Dual stem-loop oligonucleotide and its use in the detection of analytes of interest
Patent Information
- Application Number
- FR2021009667
- Authority / Receiving Office
- FR · FR
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2021-09-15
- Publication Date
- 2026-06-26
- Estimated Expiration
- 2041-09-15
AI Technical Summary
Existing methods for detecting and quantifying analytes in samples, such as ELISA, immuno-PCR, aptamero-PCR, and LAMP with four primers, are inefficient, complex, and costly, especially when analytes are present in low concentrations, and require multiple specific antibodies or probes, making them impractical for diverse analyte detection.
A double stem-loop oligonucleotide structure with a specific entity for analyte recognition at its ends, allowing LAMP amplification with only two primers, providing faster and less complex detection and quantification.
The double stem-loop oligonucleotide enables sensitive and cost-effective detection and quantification of analytes with high specificity, overcoming the limitations of existing methods by reducing primer usage and maintaining isothermal amplification efficiency.
Abstract
Description
Description Title of the invention: Dual-structure stem-loop oligonucleotide and its use in the DETECTION OF ANALYTES OF INTEREST technical field
[0001] = The present invention relates to the field of tools and methods for detecting molecules of interest.
[0002] = More particularly, the present invention proposes a double oligonucleotide a particular stem-loop structure, useful especially for detecting and possibly quantify at least one analyte of interest in a liquid sample using a LAMP (for "Loop-mediated isothermal AMPlification") amplification with two primers. The present invention also relates to such a detection method and of possible quantification. PREVIOUS STATE OF THE ART
[0003] — Numerous works and studies in fields including, in particular, the academic research; clinical and diagnostic research and analysis, with tests performed on blood samples or cell biopsies or tissues islands; environmental monitoring; civil monitoring; ali- security commentary and in particular quality control; criminal analysis of traces... im- complicate the detection of biomarkers, molecules of interest or contaminants in a sample, and especially in a liquid sample.
[0004] — Several techniques have been developed for this purpose.
[0005] — A first immuno-enzymatic detection technique called the ELISA method (for "Enzyme-Linked Immunosorbent Assay") was developed in the early 20th century. 1970s. In this technique, a sandwich between two specific antibodies and the target can be achieved. The first antibody is used to capture the target, by for example, at the bottom of a well, while the second antibody is used for amplification by- zymatic, directly or via a secondary antibody coupled to an enzyme such as the HRP (for "Horse Radish Peroxidase"). The ELISA method uses a antibody and allows quantification of the target using a range of quanti- Fiction carried out beforehand or simultaneously. This method is still currently used and many variants exist. Indeed, an aptamer is a sequence oligonucleotide specifically selected for its interaction with an analyte or any other oligonucleotide sequence having a specific affinity for a The analyte can be used in place of an antibody and applied as a probe in a ELISA method. Aptamers are a good alternative to antibodies in the to the extent that they can detect small molecules and are very specific to a target, much easier to produce and handle, more stable and less expensive. However, when the target to be detected is present in very low concentrations in the sample, the ELISA technique with antibodies or aptamers proves ineffective. To overcome this problem, amplification of a DNA probe is generally necessary. Therefore, other detection methods have been developed using polymerase chain reaction (PCR). Specific examples of such methods include immuno-PCR and aptamer-PCR. In immuno-PCR, the enzymatic amplification of the ELISA technique is replaced by DNA amplification. The second antibody is then coupled to a DNA sequence, which is exponentially amplified by PCR. This method is highly specific and quantitative, but it still requires the presence of two target-specific antibodies, and in particular the development of an antibody coupled to DNA, which makes this method complex and expensive. Aptamero-PCR, on the other hand, allows the secondary antibody to be replaced by an oligonucleotide containing an aptamer sequence specific to the target to be detected. Detection is achieved by direct amplification of this probe by PCR. This method allows for a detection limit of a few picomolars. However, both immuno-PCR and aptamero-PCR share the drawbacks of PCR, namely the need for long temperature cycles involving different temperatures. Finally, another amplification method has been developed to replace PCR for the amplification of double-stranded DNA. This method, called LAMP and patented [1], has the major advantage of being isothermal, with amplification carried out at a constant temperature typically between 60°C and 65°C. Thus, a protein detection method using LAMP amplification was described by Pourhassan-Moghaddam et al., 2013 [2]. It employs, on the one hand, an antibody or aptamer attached to a surface to capture the target and, on the other hand, an oligonucleotide containing an aptamer sequence that recognizes the target. This oligonucleotide is then amplified using the classical LAMP method with four primers. However, the complex design of the four primers essential to the LAMP amplification method makes this process complex and expensive to implement, despite the development of numerous LAMP primer design software such as, for example, LAMP designer (OPtigene) or primer Explorer. Finally, a method for detecting micro-RNAs (mi-RNAs) using a LAMP method with two primers has been developed [3,4]. This method has the advantage to be quantitative. However, it only allows the detection of RNA from which a complementary DNA fragment (cDNA) is formed by means of a reverse transcription reaction. Two hairpin DNA probes, designated H1 and H2 in Du et al., 2016 [4], are designed. Probe H1 has a 3' extension complementary to half of the cDNA fragment at its end, and probe H2 has a 5' extension complementary to the other half of the cDNA fragment at its end. In the presence of the cDNA fragment, probes H1 and H2 hybridize to it, and if no mismatch exists between the extensions of probes H1 and H2 and the cDNA fragment, a covalent bond between the two DNA probes H1 and H2 can be formed using a high-fidelity ligase such as Tag DNA ligase. It is therefore clear that this method of detecting miRNAs is not generic since it requires the preparation of two probes specific to each miRNA to be detected.Furthermore, this method involves several steps before the implementation of the LAMP technique, including a reverse transcription step and a ligation step, the latter potentially being complex with a low yield and the need to use an additional enzyme. Despite this, in their publication Du et al, 2016 [4], the authors emphasize that this step is crucial, particularly for better discrimination of mutations in mi-SRNAs (sentence bridging columns on page 12722). The inventors have already developed an innovative method for performing LAMP amplification with only two primers [5]. This method allows the detection of various analytes of interest in a sample and avoids the drawbacks of prior art methods. It employs a sequence in the form of a double stem-loop oligonucleotide, which serves as a template for LAMP amplification. It combines analyte recognition by oligonucleotide strands with two-primer LAMP amplification, resulting in highly sensitive detection. Indeed, the double stem-loop oligonucleotide incorporates, within its structure, a detection entity for the analyte of interest.In other words, the oligonucleotide has, within its structure, at least one sequence specific to the analyte to be detected, such as, for example, an aptamer or at least one sequence complementary to a part of the nucleotide sequence of the analyte to be detected when the latter is a nucleotide molecule. In such a configuration, only one nucleotide sequence can be used as the analyte detection entity, and this is integrated into the structure to be amplified, making its use unique for each application. The inventors therefore set themselves the goal of proposing a useful tool in a process for detecting molecules of interest of various kinds in a sample, said process not presenting the drawbacks of prior art methods. and to further improve the double stem-loop oligonucleotide described in [5]. Description of the invention The present invention solves the technical problems and drawbacks previously listed. Indeed, the inventors have proposed a new oligonucleotide tool, particularly useful in a method for detecting and possibly quantifying an analyte, which allows one to take advantage of the benefits of two-primer LAMP amplification, namely an isothermal, quantifiable method requiring only two primers. The oligonucleotide tool of the present invention is a double stem-loop oligonucleotide. The expressions and terms "double stem-loop oligonucleotide", "two stem-loop oligonucleotide", "dumbbell-structure oligonucleotide" and "dumbbell" are equivalent and may be used interchangeably within the scope of the present invention. The inventors have shown that it is possible to introduce, at any end of this dumbbell (i.e., the 5' or 3° end), a specific component of the analyte to be detected, which also allows for two-primer LAMP amplification (see section I.2 of the experimental part below). This amplification is even faster than the amplification obtained with a dumbbell as defined in [5], i.e., a dumbbell into any portion of which a nucleotide sequence specific to the analyte to be detected has been introduced. It should be noted that the LAMP amplification of the detection method described in [5] is faster, less complex to perform, and less expensive than four-primer LAMP amplification, particularly due to the reduction in the number of primers. These properties are maintained and even improved when using the dumbbell described in the present invention. The oligonucleotide with a double stem-loop structure that is the subject of the present invention corresponds to the following formula (I): [Chem.1] S'-Fic-F2-FO'-Fi-Int-Bic-BG / -B2c-B1-3" {} in which The Flc portion has a nucleotide sequence complementary to the nucleotide sequence of the F1 portion, whereby the F1c portion and the F1 portion hybridize to form the stem of the first stem-loop structure, The FO' separating portion F2 and portion F1 is either a covalent bond or a portion comprising at least one nucleotide. the F2-F0® portion forms the loop of the first stem-loop structure, designated herein- after the FO loop, portion B1 has a nucleotide sequence complementary to the nucleotide sequence of portion B1c, whereby portion B1 and portion B1c hybridize to form the stem of the second stem-loop structure, BO' separating portion BIc and portion B2c is either a covalent bond or a portion comprising at least one nucleotide. the portion BO"-B2c forms the loop of the second stem-loop structure, hereinafter referred to as loop BO, The element separating portion F1 and portion B1c is either a covalent bond or a portion comprising at least one nucleotide, and said oligonucleotide has, at its 5' end and / or at its 3' end, a structure comprising at least one entity E capable of binding, directly or indirectly, to an analyte of interest. The double stem-loop oligonucleotide of the present invention is clearly distinct from the oligonucleotide described in [3,4]. In the latter, the sequence capable of recognizing the cDNA obtained from the microRNA to be detected corresponds to the Int portion as defined in formula (I) above. This localization is essential to the process described in [3,4]. Similarly, the double stem-loop oligonucleotide of the present invention differs from the oligonucleotide described in [5]. The latter has at least one nucleotide sequence that specifically recognizes the analyte to be detected in any one or more of the portions of the oligonucleotide (i.e., Flc, F2, FO”, F1, Int, B1c, BO, B2c, and B1).It is stated in [5] that, in the implemented double stem-loop oligonucleotide, the nucleotide at the 5' end of portion F1c is linked, by means of hydrogen bonds, to the corresponding nucleotide in portion F1 and the nucleotide at the 3' end of portion B1 is linked, by means of hydrogen bonds, to the corresponding nucleotide in portion B1c. Such instruction would have deterred a person skilled in the art from linking, at the 5' end of portion F1c or at the 3' end of portion B1, a structure such as that defined in the present invention. In other words, the double stem-loop oligonucleotide of the present invention corresponds to any one of the following formulas (II), (IIT) and (IV): [Chem.2] S-FÎc-F2-FO"-F1-int-B1c-B0"-B2c-B1 [Chem.3] F1c-F2-F0"-F1-Int-Ric-B0®-B2c-Bi-S | (Het [Chem.4] S-Fic-F2-FO?-F1-int-B1c-B0"-B2c-B1-S" (IV) in which FO”, Int and BO”, and the portions Flc, F2, F1, B1c, B2c and B1 are such as previously defined, and Set S', identical or different, represent a structure comprising at least one entity E capable of linking, directly or indirectly, to an analyte of interest. In the context of the present invention, two nucleotide sequences are complementary to each other when a sufficient number of nucleotides from the first nucleotide sequence can bind, by means of hydrogen bonds, to the corresponding nucleotides of the second nucleotide sequence such that pairing between the two nucleotide sequences can occur. "Complementarity," as used here, refers to the pairing capacity between the nucleotides of a first nucleotide sequence and a second nucleotide sequence. Non-complementary nucleotides between two nucleotide sequences may be tolerated provided that the two nucleotide sequences remain capable of specifically hybridizing to each other.Furthermore, a first nucleotide sequence can hybridize to one or more segments of a second nucleotide sequence such that the intermediate or adjacent segments are not involved in the hybridization. In certain embodiments of the invention, a first nucleotide sequence, or a specific part thereof, is at least 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% complementary to a second nucleotide sequence, or a specific part thereof. Typically, in the double stem-loop oligonucleolide implemented in the invention, the F1 portion and the F1c portion each comprise from 10 to 35 nucleotides, in particular between 15 and 25 nucleotides and, by way of specific examples, 19, 20, 21, or 22 nucleotides. The melting temperature (Tm) of F1-F1c is notably higher than the temperature used during amplification and, in particular, 5°C to 7°C higher. Those skilled in the art can find additional information regarding these portions in [1]. Typically, portion B1 and portion B1c each comprise 10 to 35 nucleotides, particularly between 15 and 30 nucleotides and, as specific examples, 18 or 25 nucleotides. The temperature Tm of B1-B1c is notably higher than the temperature used during amplification and, in particular, 5°C to 7°C higher. Those skilled in the art can find additional information regarding these portions in [1]. In particular, portion F2 comprises from 8 to 30 nucleotides and, by way of particular example, 21 or 24 nucleotides. In the oligonucleotide according to the present invention, F0” is either a covalent bond linking portion F2 and portion F1, whereby the loop F0 is formed by portion F2, or a portion comprising at least one nucleotide. In the latter case, portion F0” is such that the loop FO formed by portion F2-F0® comprises from 10 to 70 nucleotides. Furthermore, the B2c portion comprises from 8 to 35 nucleotides, including between 15 and 30 nucleotides and, by way of specific examples, 18 or 22 nucleotides. In the oligonucleotide according to the present invention, BO” is either a covalent bond linking the Blc portion and the B2c portion, whereby the BO loop is formed by the B2c portion, or a portion comprising at least one nucleotide. In the latter case, the B0” portion is such that the BO loop formed by the BO'-B2c portion comprises from 10 to 70 nucleotides. In the oligonucleotide according to the present invention, when Int represents a portion comprising at least one nucleotide, the latter may comprise up to 70 nucleotides. Advantageously, the double stem-loop oligonucleotide according to the present invention comprises fewer than 200 nucleotides, in particular fewer than 180 nucleotides, in particular fewer than 170 nucleotides, more particularly fewer than 160 nucleotides, and especially fewer than 150 nucleotides. In some embodiments, the double stem-loop oligonucleotide according to the present invention may comprise fewer than 140 nucleotides, in particular fewer than 130 nucleotides, in particular fewer than 120 nucleotides, more particularly fewer than 110 nucleotides, and especially fewer than 100 nucleotides, particularly because the Int, FO” and BO” portions are optional and the S structure may not comprise any nucleotides. With such a size, the chemical synthesis of this oligonucleotide is facilitated and the cost of this synthesis and, consequently, the cost of the process according to the invention are lower. The double stem-loop oligonucleotide according to the invention has, at the 5' end of portion F1c (case according to formula (IT) or (IV)) or at the 3° end of portion B1 (case according to formula (III) or (IV)), an S or S' structure comprising at least one entity E capable of linking itself, directly or indirectly, to an analyte of interest. The S or S' structure in the oligonucleotide according to the invention may comprise only one entity E as previously defined. In this first embodiment, the S structure consists of the entity E. In other words, the entity E is linked, via a covalent bond, to the 5' end of the F1c portion (case according to formula (II) or (IV)) or to the 3° end of the B1 portion (case according to formula (III) or (IV)). In a second embodiment, the S$ or S' structure in the oligonucleotide according to the invention may comprise, in addition to an entity E as previously defined, at least one other element for linking entity E to the 5° end of the Flc portion (as in formula (II) or (IV)) or to the 3° end of the B1 portion (as in formula (III) or (IV)). This additional element is known as a "linking arm" and serves to improve the accessibility of entity E. Those skilled in the art are aware of various examples of such elements that could be used in the context of the present invention. By way of example, a nucleotide molecule as previously defined, and in particular a sequence comprising several thymine bases, and in particular 10 thymine bases, or a streptavidin-biotin molecular structure, may be cited.The bonds implemented in this variant are non-covalent and low-energy bonds such as hydrogen bonds or Van der Waals bonds and / or high-energy bonds such as covalent bonds. In a third embodiment, the S or S' structure in the oligonucleotide according to the invention may comprise several entities E as previously defined, which may be identical or different. In this embodiment, two successive entities E may optionally be separated by a linking arm. Similarly, the first of these entities may optionally be linked to the 5' end of the F1c portion (as in formula (II) or (IV)) or to the 3° end of the B1 portion (as in formula (III) or (IV)) via a linking arm. Finally, when the S or S' structure has several linking arms, these may be identical or different. In a first embodiment, the entity or entities E present at the level of the S or S' structure in the oligonucleotide according to the present invention are capable of binding directly to at least one analyte of interest. An entity E according to this embodiment may also be designated, in the present context, by the expression "recognition entity". This entity can be any molecule capable of forming a bond pair with the analyte to be detected, with entity E and the analyte corresponding to the two partners in this bond pair. The bonds involved in the analyte-entity interaction are advantageously non-covalent and low-energy bonds such as hydrogen bonds or Van der Waals forces, and / or high-energy bonds of the type covalent bonds. It should be noted that with the oligonucleotides described in [5], a high energy bond between the analyte and the nucleotide sequence recognizing it, specifically and present within the oligonucleotide, was not possible in order to avoid affecting LAMP amplification. The recognition entity or entities used are therefore dependent on the analyte(s) to be detected. Depending on the analyte(s), a person skilled in the art will be able to choose the most suitable entity or entities without inventive effort. A recognition entity can be chosen, for example, from the group consisting of a carbohydrate; a peptide such as an antimicrobial peptide or a MIP (i.e., a peptide associated with MHC-1, for "Major Histocompatibility Complex-1"); an antigen; an epitope; a protein; a glycoprotein; an enzyme; an enzyme substrate; a membrane or nuclear receptor; an agonist or antagonist of a membrane or nuclear receptor; a toxin; a polyclonal or monoclonal antibody; an antibody fragment such as a Fab, F(ab*), Fv fragment or a hypervariable domain (or CDR, for "Complementarity Determining Region"); a nucleotide molecule; and an aptamer. In fact, the oligonucleotide according to the present invention is further distinguished from other oligonucleotides with a double stem-loop structure of the prior art, useful in the identification of analytes of interest. In the latter, an entity forming a bond pair with an analyte of interest is necessarily in the form of a nucleotide sequence, whereas it can be of carbohydrate, peptide, lipid, and / or nucleotide nature in the context of the present invention. The term "nucleotide molecule" used herein is equivalent to the following terms and expressions: "nucleic acid," "polynucleotide," "nucleotide sequence," "polynucleotide sequence," and "oligonucleotide sequence." For the purposes of this invention, "nucleotide molecule" means a chromosome; a gene; a regulatory polynucleotide; DNA, single-stranded or double-stranded, genomic, chromosomal, chloroplast, plasmid, mitochondrial, recombinant, or complementary; a total RNA; a messenger RNA; a ribosomal RNA (or ribozyme); a transfer RNA; a microRNA; an aptamer sequence; a peptide nucleic acid; a locked nucleic acid (LNA); a morpholino; or a portion or fragment thereof. In a second embodiment, particularly illustrated in point III of the experimental section below, the entity or entities E present at the level of the S or S' structure in the oligonucleotide according to the present invention are capable of binding indirectly to one or more analytes of interest. In other words, this or these entity or entities E are independent of the analyte or analytes of interest to be detected, and this detection requires the use of an inter- A binding medium capable of binding, on the one hand, to the oligonucleotide according to this second embodiment of the invention and, on the other hand, to the analyte(s) of interest. This binding partner corresponds to a molecule comprising a first portion P1 capable of binding to an entity E present in the S or S' structure of the oligonucleotide and a second portion P2 capable of binding to at least one analyte of interest. The portion P2 of this molecule corresponds to a recognition entity as defined above or comprises several recognition entities as defined above, whether identical or different. Thus, everything described above for the recognition entity(ies) applies mutatis mutandis to the portion P2. In this binding partner, the portion P1 and the portion P2 are coupled to each other by means of a covalent bond.Alternatively, portion P1 and portion P2 can be coupled to each other by means of a connecting arm as previously defined. An entity E in this second embodiment can be any molecule capable of forming a bond pair with the P1 portion of the bonding partner, with entity E and the P1 portion corresponding to the two partners in this bond pair. The bonds involved in the entity-P1 portion bond are non-covalent and low-energy bonds such as hydrogen bonds or Van der Waals forces. The present invention relates to a non-covalent complex formed by an oligonucleotide according to the second embodiment and a molecule comprising a first portion P1 capable of binding to at least one entity E of this oligonucleotide and a second portion P2 capable of binding to at least one analyte of interest. In other words, this non-covalent complex is formed by a stem-loop oligonucleotide whose structure S or S' comprises at least one entity E capable of binding indirectly to at least one analyte of interest as previously defined, and a molecule comprising a first portion P1 capable of binding to this at least one entity E present in the structure S or S' and a second portion P2 capable of binding to at least one analyte of interest. Such a complex may be designated by the expression "binding complex". The present invention also relates to the use of a double stem-loop oligonucleotide as previously defined or a binding complex as previously defined to detect and possibly quantify at least one analyte possibly present in a liquid sample. In a particular embodiment, the present invention relates to a method for detecting and possibly quantifying at least one analyte possibly present in a liquid sample, comprising the following steps: 1) bring said liquid sample into contact with the surface of a solid support comprising at least one active zone on which at least one probe capable of binding said at least one analyte is immobilized; li) bring said surface into contact with a solution containing at least one oligo- gononucleotide with a double stem-loop structure comprising an entity E capable of binding directly to at least one analyte of interest as previously defined, or a binding complex as previously defined, said oligonucleotide and said complex having been prepared prior to said contacting; iii) eliminate excess oligonucleotides or excess binding complexes that did not react during contact in step ii); (iv) bring said surface into contact with two loop-mediated isothermal amplification primers under conditions permitting amplification of said oligonucleotide: (v) detect and possibly quantify the amplification product of said oligonucleotide (whereby said at least one analyte is detected and possibly quantified). In another particular embodiment, the present invention relates to a method for detecting and optionally quantifying at least one analyte possibly present in a liquid sample, comprising the following steps: (l) bring said liquid sample into contact with the surface of a solid support comprising at least one active zone on which at least one probe capable of binding said at least one analyte is immobilized; 1l,") to bring said surface into contact with a solution containing at least one molecule comprising a first portion P1 capable of binding to the entity E present in the structure of the oligonucleotide according to the second embodiment as previously defined and a second portion P2 capable of binding to said at least one analyte of interest; 1i;”) eliminate the excess of molecules that did not react during the contact in step ii'); ii;”) bring said surface into contact with a solution containing at least one oligonucleotide with a double stem-loop structure whose structure includes an entity E capable of indirectly binding to said analyte of interest as previously defined, said oligonucleotide having been synthesized prior to said contacting; iii') eliminate the excess oligonucleotides that did not react during the contact in step ii'); iv”) bring said surface into contact with two loop-mediated isothermal amplification primers under conditions permitting amplification of said oligonucleotide; v') detect and possibly quantify the product of the amplification of said oligonucleotide (whereby said at least one analyte is detected and possibly quantified). The liquid sample used in the present invention is a A liquid that may contain one or more analytes to be detected and possibly quantified. It can be of very diverse nature and origin. This liquid sample is advantageously chosen from the group consisting of a biological fluid; a plant fluid such as sap, nectar and root exudate; a sample taken from a culture medium or from a biological culture reactor such as a cell culture of higher eukaryotes, yeasts, fungi, algae or bacteria; a liquid obtained from one or more animal or plant cells; a liquid obtained from an animal or plant tissue; a sample taken from a food matrix; a sample taken from a chemical reactor; municipal, river, sea, swimming pool, cooling tower or groundwater; a sample taken from a liquid industrial effluent; wastewater from, in particular, intensive livestock farms or industries in the chemical, pharmaceutical or cosmetic fields; a sample taken from an air filter or a coating;a sample taken from an object such as a fragment of fabric, a garment, a sole, a shoe, a tool or a weapon; a pharmaceutical product; a cosmetic product; a perfume; a soil sample or a mixture thereof. In the context of the present invention, "sampling" means any type of sample collection, for example, by contact, scraping, drilling, cutting, punching, grinding, washing, rinsing, suction or pumping. The biological fluid is advantageously chosen from the group consisting of blood, such as whole blood or anticoagulated whole blood, blood serum, blood plasma, lymph, saliva, sputum, tears, sweat, semen, urine, feces, milk, cerebrospinal fluid, interstitial fluid, isolated bone marrow fluid, mucus or fluid from the respiratory, intestinal, or genitourinary tract, cell extracts, tissue extracts, and organ extracts. Thus, the biological fluid may be any fluid naturally secreted or excreted from a human or animal body, or any fluid recovered from a human or animal body by any technique known to those skilled in the art, such as extraction, sampling, or washing. The steps of recovering and isolating these various fluids from the human or animal body are carried out prior to implementing the process according to the invention. Similarly, if one of the envisaged samples does not allow the implementation of the process of the invention, for example due to its gaseous or solid nature, its concentration or the elements it contains such as solid residues, waste, suspension or interfering molecules, the process of the invention further includes a preliminary step of preparing the liquid sample with possibly dissolving the sample by techniques known to those skilled in the art such as filtration, precipitation, dilution, distillation, mixing, concentration, lysis, etc. Furthermore, it is possible to add known quantities of at least one analyte to be detected to the liquid sample. This is then referred to as a liquid sample spiked with at least one analyte. This spike allows for a positive control, particularly when the liquid sample is complex, and may also enable quantification of the analyte(s) initially present in the liquid sample. An analyte to be detected and possibly quantified in the liquid sample may be chosen from the group consisting of a molecule of environmental interest such as a pesticide; a molecule of biological interest; a molecule of pharmaceutical interest; a toxin; a carbohydrate such as glucose; a lipid such as cholesterol; a peptide; an antigen; an epitope; a protein; a glycoprotein; an enzyme; an enzyme substrate; a nuclear or membrane receptor; an agonist or antagonist of a nuclear or membrane receptor; a hormone; a polyclonal or monoclonal antibody; an antibody fragment such as a Fab, F(ab”), Fv fragment or a hypervariable domain; a nucleotide molecule as previously defined; ions such as mercury or lead ions; a eukaryotic cell; a prokaryotic cell and a virus. Note that, in certain implementations, an analyte to be detected and possibly quantified in the liquid sample can be defined as a small molecule, i.e., a molecule with a molecular weight less than or equal to 10,000 daltons, and in particular less than or equal to 8,000 daltons. This small molecule can belong to any of the elements in the analyte lists above. Step 1) or 1') of the method according to the present invention employs a probe capable of binding said at least one analyte immobilized on the surface of a solid support. The probe used to functionalize an active region of the surface of the solid support is any molecule capable of forming a bond pair with an analyte to be detected, the probe and the analyte corresponding to the two partners of this bond pair. The bonds involved in the analyte-probe interaction are advantageously either non-covalent and low-energy bonds such as hydrogen bonds or Van der Waals forces, or high-energy bonds such as covalent bonds. The probe used is therefore dependent on the analyte to be detected. Based on this analyte, a person skilled in the art will be able to choose the most suitable probe without any inventive effort. It can be chosen, for example, from the group consisting of a carbohydrate; a peptide such as an antimicrobial peptide or a MIP (i.e., a peptide associated with MHC-1, for "Major Histocompatibility Complex-1"); an antigen; an epitope; a protein; a glycoprotein; an enzyme; an enzyme substrate; a membrane or nuclear receptor; an agonist or antagonist of a membrane or nuclear receptor; a toxin; a polyclonal or monoclonal antibody; or an antibody fragment such as a fragment Fab, F(ab'), Fv or a hypervariable domain; a nucleotide molecule as previously defined; and an aptamer. It is clear that, when choosing the most suitable probe, the recognition entity subsequently implemented must be taken into account. The probe and the recognition entity can recognize distinct areas or features on the analyte to be detected. Alternatively, the probe and the recognition entity can target the same feature on the analyte to be detected. This variant is particularly relevant when the analyte to be detected is a bacterium or a virus, and the target feature is a surface element present in several areas of the bacterial or viral surface. Any solid support suitable for implementing the present invention is usable. This could be, for example, a biochip support such as those classically used in silicon, glass, metal, polymer, or plastic. This solid support could also consist of particles, and in particular silica particles, polymeric particles, and / or magnetizable particles. The functionalization of the active area of the surface of the solid support by a probe as previously defined can be carried out by any suitable technique allowing the fixation of a compound on a solid support. In particular, simple adsorption, ionic bonds, hydrogen bonds, electrostatic interactions, hydrophobic interactions, Van der Waals bonds or covalent grafting can be considered. In a particular embodiment of the present invention, the surface of the solid support has functional groups by which the probe(s) are able to become immobilized. Advantageously, these functional groups are selected from among carboxylic groups, radical entities, alcohol, amine, amide, epoxy, or thiol functional groups. These groups are carried, either intrinsically or by functionalization, by the active zone of the solid support surface. The probe(s) may also have such functional groups, either intrinsically or by functionalization. In a first embodiment of the present invention, the probe(s) can be directly immobilized at the functionalized or non-functionalized surface. A solid support coated with a protein such as streptavidin is an example of direct immobilization, in which the probe must be functionalized with biotin. In a second embodiment of the present invention, the probe(s) can be indirectly immobilized at the level of the functionalized or non-functionalized surface. This indirect immobilization involves a spacer arm (or joining agent) attached, on one side, to the surface and, on the other side, to a probe. Such a spacer arm is notably used to improve probe accessibility. By way of illustrative examples, one can citing the silane reagents used for grafting probes onto glass, complexing thiol products onto gold surfaces and immobilizing probes in polymer matrices, In addition, when the probe(s) are one or more nucleotide molecules as previously defined, such a spacer arm can be in the form of a sequence comprising several thymine bases and in particular 10 thymine bases. The bonds implemented during a direct or indirect immobilization can be any bonds known to a person skilled in the art and in particular covalent bonds, ionic bonds, hydrogen bonds, electro-static interactions, hydrophobic interactions, Van der Waals bonds or adsorption. Advantageously, a surface blocking step can be implemented prior to and / or following probe fixation. The blocking solution used in this blocking step may contain one or more of the following components: albumin such as BSA (Bovine Serum Albumin), genomic DNA such as single-stranded DNA, particularly salmon sperm single-stranded DNA, gelatin, casein, milk proteins, serum, polyethylene glycol, and polymers such as polyvinylpyrrolidone. A specific example of a blocking solution is a solution containing 1% to 5% BSA and optionally 20 µg / mL of salmon sperm single-stranded DNA. Step 1) or 1') of the process according to the invention consists of bringing the liquid sample as previously defined into contact with the surface of a solid support functionalized by one or more probes capable of binding the analyte to be detected, whereby, if the liquid sample contains this analyte, the latter is captured at the level of the probe(s). Typically, step i) or l') of contact can last between 1 min and 24 h, between 2 min and 12 h, between 5 min and 6 h, between 10 min and 3 h, between 15 min and 2 h, between 20 min and 1 h, and, in particular, on the order of 30 min (i.e., 30 min + 5 min). Furthermore, step i) of contact can be carried out at a temperature between 4°C and 70°C, in particular between 10°C and 60°C, especially between 15°C and 45°C, and, more particularly, at room temperature (i.e., 23°C + 5°C) or at physiological temperature (i.e., 37°C + 5°C). Following step 1) or 1') and prior to step ii) or ii;”) of the process according to the present invention, it is possible to remove elements present in the liquid sample that have not been captured by the probe(s). Any technique enabling such removal is usable within the scope of the present invention. By way of example, washing the surface of the solid support or separating the liquid sample from the solid support as a physical or mechanical separation may be cited. genetics. However, this elimination step is optional since these elements can be eliminated later, particularly during any of the steps iii), ii') or iii”). When this removal step is implemented, the surface of the solid support may be subjected to at least one rinse to remove all traces of the liquid sample. This rinse is typically performed with an aqueous rinsing solution that preserves the probe / analyte interaction or irreversibly binds the analyte and the probe. This solution can also be used to remove nonspecific interactions. It may contain one or more of the following components: a buffer such as Tris, phosphate, acetate, or borate buffer; salts such as KCl, NaCl, (NH₄)SO₄, MgCl₂, or CaCl₂; detergents or surfactants such as Tween®, Triton®, or sodium dodecyl sulfate (or SDS); denaturing agents such as formamide or dimethyl sulfoxide; an organic solvent such as ethanol, methanol, or acetonitrile; and bridging agents such as formaldehyde or glutaraldehyde.This rinsing can be repeated two, three, five, ten, or even fifty times, using the same or a different rinsing solution for each rinse. Typically, the rinsing is repeated three times with a solution comprising (i) phosphate buffer saline (or PBS) and 0.1% Tween® such as Tween®20, (ii) PBS, 0.3% Tween® such as Tween®20 and 1 M NaCl, or (iii) a saline solution containing 0.02 M PBS, 1.074 M NaCl and 0.3% Tween® such as Tween®20. Furthermore, when this optional elimination step is implemented, it is carried out at a temperature between 4°C and 100°C, in particular between 10°C and 60°C, especially between 15°C and 45°C and, more particularly, at room temperature or physiological temperature. Step ii) of the method according to the present invention consists of contacting the surface of the solid support on which an analyte to be detected is optionally retained via the probe(s) functionalizing this surface with a solution containing at least one stem-loop oligonucleotide capable of binding to said analyte or at least one binding complex as previously defined, whereby, if this analyte is present on the surface of the solid support, the oligonucleotide or the binding complex binds to the latter respectively via its recognition entity or its P2 portion. In other words, the stem-loop oligonucleotide or the binding complex is capable of forming a bond pair with the analyte to be detected, the oligonucleotide or the binding complex and the analyte corresponding to the two partners of this bond pair.The bonds involved in the oligonucleotide-analyte bond or in the complex-analyte bond are advantageously non-covalent and low-energy bonds such as hydrogen bonds or Van der Waals bonds and / or high-energy bonds of the co- type. valentes. The oligonucleotide was synthesized prior to contact in step ii) or is”). In other words, this synthesis is carried out neither in the presence of the solid support surface functionalized by the probe(s) as previously defined, nor in the presence of the analyte to be detected. Typically, the synthesis of this stem-loop oligonucleotide does not involve two of the primers usually used in a four-primer LAMP amplification. Advantageously, this synthesis is a chemical synthesis classically used to prepare oligonucleotides. In step ii) of the process according to the present invention, the surface of the solid support, on which at least one analyte is optionally held by means of a probe, is brought into contact with a solution containing at least one stem-loop oligonucleotide as previously defined or a binding complex as previously defined. This solution is advantageously an aqueous solution allowing the dumbbell or complex / analyte interaction. It may comprise one or more of the following components: a buffer such as Tris, phosphate, acetate, or borate buffer; salts such as KCl, NaCl, (NH₄):SO₄, MgCl, or CaCl₂; detergents or surfactants such as Tween®, Triton®, or sodium dodecyl sulfate (or SDS); denaturing agents such as formamide or dimethyl sulfoxide; an organic solvent such as ethanol, methanol, or acetonitrile; and bridging agents such as formaldehyde or glutaraldehyde.Advantageously, when the oligonucleotide includes an aptamer sequence for analyte recognition, the solution used will be composed of the components, in whole or in part, of the aptamer selection buffer. The solution used in step ii) may, in addition, include one or more components selected from genomic DNA such as single-stranded DNA, particularly salmon sperm single-stranded DNA, serum, albumin, a synthetic polymer, a blocking agent such as Denhardt blocking agent, and any other component that limits non-specific adsorption. A specific example of a solution used in step ii) is a saline solution containing 0.02 M PBS, 1.074 M NaC, 0.3% Tween20 detergent, 20 µg / mL salmon sperm DNA, and 4% Denhardt blocking agent. Furthermore, the stem-loop double oligonucleotide or the linkage complex is present in this solution in an amount between | aM and | mM, and in particular between 100 aM and 1 µM. Specific examples of usable concentrations include 10 pM, 100 pM, | nM, or 10 nM. Advantageously, the stem-loop double oligonucleotide or the linkage complex is present in the solution prepared in step ii) by a concentration of 100 pM. Typically, step ii) of establishing contact can last between 1 minute and 24 hours, specifically between 2 minutes and 12 hours, and in particular between 5 minutes and 6 hours. In one particular implementation, this contact can last between 10 minutes and 3 hours, between 15 minutes and 2 hours, between 20 minutes and 1 hour, and in particular, on the order of 30 minutes (i.e., 30 minutes + 5 minutes). In another implementation, this can last between 30 minutes and 6 hours, between 1 and 5 hours, between 2 and 4 hours, and in particular, on the order of 3 hours (i.e., 3 hours + 15 minutes). Similarly, step (ii) of bringing the dumbbell into contact can be carried out at a temperature between 4°C and 100°C, specifically between 10°C and 60°C, particularly between 15°C and 30°C, and more specifically at room temperature (i.e., 23°C + 5°C) or physiological temperature (i.e., 37°C + 5°C). This is a preliminary step to be taken before bringing the dumbbell into contact with the surface to ensure optimal folding. Prior to this contact, the oligonucleotide according to the invention can be heated to a temperature above 80°C, and in particular to approximately 90°C (Le. 90°C + S°C), for 5 minutes, and then cooled to room temperature in about 35 minutes (35 min + 10 min). This preliminary step allows, particularly when the recognition entity is an aptamer, for the latter to be given an optimal conformation for analyte detection. Everything described above for step ii) (nature of the solution, duration, and temperature) applies to steps ii”) and ii’(s). Furthermore, the molecule comprising a first portion P1 and a second portion P2 as previously defined, and the oligonucleotide with a double stem-loop structure, is present in the solution upon contact in steps ii”) and ii’(s), respectively, in an amount between 1 aM and 1 mM, and in particular between 100 aM and 1 µM. Specific examples of usable concentrations include 10 pM, 100 pM, 1 nM, or 10 nM. Following step ii) or ii') and prior to LAMP amplification, or following step ii'), and prior to step ii'), it is necessary to eliminate all elements likely to give false positives, such as, for example, oligonucleotides with a double stem-loop structure, molecules with P1 and P2 portions, or binding complexes not specifically linked to the analyte to be detected or linked to elements not linked to the probes functionalizing the surface of the solid support. This constitutes step ii'), iii), or iii') of the method according to the present invention. Any technique enabling such removal is usable within the scope of the present invention. Examples include washing the surface of the solid support or separating the solution containing oligonucleotides with a double stem-loop structure, molecules with P1 and P2 portions, or binding complexes and the solid support such as a physical or magnetic separation. When this removal step is implemented, the surface of the solid support may be subjected to at least one rinse, which is typically carried out with a rinsing solution consisting of an aqueous solution: - preserving the analyte / oligonucleotide interaction or irreversibly linking the analyte and the oligonucleotide (case of step iii)); - preserving the analyte / binding complex interaction or irreversibly binding the analyte and the binding complex (case of step iii) and step iii')) or - preserving the analyte / molecule interaction with portions P1 and P2 or irreversibly binding the analyte and the molecule with portions P1 and P2 (case of step ii.')). This rinsing solution can also eliminate non-specific interactions. It may contain one or more of the following components: a buffer such as Tris, phosphate, acetate, or borate buffer; salts such as KCl, NaCl, (NH₄)₂SO₄, MgCl, or CaCl₂; detergents or surfactants such as Tween®, Triton®, or sodium dodecyl sulfate (SDS); denaturing agents such as formamide or dimethyl sulfoxide; an organic solvent such as ethanol, methanol, or acetonitrile; and bridging agents such as formaldehyde or glutaraldehyde; and one or more elements selected from genomic DNA such as single-stranded DNA, particularly salmon sperm single-stranded DNA, serum, albumin, and a synthetic polymer. This rinsing can be repeated two, three, five, ten, or even fifty times, using the same or a different rinsing solution for each rinse.Typically, rinsing is repeated three times with a solution comprising PBS and 0.1% Tween®. Alternatively, rinsing is repeated three times with a saline solution containing 0.02 M PBS, 1.074 M NaCl and 0.3% Tween®20 detergent. Furthermore, step 11'), i1i) or 1il') is carried out at a temperature between 4°C and 100°C, in particular between 15°C and 80°C, especially between 30°C and 60°C and, more particularly, at a temperature of around 40°C (i.e. 40°C + 5°C) or at physiological temperature. Step iv) or iv') of the process according to the invention is the two-primer LAMP amplification proper. The only two primers used in this step correspond respectively to formula (V) and formula (VI) below: [Chem.5] S'-Fic-F2-3" (V) [Chem.6] S'-Bic-B2-3" (VI) portion B2 having a nucleotide sequence complementary to the nucleotide sequence of portion B2c and portions F1c, F2, B1c and B2c being as previously defined. The primers of formula (V) or formula (VI) are respectively called, in the four-primer LAMP amplification, FIP primer (for "Forward Inner Primer") and BIP primer (for "Backward Inner Primer"). The temperature Tm of B2-B2c is notably higher than the temperature used during amplification and, in particular, 5°C to 7°C higher. Those skilled in the art can find additional information regarding these portions in [1]. The temperature Tm of F2-F2c is notably higher than the temperature used during amplification and, in particular, 5°C to 7°C higher. Those skilled in the art can find additional information regarding these portions in [1]. It should be noted that, in step iv) or iv') of the process according to the present invention, the analyte is not used as a primer for LAMP amplification. Step iv) or iv') of the process according to the present invention consists of bringing into contact the surface on which is / are immobilized one or more probe(s) specific to the analyte(s) to be detected with a reaction mixture comprising the primers FIP and BIP and any element necessary for the production of an amplification product if the oligonucleotide with a double stem-loop structure is present. Typically, the reaction mixture used in step iv) or iv') includes a suitable buffer, such as phosphate buffer or Tris buffer; deoxyribonucleosides (dNTPs), such as an equimolar mixture of dATP, dCTP, dGTP, and dTTP; and a LAMP amplification catalyzing enzyme. Such an enzyme is a polymerase with high strand-displacement activity in addition to replication activity. Specific examples of such enzymes include those listed below: - Bst DNA polymerase and its variants such as, for example, Bst2.0 DNA polymerase and Bst3.0 DNA polymerase, - BSM DNA polymerase, - Bca (exo-) DNA polymerase, - Klenow fragment of DNA polymerase I, - Vent DNA polymerase, - Vent(Exo-) DNA polymerase (exonuclease activity-free Vent DNA polymerase), - DeepVent DNA polymerase, - DeepVent(Exo-) DNA polymerase (DeepVent DNA polymerase without exo-nuclease activity), - 29 phage DNA polymerase, - MS-2 phage DNA polymerase, - Z-Taq DNA polymerase (Takara Shuzo), and - KOD DNA polymerase (TOYOBO). The reaction medium may also include salts such as magnesium salts, manganese salts and / or ammonium salts; detergents, betaine and / or elements useful for the detection and quantification of the amplification product of the double stem-loop oligonucleotide such as, for example, calcein, an intercalating dye such as, for example, propidium iodide, SYTO 9, SYBR green and EvaGreen. Step iv) or iv”) of the process according to the present invention is carried out for a period of time and at a temperature sufficient for the production of an amplification product if the stem-loop double-strand oligonucleotide is present. Advantageously, this step is carried out under isothermal conditions, and in particular at a temperature between 15°C and 90°C, more specifically between 50°C and 80°C, and more particularly around 65°C (i.e., 65°C + 5°C). The duration of step iv) or iv”) of the process according to the present invention is between 1 min and 120 min, specifically between 5 min and 90 min, and in particular between 15 min and 60 min. Step v) or v') consists of detecting and possibly quantifying the amplification product of the double stem-loop oligonucleotide and therefore detecting and possibly quantifying the analyte to which the double stem-loop oligonucleotide is bound since the accumulation of the amplification product is an indicator of the presence of this analyte immobilized on the surface of the solid support. Step v) or v') can be performed simultaneously with or after step iv) or iv'). A person skilled in the art is familiar with various techniques for performing this detection. This may include any of the techniques described in Becherer et al, 2020 [6]. The amplification product can be detected, during step v) or v'), by measuring the turbidity caused by the magnesium pyrophosphate precipitated in solution as a by-product of the amplification. This measurement can be carried out with the naked eye or via a turbidity meter or by lensless imaging [7]. The amplification product can be detected, during step v) or v'), by a pH probe allowing monitoring of the acidification of the reaction mixture during LAMP amplification. The amplification product can be detected, during step v) or v'), via an ele- tropheresis on frost. The amplification product can be detected, during step v) or v'), by in-plane crystal detection by lensless imaging as described in [7]. The amplification product can also be detected, during step v) or v'), by a colorimetric test or by fluorescence measurement, particularly when calcein or a fluorescent intercalating dye is present in the reaction mixture. When quantification of at least one analyte is required during step v) or v') of the process according to the present invention, this quantification is performed by comparison with a standard range of analytes at known concentrations. This quantification is a standard step in the ELISA method. This quantification can also involve adding known quantities of the analyte to be detected to the liquid sample, as previously described (doped liquid sample). Other features and advantages of the present invention will become apparent to the person skilled in the art upon reading the examples below, given by way of illustration and not limitation, with reference to the attached figures. Brief description of the drawings [Fig.1] presents the LAMP calibration range of a dumbbell as defined in [5] (“Halt]”) and of two dumbbells according to the present invention (“Halt2” with a recognition entity in 5’ and “Halt3” with a recognition entity in 3’), the three dumbbells comprising a recognition entity of 18 bases, [Fig.2] presents the LAMP calibration range of a dumbbell as defined in [5] (“Halt4”) and of a dumbbell according to the present invention (“Halt5”), both dumbbells comprising a recognition entity of 40 bases (n=2). [Fig.3] presents the principle of direct detection of a single strand of DNA complementary to a part of the "DTBGE" dumbbell according to the invention. [Fig.4] shows the amplification curves of the "DTBGE" dumbbell according to the invention, hybridized on the complementary DNA strand Thrlc immobilized on magnetic beads. [Fig.5] presents the quantification range of the "DTBGE" dumbbell according to the invention, hybridized on the complementary DNA strand "Thr1c" immobilized on magnetic beads. [Fig.6] presents the principle of DNA strand sandwich detection by the "DTBGE" dumbbell according to the invention (left) and positive controls (right). [Fig.7] presents the range of quantification of the oligonucleotide "Zip6Thrl1c" with different dumbbells ("DTBGE" according to the invention and "DTRC" as defined in [5]), and positive controls ("DTBGE positive control" according to the invention and "DTRC positive control" as defined in [5]). [Fig.8] presents the quantification range of the oligonucleotide "Zip6Thrlc" ("DTBGE Detection (plasma)"), quantification range of positive controls ("DTBGE Positive Control (plasma)") and low detection limits ("Negative control (low LOD)") in complex medium (human blood plasma). [Fig.9] presents the principle of direct detection of molecules by recognition with the "DTBGE" dumbbell according to the invention. [Fig.10] presents the range of quantification for the detection of thrombin in direct format, in experimental duplicates (replica 1 and 2) and analytical (curves re- presented with features of the same nature). [Fig.11] presents the calibration range for direct thrombin detection with dumbbell “DTBGE” according to the present invention (data [Fig.10]). [Fig.12] presents the principle of molecule detection by double aptamer sandwich and LAMP amplification. [Fig.13] presents the range of quantification of the double aptamer sandwich recognition of thrombin, in experimental (replica 1 and 2) and analytical (curves represented with lines of the same nature) duplicates. [Fig.14] presents the range of quantification of buffered thrombin detected in double aptamer sandwich with the "DTBGE" dumbbell according to the invention. [Fig.15] presents the principle of indirect grafting of a recognition entity (aptamers or antibodies) to the end of the dumbbell according to the present invention by hybridization of complementary DNA. DETAILED DESCRIPTION OF SPECIFIC METHODS OF IMPLEMENTATION T. Comparison of LAMP with dumbbell as described in [S] and dumbbells according to the L.1. Experimental protocol. Several dumbbell solutions at different concentrations were amplified according to the two-primer LAMP amplification protocol. The protocol consists of adding 2 uL of diluted dumbbell solution in a buffer containing PBS and MgCl (pH = 7.3) with 18 uL of reaction mix comprising: - an enzyme catalyzing amplification, such as Bst DNA Polymerase, with its associated amplification buffer, - an isothermal amplification buffer associated with the enzyme, such as "isothermal amplification buffer (NEB)" for example, - deoxyribonucleosides triphosphates (dNTPs), - magnesium salts such as MgCl₂, - an intercalating colorant such as EvaGreen, - betaine and - FIP and BIP primers as defined below. 1.2. 18-nucleotide recognition entity. The recognition entity El implemented in this example comprises 18 bases. In the dumbbell as defined in [5], it is inserted between portions F1 and Blc. In both cases according to the present invention where the recognition entity is added to the end (5° or 3”), a 10-base thymine spacer arm is added beforehand. A summary of the sequences used is presented in Table 1 below. In this example, the dumbbells are used in quantities ranging from 10 nM to 10 pM in the 2 µL of solutions. [Table 1] [Name | Construction | Sequence (5°-8"3 Haiti S'-Fie-F2-F1- | CGGATCCAAGACGCGGTTTATCGTGCAGTACGCCAACCT | 152 (probe £i-Bic-B2C- | TTCTCAATAAACCGCGTCTTGGATCCGTGGTTGGTGTGGT at B1-3" FGGGACATCTCTGAGTTATATCTIFCCCCCCCTCACTGAC centre) ECTCCITCGGGGAAAGATATAACTCAGAGATG {5} (SEQ D NO: 1 in the sequence list in annexe) Halt2 5°-E1-10T— GGTIGGTGTGGITGETITTCA {GITCGITCA 162 | Fl1c-F2-Fi- GTITATCSTGCAGTACGCCAACCTTECTCAATAAACCECG en5') Bic-82C-B1-3' | TCTTGGATCCGTGACATCTCTGAGTTATATCTITECCCCCC TCACTGACECTCCTTCGGGGAAAGATATAACTCAGAGA TG [SEQ 3D NO: 2 in the attached sequence list) Halt3 5'-Fic-F2-Fi- | CGGATCCAAGACGCGGTITATCGTGCAGTACGCCAACCT | 162 {probe Bic-B2C-Bi- | TTCICAATAMACCGCOTCTTGGATCCGTGACATCTCTGAG en 3) TOT-E1-3" TTATATCITTCCCCCTCCACTGACCCTCCTTCGGGGGAA AGATATAACTCAGAGATGTITTIITTGGTTGGTGTEGT TsGG (SEQ 1D NO: 3 in the list of Amor ence} | 5°-Fic-F2-3' EGGATCCAAGACGCGGTTTATCGTGCAGTACGCCAACCT |sequences in appendix} Primer | 5S°-Bic-B2-3" CATCTCTGAGTTATATCTITCCCCCGAAGGAGGGTCAGTS | 43 BIP AGG (SEQ 1D NO: 5 in the sequence listing in appendix) Table i The calibration range comparing the dumbbells described in Table 1 is shown [Fig.1]. First, we observe that the amplification of the "Halt1" dumbbell is the slowest and therefore the least optimal. Interestingly, when a sequence is added to the end of the chain ("Halt2" and "Halt3"), the amplification is faster. Furthermore, when adding a sequence to the end of the chain, the LAMP is more efficient when the sequence is added to the 5' end, as it is less disruptive to the amplification process, notably allowing for easier strand openings. Finally, integrating the probe at the 5' end of the chain is more advantageous compared to the configurations where the probe was integrated into the oligonucleotide sequence, as was the case in [5]. Thus, the "Halt2" dumbbell containing the probe at the 5° end is particularly interesting in terms of molecular recognition applications. This dumbbell offers the best compromise between the speed of LAMP amplification and the degrees of freedom provided to the recognition entity E, which can directly contain an aptamer or serve as a support for grafting any type of structure containing a recognition entity E by hybridization or covalent bonding, and therefore becomes the sequence of choice for detection applications. 1.3. 40 nucleotide recognition entity. As presented in point 1.2 above, it is possible to add a recognition entity E to the 5' or 3" end of the dumbbell, the most interesting configuration for detection applications corresponding to an addition at the 5° end. Two new dumbbell sequences were designed with a recognition entity E2 containing 40 bases and are presented in Table 2 below. These sequences are expandable using the new primer pair FIP2 and BIP2. [Tables 2] [Name _ [Construction | sequence (5-3 [tongue | Halted 5'-Fic-F2-F1- AGAGCAGCAGAAGTGGCACAGGTGATTGTGAAGAAGAAG | 159 E2-Bic-B2C- AGTGTGCCACTICTGCTGCTCTCGTGCAGTACGCCAACCTT B1-3' TCICATGCGCTGCCCCTCTTATCAACCTGAAGAAGGCAG GCAGTGAGGACAATCAGTTCT FGCTCTTCTCAGGTTGA {SEQ ID NO: 6 in the sequence listing in Annex Halt5 S°-E2-10T-Fic- | CGTGCAGTACGCCAACCTITCTCATGCGCTGCCCCTCTTAT | 172 F2-F1-Int-Bic- | AGAAGAAGAGTGTGCCACTICTGCTGCTCTITATCAACCTG AAGAAGAGCAGGCAGTGAGGACAATCAGTICT TGCTCITCITCAGGTTGA (SEQ 1D NO: 7 in the sequence list in the appendix) Primer | 5°-Fic-F2-3" AGAGCAGCAGAAGTGGCACAGGTGATTGTGAAGAAGAAG | 41 FiP2 AG {SEQ ID NO: 8 in the sequence list in the appendix} BIP2 (SEQ ID NO: 9 in the sequence list in the appendix) Table 2 These two dumbbells, in quantities ranging from 10 nM to 10 pM in 2 µL of solution, are amplified according to the two-primer LAMP protocol described previously. Here, a faster enzyme such as Bst3.0 DNA Polymerase from New England Biolabs is used because the significant length of the sequences to be amplified makes amplification slower with the enzyme usually used (Bst2.0 DNA Polymerase). The calibration curves after LAMP amplification are presented [Fig.2]. These results validate the functionality of this newly designed "Halt5" dumbbell, which features a novel end-chain sequence that can serve as a probe or probe holder for various applications. This also demonstrates the advantage of adding the extra sequence to the end of the chain, rather than within it, by accelerating the LAMP (Laser-Assisted Movement) for the "HaltS" dumbbell compared to the "Halt4" dumbbell. II. Use of a dumbbell according to the present invention in detection. In this example, the use of the "Halt2" dumbbell in detection is illustrated, following various innovative schemes, as it is the dumbbell offering the best compromise between sequence length (acceptable and realistic chemical synthesis yield) and LAMP amplification speed. Furthermore, this dumbbell was designed to present a recognition entity corresponding to a "Thrl" aptamer that recognizes the thrombin protein [8]. In what follows, the "Halt2" dumbbell is referred to as "DTBGE" and the El recognition entity is referred to as "Thr1" (thrombin aptamer 1 according to [8]). II.1. Range for quantifying oligonucleotides on beads (direct). Initially, DNA strand detection was performed and showed that the dumbbell according to the present invention could detect a single strand of DNA when it was complementary to the sequence located at the 5' end. Two direct and indirect detection protocols were implemented and tested with the "DTBGE" dumbbell. A range of different dumbbell concentrations mixed with beads onto which the DNA strand complementary to the recognition entity "Thrlc" is grafted is prepared. The solution containing the beads and the dumbbell is amplified after three washes to remove dumbbells that did not bind to the target. The principle of the detection protocol is shown [Fig. 3]. A negative control is performed in parallel with beads containing a random sequence "Zip6" of the sequence S'-GACCGGTATGCGACCTGGTATCGG-3' (SEQ ID NO: 10 in the sequence list in the appendix) grafted via biotin onto streptavidin magnetic beads and not complementary to the DTBGE dumbbell. "Zip6c" is of the sequence 5'-CGCATACCAGGTCGCATACCGGTC-3' functionalized with a biotin group at the 5' end (SEQ ID NO: 11 in the sequence list in the appendix). The detection protocol is then as follows: - incubation of the biotinylated DNA strand "Thrlc" of sequence 5S'-CCAACCACACCAACC-3' functionalized with a biotin function at the 5' end (SEQ ID NO: 12 in the sequence listing in the appendix) with streptavidin magnetic beads at 25°C for 10 min then rinsed using a magnet and a rinsing buffer containing PBS, 1.074 M NaCl and 0.3% Tween®20 (hereinafter "Tr rinsing pad"), - blocking the magnetic beads for 30 min using a hybridization solution containing BSA (for "Bovine Serum Albumin"), - incubation of different concentrations of dumbbell (1 nM — 100 pM) at 25°C for 3 h, then 3 rinses at 40°C with the Tr rinsing buffer, - addition of the LAMP solution containing 2.4 uM of each of the FIP and BIP primers and the enzyme necessary for amplification, namely 0.4 U / ml of Enzyme Bst2.0 DNA Polymerase (NEB) (hereinafter "LAMP mix solution"). This protocol allows us to obtain an amplification range for the dumbbell when its 5' end hybridizes with the complementary strand. The amplification curves obtained and the associated calibration range are shown in [Fig. 4] and [Fig. 5] respectively. Negative controls are also performed using beads immobilized with a strand of DNA non-complementary to the dumbbell ("Zip6c"). These controls are dissolved in LAMP reagents, allowing for the assessment of the non-specific signal component. Signals corresponding to the negative control appear around 17 min, making it possible to quantify the dumbbell down to a concentration of 10 pM. 11.2. Quantification range of oligonucleotides in sandwich format (indirect). A DNA strand detection in a sandwich format is performed. The principle of the detection is described [Fig. 6]. Here, the previously presented oligonucleotide quantification range on beads serves as a positive control for indirect detection. The protocol put in place is as follows: - incubation of the biotinylated DNA strand “Zip6c” with streptavidin magnetic beads at 25°C for 10 min then rinsing using a magnet and Tr rinsing buffer, - blocking the magnetic beads for 30 min using a hybridization solution containing BSA, - Incubation of different concentrations of target “ZipéThr1c” (1 nM — 1 pM) at 37°C for 30 min followed by 3 rinses with Tr rinsing buffer. The target “Zip6Thrlc” has the sequence 5'- CCAACCACACCAACCGACCGGTATGC- GACCTGGTATGCG-3' (SEQ ID NO: 13 in the sequence listing in the appendix), - Addition of the 100 pM dumbbell solution and incubation at 37°C for 3 h, then 3 rinses at 40°C with Tr rinsing buffer, - Addition of the LAMP mix solution. The protocol for positive controls is similar but the complementary "Thrlc" strand to the dumbbell is immobilized on the probes, no "Zip6Thr1c" target is added, and finally 4 different dumbbell concentrations are added (1 nM — 1 pM). The same protocol is performed with the dumbbell "Halt1" (here named "DTRC") as defined in [5] to evaluate the performance of the dumbbell according to the present invention. The results for the quantification range are presented in [Fig. 7]. These latest results validate the detection of a single strand of DNA with the "DTBGE" dumbbell and its advantage over the "DTRC" dumbbell. The range on beads corresponds to positive controls and allows validation of the method through detection. Finally, sandwich detection with the "DTBGE" dumbbell has the major advantage of being faster (less than 20 min) than the "DTRC" dumbbell as defined in [5]. In a second step, sandwich detection is performed in a complex medium (human blood plasma) to approximate the experimental conditions on clinical samples. The results are presented [Fig. 8]. Two linear ranges are obtained: the positive controls (dumbbells + beads) and the sandwich detection range. The four points corresponding to the negative controls appear at the last point of the detection range, resulting in a lower detection limit of 1 pM for oligonucleotide detection with the dumbbell according to the invention. The method using a dumbbell according to the invention therefore makes it possible to detect and quantify an oligonucleotide in complex medium up to a concentration of 1 pM in less than 30 min of amplification. 11.3. Protein quantification range on beads (direct). A direct detection method involves attaching a molecule of interest to beads beforehand via covalent bonding, and the dumbbell then detects the molecule thanks to the specific aptamer located at the 5' end of the dumbbell, "DTBGE". The scheme of this type of detection is shown [Fig. 9]. To validate protein detection, this protocol is performed with the "DTBGE" dumbbell which contains the "Thr1" aptamer at the 5' end specific to thrombin, previously immobilized on magnetic beads. The protocol implemented is as follows: - preparation of different bead solutions containing different concentrations of thrombin (100 nM — 1 nM), - blocking the magnetic balls for 30 minutes using a BSA solution, - Incubation with the "DTBGE" dumbbell solution at 100 pM under stirring at 25°C for 2 h, - - addition of the LAMP mix solution. The amplification results are presented [Fig.10]. [Fig.11] is a proof of concept of a possible quantification of thrombin down to the nanomolar scale in less than 30 min, by recognition of the aptamer placed at the end of the dumbbell chain and specific to the molecule to be recognized. This experiment therefore validates the use of the "DTBGE" dumbbell according to the invention. to recognize a protein in a direct detection format. However, for detection applications in complex samples, it is advantageous to be able to detect molecules in a sandwich format and in a specific manner. Section II.4 below therefore focuses on detection in a sandwich format using the "DTBGE" dumbbell according to the invention. 11.4. Quantification range for sandwich-format (indirect) proteins. Following the validation of the use of the dumbbell according to the invention for the direct recognition of molecules, a double aptamer sandwich can be considered and allow for the indirect detection of molecules in a complex sample. The principle of such detection is explained [Fig. 12]. The protocol used for the detection of the thrombin molecule, implementing two aptamers in sandwich recognition from the literature [6], is as follows: - immobilization of "Thr2" oligonucleotide probes of the 5'-AGTCCGTGGTAGGGCAGGTTGGGGTGACT-3' sequence functionalized with a biotin function at 5' (SEQ ID NO: 14 in the sequence list in the appendix) on magnetic beads, - magnetic ball locking at the BSA for 30 minutes - Incubation of different concentrations of the target thrombin under shaking at 25°C for 2 hours, - Incubation with the "D'TBGE" dumbbell at 100 pM under shaking at 25°C for 30 min, - Addition of the LAMP mix solution. These results, presented in [Fig. 13] and [Fig. 14], demonstrate proof of concept for thrombin detection using a double aptamer sandwich and the potential quantification of up to 1 nM of thrombin in less than 30 minutes of amplification with the "DTBGE" dumbbell according to the present invention. This method has the key advantage of completely eliminating the need for antibodies and enabling the detection of small quantities thanks to the sensitivity provided by the LAMP. TIL. Another variant of a dumbbell according to the present invention. The dumbbell according to the present invention has the major advantage of being generic and several detection schemes can be envisaged, several of which have been detailed in point II above. Alternatively, the halier according to the present invention may have a generic "Zip"-type sequence integrated at the end of the 5° chain, serving as a support for hybridizing another oligonucleotide strand, which can then contain various types of recognition entities without interfering with LAMP amplification. This complex then forms a recognition probe composed of two parts linked by DNA hybridization, which is a non-covalent chemical bond. We can consider three examples of such a variant, illustrated in [Fig.15]: - a molecule comprising a PI portion of the complementary oligonucleotide sequence type and a P2 portion of the aptamer type that hybridizes to entity E of the dumbbell. The aptamer can detect a molecule. This example notably allows the integration of RNA aptamers impossible with dumbbells as described in the prior art, - a molecule comprising a PI portion of the complementary oligonucleotide sequence type and a P2 portion of the antibody type which hybridizes to entity E of the dumbbell. This antibody then serves as a detection agent for the molecule of interest and is covalently or non-covalently coupled to the dumbbell, which can be amplified by LAMP with two primers, and - a molecule comprising a PI portion of the complementary oligonucleotide sequence type and a P2 portion of the antibody type which hybridizes to entity E of the dumbbell, the P1 and P2 portions being coupled to each other by biotin-streptavidin linkage. This antibody then serves as a detection agent for the molecule of interest and is coupled to the dumbbell amplifiable by LAMP with two primers. This method is as generic as possible because it adapts to a wide range of molecules using a single dumbbell. All of these different molecules sensitively detect targets thanks to LAMP amplification. Bibliographical references [1] US Patent 6,410,278 published on June 25, 2002. [2] Pourhassan-Moghaddam et al, 2013, “Protein detection through different platforms of immuno-loop-mediated isothermal amplification”, Nanoscale Research Letters, vol. 8:485, pages 1-11. [3] Du et al, 2016, “Ligation-based loop-mediated isothermal amplification (ligation-LAMP) strategy for highly selective microRNA detection”, Chem. Common,, vol. 52, pages 12721-12724. [4] Patent application CN 106148549 published on November 23, 2016. [5] Patent application EP 3878971 published on September 15, 2021. [6] Becherer et al, 2020, « Loop-mediated isothermal amplification (LAMP) — review and classification of methods for sequence-specific detection », vol. 12, pages 717-746. [7] Demande de brevet EP 3363913 publiée le 22 août 2018. [8] Daniel et al, 2013, « Real-time monitoring of thrombin interactions with its aptamers: Insights into the sandwich complex formation », Biosens. Bioelectron., vol. 40, pages 186-192.
Claims
Demands
1. Oligonucleotide with a dual stem-loop structure, object responding to the The following formula (T): [Chem.7] 5'-Fic-F2-F0"-F1-Int-Biîc-BO"-B2c-B1-3" (} in which the Flc portion has a nucleotide sequence complementary to the nucleotide sequence of portion F1 by which portion Flc and the F1 portion hybridize to form the stem of the first structure stem-loop, FO' separating portion F2 and portion F1 is either a covalent bond, either a portion comprising at least one nucleotide, The portion F2-FO0' forms the loop of the first stem-loop structure, hereinafter referred to as the FO loop, the B1 portion has a nucleotide sequence complementary to the nucleotide sequence of the Blc portion by which the B1 portion and portion B1c hybridize to form the stem of the second structure stem-loop, BO' separating portion Blc and portion B2c is either a bond covalent, that is, a portion comprising at least one nucleotide, the portion BO”-B2c forms the loop of the second stem-loop structure, hereinafter referred to as the BO loop, The interaction separating portion F1 and portion B1c is either a covalent bond, either a portion comprising at least one nucleotide, and said oligonucleotide has, at its 5' end and / or at its end 3', a structure comprising at least one entity E capable of binding, di- directly or indirectly, to an analyst of interest.
2. Oligonucleotide according to claim 1, characterized in that it meets to any one of the following formulas (II), (III) and (IV): [Chem.8] S-Fic-F2-FO-F1-int-B1c-BO0"-B2c-B1 3 (H) [Chem.9] F1c-F2-FO"-F1-Int-Bic-R0"-B2c-B1-S (Het [Chem.10] S-Fic-F2-FO"-F1-int-B1ic-B0"-82c-B1-S' {IV) in which FO', Int and B0? and the portions F1c, F2, F1, Blc, B2c and B1 are such that defined in claim 1, and Set S', identical or different, represents a structure comprising at least one entity E capable of linking itself, directly or indirectly, to a analyst of interest.
3. Oligonucleotide according to claim 1 or 2, characterized in that: said portion F1 and said portion Flc each comprise from 10 to 35 nucleotides, and said portion B1 and said portion B1c each comprise from 10 to 35 nucleotides, said portion F2 comprises 8 to 30 nucleotides and / or said portion B2c comprises 8 to 35 nucleotides.
4. Oligonucleotide according to any one of claims 1 to 3, ca- characterized in that: - when F0” is a portion comprising at least one nucleotide, said portion FO? is such that said loop FO formed by portion F2-F0” comprises 10 to 70 nucleotides, and / or - when BO® is a portion comprising at least one nucleotide, said portion BO” is such that the loop BO formed by portion B0”-B2c comprises 10 to 70 nucleotides.
5. Oligonucleotide according to any one of claims 2 to 4, ca- characterized in that said structure S or S' comprises, in addition to said at least one entity E, at least one other element allowing linking said at least one entity E at the 5' end of portion Flc of the oligonucleotide of formula (II) or (IV) or at the 3' end of the portion B1 of the oligonucleotide of formula (III) or (IV).
6. Oligonucleotide according to any one of claims 1 to 5, ca- characterized in that said at least one entity E is capable of forming di- directly to at least one analyte of interest.
7. Oligonucleotide according to claim 6, characterized in that said at less one entity EF is chosen from the group consisting of a carbohydrate; a peptide; an antigen; an epitope; a protein; a glycoprotein; an enzyme; an enzyme substrate; a membrane receptor or nuclear; an agonist or antagonist of a membrane receptor or nuclear; a toxin; a polyclonal or monoclonal antibody; a antibody fragment; a nucleotide molecule and an aptamer.
8. Oligonucleotide according to any one of claims 1 to 5, ca- characterized in that said at least one entity E is capable of forming an indicative bond directly to at least one analyte of interest.
9. Non-covalent complex, formed by an oligonucleotide according to claim- dication 8 and a molecule comprising a first portion P1 suitable for bind to said at least one entity E of said oligonucleotide and a second portion P2 capable of binding to at least one analyte of interest.
10. Use of a double stem-loop oligonucleotide according to any one of claims 1 to 8 or a non-covalent complex according to claim 9 to detect and optionally quantify at less one analyte possibly present in a liquid sample.
11. | Method for detecting and possibly quantifying at least one analyte possibly present in a liquid sample, including the Next steps: 1) bring the liquid sample into contact with the surface of a support solid comprising at least one active zone on which at least one probe capable of binding said at least one analyte is immobilized; 11) bring said surface into contact with a solution containing either less one oligonucleotide according to claim 6 or 7, i.e., one complex according to claim 9, said oligonucleotide and said complex having been prepared prior to said contact; iii) eliminate excess oligonucleotides or excess complexes that have did not react during the contact in step ii); (iv) bring said surface into contact with two amplification primers loop-mediated isotherm under conditions allowing the amplification of said oligonucleotide; v) detect and possibly quantify the amplification product said oligonucleotide.
12. A method for detecting and possibly quantifying an analyte may- actually present in a liquid sample, including the steps following: (l) bring said liquid sample into contact with the surface of a solid support including at least one active zone on which to at least one probe capable of binding said at least one analyte is immobilized; ii, ) bring said surface into contact with a solution containing at less a molecule comprising a first portion P1 capable of binding to entity E present in the oligonucleotide structure according to the claim- dication 8 and a second portion P2 capable of binding to said at least one analyst of interest; 1l,”) eliminate the excess molecules that did not react during the initial mixing contact of step 1i,°); 1i,) bring said surface into contact with a solution containing at less an oligonucleotide according to claim 8, said oligonucleotide having been synthesized prior to the said contact; iii”) eliminate excess oligonucleotides that did not react during the setting in contact with step 1i5'); iv') bring said surface into contact with two amplification primers loop-mediated isotherm under conditions allowing the amplification of said oligonucleotide; v') detect and possibly quantify the amplification product said oligonucleotide.
13. A method according to claim 11 or 12, characterized in that said The amplification product is detected, during said step v) or v'), by Turbidity measurement, by lensless imaging, using a pH probe, via gel electrophoresis, by colorimetric test or by measurement of fluorescence.