S., Bernstein, B.E., Nusbaum, C., Myers, R.M., Brown, M., Li, W., et al. (2008). Model-based analysis of ChlP-Seq (MACS). Genome Biol 9, R137.Li, J., Gui, Y., Ren, J., Liu, X., Feng, Y., Zeng, Z., He, W., Yang, J., and Dai, C. (2016). MetforminProtects Against Cisplatin-Induced Tubular Cell Apoptosis and Acute Kidney Injury viaAMPKalpha-regulated Autophagy Induction. Sci Rep 6, 23975.Mao-Ying, Q.L., Kavelaars, A., Krukowski, K., Huo, X.J., Zhou, W., Price, T.J., Cleeland, C., andHeijnen, C.J. (2014). The anti-diabetic drug metformin protects against chemotherapy-induced peripheral neuropathy in a mouse model. PLoS One 9, el00701.Nguyen, L.D., and Ehrlich, B.E. (2020). Cellular mechanisms and treatments for chemobrain: insight from aging and neurodegenerative diseases. Embo Mol Med 12, e 12075.Nurgali, K., Jagoe, R.T., and Abalo, R. (2018). Editorial: Adverse Effects of Cancer Chemotherapy:Anything New to Improve Tolerance and Reduce Sequelae? Front Pharmacol 9, 245.Oddo, S., Caccamo, A., Shepherd, J.D., Murphy, M.P., Golde, T.E., Kayed, R., Metherate, R., Matson, M.P., Akbari, Y., and LaFerla, F.M. (2003). Triple-transgenic model of Alzheimer's disease with plaques and tangles: intracellular Abeta and synaptic dysfunction. Neuron 39, 409-421.Shim, H.S., Homer, J.W., Wu, C.J., Li, J., Lan, Z.D., Jiang, S„ Xu, X., Hsu, W.H., Zal, T„ Flores, II, et al. (2021). Telomerase Reverse Transcriptase Preserves Neuron Survival and Cognition in Alzheimer's Disease Models. Nat Aging 1, 1162-1174.Singhal, G., Jaehne, E.J., Corrigan, F., Toben, C., and Baune, B.T. (2014). Inflammasomes in neuroinflammation and changes in brain function: a focused review. Front Neurosci 8, 315.Ta, L.E., Bieber, A.J., Carlton, S.M., Loprinzi, C.L., Low, P.A., and Windebank, A. J. (2010). Transient Receptor Potential Vanilloid 1 is essential for cisplatin-induced heat hyperalgesia in mice. Mol Pain 6, 15.Zhou, W., Kavelaars, A., and Heijnen, C.J. (2016). Metformin Prevents Cisplatin-Induced Cognitive Impairment and Brain Damage in Mice. PLoS One 11, e0151890.

Claims

CLAIMS1. A composition comprising one or more compounds selected from the group consisting of: a A-(3-chloro-4-fluorophenyl)-4-fluoro-3,5-dimethylbenzenesulfonamide compound represented by formula (I):a A-(3,5-dichlorophenyl)-2,3,4,5,6-pentamethylbenzenesulfonamide compound represented by formula (II):or a combination thereof.

2. The composition of claim 1, wherein the one or more compounds are in the form of a pharmaceutically acceptable salt.

3. A pharmaceutical composition comprising the composition of claims 1 or 2 and a pharmaceutically acceptable carrier.

4. The pharmaceutical composition of claim 3, wherein the pharmaceutically acceptable carrier comprises phosphate buffered saline, preservatives, or combinations thereof.

5. The pharmaceutical composition of any one of claims 3-4, further comprising one or more additional agents.

6. The pharmaceutical composition of claim 5, wherein the one or more additional agents is selected from the group consisting of aducanumab, solanezumab, CSP-1103,Mannitol, Osmitrol, Resectisol, Phenytoin, Dilantin, Phenytek, valproic acid, Depakote, Gabapentin, Neurontin, Topiramate, Topamax, Carbamazepine, Equetro, anti-platelet medications, aspirin, Clopidogrel, Ticagrelor, warfarin, prasugral, beta blockers, Angiotensin-converting enzyme (ACE) inhibitors, benazepril, Lisinopril, Ramipril, calcium channel blockers, diuretics, aspirin, Levodopa, carbidopa, tetrabenazine, deuterabenazine, zonisamid, Zonegran, levetiracetam, Keppra, clonazepam, Klonopin, rufinamide, Banzel, lamotrigine, Lamictal, pregabalin, Lyrica, lacosamide, Vimpat, vigabatrin, Sabril, oxcarbazepine, Trileptal, phenobarbital, Donepezil, galantamine, memantine, rivastigmine, memantine extended-release and donepezil, Namzaric, verubecestat, AADvacl, intepirdine, or any combination thereof.

7. The pharmaceutical composition of claim 5, wherein the one or more additional agents is selected from the group consisting of Lonafarnib, zokinvy, aspirin, Androgen, G- CSF, GM-CSF, and any combination thereof.

8. The pharmaceutical composition of claim 5, wherein the one or more additional agents is selected from the group consisting of insulin, metformin, amylin analogs, glucagon, sulfonylureas, glimepiride, glipizide, glyburide, chlorpropamide, tolazamide, tolbutamide, meglitinides, nateglinide, mitiglinide, repaglinide, thiazolidinediones, pioglitazone, rosiglitazone, alpha-glucosidase inhibitors, acarbose, miglitol, dipeptidyl peptidase (DPP -4) inhibitors, alogliptin, linagliptin, sitagliptin, saxagliptin, sodium-glucose co-transporter 2 (SGLT2) inhibitors, canagliflozin, dapagliflozin, empagliflozin, ertugliflozin, incretin mimetics, exenatide, liraglutide, dulaglutide, lixisenatide, semaglutide, PPAR-antagonists, interleukin- 10, furosemide, pirfenidone, Esbriet, nintedanib, Ofev, statins, Atorvastatin, Fluvastatin, Lovastatin, Pitavastatin, Pravastatin Rosuvastatin calcium, Simvastatin, fibrates, Gemfibrozil, Fenofibrate, niacin, ezetimibe, bile acid sequestrants, cholestyramine, colestipol, colesevelam, proprotein convertase subtilisin kexin type 9 (PCSK9) inhibitors, endothelin inhibitors, pentoxifylline, phosphate binders, calcium acetate, calcium carbonate, hyaluronic acid, a-Tocopherol, colchicine, TGF-pi inhibitors, erythropoietin, S-adenosyl-methionine, colecalciferol, ergocalciferol, analgesics, acetaminophen, tramadol, oxycodone, hydrocodone, nonsteroidal antiinflammatory drugs, aspirin, ibuprofen, naproxen, celecoxib, cyclooxygenase-2 inhibitors, corticosteroids, interferon-a, phosphatidylcholine, cyclophosphamide, or any combination thereof.

9. The pharmaceutical composition of any one of claims 3-8, wherein the composition is formulated for oral, intranasal, intrathecal, parenteral intravenous, intramuscular, intraperitoneal, subcutaneous, rectal, intrathecal, intraocular, intradermal, transmucosally, iontophoretical, or topical administration.

10. The pharmaceutical composition of claim 9, wherein the composition formulated for oral administration is a capsule, tablet, pill, powder, or granule.

11. The pharmaceutical composition of claim 9, wherein the composition formulated for topical administration is a roll-on, a cream, a lotion, a gel, a powder, a water activated cream, a water activated power, an injectable, a patch, or a spray.

12. A method of treating aging, an aging-related disease, or a neurodegenerative disease in a subject in need thereof, comprising administering to the subject an effective amount of the composition of claim 1 or 2 or the pharmaceutical composition of any one of claims 3- 11.

13. The method of claim 12, wherein the aging-related disease or the neurodegenerative disease is selected from the group consisting of Alzheimer’s disease, epilepsy, Huntington's Disease, Parkinson's Disease, stroke, spinal cord injury, traumatic brain injury, Lewy body dementia, Pick's disease, Niewmann-Pick disease, amyloid angiopathy, cerebral amyloid angiopathy, systemic amyloidosis, hereditary cerebral hemorrhage with amyloidosis of the Dutch type, mild cognitive impairment, chemotherapy induced peripheral neuropathy, Hutchinson-Gilford progeria syndrome (HGPS), Nestor-Guillermo progeria syndrome, Werner syndrome, Cockayne syndrome, Bloom syndrome, xeroderma pigmentosum, ataxia telangiectasia, trichothiodystrophy, dyskeratosis congenital, mosaic variegated aneuploidy syndrome, diabetes, liver fibrosis, liver cirrhosis, lung fibrosis, atherosclerosis, chronic kidney disease, inclusion body myositis, or osteoarthritis, or any combination thereof.

14. The method of claim 13, wherein the aging-related disease or neurodegenerative disease is Alzheimer’s disease.

15. The method of claim 13, wherein the aging-related disease or neurodegenerative disease is chemotherapy induced peripheral neuropathy.

16. The method of any one of claims 12-15, wherein the aging-related disease or the neurodegenerative disease comprises senescent cells, neuroinflammation, neuronal loss, loss of dendritic spines, decreased expression of learning and memory genes, and amyloid plaque formation.

17. The method of any one of claims 12-16, wherein the composition or pharmaceutical composition is administered orally, intranasally, intrathecally, parenterally, intravenously, intramuscularly, intraperitoneally, subcutaneously, rectally, intrathecally, intraocularly, intradermally, transmucosally, iontophoretically, or topically.

18. The method of any one of claims 12-17, wherein the composition or pharmaceutical composition is administered sequentially, simultaneously, or separately with one or more additional agents.

19. The method of claim 18, wherein the one or more additional agents is selected from the group consisting of aducanumab, solanezumab, CSP-1103, Mannitol, Osmitrol, Resectisol, Phenytoin, Dilantin, Phenytek, valproic acid, Depakote, Gabapentin, Neurontin, Topiramate, Topamax, Carbamazepine, Equetro, anti-platelet medications, aspirin, Clopidogrel, Ticagrelor, warfarin, prasugral, beta blockers, Angiotensin-converting enzyme (ACE) inhibitors, benazepril, Lisinopril, Ramipril, calcium channel blockers, diuretics, aspirin, Levodopa, carbidopa, tetrabenazine, deuterabenazine, zonisamid, Zonegran, levetiracetam, Keppra, clonazepam, Klonopin, rufmamide, Banzel, lamotrigine, Lamictal, pregabalin, Lyrica, lacosamide, Vimpat, vigabatrin, Sabril, oxcarbazepine, Trileptal, phenobarbital, Donepezil, galantamine, memantine, rivastigmine, memantine extended- release and donepezil, Namzaric, verubecestat, AADvacl, intepirdine, or any combination thereof.

20. The method of claim 18, wherein the one or more additional agents is selected from the group consisting of Lonafarnib, zokinvy, aspirin, Androgen, G-CSF, GM-CSF, and any combination thereof.

21. The method of claim 18, wherein the one or more additional agents is selected from the group consisting of insulin, metformin, amylin analogs, glucagon, sulfonylureas, glimepiride, glipizide, glyburide, chlorpropamide, tolazamide, tolbutamide, meglitinides, nateglinide, mitiglinide, repaglinide, thiazolidinediones, pioglitazone, rosiglitazone, alphaglucosidase inhibitors, acarbose, miglitol, dipeptidyl peptidase (DPP -4) inhibitors, alogliptin, linagliptin, sitagliptin, saxagliptin, sodium-glucose co-transporter 2 (SGLT2) inhibitors, canagliflozin, dapagliflozin, empagliflozin, ertugliflozin, incretin mimetics, exenatide, liraglutide, dulaglutide, lixisenatide, semaglutide, PPAR-antagonists, interleukin- 10, furosemide, pirfenidone, Esbriet, nintedanib, Ofev, statins, Atorvastatin, Fluvastatin, Lovastatin, Pitavastatin, Pravastatin Rosuvastatin calcium, Simvastatin, fibrates, Gemfibrozil, Fenofibrate, niacin, ezetimibe, bile acid sequestrants, cholestyramine,colestipol, colesevelam, proprotein convertase subtilisin kexin type 9 (PCSK9) inhibitors, endothelin inhibitors, pentoxifylline, phosphate binders, calcium acetate, calcium carbonate, hyaluronic acid, a-Tocopherol, colchicine, TGF-pi inhibitors, erythropoietin, S-adenosyl- methionine, colecalciferol, ergocalciferol, analgesics, acetaminophen, tramadol, oxycodone, hydrocodone, nonsteroidal anti-inflammatory drugs, aspirin, ibuprofen, naproxen, celecoxib, cyclooxygenase-2 inhibitors, corticosteroids, interferon-a, phosphatidylcholine, cyclophosphamide, or any combination thereof.

22. The method of any one of claimsl8-21, wherein the one or more additional agents are administered orally, intranasally, intrathecally, parenterally, intravenously, intramuscularly, intraperitoneally, subcutaneously, rectally, intrathecally, intraocularly, intradermally, transmucosally, iontophoretically, or topically.

23. A kit comprising the composition of claim 1 or 2 or the pharmaceutical composition of any one of claims 3-11 and instructions for treating aging, an aging-related disease, or a neurodegenerative disease.

24. The kit of claim 23, wherein the aging-related disease or the neurodegenerative disease is selected from the group consisting of Alzheimer’s disease, epilepsy, Huntington's Disease, Parkinson's Disease, stroke, spinal cord injury, traumatic brain injury, Lewy body dementia, Pick's disease, Niewmann-Pick disease, amyloid angiopathy, cerebral amyloid angiopathy, systemic amyloidosis, hereditary cerebral hemorrhage with amyloidosis of the Dutch type, mild cognitive impairment, chemotherapy induced peripheral neuropathy, Hutchinson-Gilford progeria syndrome (HGPS), Nestor-Guillermo progeria syndrome, Werner syndrome, Cockayne syndrome, Bloom syndrome, xeroderma pigmentosum, ataxia telangiectasia, trichothiodystrophy, dyskeratosis congenital, mosaic variegated aneuploidy syndrome, diabetes, liver fibrosis, liver cirrhosis, lung fibrosis, atherosclerosis, chronic kidney disease, inclusion body myositis, or osteoarthritis, or any combination thereof.

25. A method for identifying a candidate agent for activating human TERT expression comprising(a) contacting a recombinant cell comprising a human TERT reporter transgene with a candidate agent(b) detecting expression levels of the human TERT reporter transgene in the recombinant cell, wherein an increase in the expression levels of the human TERT reporter transgene in the recombinant cell of step (a) compared to that observed in the recombinant call in theabsence of the candidate agent indicates that the candidate agent increases TERT expression.

26. The method of claim 25, wherein the candidate agent that increases TERT expression further increases ERK activity in the recombinant cell of step (a) compared to the ERK activity observed in the recombinant cell in the absence of the candidate agent.

27. The method of claim 25 or claim 26, wherein the human TERT reporter transgene comprises a TERT regulatory sequence or promoter that is operably linked to a reporter gene.

28. The method of claim 27, wherein the reporter gene comprises an open reading frame that encodes a fluorescent protein, a chemiluminescent protein, a bioluminescent protein, or any combination thereof.

29. The method of claim 27, wherein the fluorescent protein is TagBFP, Azurite, EBFP2, mKalamal, Sirius, Sapphire, T-Sapphire, ECFP, Cerulean, SCFP3A, mTurquoise, monomeric Midoriishi-Cyan, TagCFP, mTFPl, EGFP, Emerald, Superfolder GFP, Monomeric Azami Green, TagGFP2, mUKG, mWasabi, EYFP, Citrine, Venus, SYFP2, Tag YFP, Monomeric Kusabira-Orange, ITIKOK, mK02, mOrange, m0range2, mRaspberry, mCherry, dsRed, mStrawberry, mTangerine, tdTomato, TagRFP, TagRFP-T, mApple, mRuby, mPlum, HcRed-Tandem, mKate2, mNeptune, NirFP, TagRFP657, IFP1.4, iRFP, mKeima Red, LSS-mKatel, LSS-mKate2, PA-GFP, PAmCherryl, PATagRFP, Kaede (green), Kaede (red), KikGRl (green), KikGRl (red), PS-CFP2, PS-CFP2, mEos2 (green), mEos2 (red), PSmOrange, or Dronpa.

30. The method of claim 27, wherein the chemiluminescent protein is 3 -galactosidase, horseradish peroxidase (HRP), or alkaline phosphatase.

31. The method of claim 27, wherein the bioluminescent protein is Aequorin, firefly luciferase, Renilla luciferase, red luciferase, luxAB, or nanoluciferase.