Gene therapy vectors and methods of production and use thereof
Patent Information
- Application Number
- GB2025022351
- Authority / Receiving Office
- GB · GB
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-06-21
- Filing Date
- 2024-06-18
- Publication Date
- 2026-07-08
AI Technical Summary
Current gene therapy vectors, such as rAAV, face limitations including limited payload capacity, immunogenicity, and manufacturing inefficiencies, while non-viral alternatives struggle to match their efficiency and persistence.
Development of circular DNA vectors with small replication origins and minimal bacterial elements, lacking antibiotic resistance genes and transcriptional regulatory elements, to enhance expression, persistence, and manufacturability, and reduce immunogenicity.
These vectors provide improved expression and safety, enabling efficient large-scale production and reduced immunogenicity, leading to persistent gene expression in target cells and tissues.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[0001] GENE THERAPY VECTORS AND METHODS OF PRODUCTION AND USE THEREOF
[0002] FIELD OF THE INVENTION
[0003] In the various aspects and embodiments, the present disclosure provides therapeutic vectors and pharmaceutical compositions thereof, as well as associated methods and engineered bacterial cells.
[0004] CROSS-REFERENCE TO RELATED APPLICATIONS
[0005] This application claims the benefit of U.S. Provisional Patent Application No. 63 / 509,458, filed June 21 , 2023, the entire contents of which are hereby incorporated by reference in their entirety.
[0006] SEQUENCE LISTING
[0007] This application contains a Sequence Listing in XML format submitted electronically herewith via Patent Center. The contents of the XML copy, created on June 11 , 2024, is named “IGT-014PC_138289-5014.xml” and is 200,459 bytes in size. The Sequence Listing is incorporated herein by reference in its entirety.
[0008] BACKGROUND
[0009] Gene therapy is emerging as a promising approach to treat a wide variety of diseases and disorders in human patients. RecSEQIDombinant adeno-associated viral (rAAV) vectors have an established record of high-efficiency gene transfer in human patients and a variety of model systems. Genomes of rAAV vectors are advantageous for their ability to persist in vivo as circular episomes for the life of the target cell. On the other hand, rAAV-based vectors suffer substantial drawbacks, such as limited maximum payload, immunogenicity, and manufacturing inefficiencies.
[0010] To address some of these challenges in rAAV technology, non-viral alternatives have gained traction in recent years. However, development of a scalable non-viral gene therapy platform that enjoys the efficiency and persistence of rAAV has proven elusive. For example, traditional bacterial plasmid DNA vectors represent a tool in gene delivery but are limited by having an abundance of bacterial components of plasmid DNA vectors, such as antibiotic resistance genes and transcriptional regulatory elements, which can lead to immunogenicity and loss of gene expression by transcriptional silencing.
[0011] There exists a need for non-viral vectors that have minimal bacterial elements and methods of producing them efficiently at large scale. SUMMARY
[0012] Provided herein are circular DNA vectors (e.g., non-viral DNA vectors), which can provide features including enhanced expression, persistence, safety, and manufacturability over previously described DNA vectors, such as AAV vectors, plasmids, and other circular DNA vectors lacking one or more backbone components. DNA vectors described herein contain small (e.g., less than 50- base pair) replication origins and lack sequences encoding selection markers (e.g., antibiotic resistance genes), which can reduce risks introduced by foreign sequences in the vector. In embodiments, the DNA vectors disclosed herein have about 200 base pairs (bp) or less, or about 150 bp or less, or about 100 bp or less, or about 75 bp or less, or about 50 bp or less of bacterially- derived nucleotide sequences. Such DNA vectors can be produced efficiently and at large scale for therapeutic applications, including with the use of methods disclosed herein. Additionally, by eliminating or reducing bacterial plasmid DNA sequences in the vector, transcriptional silencing of a circular DNA vector can be reduced or eliminated, resulting in persistence of the vector sequence in a cells and tissues of a subject. In particular embodiments, immunogenic components (e.g., bacterial endotoxin, DNA, or RNA, or bacterial signatures, such as CpG motifs) are absent in the circular DNA vectors or are present at very low levels suitable for pharmaceutical, clinical, or laboratory applications; therefore, the risk of stimulating a host immune response is reduced relative to certain conventional DNA vectors, such as plasmid DNA vectors.
[0013] Also provided herein are methods of producing the DNA vectors, host cells containing such DNA vectors (e.g., engineered bacterial cells useful in production of such DNA vectors), methods of using such DNA vectors (e.g., methods of expressing a therapeutic sequence in a target cell by administering the DNA vectors, and methods of treating disease or disorder by administering such DNA vectors), and pharmaceutical compositions containing such DNA vectors.
[0014] In one aspect, the disclosure provides a circular DNA vector or pharmaceutical composition thereof, wherein the circular DNA vector comprises a therapeutic sequence and a sequence comprising a bacterial replication origin. In embodiments, the sequence comprising the bacterial replication origin is less than 50 bp in length, and the circular DNA vector lacks a selectable marker. In various embodiments, the vector further lacks a recombination site. In some embodiments, the vector comprises a transposase scar.
[0015] In various embodiments, the sequence comprising the bacterial replication origin directly connects the 3’ end of the therapeutic sequence to the 5’ end of the therapeutic sequence.
[0016] In various embodiments, the circular DNA vector has about 200 base pairs (bp) or less, or about 150 bp or less, or about 100 bp or less, or about 75 bp or less, or about 50 bp or less of bacterially-derived sequences. In some embodiments, the replication origin is from a ColE2-related plasmid, and which is optionally ColE2-P9. In such embodiments, the replication origin is recognized by a ColE2-P9 replication protein. An exemplary ColE2-P9 replication protein comprises the amino acid sequence of SEQ ID NO: 1.
[0017] In some embodiments, the replication origin is 40 bp or less in length. In some embodiments, the replication origin is 36 bp or less in length, or 34 bp or less in length, or 32 bp of less in length, or 30 bp or less in length, or 28 bp or less in length. For example, the replication origin may have the nucleotide sequence of SEQ ID NO: 2, or may be a functional variant or truncated variant thereof.
[0018] In some embodiments, the replication origin is a truncated ColE2-P9 replication origin, where one strand of the replication origin comprises or consists of the nucleotide sequence of SEQ ID NO: 12.
[0019] In some embodiments, the replication origin is a truncated ColE2-P9 replication origin, wherein one strand of the replication origin comprises or consists of the nucleotide sequence of SEQ ID NO: 13.
[0020] In some embodiments, the replication origin is a truncated ColE2-P9 replication origin, wherein one strand of the replication origin comprises or consist of the nucleotide sequence of SEQ ID NO: 14.
[0021] In some embodiments, the replication origin is a truncated ColE2-P9 replication origin, wherein one strand of the replication origin comprises or consists of the nucleotide sequence of SEQ ID NO: 15.
[0022] In some embodiments, the replication origin is a truncated ColE2-P9 replication origin, wherein one strand of the replication origin comprises or consists of the nucleotide sequence of SEQ ID NO: 16.
[0023] In some embodiments, the replication origin is a truncated ColE2-P9 replication origin, wherein one strand of the replication origin comprises or consists of the nucleotide sequence of SEQ ID NO: 17.
[0024] In some embodiments, the replication origin is a truncated ColE2-P9 replication origin, wherein one strand of the replication origin comprises or consists of the nucleotide sequence of SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4.
[0025] In some embodiments, the replication origin comprises or consists of the nucleic acid sequence of X1X2X3X4X5TGTTATCTGATAAGGCTTATCTGGTCTX6X7 (SEQ ID NO: 18), wherein each X is selected from A, T, C, or G. In some embodiments: Xi is A, T, or C; X2 is A, T, or C; X3 is A, T, or G; X4 is A, T, or C; X5 is A, T, or G; Xs is C; X? is A.
[0026] In some embodiments, the circular DNA vector is a non-integrating circular DNA vector. The therapeutic sequence may comprise a scaffold-matrix attachment region (S / MAR), to enhance cellular persistence. In some embodiments, the therapeutic sequence is greater than 4.5 kb. In some embodiments, the circular DNA vector is monomeric and supercoiled.
[0027] In some embodiments, the therapeutic sequence comprises an ocular gene. In some embodiments, the ocular gene is selected from MYO7A, BEST 1 , CFH, CEP290, USH2A, ADGRV1 , CDH23, CRB1 , PCDH15, RPGR, ABCA4, ABCC6, RIMS1, LRPS, CC2D2A, TRPM1 , C3, IFT172, COL1 1A1 , TUBGCP6, KIAA1549, CACNA1F, SNRNF200, PRPF8, VCAN, USH2A, HMCN1 , RPE65, NR2E3, NRL, RHO, RP1 , RP2, and OFD1.
[0028] In some embodiments, the ocular gene comprises a nucleic acid sequence that is at least 90% identical to SEQ ID NO: 19 or SEQ ID NO: 20, and the ocular gene encodes a polypeptide having the amino acid sequence of SEQ ID NO: 63 (CFH).
[0029] In some embodiments, the ocular gene comprises a nucleic acid sequence that is at least 90% identical to SEQ ID NO: 21 , and the ocular gene encodes a polypeptide having the amino acid sequence of SEQ ID NO: 61 (ABCA4). In some embodiments, the nucleic acid sequence is at least 90% identical to SEQ ID NO: 8, and optionally comprises the nucleic acid sequence of SEQ ID NO: 8.
[0030] In some embodiments, the ocular gene comprises a nucleic acid sequence that is at least 90% identical to SEQ ID NO: 22, and encodes a polypeptide having the amino acid sequence of SEQ ID NO: 62 (MYO7A). In some embodiments, the nucleic acid sequence is at least 90% identical to SEQ ID NO: 23, and optionally comprises the nucleic acid sequence of SEQ ID NO: 23.
[0031] In various embodiments, the therapeutic sequence comprises a CAG promoter controlling expression of a therapeutic gene (e.g., an ocular gene).
[0032] In some embodiments, the therapeutic sequence further comprises a regulatory element comprising a sequence derived from ABCA4 intron 6. For example, the regulatory element can be derived from the 5’ half of ABCA4 intron 6. In some embodiments, the regulatory element comprises at least 90% identity to at least 500 consecutive nucleotides within ABCA4 intron 6. For example, the at least 500 consecutive nucleotides may comprise consecutive nucleotides within nucleotides 3,158 to 4,822 of intron 6. In some embodiments, the regulatory element comprises the nucleic acid sequence of SEQ ID NO: 24, or a functional variant thereof. In other aspects, the disclosure provides a method of expressing a therapeutic sequence in an ocular cell of a subject. The method comprises delivering the circular DNA vector encoding an ocular protein to the ocular cell (e.g., an ocular cell of the retina). In some embodiments, the circular DNA vector is delivered to the ocular cell by ocular administration. In some embodiments, the expression persists in ocular cells for at least 12 months after the administration of the circular DNA vector to the subject. In some embodiments, the circular DNA vector is administered no more frequently than about once every three months, about once every four months, about once every six months, about once every eight months, or about once every year. In various embodiments, the subject has an ocular disease, and the ocular gene may replace a mutated copy in the subject.
[0033] In other aspects, the therapeutic sequence comprises a respiratory gene. In embodiments, the respiratory gene encodes cystic fibrosis transmembrane receptor (CFTR), and the therapeutic sequence optionally comprises an elongation factor 1 (EF1A) promoter. In some embodiments, the therapeutic sequence further comprises a hypersensitivity sequence 5’ to the respiratory gene. An exemplary hypersensitivity sequence comprises the nucleotide sequence of SEQ ID NO: 28, or a functional variant thereof.
[0034] In an aspect, the disclosure provides a method of expressing a therapeutic sequence in an airway cell of a subject. The method comprises delivering the circular DNA vector of this disclosure (expressing a respiratory gene) to the airway cell of the subject. In some embodiments, the subject has a respiratory disease such as cystic fibrosis.
[0035] In another aspect, the disclosure provides a circular DNA vector (as disclosed), where the therapeutic sequence comprises a modulatory protein-encoding gene, which can be an immunomodulatory protein-encoding gene. In certain embodiments, the immunomodulatory protein-encoding gene is a dendritic cell chemoattractant-encoding gene, a dendritic cell growth factor or activator-encoding gene, or a lymphocyte signaling protein-encoding gene. In some embodiments, the dendritic cell chemoattractant-encoding gene is XCL1, XCL2, CCL5, or CCL4; the dendritic cell growth factor or activator-encoding gene is FLT3L, GMCSF, or CD40; or the lymphocyte signaling protein-encoding gene is IL-12, IL-15, CXCL9, or CXCL10. In some embodiments, the circular DNA vector is a bi-cistronic or multi-cistronic vector encoding two, three, or more modulatory protein-encoding genes.
[0036] In a related aspect, the disclosure provides a method of expressing a therapeutic sequence comprising a modulatory protein-encoding gene in a target cell of a subject. The method comprises delivering the circular DNA vector of this disclosure to the target cell of the subject (which in some embodiments comprises a tumor). In some embodiments, the subject has cancer, and the method modulates a tumor microenvironment in the subject. In still other aspects and embodiments, the therapeutic sequence encodes an antigenbinding protein, an enzyme, a growth factor, a hormone, an interleukin, an interferon, a cytokine, an anti-apoptosis factor, an anti-diabetic factor, a coagulation factor, an anti-tumor factor, a liver secreted protein, or a neuroprotective factor.
[0037] In other aspects, the therapeutic sequence comprises a transcriptional knockdown sequence, and which may be selected from a micro-RNA-encoding sequence, a short hairpin RNA- encoding sequence, a zinc finger nuclease-encoding sequence, a TALEN-encoding sequence, a dCAS9-encoding sequence, a guide RNA-encoding sequence, or a combination thereof. In some embodiments, the transcriptional knockdown sequence comprises one or more guide RNA- encoding sequences and a dCAS9-encoding sequence. For example, the dCAS9-encoding sequence may be fused to one or more repressor proteins (e.g., transcription repressor proteins). In some embodiments, the therapeutic sequence further comprises a therapeutic protein-encoding sequence, wherein the transcriptional knockdown sequence is configured to silence transcription of endogenous expression of a target gene, and wherein the therapeutic sequence encodes a therapeutic replacement protein encoded by a functional version of the target gene. In related aspects, the disclosure provides a method of knocking down transcription of a mutated target gene in a cell in a subject in need. The method comprises contacting the circular DNA vector of any one of the disclosure with the cell under conditions suitable to knock down transcription of the mutated target gene.
[0038] In another aspect, the therapeutic sequence comprises a gene editing sequence. Exemplary gene editing sequences encode guide RNA and / or a CRISPR-associated (Cas) endonuclease (e.g., Cas9).
[0039] In another aspect, the present disclosure provides an engineered bacterial cell for replicating the circular DNA vector. The engineered bacterial cell comprises: (a) the circular DNA vector of the present disclosure, and (b) a Rep gene encoding a bacterial replication protein that binds to the bacterial replication origin of the circular DNA vector, wherein the Rep gene replicates the circular DNA vector.
[0040] In some embodiments, the therapeutic sequence comprises a transposase overhang sequence, which may be (without limitation) TTAA. In such embodiments, the bacterial cell comprises a transposase protein, wherein the transposase protein hydrolyzes DNA adjacent to a transposase overhang sequence. In some embodiments, the transposase protein is encoded by a transposase gene expressed by the engineered bacterial cell, and may be integrated into the bacterial genome. In some embodiments, the engineered bacterial cell further comprises an insertion sequence excision enhancer (IEE), which can be encoded by a gene that is integrated into the bacterial genome. In some embodiments, the engineered bacterial cell further comprises a closed-ended linear DNA molecule comprising a plasmid backbone. The plasmid backbone may comprise a selectable marker (which may be an antibiotic resistance gene and / or a counterselection marker).
[0041] In various embodiments, the replication origin is the only bacterial sequence in the circular DNA vector. In embodiments, the engineered bacterial cell (e.g., in culture) comprises at least 10 copies of the circular DNA vector on average. In various embodiments, the circular DNA vector is monomeric. In some embodiments, the bacterial cell in culture comprises a mean copy number of the circular DNA vector per engineered bacterial cell of at least 10, or at least 15, or at least 20.
[0042] In another aspect, the disclosure provides an engineered bacterial cell for producing the circular DNA vector, the cell comprising: (a) a plasmid template, wherein the plasmid template comprises: (i) a first segment comprising a therapeutic sequence and a sequence comprising a bacterial replication origin, wherein the first segment is flanked by two transposase overhang sequences; and (ii) a second segment comprising a plasmid backbone, wherein the second segment is flanked by a left end (LE) repeat and a right end (RE) repeat, wherein the LE repeat and the RE repeat can be bound by the transposase protein; and (b) a Rep gene encoding a bacterial replication protein that binds to the bacterial replication origin. In various embodiments, the bacterial cell further comprises a transposase protein, wherein the transposase protein hydrolyzes DNA adjacent to a transposase overhang sequence. In some embodiments, the engineered bacterial cell further comprises (e.g., produces): (c) a circular DNA vector comprising the therapeutic sequence, the sequence comprising the bacterial replication origin, and one of the two transposase overhang sequences; and / or (d) a linear closed-ended DNA molecule comprising the plasmid backbone flanked by the LE repeat and the RE repeat.
[0043] In some embodiments, the transposase protein is encoded by a transposase gene expressed by the engineered bacterial cell, and which may be integrated into the bacterial genome. In some embodiments, the engineered bacterial cell further expresses an IEE, wherein the IEE may be encoded by a gene that is integrated into the bacterial genome.
[0044] In some embodiments, the sequence comprising the bacterial replication origin directly connects the 3’ end of the therapeutic sequence to the 5’ end of the therapeutic sequence. In various embodiments, the sequence comprising the bacterial replication origin is less than 50 bp in length (e.g., as described herein). In various embodiments, the bacterial replication origin is a ColE2-P9 replication origin (e.g., as described herein).
[0045] In various embodiments, the first segment and the circular DNA vector lack a selectable marker, and wherein the second segment and the plasmid backbone comprises a selectable marker. As described herein, selected markers include antibiotic resistance genes and counterselection markers.
[0046] In various embodiments, the therapeutic sequence is a eukaryotic sequence (e.g., as described herein).
[0047] In various embodiments, the engineered bacterial cell does not comprise any extra- genomic circular DNA molecules other than one or more copies of the circular DNA vector, plasmid template, or second segment comprising the plasmid backbone.
[0048] In related aspects, the disclosure provides a method of making the circular DNA vector of this disclosure. The method comprises: (a) providing a bacterial cell comprising a Rep gene encoding a bacterial replication protein that binds to a bacterial replication origin and a plasmid template, wherein the plasmid template comprises: (i) a first segment comprising a therapeutic sequence and a sequence comprising the bacterial replication origin; and (ii) a second segment comprising a plasmid backbone; and (b) contacting the plasmid within the bacterial cell with an enzyme to circularize the first segment, thereby producing the circular DNA vector containing the therapeutic sequence and the replication origin.
[0049] In various embodiments, the method further comprises culturing the bacterial cell under conditions suitable for replication of the circular DNA vector, thereby preparing a bacterial cell culture replicating the circular DNA vector. In certain embodiments, the enzyme is encoded on a helper plasmid or a bacterial artificial chromosome (BAC) within the bacterial cell. In some embodiments, the bacterial cell culture (replicating the circular DNA vector) is substantially devoid of helper plasmid or BAC. In various embodiments, the mean copy number of the circular DNA vector per bacterial cell (e.g., in culture) is at least 10, or is at least 15, or is at least 20.
[0050] In some embodiments, the enzyme is a transposase. For example, the second segment is flanked by a left end (LE) repeat and a right end (RE) repeat, wherein the LE repeat and the RE repeat are bound by the transposase protein. In some embodiments, the second segment comprises a selectable marker and the first segment lacks a selectable marker. In various embodiments, the selectable marker is selected from one or more of an antibiotic resistance gene and a counterselection marker. In still further embodiments, the bacterial cell expresses an IEE.
[0051] In various embodiments, the circular DNA vector is isolated from the bacterial cell or culture thereof.
[0052] Further aspects and embodiments of the disclosure will be apparent to the skilled person in view of the following detailed description and drawings. BRIEF DESCRIPTION OF THE DRAWINGS
[0053] The features of the present disclosure are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the disclosure are utilized, and the accompanying drawings of which:
[0054] FIG. 1 is a table showing results from a stability study in which three ColE2-P9 replication origins were tested for their ability to confer stability to plasmids over E. coli expansion. A 40-bp ColE2-P9 origin is shown (SEQ ID NO: 2) along with an opposite strand sequence (SEQ ID NO: 43). SEQ ID NOS: 44 and 45 represent truncated ColE2-P9 origins.
[0055] FIG. 2 illustrates an example of an assembly method for a parental plasmid that can be used in embodiments disclosed herein.
[0056] FIG. 3 illustrates an exemplary procedure for production of a test circular DNA vector according to embodiments disclosed herein involving a recombinase as an enzyme for removing the sequence of interest from the backbone and re-circularizing the circular DNA vector.
[0057] FIG. 4 shows the results of agarose gel electrophoresis of extrachromosomal DNA purified from engineered bacteria grown in rich media with either chloramphenicol (“Cm”; lanes 7-12) or no chloramphenicol (“No Cm”; Lanes 1-6). Lanes 2, 3, 5, 8, 9, and 11 show bands corresponding to a test circular DNA vector produced by recombination from a test parental plasmid. Lanes 1, 4, 7, and 10, show bands corresponding to a test parental plasmid.
[0058] FIG. 5 is a graph showing the percentage of sfGFP-positive cells in the indicated growth media with or without chloramphenicol (“Cm”). ZB = Zymo Broth; TB = Terrific Broth; SB = Super Broth; SOB = Super Optimal Broth; SOC = Super Optimal Broth with Catabolite Repression; LB = Luria Broth.
[0059] FIG. 6 is a schematic chart showing an exemplary process of producing a circular DNA vector of the disclosure using counterselection.
[0060] FIGS. 7A to 7F are schematic drawings showing contents of a bacterial artificial chromosome (BAC)-based method of expressing Bxb1 to produce circular DNA vector. FIG. 7A is a Rep gene integrated into the host genome. FIG. 7B and 7C are two alternative BAC designs; the Bxb1 of FIG. 7B is driven by a cuminic acid inducible promoter, whereas the Bxb1 of FIG. 7C is driven by an arabinose inducible promoter. FIG. 7D is a template plasmid, which, upon recombination by Bxb1, becomes the circular DNA vector of FIG. 7E and the byproduct of FIG. 7F. Because the circular DNA vector contains the replication origin, and (optionally) the byproduct contains a PheS counterselection marker, the circular DNA vector becomes the dominant species as the host bacteria duplicate and expand.
[0061] FIG. 8A and 8B are photographs showing fluorescence of clones at 24 and 72 hours, respectively, post-transformation using BAC 1696.
[0062] FIG. 9A and 9B are photographs showing fluorescence of clones at 24 and 72 hours, respectively, post-transformation using BAC 1696.
[0063] FIG. 10 is a set of photographs showing fluorescence of clones 24 hours after contact with cuminic acid inducer.
[0064] FIG. 11 is a set of photographs showing fluorescence of clones 24 hours after contact with arabinose inducer.
[0065] FIG. 12 is a series of photographs showing fluorescence of re-streaked 1696 colonies incubated overnight on LB agar plates under various conditions.
[0066] FIG. 13 is a series of photographs showing fluorescence of re-streaked 1697 colonies incubated overnight on LB agar plates under various conditions.
[0067] FIG. 14 is photograph of a gel electrophoresis experiment showing presence of circular DNA vector in counterselected cultures for both 1696 and 1697. A digestion map showing theoretical bands is shown to the left of the photograph.
[0068] FIG. 15A is a plasmid map of an exemplary ABCA4 template plasmid.
[0069] FIG. 15B is a plasmid map of an ABCA4 circular DNA vector resulting from the template plasmid of FIG. 15A.
[0070] FIG. 16A is a theoretical gel map showing banding patterns for circular DNA construct digests described in Example 7. FIG. 16B is a photograph of a gel showing actual banding patterns corresponding to FIG. 16A.
[0071] FIG. 17A is a histogram showing long-read sequencing data from purified ABCA4 circular DNA vectors produced using an overnight Kan resistance incubation with template plasmid. Major peaks are BAC and dimeric circular DNA vector.
[0072] FIG. 17B is a histogram showing long-read sequencing data from purified ABCA4 circular DNA vectors produced using a 2-hour Kan resistance incubation with template plasmid. Major peaks are monomeric circular DNA vector and BAC.
[0073] FIG. 18 is a plasmid map showing components of a helper plasmid useful for expressing
[0074] Bxb1 in a bacterial host. FIG. 19 is a photograph showing green fluorescent colonies (circled) which contain circular DNA vector without backbone byproduct as a result of Bxb1 expression by the helper plasmid of FIG. 18.
[0075] FIG. 20 is a set of drawings depicting a process of integrating Bxb1 into the host cell genome.
[0076] FIG. 21 is a photograph of a gel showing two positive clones for Bxb1 integration. 1696 plasmid controls are shown in a triplicate at the bottom left.
[0077] FIG. 22 is a schematic drawing illustrating an exemplary procedure for production of a test circular DNA vector containing GFP, according to embodiments disclosed herein involving transposase as an enzyme for removing the sequence of interest from the backbone and recircularizing the circular DNA vector.
[0078] FIG. 23A is a table showing results of a screening study in which a ColE2-P9 replication origin was varied at its termini and tested for colony size. SEQ ID NOS: 46 and 47 represent both strands of a plasmid comprising the ColE2-P9 origin. Partial plasmid sequences are provided for plasmids 55002 (SEQ ID NO: 48), 55003 (SEQ ID NO: 49), 55004 (SEQ ID NO: 50), 55005 (SEQ ID
[0079] NO: 51), 55006 (SEQ ID NO: 52), 55007 (SEQ ID NO: 53), 55008 (SEQ ID NO: 54), 55009 (SEQ ID
[0080] NO: 55), 55010 (SEQ ID NO: 56), 55033 (SEQ ID NO: 57), 55034 (SEQ ID NO: 58), 55035 (SEQ ID
[0081] NO: 59), and 55036 (SEQ ID NO: 60).
[0082] FIG. 23B is a series of photographs showing carb plates after seeding with S1037 E co / i cells transformed with circular DNA vectors containing each variant of ColE2-P9 replication origin shown in FIG. 23A.
[0083] FIG. 24 is a photograph of a western blot showing that HEK293T cells transfected with bacterially produced ABCA4 circular DNA vectors express ABCA4 protein.
[0084] DETAILED DESCRIPTION
[0085] There have been efforts to improve plasmid DNA vectors (e.g., for use in gene therapy) by removing plasmid backbone components. For example, minicircles are made in bacterial cells using recombination to remove the backbone from the plasmid, producing a minicircle vector and a circular backbone byproduct. Minicircles, however, are difficult to produce at large scale, in part because of difficulties in removing backbone byproduct, which has similar properties to the minicircle product. Alternative vector types, such as nanoplasmids, have been designed for easier purification through positive selection by including a replication origin and selectable marker in the vector. But such extraneous elements are relatively large - generally hundreds of base pairs in length - and are foreign to the patient, which can introduce risks of immunogenicity and / or transgene silencing.
[0086] Provided herein are circular DNA vectors (e.g., non-viral DNA vectors), which can provide features including enhanced expression, persistence, safety, and manufacturability over previously described DNA vectors, such as AAV vectors, plasmids, and other circular DNA vectors lacking one or more backbone components. DNA vectors described herein contain small (e.g., less than 50- base pair) replication origins and lack sequences encoding selection markers (e.g., antibiotic resistance genes), which can reduce risks introduced by foreign sequences in the vector. In embodiments, the DNA vectors disclosed herein have about 200 base pairs (bp) or less, or about 150 bp or less, or about 100 bp or less, or about 75 bp or less, or about 50 bp or less of bacterially- derived sequences. Such DNA vectors can be produced efficiently and at large scale for therapeutic applications, including with the use of methods disclosed herein. Additionally, by eliminating or reducing bacterial plasmid DNA sequences, transcriptional silencing of a circular DNA vector can be reduced or eliminated, resulting in persistence of the vector sequence in a subject. In particular embodiments, immunogenic components (e.g., bacterial endotoxin, DNA, RNA, and bacterial nucleic acid signatures such as CpG motifs) are absent in the present circular DNA vectors or are present at very low levels suitable for pharmaceutical, clinical, or laboratory applications; therefore, the risk of stimulating a host immune response is reduced relative to certain conventional DNA vectors, such as plasmid DNA vectors.
[0087] Also provided herein are methods of producing the DNA vectors, host cells containing such DNA vectors (e.g., engineered bacterial cells useful in production of such DNA vectors), methods of using such DNA vectors (e.g., methods of expressing a therapeutic sequence in a target cell by administering such DNA vectors, and methods of treating disease or disorder by administering such DNA vectors), and pharmaceutical compositions containing such DNA vectors.
[0088] I. Definitions
[0089] As used in this specification and the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. It should also be noted that the term “or” is generally employed in its sense including “and / or” unless the context clearly dictates otherwise. The terms “and / or" and “any combination thereof” and their grammatical equivalents as used herein, can be used interchangeably. These terms can convey that any combination is specifically contemplated. Solely for illustrative purposes, the following phrases “A, B, and / or C” or “A, B, C, or any combination thereof” can mean “A individually; B individually; C individually; A and B; B and C; A and C; and A, B, and C.” The term “or” can be used conjunctively or disjunctively, unless the context specifically refers to a disjunctive use. As used herein, the term “about" refers to a value within ± 10% variability from the reference value, unless otherwise specified or the context requires otherwise.
[0090] As used in this specification and claim(s), the words “comprising” (and any form of comprising, such as “comprise” and “comprises”), “having” (and any form of having, such as “have” and “has"), “including” (and any form of including, such as “includes" and “include”) or “containing” (and any form of containing, such as “contains” and “contain”) are inclusive or open- ended and do not exclude additional, unrecited elements or method steps. It is contemplated that any embodiment discussed in this specification can be implemented with respect to any method or composition of the present disclosure, and vice versa. Furthermore, compositions of the present disclosure can be used to achieve methods of the present disclosure.
[0091] Reference in the specification to “some embodiments,” “an embodiment,” “one embodiment,” or “other embodiments” means that a particular feature, structure, or characteristic described in connection with the embodiments is included in at least some embodiments, but not necessarily all embodiments, of the present disclosure. Certain specific details of this description are set forth in order to provide a thorough understanding of various embodiments. However, one skilled in the art will understand that the present disclosure may be practiced without these details. In other instances, well-known structures have not been shown or described in detail to avoid unnecessarily obscuring descriptions of the embodiments.
[0092] The term “promoter” refers to a regulatory element that regulates transcription of a gene operably linked thereto and includes (a) one or more sequence sufficient to direct transcription and / or (b) recognition sites for RNA polymerase and other transcription factors required for transcription. In some embodiments, the promoter is operably linked 5’ to the gene (e.g., operably linked upstream of the gene). Some promoters can direct cell-specific expression.
[0093] As used herein, the term “operably linked” refers to an arrangement of elements, wherein the components so described are configured so as to perform their usual or intended function. A nucleic acid is “operably linked” when it is placed into a functional relationship with another nucleic acid sequence. For example, a promoter is operably linked to one or more heterologous genes if it directs the transcription of the one or more heterologous genes in a cell. Further, control elements operably linked to a coding sequence are capable of effecting (e.g., enhancing) the expression of the coding sequence. The control elements need not be contiguous with the coding sequence, so long as they function to direct the expression thereof. Thus, for example, intervening untranslated yet transcribed sequences can be present between a promoter sequence and the coding sequence, and the promoter sequence can still be considered “operably linked” to the coding sequence. As used herein, the term “vector” refers to a nucleic acid molecule capable of delivering a therapeutic sequence to which is it linked into a target cell in which the therapeutic sequence can then be transcribed, replicated, processed, and / or expressed in the target cell. One type of vector is a “plasmid”, which refers to a circular double stranded DNA loop containing a bacterial backbone into which additional DNA segments may be ligated. Another type of vector is a phage vector. Another type of vector is a viral vector (e.g., adeno-associated viral (AAV) vector), wherein additional DNA segments may be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) can be integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as “recombinant expression vectors” (or simply, “recombinant vectors” or “expression vectors”). Any of the nucleic acid vectors described herein may be referred to as “isolated nucleic acid vectors.”
[0094] As used herein, the term “circular DNA vector” refers to a DNA vector in a circular form. The term “circular DNA vector” is used interchangeably herein with the terms “covalently closed 3 and circular DNA vector” and “C DNA.” A skilled artisan will understand that such circular vectors include vectors that are covalently closed with supercoiling and complex DNA topology. In particular embodiments, a circular DNA vector is supercoiled (e.g., monomeric supercoiled). In other embodiments, a circular DNA vector is relaxed open circular (covalently closed without supercoiling). In certain instances, a circular DNA vector is non-integrating (e.g., an episomal circular DNA vector).
[0095] As used herein, the term “therapeutic sequence” refers to the portion of a DNA molecule (such as a DNA vector) that contains genetic material for expression in a target cell (e.g., a cell in a subject, such as a mammalian or human subject) of one or more therapeutic moieties, which may include one or more protein coding sequences or one or more RNAs. Other sequences that may be included within the term therapeutic sequence include promoters, terminators, introns, and / or other regulatory elements (e.g., S / MARs and / or intron-derived regulatory elements). A therapeutic moiety can be a therapeutic protein (e.g., a replacement protein, such as a protein that replaces a defective protein in the target cell) and / or a therapeutic RNA (e.g., a microRNA or siRNA). Other therapeutic sequences are described herein. In circular DNA vectors having more than one transcription unit, the therapeutic sequence contains all of the transcription units. A therapeutic sequence may include one or more genes (e.g., heterologous genes or transgenes, e.g., ocular genes) to be administered for a therapeutic purpose. In some embodiments, the therapeutic sequence is a mammalian sequence (e.g., a human sequence).
[0096] As used herein, “exogenous” refers to any material introduced from or produced outside an organism, cell, tissue or system.
[0097] As used herein, the terms “parental plasmid,” “plasmid template,” and “template plasmid” are used interchangeably to refer to a plasmid that contains both a vector sequence (as defined below) and a “backbone sequence” (as defined below). Embodiments disclosed herein include methods of making a circular DNA vector that include removing the backbone sequence from the plasmid template.
[0098] As used herein, a “vector sequence” of a parental plasmid refers to a portion of plasmid DNA that includes regions of the parental plasmid that will be present in the vector (e.g., circular DNA vector), i.e., (i) an origin of replication and (ii) a therapeutic sequence. In some embodiments, the vector sequence does not include a selectable marker (e.g., does not include a drug resistance gene). In some descriptions of embodiments herein, a vector sequence is referred to as a “first segment” of a plasmid.
[0099] As used herein, a “backbone sequence” refers to a portion of plasmid DNA other than the therapeutic sequence(s), the origin of replication. The backbone sequence can comprise bacterial- derived sequences. Backbone sequences include selectable markers such as drug resistance genes or fragments thereof, and recombination sites. In various embodiments, the majority of the backbone sequence is removed from a parental plasmid or plasmid template to create the circular DNA vector. In accordance with embodiments, the circular DNA vector will contain minimal bacterial sequences, such as about 200 bps or less, or about 150 bps or less, or about 100 bps or less, or about 75 bps or less, or about 50 bps or less.
[0100] As used herein a “replication protein” is a protein that is necessary for initiation of replication at an origin of replication sequence that corresponds to the replication protein (e.g., wherein the replication protein binds the origin of replication to initiate replication). A particular origin of replication sequence corresponds to a given replication protein if the origin of replication depends on the replication protein for initiation of replication at the origin of replication sequence. As an example, the replication protein encoded by a ColE2-P9 plasmid corresponds with the ColE2-P9 ori sequence; i.e., the ColE2-P9 replication protein is necessary for initiation of DNA replication at a ColE2-P9 ori sequence.
[0101] As used herein, the term “recombination site” refers to a nucleic acid sequence that is a product of site-specific recombination, which includes a first sequence that corresponds to a portion of a first recombinase attachment site and a second sequence that corresponds to a portion of a second recombinase attachment site. One example of a hybrid recombination site is attR, which is a product of site-specific recombination and includes a first sequence that corresponds to a portion of attP and a second sequence that corresponds to a portion of attB. Alternatively, recombination sites can be generated from Cre / Lox recombination. Thus, a vector generated from Cre / Lox recombination (e.g., a vector including a LoxP site) includes a recombination site, as used herein. Other site-specific recombination events that generate recombination sites involve, e.g., lambda integrase, FLP recombinase, and Kw recombinase. Nucleic acid sequences that result from non-site-specific recombination events (e.g., ITR-mediated intermolecular recombination) are not recombination sites, as defined herein.
[0102] As used herein, a “functional variant” of a nucleic acid sequence differs in at least one nucleic acid residue from the reference nucleic acid sequence, such as a naturally occurring nucleic acid sequence, wherein relevant functional activity of the variant is at least about 90% of the level of relevant functional activity of the reference nucleic acid sequence (e.g., substantially similar to the relevant function of the reference nucleic acid sequence). In this context, the difference in at least one nucleic acid residue may consist, for example, in a mutation of a nucleic acid residue to another nucleic acid residue, a deletion of a nucleic acid residue, or an insertion of a nucleic acid residues. A variant may encode a homolog, isoform, or transcript variant of a therapeutic protein or a fragment thereof encoded by the reference nucleic acid sequence, wherein the homolog, isoform or transcript variant is characterized by a degree of identity or homology, respectively, as defined herein.
[0103] In some instances, a functional variant of a polynucleotide or polypeptide includes at least one nucleic acid or amino acid substitution (e.g., 1-100 nucleic acid or amino acid substitutions, 1- 50 nucleic acid or amino acid substitutions, 1-20 nucleic acid or amino acid substitutions, 1-10 nucleic acid or amino acid substitutions, e.g., 1 nucleic acid or amino acid substitution, 2 nucleic acid or amino acid substitutions, 3 nucleic acid or amino acid substitutions, 4 nucleic acid or amino acid substitutions, 5 nucleic acid or amino acid substitutions, 6 nucleic acid or amino acid substitutions, 7 nucleic acid or amino acid substitutions, 8 nucleic acid or amino acid substitutions, 9 nucleic acid or amino acid substitutions, or 10 nucleic acid or amino acid substitutions). Nucleic acid substitutions that result in the expressed polypeptide having an exchanged in amino acids from the same class are referred to herein as conservative substitutions. In particular, these are amino acids having aliphatic side chains, positively or negatively charged side chains, aromatic groups in the side chains or amino acids, the side chains of which can form hydrogen bridges, e.g., side chains which have a hydroxyl function. By conservative substitution, e.g., an amino acid having a polar side chain may be replaced by another amino acid having a polar side chain, or, for example, an amino acid characterized by a hydrophobic side chain may be substituted by another amino acid having a hydrophobic side chain (e.g., serine by threonine, or leucine by isoleucine.
[0104] In order to determine the percentage to which two sequences (e.g., nucleic acid sequences or amino acid sequences) are identical, the sequences can be aligned in order to be subsequently compared to one another. For this purpose, gaps can be inserted into the sequence of the first sequence and the component at the corresponding position of the second sequence can be compared. If a position in the first sequence is occupied by the same component as is the case at a corresponding position in the second sequence, the two sequences are identical at this position. The percentage, to which two sequences are identical, is a function of the number of identical positions divided by the total number of positions. The percentage to which two sequences are identical can be determined using a mathematical algorithm. A preferred, but not limiting, example of a mathematical algorithm, which can be used is the algorithm of Karlin et al. (1993), PNAS USA, 90:5873-5877 or Altschul et al. (1997), Nucleic Acids Res., 25:3389-3402. Such an algorithm can be integrated, for example, in the BLAST program. Sequences which are identical to the sequences of the present invention to a certain extent can be identified by this program.
[0105] As used herein, the term “flank,” “flanking,” and “flanked” refer to a pair of regions or points on a nucleic acid molecule (e.g., a plasmid) that are outside a reference region of the nucleic acid molecule. In some embodiments, a pair of regions or points flanking a reference region on a nucleic acid are adjacent to (i.e., abut) the reference region (i.e., there are no intervening bases between the reference point and the flanking point). In other embodiments, a pair of regions or points on a nucleic acid molecule that flank a reference region are separated from the reference region by one or more intervening bases (e.g., up to 1 ,000 intervening bases). For example, a first and second restriction site are said to flank a given sequence if the first restriction site is 200 bases upstream of the sequence and the second restriction site is 100 bases downstream of the sequence. In some embodiments, all intervening sequences between a flanking region or point and a reference region are devoid of bacterial sequences. In such embodiments, there are no bacterial sequences other than an ori sequence in a circular DNA vector produced by self-ligating or circularization (e.g., by recombination or transposition) a vector sequence that was cut out of a parental plasmid at restriction sites or recombination sites flanking the vector sequence. For example, in such embodiments, an exogenous restriction enzyme that cuts sites flanking a vector sequence may produce a circular DNA vector having a sequence between the 5’ end and 3’ end of the therapeutic sequence; however, this region contains no bacterial sequences (e.g., drugresistance genes). Such intervening sequences may be artifacts from sticky end ligation, e.g., corresponding to overhang bases generated by the exogenous restriction enzyme. As used herein, an “ocular gene" means a gene that is preferentially, selectively, or exclusively expressed in ocular tissue or that is involved in ocular functions such as eyesight.
[0106] As used herein, the term “protein” refers to a plurality of amino acids attached to one another through peptide bonds (i.e., as a primary structure).
[0107] As used herein, the term “therapeutic protein” refers to a protein that can treat a disease or disorder in a subject. In some embodiments, a therapeutic protein is a therapeutic replacement protein administered to replace a defective (e.g., mutated) protein in a subject. In some embodiments, a therapeutic protein is the same or functionally similar to a native protein that is not defective in a subject.
[0108] As used herein, the term “therapeutic replacement protein” refers to a protein that is structurally similar to (e.g., structurally identical to) a protein that is endogenously expressed by a normal (e.g., healthy) individual. A therapeutic replacement protein can be administered to an individual that suffers from a disorder associated with a dysfunction of (or lack of) the protein to be replaced. In some embodiments, the therapeutic replacement protein corrects a defect in a protein resulting from a mutation (e.g., a point mutation, an insertion mutation, a deletion mutation, or a splice variant mutation) in the gene encoding the protein. Therapeutic replacement proteins do not include non-endogenous proteins, such as proteins associated with a pathogen (e.g., as part of a vaccine). Therapeutic replacement proteins may include enzymes, growth factors, hormones, interleukins, interferons, cytokines, anti-apoptosis factors, anti- diabetic factors, coagulation factors, anti-tumor factors, liver-secreted proteins, or neuroprotective factors. In some instances, the therapeutic replacement protein is monogenic.
[0109] The term “ABCA4” refers to any native ABCA4 from any vertebrate source, including mammals such as primates (e.g., human and cynomolgus monkeys) and rodents (e.g., mice and rats), unless otherwise indicated, as well as functional variants (e.g., natural or synthetic variants), e.g., mutants, muteins, analogs, subunits, receptor complexes, isotypes, splice variants, and fragments thereof. Functional variants can be determined on the basis of known ABCA4 signaling. ABCA4 encompasses full-length, unprocessed ABCA4, as well as any form of ABCA4 that results from native processing in the cell. An exemplary human ABCA4 sequence is provided as NCBI Reference Sequence: NG_009073 or NM_000350. A human ABCA4 amino acid sequence is provided herein as SEQ ID NO: 61.
[0110] As used herein, the term “ABCA4 intron 6” refers to a native nucleic acid sequence beginning from the nucleotide directly 3’ (i.e., downstream) to the 3’ end of ABCA4 exon 6 and ending on the nucleotide directly 5’ (i.e., upstream) to the 5’ end of ABCA4 exon 7. An exemplary sequence of a native human ABCA4 intron 6 is given by SEQ ID NO: 29. As used herein, nucleotide numbering of human ABCA4 intron 6 begins at the first position of intron 6 according to NG_009073; i.e., nucleotide 1 of ABCA4 intron 6 corresponds to chromosome 1 , strand (-), position 94,564,349 according to GRCh37 / hg19. For example, nucleotide 3,158 of ABCA4 intron 6 corresponds to GRCh37 / hg19 position 94,561 ,192 of chromosome 1, strand (-).
[0111] The terms “regulatory element” and “control element” are used interchangeably herein and each refer to a non-coding nucleic acid region, such as a promoter, enhancer, and silencer, which function to affect gene expression (e.g., level of expression and / or persistence of expression). In some embodiments, a regulatory element is not transcribed into mRNA. In other embodiments, a regulatory element is transcribed into mRNA but not translated into protein. Suitable regulatory elements are described in International Publication No. WO 2021 / 055760, which is incorporated herein by reference in its entirety.
[0112] A regulatory element is “derived” from a reference sequence (e.g., a native intron) when it contains a functional sequence, or functional variant of a sequence, contained within the reference sequence (e.g., a functional sequence, or functional variant of a sequence, having at least 20, at least 30, at least 40, at least 50, at least 100, at least 150, at least 200, at least 300, at least 400, or at least 500 nucleotide bases having at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with the reference sequence). A regulatory element derived from a reference sequence need not have the same level of function or type of function as the reference sequence; the functional sequence of the regulatory element must confer a detectable function (e.g., improve the level and / or persistence of expression, compared to an expression construct lacking the functional sequence of the regulatory element).
[0113] The term “MYO7A” refers to any native MYO7A (also known as DFNB2, MYU7A, NSRD2, USH1 B, DFNA1 1, or MYOVIIA) from any vertebrate source, including mammals such as primates (e.g., human and cynomolgus monkeys) and rodents (e.g., mice and rats), unless otherwise indicated, as well as functional variants (e.g., natural or synthetic variants), e.g., mutants, muteins, analogs, subunits, receptor complexes, isotypes, splice variants, and fragments thereof. Functional variants can be determined on the basis of known MYO7A signaling. MYO7A encompasses full- length, unprocessed MYO7A, as well as any form of MYO7A that results from native processing in the cell. An exemplary human MYO7A sequence is provided as National Center for Biotechnology Information (NCBI) Gene ID: 4647. A human MYO7A amino acid sequence is provided herein as SEQ ID NO: 62.
[0114] As used herein, the terms “scaffold / matrix attachment region” and “S / MAR” each refers to a DNA sequence of at least 200 nucleotides which mediates attachment of the DNA to a nuclear matrix of a eukaryotic cell, wherein the DNA sequence has at least three sequence motifs ATTA per 100 nucleotides over a stretch of at most 200 nucleotides. Exemplary S / MAR sequences are described in Liebich et al., Nucleic Acids Res. 2002, 30:312-374 and in International Patent Publication No. WO 2019 / 060253, the S / MAR descriptions of each of which are hereby incorporated by reference.
[0115] As used herein, the term “naked” refers to a nucleic acid molecule (e.g., a circular DNA vector) that is not encapsulated in a lipid envelope (e.g., a liposome) or a polymer matrix and is not physically associated with (e.g., covalently or non-covalently bound to) a solid structure (e.g., a particulate structure) upon administration to the individual. In some instances of the present invention, a pharmaceutical composition includes a naked circular DNA vector.
[0116] As used herein, the term “isolated" means artificially produced and not integrated into a host genome in a native manner. For example, isolated nucleic acid vectors include nucleic acid vectors that are naked, as well as those that are encapsulated in a lipid envelope (e.g., a liposome) or a polymer matrix. In some embodiments, the term “isolated” refers to a DNA vector that is: (i) synthetic, e.g., amplified in vitro (e.g., in a cell-free environment), for example, by rolling-circle amplification or polymerase chain reaction (PCR); (ii) produced by replication in a host bacterial cell and recovered in purified or partially purified (e.g., cell free) form; (iii) purified, as by restriction endonuclease cleavage and gel electrophoretic fractionation, or column chromatography; or (iv) synthesized by, for example, chemical synthesis. An isolated nucleic acid vector can be readily manipulable by recombinant DNA techniques well-known in the art. Thus, a nucleotide sequence contained in a vector in which 5’ and 3’ restriction sites are known or for which PCR primer sequences have been disclosed is considered isolated, but a nucleic acid sequence existing in its native state in its natural host is not. An isolated nucleic acid vector may be substantially purified, but need not be.
[0117] As used herein, the terms “individual” and “subject” are used interchangeably and include any mammal in need of treatment or prophylaxis, e.g., by a circular DNA vector, or pharmaceutical composition thereof, described herein. In some embodiments, the individual or subject is a human. In other embodiments, the individual or subject is a non-human mammal (e.g., a non-human primate (e.g., a monkey), a mouse, a pig, a rabbit, a cat, a dog, or a horse). The individual or subject may be male or female.
[0118] As used herein, an “effective amount” or “effective dose” of a DNA vector, or pharmaceutical composition thereof, refers to an amount sufficient to achieve a desired biological, pharmacological, or therapeutic effect, e.g., when administered to the individual according to a selected administration form, route, and / or schedule. As will be appreciated by those of ordinary skill in this art, the absolute amount of a particular composition that is effective can vary depending on such factors as the desired biological or pharmacological endpoint, the agent to be delivered, the target tissue, etc. Those of ordinary skill in the art will further understand that an “effective amount” can be contacted with cells or administered to a subject in a single dose or through use of multiple doses. An effective amount of a composition to treat a disease may slow or stop disease progression or increase partial or complete response, relative to a reference population, e.g., an untreated or placebo population, or a population receiving the standard of care treatment.
[0119] As used herein, a “therapeutically effective amount” or “therapeutically effective dose” refers to an effective amount of a DNA vector for treatment or prophylaxis of a disease or disorder in a subject.
[0120] As used herein, “treatment” (and grammatical variations thereof such as “treat” or “treating”) refers to clinical intervention in an attempt to alter the natural course of the individual being treated, which can be performed either for prophylaxis or during the course of clinical pathology. Desirable effects of treatment include, but are not limited to, preventing occurrence or recurrence of disease, alleviation of symptoms, diminishment of any direct or indirect pathological consequences of the disease, decreasing the rate of disease progression, amelioration or palliation of the disease state, and improved prognosis. In some embodiments, circular DNA vectors of the invention are used to delay development of a disease or to slow the progression of a disease.
[0121] The terms “level of expression” or “expression level” are used interchangeably and generally refer to the amount of a polynucleotide or an amino acid product or protein in a biological sample (e.g., retina). “Expression” generally refers to the process by which gene-encoded information is converted into the structures present and operating in the cell. Therefore, according to the invention, “expression” may refer to transcription into a polynucleotide, translation into a protein, or post-translational modification of the protein. Fragments of the transcribed polynucleotide, the translated protein, or the post-translationally modified protein shall also be regarded as expressed whether they originate from a transcript generated by alternative splicing or a degraded transcript, or from a post-translational processing of the protein, e.g., by proteolysis. “Expressed genes” include those that are transcribed into a polynucleotide as mRNA and then translated into a protein, and also those that are transcribed into RNA but not translated into a protein (for example, miRNA or shRNA).
[0122] As used herein, a “target cell” refers to a cell that expresses a therapeutic protein encoded by a therapeutic gene. In some embodiments, a target cell is a retinal cell. For example, in particular embodiments, a target cell is a retinal pigment epithelial (RPE) cell or a photoreceptor. In other embodiments, a target cell is a respiratory cell (e.g., a lung epithelial cell). In various embodiments, the target cell is in a subject to be treated. As used herein, “delivering,” “to deliver," and grammatical variations thereof, means causing an agent (e.g., a DNA vector) to access a target cell. The agent can be delivered by administration of the agent to an individual having the target cell (e.g., systemically or locally administering the agent) such that the agent gains access to the organ or tissue in which the target cell resides. Additionally, or alternatively, the agent can be delivered by applying a stimulus to a tissue or organ harboring the agent, wherein the stimulus causes the agent to enter the target cell. Thus, in some instances, an agent is delivered to a target cell by transmitting an electric field into a tissue harboring the agent at conditions suitable for electrotransfer of the agent into a target cell within the tissue.
[0123] As used herein, “electrotransfer” refers to movement of a molecule (e.g., a nucleic acid vector, e.g., a naked nucleic acid vector) across a membrane of a target cell (e.g., from outside to inside the target cell, e.g., a retinal cell) that is caused by transmission of an electric field (e.g., a pulsed electric field) to the microenvironment in which the cell resides (e.g., retina). Electrotransfer may occur as a result of electrophoresis, i.e., movement of a molecule (e.g., a nucleic acid, e.g., a naked nucleic acid) along an electric field, based on a charge of the molecule. Electrophoresis can induce electrotransfer, for example, by moving a molecule (e.g., a nucleic acid, e.g., a naked nucleic acid) into proximity of a cell membrane to allow a biotransport process (e.g., endocytosis including pinocytosis or phagocytosis) or passive transport (e.g., diffusion or lipid partitioning) to carry the molecule into the cell. Additionally, or alternatively, electrotransfer may occur as a result of electroporation, e.g., generation of pores in the target cell caused by transmission of an electric field (e.g., a pulsed electric field), wherein the size, shape, and duration of the pores are suitable to accommodate movement of a molecule (e.g., a nucleic acid vector, e.g., a naked nucleic acid vector) from outside the target cell to inside the target cell. Thus, in some instances, electrotransfer occurs as a result of a combination of electrophoresis and electroporation.
[0124] As used herein, "ad ministering11is meant a method of giving a dosage of an agent (e.g., a DNA vector) of the invention or a composition thereof (e.g., a pharmaceutical composition) to an individual or subject.
[0125] As used herein, the term “expression persistence” refers to the duration of time during which a sequence of interest, or a functional portion thereof (e.g., one or more coding sequences of a circular DNA vector), is expressible in the cell in which it was transfected (“intra-cellular persistence”) or any progeny of the cell in which it was transfected (“trans-generational persistence”). A sequence of interest, such as a therapeutic sequence, or functional portion thereof, may be expressible if it is not silenced. Expression persistence can be assessed by detecting or quantifying (i) mRNA transcribed from the sequence in the target cell or progeny thereof (e.g., through qPCR, RNA-seq, or any other suitable method) and (ii) protein translated from the sequence in the target cell or progeny thereof (e.g., through Western blot, ELISA, or any other suitable method). In some instances, expression persistence is assessed by detecting or quantifying therapeutic DNA in the target cell or progeny thereof (e.g., the presence of circular DNA vector in the target cell, e.g., through episomal DNA copy number analysis) in conjunction with either or both of (i) mRNA transcribed from the therapeutic sequence in the target cell or progeny thereof and (ii) protein translated from the therapeutic sequence in the target cell or progeny thereof. Expression persistence of a sequence of interest, or a functional portion thereof, can be quantified relative to a reference vector, such as a control vector having one or more bacterial backbone sequences that are not present in the vector of the invention, using any gene expression characterization method known in the art. Expression persistence can be quantified at any given time point following administration of the vector. For example, in some embodiments, expression of a circular DNA vector of the invention persists for at least two weeks after administration if it is detectable in the target cell, or progeny thereof, two weeks after administration of the circular DNA vector. In some embodiments, expression of a gene “persists” in a target cell if it is detectable in the target cell at one week, two weeks, three weeks, four weeks, six weeks, two months, three months, four months, five months, six months, seven months, eight months, nine months, ten months, eleven months, one year, or longer after administration. In some embodiments, expression of a therapeutic sequence persists in a target cell (e.g., cells of the retina) for at least four weeks, at least six weeks, or at least two months, or at least four months, or at least six months, or at least eight months, or at least one year. In some embodiments, expression of a therapeutic sequence persists in a target cell (e.g., cells of the retina) for more than one year, such as 18 months or more, or two years or more.
[0126] As used herein, “intra-cellular persistence” refers to the duration of time during which a sequence, or a functional portion thereof (e.g., one or more coding sequences of a circular DNA vector), is expressible in the cell in which it was transfected (e.g., a target cell, such as a postmitotic cell or a quiescent cell). Intra-cellular persistence can be assessed by detecting or quantifying (i) mRNA transcribed from the sequence in the target cell and (ii) protein translated from the sequence in the target cell. In some instances, intra-cellular persistence is assessed by detecting or quantifying DNA in the target cell (e.g., the presence of circular DNA vector in the target cell) in conjunction with either or both of (i) mRNA transcribed from the sequence in the target cell and (ii) protein translated from the sequence in the target cell. In some embodiments, the circular DNA vector of the invention exhibits improved intra-cellular persistence relative to a reference vector (e.g., a plasmid DNA vector).
[0127] As used herein, “trans-generational persistence” refers to the duration of time during which a sequence, or a functional portion thereof (e.g., one or more coding sequences of a DNA vector), is expressible in progeny of the cell in which the gene was transfected (e.g., progeny of the target cell, such as first-generation, second-generation, third-generation, or fourth-generation descendants of the cell in which the gene was transfected, e.g., through a circular DNA vector). Trans-generational persistence accounts for any dilution of a gene over cell divisions and may therefore be useful in measuring persistence of a vector in a dividing tissue over time. In some embodiments, the circular DNA vector of the invention exhibits improved trans-generational persistence relative to a reference vector (e.g., a plasmid DNA vector). Trans-generational persistence can be assessed by detecting or quantifying (i) mRNA transcribed from the vector sequence in progeny of the target cell and (ii) protein translated from the vector sequence in progeny of the target cell. In some instances, intra-cellular persistence is assessed by detecting or quantifying DNA in progeny of the target cell (e.g., the presence of circular DNA vector in progeny of the target cell) in conjunction with either or both of (i) mRNA transcribed from the sequence in progeny of the target cell and (ii) protein translated from the sequence in progeny of the target cell. In some embodiments, the circular DNA vector of the invention exhibits improved trans- generational persistence relative to a reference vector (e.g., a plasmid DNA vector).
[0128] As used herein, the term “copy number” of a DNA molecule refers to the average number of copies of the DNA molecule per cell in a given population of cells.
[0129] The term “pharmaceutically acceptable” means safe for administration to a mammal, such as a human. In some embodiments, a pharmaceutically acceptable composition is approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.
[0130] The term “carrier” refers to a diluent, adjuvant, excipient, or vehicle with which a vector or composition of the invention is administered. Examples of suitable pharmaceutical carriers are described in “Remington's Pharmaceutical Sciences,” Mack Publishing Co., Easton, PA., 23rd edition, 2020.
[0131] For any conflict in definitions between various sources or references, the definition provided herein shall control.
[0132] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods, and materials are described below. II. Production of Circular DNA Vectors
[0133] Embodiments disclosed herein include methods of producing circular DNA vectors in engineered bacterial cells (e.g., engineered E. co / / cells). The engineered bacterial cells disclosed herein can be used to produce circular DNA vectors from a parental plasmid. In some embodiments, the engineered bacterial cell includes a Rep gene encoding a bacterial replication protein (e.g., directing replication from ColE2-P9 origin) integrated into the bacterial genome and a parental plasmid. In some embodiments, the Rep gene is included on an extrachromosomal DNA molecule such as, for example, a plasmid (e.g., a helper plasmid) or a bacterial artificial chromosome (“BAC”). In some embodiments, the Rep gene is included on the parental plasmid. The parental plasmid comprises a vector sequence and a backbone sequence. The vector sequence includes a replication origin ri) sequence corresponding to the Rep gene and does not include a selectable marker. The backbone sequence includes a gene encoding a selectable marker and does not include the or / sequence included in the vector sequence, but may, in some embodiments, include a different ori sequence. The parental plasmid also has enzyme recognition sequences (e.g., restriction enzyme recognition sequences or transposase recognition sequences (e.g., transposase overhang sequences)) or site-specific recombination sequences flanking the vector sequence arranged so that the plasmid backbone sequence can be separated from the vector sequence inside the cell by restriction digestion, transposition, or site-specific recombination. In the case of restriction digestion, the circular DNA vector is then formed by selfligation of the vector sequence. In the case of site-specific recombination or transposition, the circular DNA vector is formed as recombination or transposition is completed. Expression of the Rep protein after separation of the vector sequence and formation of the circular DNA vector can maintain the circular DNA vector, and may maintain the circular DNA vector at a high copy number, despite the circular DNA vector lacking a selectable marker. In contrast, maintenance of the plasmid backbone sequence in the engineered bacterial cell after separation can be avoided by changing the culture conditions to remove selective pressure for the selectable marker. Culturing of a population of bacterial cells with a circular DNA vector (which can be at high copy number) under conditions in which the parental plasmid is not maintained can efficiently produce a high yield of highly pure circular DNA vector.
[0134] A. Engineered Bacteria! Cells
[0135] Methods of producing circular DNA vectors disclosed herein include the use of engineered bacterial cells, which can include, for example engineered E. co / / bacterial cells or other suitable bacterial host cells. In some embodiments, the engineered bacterial cells include an exogenous Rep gene encoding a replication protein integrated into the bacterial genome and a parental plasmid having an or / sequence that corresponds with the Rep gene. In some embodiments, the Rep gene is not integrated into the bacterial genome but is present on an extrachromosomal DNA molecule, such as a plasmid or BAC.
[0136] In some embodiments, the engineered bacterial cells have an exogenous Rep gene integrated into the bacterial genome. Any suitable chromosomal integration process can be used to incorporate the Rep gene into the bacterial genome, including integration cassettes and procedures that are well-known in the art. In instances in which a short origin of replication is used in a circular DNA vector (e.g., a ColE2-P9 replication origin, or a functional variant thereof), the Rep gene can encode a ColE2-P9 replication protein or a related protein. In some exemplary embodiments, the Rep gene encodes a ColE2-P9 replication protein that has the amino acid sequence set forth in SEQ ID NO: 1 (or a functional variant thereof, for example, having at least 80%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto). Other suitable replication proteins include replication proteins encoded by naturally-occurring plasmids, including, for example, those that are related to ColE2-P9, such as ColE3-CA38. The replication proteins can be used in embodiments described herein in conjunction with their corresponding origin of replication sequences.
[0137] The or / sequence included in the vector sequence of a parental plasmid is chosen so that it corresponds with the Rep gene that is integrated into the genome of the engineered bacterial cell or is otherwise present in the engineered bacterial cell, such as on a plasmid or BAC. In some exemplary embodiments, the ori (e.g., one strand) comprises or consists of a nucleotide sequence as set forth in SEQ ID NO: 2. Thus, embodiments of the engineered bacterial cells disclosed herein include a functional pair of a replication protein and origin of replication sequence that allow for replication of the parental plasmid and / or circular DNA vector. In some embodiments, the ori sequence present in the vector sequence is the ColE2-P9 ori sequence or a functional variant thereof. In some embodiments, the or / sequence present in the vector sequence is a functional fragment of the ColE2-P9 or / sequence that has the DNA sequence (on one strand) set forth in SEQ ID NO: 2. The 40 base pair functional fragment set forth in SEQ ID NO: 2 is capable of supporting vector replication in a cell expressing the ColE2-P9. In some embodiments, a shorter or longer functional fragment may be used. In some embodiments, a 31 base pair fragment of ColE2-P9 can be used. Other suitable ori sequences include, without limitation, o / 7 sequences and functional fragments thereof that correspond with suitable Rep proteins, such as, for example the ori sequence of ColE3-CA38. In some embodiments, the or / is ColE2-P9 origin and is no more than about 40 nucleotides in length, or no more than 38 nucleotides in length, no more than 37 nucleotides in length, or no more than 36 nucleotides in length, or no more than 34 nucleotides in length, or no more than 30 nucleotides in length. In various embodiments, the ColE2-P9 origin is from 30 to 40 nucleotides in length, or from 35 to 40 nucleotides in length, or from 36 to 40 nucleotides in length, thereby minimizing bacterial-derived sequences in the circular vector. In some embodiments, the o / 7 sequence is a naturally occurring ori sequence.
[0138] In some instances, the ori sequence is a functional variant of a naturally occurring ori, such as, for example, an ori sequence that has been modified to be shorter than a corresponding naturally occurring ori sequence, while still retaining the ability to support replication initiation. Example 13 describes a study in which functional truncated variants of ColE2-P9 were developed and characterized. Such functional variants of the ColE2-P9 replication origin include SEQ ID NOs: 3, 4, and 12-18. Such sequences are shown herein as a single strand for convenience, although it is recognized that the origin will be present in the vector as double-stranded DNA. In some embodiments, the functional variant has 1 , 2, 3, 4, or 5 nucleotide substitutions with respect to a origin sequence of SEQ ID NOS: 3, 4, and 12-18.
[0139] In some instances, the Rep gene is operably linked to an inducible promoter or a constitutive (e.g., non-inducible) promoter. Suitable inducible promoters include, without limitation, a PT? promoter that is induced by T7 RNA polymerase, a heat inducible PL promoter, a Ptacpromoter that is suppressible by Lacl (and therefore inducible by the absence or removal of Lacl), or a promoter that is inducible by arabinose. Other inducible promoters known in the art can also be used in embodiments disclosed herein including, for example, bacteriophage promoters (e.g. Pislcon, T3, T7, SP6) and bacterial promoters (e.g. PmgrB, pLIacO, Ptrc2, pLtetO, Plac / ara, Pm). Examples of bacterial promoters for use in accordance with the present disclosure include, without limitation, positively regulated E. co / / promoters such as positively regulated o70promoters (e.g., inducible pBad / araC promoter, Lux cassette right promoter, plac Or2-62 (positive), pBad / AraC with extra REN sites, pBad, P(Las) TetO, P(Las) CIO, P(Rhl), Pu, FecA, pRE, cadC, hns, pLas, pLux), ospromoters (e.g., Pdps), o32promoters (e.g., heat shock) and o54promoters (e.g., glnAp2); negatively regulated E. co / / promoters such as negatively regulated o70promoters (e.g., Promoter (PRM+), TetR-TetR-4C P(Las) TetO, P(Las) CIO, P(Lac) IQ, RecA_DlexO_dLacO1 , dapAp, FecA, Pspac-hy, pci, plux-cl, plux-lac, CinR, CinL, glucose controlled, modified Pr, modified Prm+, FecA, Pcya, rec A (SOS), Rec A (SOS), EmrR_regulated, Betl_regulated, pLacJux, pTet_Lac, pLac / Mnt, pTet / Mnt, LsrA / cl, pLux / cl, Lacl, LaclQ, pLacIQI , pLas / cl, pLas / Lux, pLux / Las, pRecA with LexA binding site, reverse bBa_R0011 , pLacl / ara-1, pLaclq, rrnB P1 , cadC, hns, PfhuA, pBad / araC, nhaA, OmpF, RcnR), ospromoters (e.g., Lutz-Bujard LacO with alternative sigma factor a38), a32promoters (e.g., Lutz-Bujard LacO with alternative sigma factor o32), and o54promoters (e.g., glnAp2); negatively regulated B. subtHis promoters such as repressible B. subti / is cri promoters (e.g., Grampositive IPTG-inducible, Xyl, hyper-spank) and oBpromoters. Other inducible bacterial promoters may be used in accordance with the present disclosure. For example, a cuminic acid inducible promoter, such as pCymRC, may be used. The expression level of the replication protein can affect the copy number of a parental plasmid or circular DNA vector comprising a corresponding ori sequence. Thus, when a relatively low copy number (e.g., an average of less than 5, 10, or 20 copies per cell) is desired, the engineered bacterial cells can be maintained in conditions in which the replication protein is expressed at a relatively low level. When a relatively high copy number is desired (e.g., an average of more than 20, 50, or 100 copies per cell), the engineered bacterial cells can be maintained in conditions in which the replication protein is expressed from a promoter (which can be an inducible promoter) at a relatively high level. In some embodiments, the Rep gene is operably linked to an inducible promoter that provides a first level of expression in non-inducing conditions and that can be induced to provide a second, higher level of expression that results in a higher copy number of a parental plasmid or a circular DNA vector that comprises a corresponding ori sequence. In some embodiments, it is advantageous to maintain the parental plasmid in the engineered bacterial cell at a low copy number before the vector sequence and backbone sequence of the parental plasmid are separated. In embodiments in which the vector sequence and backbone sequence are separated by restriction digestion, having a relatively low copy number can help to ensure that the linearized vector sequence self-ligates rather than ligating with backbone sequence or other copies of the vector sequence. After separation of the vector sequence from the backbone sequence, and formation of a circular DNA vector, it is advantageous in some embodiments to have the circular DNA vector, which contains an or / sequence, to be maintained at a relatively high copy number in order to produce a high yield of circular DNA vector. Thus, in some embodiments, after formation of the circular DNA vector within the engineered bacterial cell, higher expression levels of the replication protein are induced by, for example, adding a molecule that induces higher expression from the inducible promoter operably linked to the Rep gene. In some embodiments the inducible promoter is maintained in an uninduced state until after separation of the vector sequence from the backbone sequence. In some embodiments, the inducible promoter is induced after separation of the vector sequence from the backbone sequence. In some embodiments, the inducible promoter is induced simultaneous with the separation of the vector sequence from the backbone sequence. In some embodiments, the inducible promoter is induced before the separation of the vector sequence from the backbone sequence.
[0140] The copy number of the parental plasmid can be maintained at a copy number of at least about 5, or at least about 10, or at least about 20, or at least about 50. In various embodiments, the parental plasmid is maintained at a copy number of no more than about 400 copies, or about 200 copies, or about 100 copies, or about 50 copies. In some embodiments, the copy number of the circular DNA vector is maintained or produced at a copy number of at least about 10, or at least about 20, or at least about 50, or at least about 75, or at least about 100, or at least about 150, or at least about 200 copies per cell.
[0141] In addition to a parental plasmid or a vector sequence separated from a parental plasmid, engineered bacteria may also include other extrachromosomal DNA molecules such as helper plasmids or BACs. The extrachromosomal DNA molecules may encode, for example, one or more exogenous recombinases, restriction enzymes, transposases, insertion sequence excision enhancers (lEEs), replication proteins, ligases, selectable markers, counterselection markers, or reporter genes. In some instances, a transposase and an IEE are encoded on the same or separate extrachromosomal DNA molecules in the engineered bacterial cell.
[0142] In some instances, the IEE corresponds to an IS3 family insertion sequence, e.g., IS629 or IS2.
[0143] In some embodiments, extrachromosomal DNA molecules other than the vector sequence are removed from the engineered bacterial cell before purification of a circular DNA vector from a culture of engineered bacterial cells. In some embodiments, an extrachromosomal DNA molecule can be removed from engineered bacterial cells by culturing cells under conditions that do not apply selective pressure for maintaining the extrachromosomal DNA molecule or by culturing cells under counterselection conditions that reduce or eliminate growth of cells that include the extrachromosomal DNA molecule.
[0144] In some embodiments, extrachromosomal DNA molecules included in engineered bacterial cells include reporter constructs that can be used to track the presence of the extrachromosomal DNA molecule in cells. For example, a backbone sequence of a parental plasmid or a helper plasmid or BAC can include genes encoding a visually detectable protein such as GFP or RFP. In that case, visual observation of colony color under UV light can reveal whether the extrachromosomal DNA molecule is present in cells of the colony. In this way, colonies that lack a given extrachromosomal DNA molecule can be detected. Other suitable reporter constructs that can be detected in other ways can also be used to determine whether an engineered bacterial cell or colony contains a given extrachromosomal DNA molecule.
[0145] In some instances of engineered bacterial cells producing circular DNA vectors (e.g., nonintegrating circular DNA vectors, or episomal circular DNA vectors) using transposase, the engineered bacterial cell includes (a) a circular DNA vector having a transposase overhang, e.g., wherein the circular DNA vector includes any one or more components of the therapeutic sequences described herein and any bacterial replication origins described herein (e.g., a ColE2- P9 replication origin, or a functional variant thereof), and (b) a Rep gene encoding a bacterial replication protein that binds to the bacterial replication origin of the circular DNA vector (e.g., wherein the Rep gene is encoded in the genome of the engineered bacterial cell).
[0146] In related embodiments of engineered bacterial cells producing circular DNA vectors (e.g., non-integrating circular DNA vectors, or episomal circular DNA vectors) using transposase, the engineered bacterial cell includes (a) a plasmid template from which the circular DNA vector is produced and (b) a Rep gene encoding a bacterial replication origin protein. The plasmid template includes: (i) a first segment comprising a therapeutic sequence and a sequence comprising any of the bacterial replication origins described herein (e.g., a ColE2-P9 replication origin, or a functional variant thereof), wherein the first segment is flanked by two transposase overhang sequences; and (ii) a second segment includes a plasmid backbone, wherein the second segment is flanked by a left end (LE) repeat and a right end (RE) repeat, wherein the LE repeat and the RE repeat can be bound by the transposase protein. In some embodiments, the bacterial replication protein binds to the bacterial replication origin of the circular DNA vector (e.g., the Rep gene is encoded in the genome of the engineered bacterial cell). In some embodiments, the engineered bacterial cell further includes (c) a circular DNA vector comprising the therapeutic sequence, the sequence comprising the bacterial replication origin, and one of the two transposase overhang sequences.
[0147] The aforementioned engineered bacterial cells may further include a transposase protein that produced the transposase overhang in the circular DNA vector. For instance, the transposase protein may be a piggyBac transposase, in which case the transposase overhang could be TTAA (5’-TTAA). Alternatively, other known transposase-overhang pairs known in the art can be utilized in engineered bacterial cells described herein. The transposase protein can be expressed from a non-integ rated gene within the bacterial cell (e.g., a helper plasmid or a BAC), or it can be integrated into the genome of the engineered bacterial cell. In either case, some embodiments of such engineered bacterial cells contain an IEE, which can likewise be expressed from a nonintegrated gene within the bacterial cell (e.g., a helper plasmid or a BAC), or it can be integrated into the genome of the engineered bacterial cell. In some instances, the transposase and IEE are encoded on the same helper plasmid or a BAC within the engineered bacterial cell, and the helper plasmid or BAC contain a replication origin (e.g., a replication origin that is different from the replication origin on the circular DNA vector). Such engineered bacterial cells that produce circular DNA vectors using transposase may also include other structures, such as byproducts of the transposition process. Such byproducts include a closed-ended linear DNA molecule of plasmid backbone sequences (e.g., the plasmid backbone present in a predecessor template plasmid from which the circular DNA vector was produced). As a product of transposition, such closed-ended linear DNA molecules may include terminal hairpins having the transposase overhang sequence, or a left end (LE) and a right end (RE) repeat associated with (e.g., bindable by) the transposase protein in the engineered bacterial cell. Such engineered bacterial cells are amenable to production of circular DNA vectors (e.g., non-integrating circular DNA vectors, or episomal circular DNA vectors) that have small backbones, where the majority (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) of the sequence directly connecting the 3' end of the therapeutic sequence to the 5’ end of the therapeutic sequence is the replication origin, which can be less than 50 bp (e.g., having one strand comprising or consisting of the nucleic acid sequence of any one of SEQ ID NOs: 2-4 or 12- 18). Such features can be achieved, in some instances, by superimposing the transposase overhang sequence onto the vector sequence (e.g., the therapeutic sequence or the replication origin), thereby effectively removing it from the backbone sequence. In such instances, the therapeutic sequence or the replication origin of the circular DNA vector comprises the transposase overhang sequence associated with the transposase within the engineered bacterial cell.
[0148] Any of the engineered bacterial cells described herein can be isolated engineered bacterial cells (e.g., cultured engineered bacterial cells).
[0149] B. Parental Plasmid
[0150] As part of production of any of the circular DNA vectors described herein, host cells (e.g., engineered bacteria) may include a parental plasmid (also referred to as a template plasmid or plasmid template) that includes a vector sequence and a backbone sequence separated from each other by two restriction sites (in instances in which the host cell expresses a cognate restriction enzymes), recombination sites (in instances in which the host cell expresses a cognate recombinase), or transposase overhangs (in instances in which the host cell expresses a cognate transposase).
[0151] The vector sequence includes an ori sequence and a sequence of interest, which in some embodiments is a therapeutic sequence. In some embodiments, the vector sequence comprises a reporter construct (e.g., a fluorescent protein-encoding gene, e.g., GFP or RFP). The vector sequence can include any of the components of circular DNA vector embodiments described herein. In some embodiments, the vector sequence does not comprise any sequences of bacterial origin other than the on sequence. In some embodiments, the parental plasmid includes restriction sites, recombination sites, or transposase sites immediately adjacent to the ori sequence and / or a therapeutic sequence or reporter construct so that there is no or minimal extraneous or nonfunctional DNA included in the vector sequence that becomes the circular DNA vector. In some embodiments, the adjacent sequences are no more than about 50 bps, or no more than about 45 bps, or no more than about 40 bps. In some embodiments, the backbone sequence includes a selectable marker and does not include an o / 7 sequence corresponding to the exogenous replication protein encoded by an exogenous (e.g., integrated) Rep gene. In some embodiments, the backbone sequence comprises an ori sequence that does not correspond to the integrated Rep gene, i.e., that is orthologous to the or / sequence in the vector sequence and to the integrated Rep gene. In some embodiments, the selectable marker comprised in the backbone sequence helps ensure that the parental plasmid is maintained in a population of engineered bacterial cells cultured under conditions wherein the selectable marker is necessary for cell growth or survival. For example, in some embodiments, the selectable marker is an antibiotic resistance gene. Culturing engineered bacterial cells in the presence of the corresponding antibiotic applies selective pressure so that the parental plasmid is maintained in a population of engineered bacterial cells. However, upon removal of selective pressure, such as by changing the growth media to one that lacks the antibiotic corresponding to an antibiotic resistance gene, a DNA molecule that includes the antibiotic resistance gene may be lost from the population, especially if such DNA molecule does not comprise an or / sequence.
[0152] Thus, after separation of the vector sequence from the backbone sequence, the backbone sequence may be lost from the population or fail to be maintained in significant quantities if culture conditions do not apply selective pressure to maintain it.
[0153] In some embodiments, the backbone sequence comprises a counterselection marker. The counterselection marker may provide a way to selectively grow cells that do not include the backbone sequence. In some embodiments, growing cells under counterselection conditions after separation of the vector sequence from the backbone sequence may promote purity and reduce the amount of the backbone sequence in the culture and / or in a composition comprising purified vector sequence. Suitable counterselection markers are known in the art and may include, for example, pheS, sacB, thyA, iacY, gata-1, ccdB, rpsL, or tetAR.
[0154] Restriction sites, recombination sites, or transposase recognition sites flanking the vector sequence in the parental plasmid can be selected from any suitable restriction sites, recombination sites, or transposase recognition sites that do not occur within the vector sequence.
[0155] C. Restriction Digestion & Ligation
[0156] In certain embodiments of bacterial production of circular DNA vectors, a step of restriction digestion separates the vector sequence from the backbone sequence of the parental plasmid. In some embodiments, the restriction digestion occurs within the engineered bacterial cell. In some embodiments, the restriction enzyme that digests the parental plasmid is an exogenous restriction enzyme that is expressed from an exogenous restriction enzyme gene introduced into the engineered bacterial cell. In some embodiments, the exogenous gene is integrated into the genome of the engineered bacterial cell. In some embodiments, the exogenous gene is encoded on a plasmid or BAC within the engineered bacterial cell. In some embodiments, it is necessary to suppress or delay induction of expression of the restriction enzyme until such time as separation of the vector sequence from the backbone sequence of the parental plasmid is desired. Thus, in some embodiments, the exogenous gene is operably linked to an inducible promoter. When separation is desired, expression of the restriction enzyme can be induced, and the separation can proceed.
[0157] In some embodiments that utilize a restriction enzyme, the restriction enzyme used to separate the vector sequence from the backbone sequence is an exogenous restriction enzyme that is introduced into the engineered bacterial cell across the cell membrane. In some embodiments, this is accomplished by electroporation. A non-limiting example of an electroporation and digestion procedure is as follows: Electrocompetent engineered E. coli harboring a parent plasmid are cultured to OD of 0.8 in SOB at 30° C. The bacteria are washed three times with ice cold 10% glycerol and resuspended in 10% glycerol. 0.5 pl of each restriction enzyme and ligase are mixed with the electrocompetent cells — 1 pg of DNA is digested with 10 units of restriction enzymes. The mixture is transferred to a cuvette (1 mm gap) and electroporated using an electroporator (BTX) using the 1800 volt setting. The cells are rescued by growing in SOC for 1 hr at 37° C and are plated on LB agar plate without antibiotics. Colonies are grown and DNA is purified using QIAGEN miniprep kit.
[0158] After the separation of the vector sequence, the circular DNA vector can be formed by selfligating the vector sequence. In some embodiments, the ligation occurs within the engineered bacterial cell. In some embodiments, the ligase that joins the ends of the vector sequence is an exogenous ligase that is expressed from an exogenous ligase gene introduced into the engineered bacterial cell. The ligase can be, for example, T3 ligase, a T4 ligase, or a T7 ligase. In some embodiments, the exogenous ligase gene is integrated into the genome of the engineered bacterial cell. In some embodiments, the exogenous ligase gene is encoded on a plasmid within the engineered bacterial cell. In some embodiments, expression of the ligase is suppressed or is not induced until such time as separation of the vector sequence from the backbone sequence of the parental plasmid is accomplished. Thus, in some embodiments, the exogenous ligase gene is operably linked to an inducible promoter.
[0159] In some instances, the ligase is an exogenous ligase that is introduced into the engineered bacterial cell across the cell membrane. In some embodiments, this is accomplished by electroporation, which may be done according to the electroporation protocol described above. In some embodiments, the electroporation of restriction enzymes and ligase is done in a single step with both restriction and ligase enzymes entering the cells in a single electroporation step. In some embodiments, the restriction enzyme(s) and ligase are added separately to the cells.
[0160] In some embodiments, self-ligation of the vector sequence is accomplished by an endogenous ligase produced by the engineered bacterial cell.
[0161] In some embodiments, an exogenous restriction enzyme and an exogenous ligase are present within the engineered bacterial cell at the same time. In some embodiments, the exogenous restriction enzyme is introduced into the engineered bacterial cell (e.g., by electroporation of an exogenous restriction enzyme, by transformation with a DNA molecule encoding an exogenous restriction enzyme, or by induction of expression of an exogenous restriction enzyme gene under control of an inducible promoter) before the exogenous ligase is introduced into the engineered bacterial cell (e.g., by electroporation of an exogenous ligase, by transformation with a DNA molecule encoding an exogenous ligase, or by induction of expression of an exogenous ligase gene under control of an inducible promoter). In some embodiments, the exogenous restriction enzyme is introduced into the engineered bacterial cell before the exogenous ligase is introduced into the engineered bacterial cell. In some embodiments, the exogenous restriction enzyme is introduced into the engineered bacterial cell at the same time as the exogenous ligase.
[0162] D. Site Specific Recombination
[0163] As an alternative to restriction digestion as described above, bacterial production of circular DNA vectors with small backbones can be achieved using site specific recombination, which can be carried out using various systems that lead to site-specific recombination between sequences. In some embodiments, the site-specific recombination involves two specific sequences that are capable of recombining with one another in the presence of a recombinase.
[0164] In some embodiments, the recombinase that separates the vector sequence from the plasmid sequence is an exogenous recombinase that is expressed from an exogenous recombinase gene introduced into the engineered bacterial cell. In some embodiments, the exogenous recombinase gene is integrated into the genome of the engineered bacterial cell. In some embodiments, the exogenous recombinase gene is encoded on a plasmid or BAC within the engineered bacterial cell. In some embodiments, it is necessary to suppress or delay induction of expression of the recombinase until such time as separation of the vector sequence from the backbone sequence of the parental plasmid is desired. Thus, in some embodiments, the exogenous recombinase gene is operably linked to an inducible promoter, such as any of the inducible promoters disclosed herein. When separation is desired, expression of the exogenous recombinase can be induced, and the separation can proceed. In some embodiments, the exogenous recombinase is expressed at the time that the parental plasmid is introduced into the engineered bacterial cell, which may cause the parental plasmid to undergo recombination without having to induce expression of the recombinase. In some embodiments, the recombinase is expressed at a relatively low level at the time the parental plasmid is introduced into the engineered bacterial cell. As an example, in some embodiments, the engineered bacterial cell may include an exogenous recombinase gene (which may be, for example, integrated into the bacterial chromosome or included on a plasmid or BAC present within the bacterial cell before introduction of the parental plasmid into the engineered bacterial cell) that is operatively coupled to an inducible promoter that provides for a low level of expression in non-inducing conditions. Introducing the parental plasmid into an engineered bacterial cell with an appropriately low level of expression of the exogenous recombinase may allow for growth of colonies on media selective for the selectable marker on the backbone sequence of the parental plasmid, while also inducing sufficient recombination of the parental plasmid to generate a population of cells in the colony that have the vector sequence separated from the backbone sequence.
[0165] In some embodiments, the recombinase used to separate the vector sequence from the backbone sequence is an exogenous recombinase that is introduced into the engineered bacterial cell across the cell membrane. In some embodiments, this is accomplished by electroporation. A non-limiting example of an electroporation and recombination procedure is as follows: Electrocompetent engineered £ co / / harboring a parent plasmid is cultured to OD of 0.8 in SOB at 30° C. The bacteria are washed three times with ice cold 10% glycerol and resuspended in 10% glycerol. 1 pl of Cre (15 units, NEB, M0298M) is mixed with 50 pl of electrocompetent cells. The mixture is transferred to a cuvette (1 mm gap) and electroporated using an electroporator (BTX) using the 1800 volt setting. The cells are rescued by growing in SOC for 1 hour at 37° C and are plated on LB agar plate without antibiotics. Colonies are grown and DNA is purified using QIAGEN miniprep kit. 1 pg of DNA is digested with 10 units of restriction enzymes.
[0166] The specific recombination system used in embodiments disclosed herein can be of different origins. In particular, the specific sequences and the recombinases used can belong to different structural classes, such as the integrase family of bacteriophage A or to the resolvase family of the transposon Tn3.
[0167] Recombinases belonging to the integrase family of bacteriophage A include, for example, the integrase of the phages lambda (Landy et aL, Science 197: 1147, 1977), P22, and q>80 (Leong et aL, J. Bid. Chem. 260: 4468,1985), HP1 of Haemophilus influenza (Hauser et aL, J. Bid Chem. 267 6859,1992), the Cre integrase of phage P1 (which recognizes and causes recombination at LoxP sites), the integrase of the plasmid pSAM2 (EP 350,341) or alternatively the FLP recombinase of the 2p plasmid. In embodiments in which circular DNA vectors are prepared by recombination by means of a site-specific system of the integrase family of bacteriophage A, the resulting circular DNA vectors generally comprise a sequence resulting from the recombination between two att attachment sequences of the corresponding bacteriophage or plasmid.
[0168] Recombinases belonging to the family of the transposon Tn3 include, for example, the resolvase of the transposon Tn3 or of the transposons Tn21 and Tn522 (Stark et aL, Trends Genet, 8, 432-439,1992); the Gin invertase of bacteriophage mu, or, alternatively, the resolvase of plasmids, such as that of the par fragment of RP4 (Albert et al. , Mol. Microbiol. 12: 131 , 1994). In embodiments in which circular DNA vectors are prepared by recombination by means of a sitespecific system of the family of the transposon Tn3, the resulting circular DNA vectors generally comprise a sequence resulting from the recombination between two recognition sequences of the resolvase of the transposon in question.
[0169] In some embodiments, site-specific recombination sequences on the parental plasmid are derived from a bacteriophage. In some embodiments, the sequences are attachment sequences (attP and attB sequences) of a bacteriophage integrase or sequences derived from such attachment sequences. These sequences are capable of recombining specifically with one another in the presence of a recombinase referred to as an integrase with or without an excisionase. The term “sequences derived from such attachment sequences” includes the sequences obtained by modification(s) of the attachment sequences of the bacteriophages that retain the capacity to recombine specifically in the presence of the appropriate recombinase. Thus, such sequences can be reduced fragments of these sequences or, alternatively, fragments extended by the addition of other sequences (restriction sites, and the like). They can also be variants obtained by mutations, in particular by point mutations, such as attP-GA and attB-GA attachment sequences, for example.
[0170] In some embodiments, the recognition sequences and recombinase used are from tyrosine recombinase family members such as, for example, Flp, XerC, XerD, A integrase, or HP1 integrase, or serine recombinase family members such as, for example, cpBT 1 , TP901 , Bxb1 , MR11 , A118, <pK38, cpC31 , or W .
[0171] In some embodiments, the recognition sequences and recombinase are from Bxb1 (e.g., the exogenous recombinase is Bxb1 and the recognition sequences are attP-GA and attB-GA).
[0172] E. Transposition
[0173] As an alternative to restriction digestion or site-specific recombination for separating a vector sequence from a backbone sequence of the parent plasmid, the enzyme used may be a transposase. One benefit of using a transposase-based system is the ability to further reduce the backbone size within the circular DNA vector. For instance, use of a site-specific recombinase results in a recombination site (e.g., an attachment site) within the vector, near or adjacent to the replication origin. In contrast, use of a transposase allows the replication origin to directly connect the 5’ end of the therapeutic sequence to 3’ end of the therapeutic sequence without intervening sequences.
[0174] In some instances, use of a transposase allows for a “scarless” backbone by positioning the resulting sequence of the transposition (the transposase overhang) within the therapeutic sequence without modifying the function of the therapeutic sequence. As an example, piggybac transposase produces a four-bp transposase overhang of TTAA. By positioning the plasmid backbone within the sequence of interest at a TTAA site, one can design the system such that, upon transposase-mediated excision of the plasmid backbone from the sequence of interest, the original sequence of interest is restored, leaving only the original TTAA sequence as the transposase scar. This leaves the backbone within the circular DNA vector free of a transposase scar. Thus, the plasmid backbone sequences in the vector can consist entirely of replication origin (e.g., less than 50 base pairs, e.g., the size of the replication origin, including truncated functional variants described herein, e.g., at Example 13).
[0175] Additionally, or alternatively, the transposase scar may be positioned within the vector backbone (e.g., within the sequence containing the replication origin). For instance, if the parental plasmid contains inverted repeats (left-end) and (right-end) repeats flanking the backbone, and or transposase overhang sequences flanking the therapeutic sequence (akin to their position in FIG. 22), the transposase scar will be positioned between the 3’ and 5’ ends of the sequence of interest (e.g., next to the origin of replication), as shown in FIG. 22.
[0176] F. Amplification of Circular DNA Vector by Culturing Cells
[0177] After production of a circular DNA vector in engineered bacterial cells according to embodiments described herein, the amount of circular DNA vector produced can be increased by culturing a population of engineered bacterial cells comprising a circular DNA vector. The culture conditions can be chosen to maximize bacterial cell growth and production of additional copies of a circular DNA vector. In some embodiments, the culture conditions are chosen so as to induce a high level of expression of a replication protein and thereby support a high copy number of the circular DNA vector having the corresponding o / 7 sequence. In some embodiments, the culture conditions are chosen to remove selective pressure for maintenance of the backbone sequence that comprises a selectable marker, such that the backbone sequence is not maintained through rounds of cell division. In some embodiments, culture conditions are chosen that provide counterselection pressure for a counterselection marker present on a backbone sequence so that cells that include the backbone sequence have diminished growth potential or cannot grow. In some embodiments, culturing a population of engineered bacterial cells comprising the circular DNA vector results in maintenance of the circular DNA vector in such cultured cells through at least 5, at least 10, at least 15, at least 20, at least 25, at least 50, at least 75, or at least 100 rounds of cell division. In some embodiments the cultured population of engineered bacterial cells maintains the circular DNA vector at an average copy number of at least 5, at least 10, at least 15, or at least 20 copies per cell after at least 10, at least 20, at least 25, at least 50, at least 75, or at least 100 doublings. In exemplary embodiments, there is at least 1 copy per cell after at least 10 doublings, or at least 5 copies per cell after at least 10 doublings, or at least 10 copies per cell after at least 10 doublings, or at least 20 copies per cell after at least 10 doublings. In some embodiments, there is at least 1 copy per cell after at least 20 doublings, or at least 5 copies per cell after at least 20 doublings, or at least 10 copies per cell after at least 20 doublings, or at least 20 copies per cell after at least 20 doublings. In some embodiments, there is at least 1 copy per cell after at least 50 doublings, or at least 5 copies per cell after at least 50 doublings, or at least 10 copies per cell after at least 50 doublings, or at least 20 copies per cell after at least 50 doublings. In some embodiments, there is at least 1 copy per cell after at least 100 doublings, or there is at least 5 copies per cell after at least 100 doublings, or at least 10 copies per cell after at least 100 doublings, or at least 20 copies per cell after at least 100 doublings. In some embodiments, the average copy number of backbone sequence after separation of the vector sequence from the backbone sequence is less than 5, 4, 3, 2, 1 , 0.5, 0.1 , 0.01 , or 0.001 copies per cell or is undetectable after at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 doublings. For example, in some embodiments that are less than .001 copies per cell after at least 1 doubling, or less than .001 copies per cell after at least 10 doublings, or less than .001 copies per cell after at least 20 doublings, or less than .001 copies per cell after at least 50 doublings, or less than .001 copies per cell after at least 100 doublings. In some embodiments, there are less than .01 copies per cell after at least 1 doubling, or less than .01 copies per cell after at least 10 doublings, or less than .01 copies per cell after at least 20 doublings, or less than .01 copies per cell after at least 50 doublings, or less than .01 copies per cell after at least 100 doublings. In some embodiments, there are less than 0.1 copies per cell after at least 1 doubling, or less than 0.1 copies per cell after at least 10 doublings, or less than 0.1 copies per cell after at least 20 doublings, or less than 0.1 copies per cell after at least 50 doublings, or less than 0.1 copies per cell after at least 100 doublings. In some embodiments, there are less than 1 copy per cell after at least 1 doubling, or less than 1 copy per cell after at least 10 doublings, or less than 1 copy per cell after at least 20 doublings, or less than 1 copy per cell after at least 50 doublings, or less than 1 copy per cell after at least 100 doublings. Some embodiments, a culture of engineered bacterial cells comprises at least 106cells, or at least 106cells, or at least 107cells, or at least 108cells, or at least 109cells, or at least 1010cells, or at least 1011cells, or at least 1012total cells. In some embodiments, the culture comprises at least 104cells / ml, or at least 105cells / ml, or at least 106cells / ml, or at least 107cells / ml, or at least 108cells / ml, or at least 109cells per ml, or at least 1010cells / ml.
[0178] G. Recovery of Circular DNA Vector
[0179] Circular DNA vectors produced using the methods and bacterial cells disclosed herein can be recovered from a culture of engineered bacteria by extraction and purification procedures known in the art. In some embodiments, at least about 1 , or at least about 2, or at least about 3, or at least about 4, or at least about 5 mg of circular DNA vector can be recovered per liter of cultured engineered bacterial cells. In some embodiments, the circular DNA vector goes through purification procedures to reduce the amount of bacterial contaminants, such as endotoxin, to levels acceptable for use in a pharmaceutical composition. Suitable purification procedures include chromatography procedures, such as anion exchange chromatography and / or hydrophobic interaction chromatography. Purification procedures applicable for purifying the bacterially produced circular DNA vectors described herein may be readily drawn from purification procedures known in the art, e.g., for purification of backbone byproducts from minicircle preparations, e.g., as described in Alves et al., Front. Chem. Eng., 2021 (doi: 10.3389 / fceng.2020.612594), which is incorporated herein by reference in its entirety.
[0180] In some embodiments, the circular DNA vector is purified by gel electrophoresis to further avoid contamination by backbone sequence that may be maintained in a culture of engineered bacterial cells. In some embodiments, no purification is necessary to avoid detectable contamination of the circular DNA vector with backbone sequence.
[0181] In some embodiments, the circular DNA vector can be purified from a culture of engineered bacterial cells described herein without contamination of the purified product by backbone sequence or by any other extrachromosomal DNA molecules. In some embodiments, a composition of isolated circular DNA vector purified from engineered bacterial cells disclosed herein includes less than about 10 ng / ml, or less than about 1 ng / ml, or less than about 0.1 ng / ml, or less than about 0.01 ng / ml, or less than about 0.001 ng / ml, or less than about 0.0001 ng / ml of DNA comprising the backbone components. In some embodiments, DNA comprising backbone is undetectable in the composition by quantitative PCR. In some embodiments, these purity levels are achieved without a gel purification or column purification step being performed after isolation of the circular DNA vector from the engineered bacterial cells. In some embodiments, methods of making circular DNA vector disclosed herein comply with current good manufacturing practice (GMP) according to the standards promulgated by the U.S. Food & Drug Administration and set forth in 21 C.F.R. Parts 210 and 211 , which are incorporated herein by reference in their entirety.
[0182] III. DNA Vectors
[0183] Provided herein are DNA vectors (e.g., bacterially produced DNA vectors, such as circular DNA vectors, that include a sequence of interest and a small backbone sequence containing a bacterial replication origin (e.g., having less than 50 base pairs). Such DNA vectors can be produced without selectable markers using the methods described herein, such as by counterselection or dilution of the backbone byproduct relative to the DNA vector. The DNA vectors having low amounts of plasmid backbone sequences can be produced by any of the methods described herein and can be particular useful for expressing therapeutic genes, e.g., in mammalian cells (e.g., ex vivo or in vivo).
[0184] DNA vectors having small bacterial replication origins (e.g., less than 50 base pairs) can be produced according to known methods as plasmid DNA vectors, such as nanoplasmid vectors (as described in, e.g., International Patent Publication Nos. WO 2008 / 153733 and WO 2014 / 035457, which are hereby incorporated by reference in their entireties), minicircle DNA vectors (as described in, e.g., U.S. Patent Nos. 8,828,726 and 9,233,174, which are hereby incorporated by reference), mini-intronic plasmids (described in, e.g., Lu et aL, Moi. Then 2013, 21 :954 and U.S. Patent No. 9,347,073, which is hereby incorporated by reference), synthetic circular DNA vectors as described herein and in International Patent Publication No. WO 2019 / 178500 (which is hereby incorporated by reference), closed-ended DNA vectors (as described, e.g., in U.S. Patent Publication Nos. 2020 / 0283794 and 2021 / 0071197, which is hereby incorporated by reference), doggybone DNA vectors (as described, e.g., in U.S. Patent Publication No. 2015 / 0329902 and U.S. Patent No. 9,499,847, which are hereby incorporated by reference), or ministring DNA vectors (as described, e.g., in U.S. Patent Nos. 9,290,778 and US RE48908, which are hereby incorporated by reference).
[0185] The circular DNA vectors described herein can persist intracellularly (e.g., in dividing or in quiescent cells, such as post-mitotic cells) as episomes, e.g., in a manner similar to AAV vectors. In any of the embodiments described herein, a circular DNA vector may be a non-integrating (e.g., episomal) vector. Circular DNA vectors provided herein can be naked DNA vectors, devoid of components inherent to viral vectors (e.g., viral proteins) and substantially devoid of bacterial plasmid DNA. In various embodiments, the circular DNA vectors are devoid of any significant immunogenic components (e.g., immunogenic bacterial signatures, such as CpG islands, CpG motifs, or CpG methylation) or components additionally or otherwise associated with reduced persistence (e.g., CpG islands or CpG motifs or CpG methylation). In some embodiments, the vector lacks bacterial methylation signatures, such as Dam methylation and Dem methylation. For example, in some embodiments, the vector contains DNA in which at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 99%, or essentially all) of the GATC sequences are unmethylated (e.g., by Dam methylase). Additionally, or alternatively, the vector contains DNA in which at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 99%, or essentially all) of the CCAGG sequences and / or CCTGG sequences are unmethylated (e.g., by Dem methylase).
[0186] In some embodiments, the circular DNA vector is persistent in vivo in a target cell, and the circular DNA vector exhibits improved expression persistence (e.g., intra-cellular persistence and / or trans-generational persistence) relative to a reference vector. The reference vector may contain additional backbone sequences or bacterial signatures described herein, which signatures may include, for example, an antibiotic resistance gene or other selectable marker.
[0187] In some embodiments, the circular DNA vector persists and the expression of the circular DNA vector persists, for at least one month, or at least two months, or at least six months, or at least eight months, or at least one year, or longer after administration. In some embodiments, therapeutic persistence of the circular DNA vector endures, such that administration is no more than 4 times per year, or no more than 2 times per year, or no more than once per year, or less frequently. In some embodiments, the expression level of the circular DNA vector does not decrease by more than 50% in the first one month, or the first two months, or the first six months following administration, compared to the expression level observed within the first 1, 2, or 3 days following administration.
[0188] Circular DNA vectors may be monomeric, dimeric, trimeric, tetrameric, pentameric, hexameric, etc. In some preferred embodiments, the circular DNA vector is monomeric. In some embodiments, the DNA vector is supercoiled. The circular DNA vector may be supercoiled due to the endogenous processes within the engineered bacterial cell or due to treatment with a topoisomerase (e.g., gyrase). In some embodiments, the circular DNA vector is a monomeric, supercoiled circular DNA molecule. In some embodiments, the circular DNA vector is nicked. In some embodiments, the circular DNA vector is open circular. In some embodiments, the circular DNA vector is double-stranded circular. In some embodiments, a composition comprising the circular DNA vector comprises at least about 70%, or at least about 80%, or at least about 90%, or at least about 95%, or at least about 97%, or at least about 98%, or at least about 99% supercoiled monomer, including in embodiments that do not include treatment by an exogenous topoisomerase. A. Sequences of Interest
[0189] The present circular DNA vectors include a sequence of interest (e.g., a therapeutic sequence), which preferably includes one or more eukaryotic (e.g., mammalian) coding sequence (e.g., transgene or heterologous gene). The sequence of interest may include one or more proteincoding domains and / or one or more non-protein coding domains (e.g., a therapeutic nucleic acid (e.g., miRNA, siRNA, shRNA, etc.) or regulatory elements (e.g., S / MAR, intronic sequences, etc.).
[0190] In particular embodiments involving a therapeutic protein-coding therapeutic domain, the therapeutic sequence includes, linked in the 5’ to 3’ direction: a promoter and a single therapeutic protein-coding domain (e.g., a single transcription unit); a promoter and two or more therapeutic protein-coding domains (e.g., a multicistronic unit); or a first transcription unit and one or more additional transcription units (e.g., a multi-transcription unit). Any such protein-coding therapeutic sequences may further include non-protein coding domains, such as polyadenylation sites, control elements, enhancers, sequences to mark DNA (e.g., for antibody recognition), PCR amplification sites, sequences that define restriction enzyme sites, site-specific recombinase recognition sites, sequences that are recognized by a protein that binds to and / or modifies nucleic acids, linkers, splice sites, pre-mRNA binding domains, regulatory sequences, and / or a therapeutic nucleic acid (e.g., a microRNA-encoding sequence). Therapeutic protein-coding domains can be full-length protein-coding domains (e.g., corresponding to a native gene or natural variant thereof) or a functional portion thereof, such as a truncated protein-coding domain (e.g., minigene).
[0191] In some embodiments, the therapeutic sequence encodes a monomeric protein (e.g., a monomeric protein with secondary structure under physiological conditions, e.g., a monomeric protein with secondary and tertiary structure under physiological conditions. Additionally, or alternatively, the therapeutic sequence may encode a multimeric protein (e.g., a dimeric protein, such as a homodimeric protein or heterodimeric protein, or a trimeric protein, etc.).
[0192] In particular instances, the therapeutic sequence includes an ocular gene. In some embodiments, the ocular gene is a gene that is expressed in ocular tissue, such as, for example retinal tissue, which may include, for example, photoreceptor cells and / or retinal pigment epithelial (RPE) cells. In some embodiments, the coding sequence comprises a human ABCA4 or MYO7A gene sequence (e.g., encoding a human ABCA4 protein, as represented by SEQ ID NO: 61 , or encoding a human MYO7A amino acid sequence, as represented by SEQ ID NO: 62). An exemplary human ABCA4 gene sequence is also provided as National Center for Biotechnology Information (NCBI) Reference Sequence: NG_009073. The amino acid sequence of an exemplary ABCA4 protein is given by Protein Accession No. P78363.3. An exemplary human MYO7A gene sequence is provided as NCBI Gene ID: 4647. The amino acid sequence of an exemplary MYO7A protein is given by Protein Accession No. Q13402. An ocular gene (e.g., an ABCA4 or MY07A gene) may be any of those genes taught in PCT / 2022 / 0082078, which is incorporated herein by reference in its entirety.
[0193] In some instances, the ocular gene is MYO7A, BEST1 , CFH, CEP290, USH2A, ADGRV1 , CDH23, CRB1 , PCDH15, RPGR, ABCA4, ABCC6, RIMS1 , LRPS, CC2D2A, TRPM1 , C3, IFT172, COL1 1A1 , TUBGCP6, KIAA1549, CACNA1F, SNRNF200, PRPF8, VCAN, USH2A, HMCN1 , RPE65, NR2E3, NRL, RHO, RP1 , RP2, or OFD1. For instance, the ocular gene can be at least 90% identical (at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to SEQ ID NO: 19, and encodes a CFH protein. In certain instances, the ocular gene comprises, or consists of, SEQ ID NO: 19. In some instances, the nucleic acid sequence (e.g., the nucleic acid sequence in a circular DNA vector) is at least 90% identical (at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to SEQ ID NO: 20, and encodes a CFH protein. In some instances, the nucleic acid sequence (e.g., the nucleic acid sequence in a circular DNA vector) comprises, or consists of, SEQ ID NO: 20. In some instances, the ocular gene can be at least 90% identical (at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to SEQ ID NO: 21 , and encodes an ABCA4 protein (e.g., as represented by SEQ ID NO: 61). In certain instances, the ocular gene comprises, or consists of, SEQ ID NO: 21. In some instances, the nucleic acid sequence (e.g., the nucleic acid sequence in a circular DNA vector) is at least 90% identical (at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to SEQ ID NO: 8, and encodes an ABCA4 protein (e.g., as represented by SEQ ID NO: 61) and includes a ColE2-P9 origin as described herein. In some instances, the nucleic acid sequence (e.g., the nucleic acid sequence in a circular DNA vector) comprises, or consists of, SEQ ID NO: 8.
[0194] In some instances, the ocular gene comprises a nucleic acid sequence that is at least 90% identical (at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to SEQ ID NO: 22, and encodes a MYO7A protein (e.g., as represented by SEQ ID NO: 62). In some instances, the ocular gene comprises, or consists of, the nucleic acid sequence of SEQ ID NO: 22. In some instances, the ocular gene comprises a nucleic acid sequence that is at least 90% identical (at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to SEQ ID NO: 23. In some instances, the ocular gene comprises, or consists of, the nucleic acid sequence of SEQ ID NO: 23. A therapeutic sequence including any of the aforementioned ocular genes may also include a promoter, (e.g., a CAG promoter) driving expression of the ocular gene. In some embodiments, the promoter includes a native sequence derived from the endogenous promoter of an ocular gene. In some embodiments, the promoter includes a native sequence of the same gene to which it is operably linked. For example, an ABCA4 coding sequence can be operably linked to, and be under the control of, a sequence derived from the native ABCA4 genetic locus, such as a sequence upstream of the ABCA4 transcription start site. As another example, a MYO7A coding sequence can be operably linked to, and be under the control of, a sequence derived from the native MYO7A genetic locus, such as a sequence upstream of the MYO7A transcription start site. In some embodiments, the promoter sequence and coding sequence are derived from native sequences of the same species. For example, a therapeutic sequence may include an ABCA4 native promoter sequence from the human genome and the ABCA4 coding sequence from the human genome or a functional variant thereof or a MYO7A native promoter sequence from the human genome and the MY07A coding sequence from the human genome or a functional variant thereof.
[0195] In some embodiments, the therapeutic sequence having an ocular gene includes one or more of the following constructs that include sequences derived from native promoter sequences: MYO7A Promoter HS1 / 2_lntron1 (SEQ ID NO: 30), MYO7A Promoter HS1-3 (SEQ ID NO: 31), MYO7A Promoter Min (SEQ ID NO: 32), ABCA4 Promoter Exon_lntron1_Short (SEQ ID NO: 33), ABCA4 Promoter Exon_lntron1_large (SEQ ID NO: 34), or ABCA4 Promoter_Large (SEQ ID NO: 35), ABCA4 Promoter_Short (SEQ ID NO: 36), or functional variants thereof. In some embodiments, the therapeutic sequence includes a sequence having at least 75, 80, 85, 90, 95, 98, 99, 99.5 or 99.9% sequence identity or having 100% sequence identity, to any of SEQ ID NOs: SO- 36. In some embodiments, the therapeutic sequence includes a sequence having at least 75, 80, 85, 90, 95, 98, 99, 99.5 or 99.9% sequence identity to at least 250 nucleotides, or at least 400 nucleotides, or at least 500 nucleotides, or at least 750 nucleotides, or at least 1000 nucleotides, of any of SEQ ID NOs: 30-36, and directing expression of the therapeutic protein in photoreceptor cells and / or RFP cells.
[0196] In addition to the sequence sufficient to direct transcription, a promoter sequence of the invention can also include sequences of other regulatory elements that are involved in modulating transcription (e.g., enhancers, Kozak sequences, and introns). For example, in some embodiments disclosed herein, the therapeutic sequence includes sequences derived from an ABCA4 or MYO7A native promoter and sequences derived from a native intron 1 sequence of ABCA4 or MYO7A. In some embodiments, regulatory elements, such as promoters, introns, insulators, enhancers, or other elements, are derived from native sequences of the same species as the gene to which they are operably linked in therapeutic sequences.
[0197] In some embodiments, promoters included in therapeutic sequences disclosed herein are tissue-specific promoters in that, in normal operation, they drive expression only when present in certain tissue types, such as, for example, ocular tissue. In some embodiments, a promoter used in a therapeutic sequence is not tissue-specific but is capable of driving expression in any tissue type. In some embodiments, the promoter is an inducible promoter. In some embodiments, the promoter is a constitutive promoter. In some embodiments, the construct described herein comprises a cytomegalovirus (CMV) enhancer / beta-actin (CAG) promoter (e.g., SEQ ID NO: 37 or a functional variant thereof), elongation factor 1 alpha (EF1A) promoter (e.g., SEQ ID NO: 38 or a functional variant thereof), interphotoreceptor retinoid-binding protein (IBRP) promoter, rhodopsin kinase (RK) promoter (e.g., G protein-coupled receptor kinase 1 (GRK1) promoter), SV40 promoter, dihydrofolate reductase promoter, p-actin promoter, phosphoglycerol kinase (PGK) promoter, or functional variants thereof. Inducible promoters allow regulation of gene expression and can be regulated by exogenously supplied compounds, environmental factors such as temperature, or the presence of a specific physiological state, e.g., acute phase, a particular differentiation state of the cell, or in replicating cells only. Inducible promoters and inducible systems are available from a variety of commercial sources. Many other systems have been described and can be readily selected by one of skill in the art. Examples of inducible promoters regulated by exogenously supplied promoters include zinc-inducible sheep metallothionine (MT) promoters, dexamethasoneinducible mouse mammary tumor virus promoters, T7 polymerase promoter systems, ecdysone insect promoters, tetracycline-repressible systems, tetracycline-inducible systems, RU486- inducible systems, and rapamycin-inducible systems. Still other types of inducible promoters which may be useful in this context are those which are regulated by a specific physiological state, e.g., temperature, acute phase, a particular differentiation state of the cell, or in replicating cells only.
[0198] In addition to a promoter, therapeutic sequences disclosed herein can include other regulatory elements, which can include, for example, appropriate transcription initiation, termination, and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation (polyA) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and sequences that enhance secretion of the encoded product.
[0199] For therapeutic sequences that include genes encoding a protein, a polyadenylation (poly- A, or pA) sequence can be inserted following the gene (e.g., operably linked 3’ to the gene, e.g., directly linked 3’ to the gene). The precise nature of the regulatory sequences needed for gene expression in host cells may vary between species, tissues or cell types, but shall in general include, as necessary, 5' nontranscribed and 5’ non-translated sequences involved with the initiation of transcription and translation respectively, such as a TATA box, capping sequence, CAAT sequence, enhancer elements, and the like. Such 5' non-transcribed regulatory sequences may include a promoter region that includes a promoter sequence for transcriptional control of the operably joined gene. Regulatory sequences may also include enhancer sequences or upstream activator sequences. The vectors of the disclosure may optionally include 5’ leader or signal sequences.
[0200] In some embodiments, therapeutic sequences disclosed herein include scaffold-matrix attachment regions (S / MARs). Without being bound by theory, it is believed that S / MAR elements can help establish long-term gene expression from a DNA vector through the interaction of the S / MAR element with the nuclear matrix. Known S / MAR constructs include the human IFN-y S / MAR (SEQ ID NO: 39) and the human APOB S / MAR (NCBI Gene ID 106632268). Other known S / MAR elements can be included in therapeutic sequences disclosed herein, as can functional variants thereof. In some embodiments, a variant (SEQ ID NO: 40) of the IFN-y S / MAR comprising tandem repeats of a functional portion of the IFN-y S / MAR is included in therapeutic sequences provided herein. In some embodiments, the therapeutic sequences includes a sequence having at least 75%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99%, or at least 99.5% sequence identity or having 100% sequence identity to SEQ ID NO: 39 or 40. S / MAR elements can be operably linked either 5’ or 3’ to a coding sequence of a therapeutic sequence.
[0201] In some embodiments, therapeutic sequences disclosed herein include chromatin insulator elements. In some embodiments, the one or more chromatin insulator elements may include one or more chicken hypersensitive site-4 elements (cHS4; SEQ ID NO: 41), which is a chromatin insulator from the chicken 0-globin locus control region. In some embodiments, the therapeutic sequence includes a sequence having at least 75%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99%, or at least 99.5% sequence identity or having 100% sequence identity to SEQ ID NO: 41 .
[0202] In some embodiments, therapeutic sequences disclosed herein include a regulatory element derived from (e.g., containing a portion of, or a variant thereof) a native sequence of ABCA4 intron 6. Such regulatory elements, e.g., SEQ ID NO: 42, can enhance persistence and expression levels of genes operably linked thereto. Thus, some embodiments of the invention feature a regulatory element derived from a native sequence of ABCA4 intron 6, e.g., a sequence in the 5’ half of ABCA4 intron 6 (i.e., a sequence that is upstream from the midpoint between the 5’ and 3’ end of ABCA4 intron 6) or a sequence in the 5’ third of ABCA4 intron 6 (i.e., a sequence that is within the 5’-most 33.3% of ABCA4 intron 6).
[0203] In some instances, a regulatory element derived from ABCA4 intron 6 has one or more (one, two, three, four, five, or more) sequences that are identical to at least 100 consecutive nucleotides within a native human ABCA4 intron 6 (e.g., SEQ ID NO: 29), e.g., at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 1100, at least 1200, at least 1300, at least 1400, at least 1500, or at least 1600 consecutive nucleotides within a native human ABCA4 intron 6 (e.g., SEQ ID NO: 29), e.g., from 100-5000, from 500 to 2500, from 1000 to 2000, or from 1500 to 1700 consecutive nucleotides within a native human ABCA4 intron 6 (e.g., SEQ ID NO: 29). In some instances, sequences shared between the regulatory element and ABCA4 intron 6 include nucleotides wholly or partially within nucleotides 3158-4822 of ABCA4 intron 6 (numbering starting from the 5’ end of ABCA4 intron 6), e.g., SEQ ID NO: 42.
[0204] In some instances, a regulatory element is a functional variant of any of the aforementioned ABCA4 intron 6-derived regulatory elements. For example, in some instances, a regulatory element derived from ABCA4 intron 6 has one or more (one, two, three, four, five, or more) sequences that are at least 90% identical (e.g., at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical) to at least 100 consecutive nucleotides within a native human ABCA4 intron 6 (e.g., SEQ ID NO: 29), e.g., at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 1100, at least 1200, at least 1300, at least 1400, at least 1500, or at least 1600 consecutive nucleotides within a native human ABCA4 intron 6 (e.g., SEQ ID NO: 29), e.g., from 100-5000, from 500 to 2500, from 1000 to 2000, or from 1500 to 1700 consecutive nucleotides within a native human ABCA4 intron 6 (e.g., SEQ ID NO: 29). In some instances, sequences shared between the regulatory element and ABCA4 intron 6 include nucleotides wholly or partially within nucleotides 3158-4822 of ABCA4 (numbering starting from the 5' end of ABCA4 intron 6), e.g., SEQ ID NO: 42.
[0205] In some instances, a regulatory element derived from ABCA4 intron 6 has one or more (one, two, three, four, five, or more) sequences that are at least 90% identical (e.g., at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical) to at least 100 consecutive nucleotides within the 5’ third of a native human ABCA4 intron 6 (e.g., SEQ ID NO: 29), e.g., at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 1100, at least 1200, at least 1300, at least 1400, at least 1500, or at least 1600 consecutive nucleotides within the 5’ third of a native human ABCA4 intron 6 (e.g., SEQ ID NO: 29), e.g., from 100-5000, from 500 to 2500, from 1000 to 2000, or from 1500 to 1700 consecutive nucleotides within the 5’ third of a native human ABCA4 intron 6 (e.g., SEQ ID NO: 29). In some instances, sequences shared between the regulatory element and ABCA4 intron 6 include nucleotides wholly or partially within nucleotides 3158-4822 of ABCA4 intron 6 (numbering starting from the 5’ end of ABCA4 intron 6), e.g., SEQ ID NO: 42.
[0206] In some instances, a regulatory element derived from ABCA4 intron 6 has one or more (one, two, three, four, five, or more) sequences that are identical to at least 100 consecutive nucleotides of nucleotides 3158-4822 of ABCA4 intron 6, e.g., at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 1100, at least 1200, at least 1300, at least 1400, at least 1500, or at least 1600 consecutive nucleotides of nucleotides 3158-4822 of ABCA4 intron 6).
[0207] In some instances, a regulatory element derived from ABCA4 intron 6 has one or more (one, two, three, four, five, or more) sequences that are at least 90% identical (e.g., at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical) to at least 100 consecutive nucleotides of nucleotides 3158-4822 of ABCA4 intron 6, e.g., at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 1 100, at least 1200, at least 1300, at least 1400, at least 1500, or at least 1600 consecutive nucleotides of nucleotides 3158-4822 of ABCA4 intron 6).
[0208] In some of any of the aforementioned instances, the regulatory element derived from ABCA4 intron 6 has been mutated in one or more positions (e.g., one, two, three, or more positions), relative to the native ABCA4 intron 6 sequence, to remove a recognition site of a restriction enzyme, e.g., a type Ils restriction enzyme (e.g., Bsal), which can improve manufacturing efficiency by streamlining cell-free production of synthetic circular DNA vectors using the methods described in the Examples herein (e.g., by consolidating steps by using a type Ils restriction enzyme). For instance, nucleotide 3530 of native human ABCA4 intron 6 (SEQ ID NO: 29), which is a G, can be deleted to remove a Bsal recognition site in a regulatory element derived from ABCA4 intron 6, thereby facilitating an improved, Bsal-based manufacturing process. For example, in some embodiments, a nucleotide sequence from nucleotides 3158-4822 of native ABCA4 intron 6 is modified to delete of G3530, thereby producing the ABCA4 intron 6-derived regulatory element of SEQ ID NO: 42.
[0209] Promoters, coding sequences, and other elements can be included in therapeutic sequences disclosed herein in any suitable order that provides for effective expression and / or persistence. In some embodiments, a therapeutic sequence includes, in a 5’ to 3' direction, a promoter, a coding sequence, and a polyadenylation sequence. In some embodiments, a therapeutic sequence includes, in a 5’ to 3’ direction, an enhancer sequence (e.g., an S / MAR), a promoter, a coding sequence, and a polyadenylation sequence. In some embodiments, a therapeutic sequence includes, in a 5’ to 3’ direction, an insulator sequence (e.g., cHS4), a promoter, a coding sequence, and a polyadenylation sequence. In some embodiments, a therapeutic sequence includes, in a 5’ to 3’ direction, an insulator sequence (e.g., cHS4), a promoter, a coding sequence, a polyadenylation sequence, and another regulatory element (e.g., a regulatory element derived from intron 6 of ABCA4). In some embodiments, a therapeutic sequence includes, in a 5’ to 3’ direction, an insulator sequence (e.g., cHS4), a promoter, a coding sequence, a polyadenylation sequence, and an enhancer sequence (e.g., an S / MAR). In some embodiments, a therapeutic sequence includes, in a 5’ to 3’ direction, an insulator sequence (e.g., cHS4), a promoter, a coding sequence, another regulatory element (e.g., a regulatory element derived from intron 6 of ABCA4), and a polyadenylation sequence. In some embodiments, a therapeutic sequence includes, in a 5’ to 3’ direction, an insulator sequence (e.g., cHS4), a promoter, a coding sequence, an enhancer sequence (e.g., an S / MAR), and a polyadenylation sequence. In some embodiments, a therapeutic sequence includes, in a 5’ to 3’ direction, a promoter, a regulatory element (e.g., an intron), a coding sequence, and a polyadenylation sequence. In some embodiments, a therapeutic sequence includes, in a 5’ to 3’ direction, an enhancer sequence (e.g., an S / MAR), a promoter, a regulatory element (e.g., an intron or portion thereof, e.g., a portion of ABCA4 intron 6, e.g., an intron 6 regulatory element), a coding sequence, and a polyadenylation sequence. In some embodiments, a therapeutic sequence includes, in a 5’ to 3’ direction, an insulator sequence (e.g., cHS4), a promoter, a regulatory element (e.g., an intron or portion thereof, e.g., a portion of ABCA4 intron 6, e.g., an intron 6 regulatory element), a coding sequence, and a polyadenylation sequence. In some embodiments, a therapeutic sequence includes, in a 5’ to 3’ direction, an insulator sequence (e.g., cHS4), a promoter, a regulatory element (e.g., an intron or portion thereof, e.g., a portion of ABCA4 intron 6, e.g., an intron 6 regulatory element), a coding sequence, a polyadenylation sequence, and another regulatory element (e.g., a regulatory element derived from intron 6 of ABCA4). In some embodiments, a therapeutic sequence includes, in a 5’ to 3’ direction, an insulator sequence (e.g., cHS4), a promoter, a regulatory element (e.g., an intron or portion thereof, e.g., a portion of ABCA4 intron 6, e.g., an intron 6 regulatory element), a coding sequence, a polyadenylation sequence, and an enhancer sequence (e.g., an S / MAR). In some embodiments, a therapeutic sequence includes, in a 5’ to 3’ direction, an insulator sequence (e.g., cHS4), a promoter, a regulatory element (e.g., an intron or portion thereof, e.g., a portion of ABCA4 intron 6, e.g., an intron 6 regulatory element), a coding sequence, another regulatory element (e.g., a regulatory element derived from intron 6 of ABCA4), and a polyadenylation sequence. In some embodiments, a therapeutic sequence includes, in a 5’ to 3’ direction, an insulator sequence (e.g., cHS4), a promoter, a regulatory element (e.g., an intron or portion thereof, e.g., a portion of ABCA4 intron 6, e.g., an intron 6 regulatory element), a coding sequence, an enhancer sequence (e.g., an S / MAR), and a polyadenylation sequence. Sequence elements disclosed herein can be arranged in other suitable combinations and orders.
[0210] Some embodiments of therapeutic sequences disclosed herein include one or more coding sequences for one or more respiratory genes, such as a CFTR-encoding gene. In some embodiments, the respiratory gene (e.g., CFTR-encoding gene) is a gene that is expressed in airway tissue, such as, an airway epithelium (e.g., a lung epithelium, a nasal epithelium, a tracheal epithelium, bronchial epithelium, bronchiole, or alveolus). In some embodiments, the respiratory gene encodes for a therapeutic protein, such as CFTR.
[0211] Coding sequences included in therapeutic sequences (e.g., CFTR-encoding therapeutic sequences) can include genes that are involved in respiratory diseases, such as cystic fibrosis. In some embodiments, the coding sequence is a cDNA of CFTR. In some embodiments, the coding sequence is a codon-optimized CFTR sequence. In some instances, the coding sequence is a functional variant of the respiratory gene, e.g., a CFTR-encoding gene. In some embodiments, the coding sequence of CFTR is, or comprises, the nucleic acid sequence of SEQ ID NO: 25. In some embodiments, the coding sequence of CFTR includes a sequence having at least 75%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 99%, or at least 99.5%, sequence identity to SEQ ID NO: 25. In some embodiments, the coding sequence may be a human sequence or a human-derived sequence.
[0212] Therapeutic sequences disclosed herein can include one or more regulatory elements upstream of the transcriptional start site of a protein-encoding sequence (upstream elements), such as promoter sequences and / or hypersensitivity sequences. In some instances described herein, the therapeutic sequence includes a hypersensitivity sequence derived from (e.g., containing a portion of, or variant thereof) a native intronic sequence found upstream from the transcriptional start site of CFTR (e.g., human CFTR). In some embodiments, the hypersensitivity sequence is derived from a native intronic sequence found, in its native position (e.g., according to GRch37 / hg19), at least 5,000 nucleotides upstream from the transcriptional start site of CFTR (e.g., human CFTR) (e.g., between 5,000 and 50,000 nucleotides upstream from the transcriptional start site of CFTR (e.g., human CFTR)). In some embodiments, the hypersensitivity sequence is derived from a native intronic sequence found, in its native position (e.g., according to GRch37 / hg19), at least 10,000 nucleotides upstream from the transcriptional start site of CFTR (e.g., human CFTR) (e.g., between 10,000 and 50,000 nucleotides upstream from the transcriptional start site of CFTR (e.g., human CFTR)). In some embodiments, the hypersensitivity sequence is derived from a native intronic sequence found, in its native position (e.g., according to GRch37 / hg19), at least 20,000 nucleotides upstream from the transcriptional start site of CFTR (e.g., human CFTR) (e.g., between 20,000 and 50,000, between 30,000 and 50,000, or between 40,000 and 50,000 nucleotides upstream from the transcriptional start site of CFTR (e.g., human CFTR)).
[0213] For example, a hypersensitivity sequence can be derived from a native human intronic sequence between 40,000 and 50,000 nucleotides upstream from the transcriptional start site human CFTR on chromosome 7, position 117,074,974-117,076,392 of Genome Reference Consortium Human Build 37 release 19 (GRch37 / hg19; SEQ ID NO: 28). Such hypersensitivity sites (e.g., SEQ ID NO: 28) can enhance expression levels of genes operably linked thereto (e.g., operatively linked downstream). Thus, some embodiments of the invention feature a hypersensitivity sequence derived from (e.g., containing a portion of, or variant thereof) SEQ ID NO: 28. In some instances, a hypersensitivity sequence derived from SEQ ID NO: 28 has one or more sequences that are identical to at least 100 consecutive nucleotides within SEQ ID NO: 28, e.g., one, two, three, four, five, or more sequences that are identical to at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 1100, at least 1200, at least 1300, or at least 1400 consecutive nucleotides within SEQ ID NO: 28. In some embodiments, a hypersensitive sequence derived from SEQ ID NO: 28 has one or more (e.g., one, two, three, four, five, or more) sequences that are identical to 100-1500, 200-1200, SOO- WOO, or 400-800 consecutive nucleotides within SEQ ID NO: 28.
[0214] In some embodiments, any of the aforementioned hypersensitivity sequences derived from a native intronic sequence found upstream from the transcriptional start site of CFTR (e.g., human CFTR) has one or more (e.g., one, two, three, four, five, or more) sequences that are at least 90% identical (e.g., at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or 100% identical) to at least 100 consecutive nucleotides within SEQ ID NO: 28. For instance, any of the aforementioned hypersensitivity sequences derived from a native intronic sequence found upstream from the transcriptional start site of CFTR (e.g., human CFTR) has one or more (e.g., one, two, three, four, five, or more) sequences that are at least 90% identical (e.g., at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or 100% identical) to at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 1 100, at least 1200, at least 1300, or at least 1400 consecutive nucleotides within SEQ ID NO: 28.
[0215] In some instances, a hypersensitivity sequence derived from a native intronic sequence found upstream from the transcriptional start site of CFTR (e.g., human CFTR) has one or more (one, two, three, four, five, or more) sequences that are identical to at least 100 consecutive nucleotides of SEQ ID NO: 28, e.g., at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 1 100, at least 1200, at least 1300, or at least 1400 consecutive nucleotides of SEQ ID NO: 28). In some embodiments, the therapeutic sequence includes a sequence having at least 75%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or at least 98%, or at least 99%, or at least 99.5% sequence identity or having 100% sequence identity to SEQ ID NO: 28.
[0216] Therapeutic sequences described herein may include a promoter sequence derived from the endogenous promoter of a respiratory gene, e.g., a CFTR gene. In some embodiments, the promoter sequence includes a native sequence of the same gene to which it is operably linked. For example, a CFTR coding sequence can be operably linked to, and be under the control of, a sequence derived from the native CFTR genetic locus, such as a sequence upstream of the CFTR transcription start site. In some embodiments, the promoter sequence and coding sequence are derived from native sequences of the same species. For example, an expression construct may include a CFTR native promoter sequence from the human genome and the CFTR coding sequence from the human genome, or a functional variant thereof.
[0217] In some embodiments in which the therapeutic sequence encodes CFTR, promoter sequences are tissue-specific promoters in that, in normal operation, drive expression only when present in certain tissue types, such as airway epithelium. In some embodiments, a promoter sequence used in a therapeutic sequence encoding CFTR is not tissue-specific but is capable of driving expression in any tissue type. In some embodiments, the promoter is an inducible promoter. In some embodiments, the promoter sequence is a constitutive promoter. In some embodiments, the construct described herein comprises an elongation factor 1 alpha (EF1 A) promoter sequence (e.g., SEQ ID NO: 43 or a functional variant thereof). In some instances, the construct described herein includes a cytomegalovirus (CMV) enhancer / beta-actin (CAG) promoter (e.g., SEQ ID NO: 44 or a functional variant thereof), an interphotoreceptor retinoid-binding protein (IBRP) promoter, a rhodopsin kinase (RK) promoter (e.g., G protein-coupled receptor kinase 1 (GRK1) promoter), an SV40 promoter, a dihydrofolate reductase promoter, a p-actin promoter, a phosphoglycerol kinase (PGK) promoter, or functional variants of any of the aforementioned promoters.
[0218] In some instances, a hypersensitivity sequence (e.g., any of the hypersensitivity sequences described herein) is operably linked (e.g., directly or indirectly) upstream of a promoter that is derived from a native intronic sequence found upstream from the transcriptional start site of CFTR (e.g., human CFTR), e.g., a native promoter. In some instances, the promoter is derived from a native sequence that extends, in its native position (e.g., according to GRch37 / hg19), no more than 5,000 nucleotides upstream from the transcriptional start site of CFTR (e.g., human CFTR) (e.g., no more than 4,500, 4,000, 3,500, or 3,000 nucleotides upstream from the transcriptional start site of CFTR (e.g., human CFTR)).
[0219] In some instances, the promoter of a CFTR-encoding therapeutic sequence is derived from human chromosome 7, position 117,118,786-117,120,280 of GRch37 / hg19 (e.g., a promoter comprising SEQ ID NO: 26, or a functional variant thereof (e.g., SEQ ID NO: 27)). Such promoters (e.g., SEQ ID NO: 26 or SEQ ID NO: 27) can enhance expression levels of genes operably linked thereto (e.g., operatively linked downstream). Thus, some embodiments of the invention feature a promoter derived from (e.g., containing a portion of, or variant thereof) SEQ ID NO: 26. In some instances, a promoter derived from SEQ ID NO: 26 has one or more (e.g., one, two, three, four, five, or more) sequences that are identical to at least 100 consecutive nucleotides within SEQ ID NO: 26, e.g., one or more (e.g., one, two, three, four, five, or more) sequences that are identical to at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 1100, at least 1200, at least 1300, or at least 1400 consecutive nucleotides within SEQ ID NO: 26, e.g., one or more (e.g., one, two, three, four, five, or more) sequences that are identical to 100-1500, 200-1200, 300-1000, or 400-800 consecutive nucleotides within SEQ ID NO: 26.
[0220] In some embodiments, any of the aforementioned promoters derived from a native intronic sequence found upstream from the transcriptional start site of CFTR (e.g., human CFTR) has one or more (e.g., one, two, three, four, five, or more) sequences that are at least 90% identical (e.g., at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or 100% identical) to at least 100 consecutive nucleotides within SEQ ID NO: 26. For instance, any of the aforementioned promoters derived from a native intronic sequence found upstream from the transcriptional start site of CFTR (e.g., human CFTR) may have one or more (e.g., one, two, three, four, five, or more) sequences that are at least 90% identical (e.g., at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or 100% identical) to at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 1100, at least 1200, at least 1300, or at least 1400 consecutive nucleotides within SEQ ID NO: 26.
[0221] In some instances, a promoter sequence derived from a native intronic sequence found upstream from the transcriptional start site of CFTR (e.g., human CFTR) has one or more (one, two, three, four, five, or more) sequences that are identical to at least 100 consecutive nucleotides of SEQ ID NO: 26, e.g., at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 1 100, at least 1200, at least 1300, or at least 1400 consecutive nucleotides of SEQ ID NO: 26).
[0222] In some instances, a promoter sequence derived from a native intronic sequence found upstream from the transcriptional start site of CFTR (e.g., human CFTR) has one or more (one, two, three, four, five, or more) sequences that are at least 90% identical (e.g., at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical) to at least 100 consecutive nucleotides of SEQ ID NO: 26 or SEQ ID NO: 27, e.g., at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 1100, at least 1200, at least 1300, or at least 1400 consecutive nucleotides of SEQ ID NO: 26 or SEQ ID NO: 27.
[0223] In some embodiments, a CFTR-encoding therapeutic sequence includes a sequence having at least 75%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or at least 98%, or at least 99%, or at least 99.5% sequence identity or having 100% sequence identity to SEQ ID NO: 26 or SEQ ID NO: 27.
[0224] In some embodiments, a CFTR-encoding therapeutic sequence includes any of the aforementioned hypersensitivity sequences derived from a native intronic sequence found upstream from the transcriptional start site of CFTR (e.g., human CFTR) (e.g., derived from SEQ ID NO: 28) operatively linked upstream to any of the aforementioned promoter sequences derived from a native intronic sequence found upstream from the transcriptional start site of CFTR (e.g., human CFTR), e.g., any of the aforementioned promoter sequences that extend, in its native position (e.g., according to GRch37 / hg19), no more than 5,000 nucleotides upstream from the transcriptional start site of CFTR (e.g., human CFTR) (e.g., no more than 4,500, 4,000, 3,500, or 3,000 nucleotides upstream from the transcriptional start site of CFTR (e.g., human CFTR)), e.g., derived from SEQ ID NO: 26. Thus, in some instances, the expression construct of the invention includes a hypersensitivity sequence derived from SEQ ID NO: 5 of 713, which is operatively linked upstream to a promoter sequence derived from SEQ ID NO: 26.
[0225] In some instances, the hypersensitivity sequence (e.g., the hypersensitivity sequence derived from SEQ ID NO: 28) is operatively linked to the promoter (e.g., the promoter derived from SEQ ID NO: 26, e.g., SEQ ID NO: 27) by an intervening sequence (e.g., an inert intervening sequence) of no more than 500 nucleotides (e.g., no more than 400, 300, 200, or 100 nucleotides), e.g., from 0-10, from 2-20, from 2-10, or from 4-8 nucleotides.
[0226] In some instances, the therapeutic sequence includes any of the structures of features described in International Patent Publication No. WO 2022 / 182795, which is incorporated herein by reference in its entirety. In instance, a therapeutic sequence may include a modulatory proteinencoding gene, e.g., an immunomodulatory protein-encoding gene, such as a dendritic cell chemoattractant-encoding gene (XCL1, XCL2, CCL5, or CCL4), a dendritic cell growth factor or activator-encoding gene (e.g., FLT3L, GMCSF, or CD40), or a lymphocyte signaling proteinencoding gene (e.g., IL-12, IL-15, CXCL9, or CXCL10). Such vectors may be a bi-cistronic or multi- cistronic vector encoding two, three, or more modulatory protein-encoding genes.
[0227] In some embodiments, the therapeutic sequence encodes an antibody, or a portion, fragment, or variant thereof. Antibodies include fragments that are capable of binding to an antigen, such as Fv, single-chain Fv (scFv), Fab, Fab’, di-scFv, sdAb (single domain antibody), (Fab’)2 (including a chemically linked F(ab’)2), and nanobodies. Papain digestion of antibodies produces two identical antigen-binding fragments, called “Fab" fragments, each with a single antigen-binding site, and a residual “Fc” fragment, whose name reflects its ability to crystallize readily. Pepsin treatment yields an F(ab’)2 fragment that has two antigen-combining sites and is still capable of cross-linking antigen. Antibodies also include chimeric antibodies and humanized antibodies. Furthermore, for all antibody constructs provided herein, variants having the sequences from other organisms are also contemplated. Thus, if a human version of an antibody is disclosed, one of skill in the art will appreciate how to transform the human sequence-based antibody into a mouse, rat, cat, dog, horse, etc. sequence. Antibody fragments also include either orientation of single chain scFvs, tandem di-scFv, diabodies, tandem tri-sdcFv, minibodies, nanobodies, etc. In some embodiments, such as when an antibody is an scFv, a single polynucleotide of a therapeutic gene sequence encodes a single polypeptide comprising both a heavy chain and a light chain linked together. Antibody fragments also include nanobodies (e.g., sdAb, an antibody having a single, monomeric domain, such as a pair of variable domains of heavy chains, without a light chain). Multispecific antibodies (e.g., bispecific antibodies, trispecific antibodies, etc.) are known in the art and contemplated as expression products of the therapeutic gene sequences of the present invention.
[0228] In some instances, the therapeutic sequence encodes one or more proteins (e.g., a single protein, two proteins, three proteins, four proteins, or more), each having a length of at least 25 amino acids, at least 50 amino acids, at least 100 amino acids, at least 200 amino acids, at least 500 amino acids, at least 1 ,000 amino acids, at least 1 ,500 amino acids, at least 2,000 amino acids, or more. In embodiments in which such therapeutic sequence encodes two or more proteins, the therapeutic sequence can be a multicistronic therapeutic sequence or a multi-transcription unit therapeutic sequence. Such a multicistronic therapeutic sequence may be, for example, a tri- cistronic cassette encoding Flt3L, IL-12, and XCL1.
[0229] In embodiments involving a non-protein coding therapeutic sequence, the therapeutic sequence lacks a protein-coding domain (e.g., a therapeutic protein-coding domain). For instance, in some embodiments, a therapeutic sequence includes a non-protein-coding therapeutic nucleic acid, such as a microRNA, siRNA, short hairpin RNA (shRNA), or an immune activating therapeutic nucleic acid (e.g., a TLR agonist).
[0230] In some instances, the therapeutic sequence includes one or more regulatory elements, such as a transcriptional knockdown sequence (with or without a therapeutic protein-encoding sequence as part of the same therapeutic sequence). In some instances of the invention, the transcriptional knockdown sequence is configured to silence transcription of endogenous expression of a target gene, wherein the therapeutic sequence encodes a therapeutic replacement protein encoded by a functional version of the target gene. Suitable transcriptional knockdown sequences include zinc finger nuclease-encoding sequences, TALEN-encoding sequences, dead CAS9-encoding sequences, guide RNA-encoding sequences, or a combination thereof. For instance, in certain embodiments, the therapeutic sequence includes a dCAS9-encoding sequence fused to one or more repressor proteins, e.g., as described in U.S. Patent No. 11 ,629,342, which is incorporated herein by reference in its entirety.
[0231] In some instances, the therapeutic sequence includes a gene editing sequence. Such gene editing sequences suitable for incorporation into a therapeutic sequence are known in the art and include, e.g., a sequence encoding a guide RNA, a reverse transcriptase, or a CRISPR- associated (Cas) endonuclease.
[0232] In some embodiments, the therapeutic sequence or other sequence of interest (which may include non-therapeutic coding sequences such as reporter genes used for measuring expression or persistence) is from 0.1 Kb to 100 Kb in length, or from 0.2 Kb to 90 Kb in length, or from from 0.5 Kb to 80 Kb in length, or from 1.0 Kb to 70 Kb in length, or from 1.5 Kb to 60 Kb in length, or from 2.0 Kb to 50 Kb in length, or from 2.5 Kb to 45 Kb in length, or from 3.0 Kb to 40 Kb in length, or from 4.0 Kb to 30 Kb in length, or from 4.5 Kb to 25 Kb in length, or from 5.0 Kb to 20 Kb in length, or from 6.0 Kb to 17 Kb in length, or from 7.0 Kb to 15 Kb in length, or from 7.5 Kb to 14 Kb in length, or from 8.0 Kb to 13 Kb in length, or from 8.5 Kb to 12.5 Kb in length, or from 9.0 Kb to 12.0 Kb in length, or from 9.5 Kb to 11 .5 Kb in length, or from 10.0 Kb to 11.0 Kb in length. In some embodiments, the therapeutic sequence is at least 1 kb, or at least 2 kb, or at least 3 kb, or at least 4kb, or at least 4.5 kb, or at least 5 kb or at least 10 Kb, or at least 12 kb, or at least 15 kb.
[0233] In some embodiments, the 3’ end of a sequence of interest, such as a therapeutic or non- therapeutic coding sequence, is connected to the 5’ end of an ori sequence in the circular DNA vector by a non-bacterial sequence (e.g., a recombination site, e.g., a recombination scar) of no more than 50 bp, or no more than 45 bp, or no more than 30 bps, or no more than 25 bp, or no more than 20 bp, or no more than 15 bp, or no more than 10 bp.
[0234] In some embodiments, the sequence of interest included in circular DNA vectors described herein includes a reporter sequence in addition to a therapeutic protein-encoding domain or a therapeutic non-protein encoding domain. In some embodiments, the therapeutic sequence lacks a reporter sequence. In some embodiments, the sequence of interest includes a reporter sequence and does not include a therapeutic sequence. The reporter sequence can be, for example, a reporter gene. Such reporter genes can be useful in verifying therapeutic gene sequence expression, for example, in specific cells and tissues. Reporter sequences that may be provided in a circular DNA vector include, without limitation, DNA sequences encoding - lactamase, -galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT), luciferase, and others well known in the art. When associated with regulatory elements which drive their expression, the reporter sequences provide signals detectable by conventional means, including enzymatic, radiographic, colorimetric, fluorescence or other spectrographic assays, fluorescent activating cell sorting assays and immunological assays, including enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and immunohistochemistry. For example, where the marker sequence is the LacZ gene, the presence of the vector carrying the signal is detected by assays for 0- galactosidase activity. Where the transgene is green fluorescent protein or luciferase, the vector carrying the signal may be measured visually by color or light production in a luminometer.
[0235] As part of the therapeutic sequence or other sequence of interest, circular DNA vectors of the invention may include conventional control elements which modulate or improve transcription, translation, and / or expression in a target cell. Suitable control elements are described in International Publication No. WO 2021 / 055760, which is incorporated herein by reference in its entirety.
[0236] B. Replication Origins
[0237] DNA vectors of the invention (e.g., circular DNA vectors) also include a replication origin (e.g., a bacterial replication origin). In embodiments of DNA vectors that lack a selectable marker, the replication origin can be selected from Pol l-dependent origins of replication, such as pUC origin, a pMBI origin, or a ColE1 origin. In some instances in which the DNA vector has a small backbone (e.g., less than 100 base pairs, or less than 50 base pairs), a small replication origin is necessary. The present invention is based partly on the surprising discovery that a ColE2-P9 replication origin, which is less than 50 base pairs, confers efficient manufacturing of the present circular DNA vectors by maintaining stable copy number over cell expansion. Moreover, the present inventors developed functional variants of the ColE2-P9 replication origin that require even fewer base pairs to maintain production of the presently disclosed circular DNA vectors in bacterial cells, thereby allowing for even smaller stretches of non-eukaryotic material in the DNA vector. Therefore, DNA vectors described herein can reduce risk associated with foreign DNA into a host subject.
[0238] The o sequence included in the vector sequence of a parental plasmid is chosen so that it corresponds with the Rep gene that is integrated into the genome of the engineered bacterial cell or is otherwise present in the engineered bacterial cell, such as on a plasmid or BAC. In some exemplary embodiments, the or / comprises a nucleotide sequence as set forth in SEQ ID NO: 2. Thus, embodiments of the engineered bacterial cells disclosed herein include a functional pair of a replication protein and origin of replication sequence that allow for replication of the parental plasmid and / or circular DNA vector. In some embodiments, the ori sequence present in the vector sequence is the ColE2-P9 ori sequence or a functional variant thereof. In some embodiments, the ori sequence present in the vector sequence is a functional fragment of the ColE2-P9 or / sequence that has the DNA sequence set forth in SEQ ID NO: 2. The 40 base pair functional fragment set forth in SEQ ID NO: 2 is capable of supporting vector replication in a cell expressing the ColE2-P9. In some embodiments, a shorter or longer functional fragment may be used. In some embodiments, a 31 base pair fragment of ColE2-P9 can be used. Other suitable or / sequences include, without limitation, or / sequences and functional fragments thereof that correspond with suitable Rep proteins, such as, for example the or / sequence of ColE3-CA38. In some embodiments, the or / sequence is a naturally occurring or / sequence.
[0239] In some instances, the or / sequence is a functional variant of a naturally occurring ori, such as, for example, an or / sequence that has been modified to be shorter than a corresponding naturally occurring or / sequence, while still retaining the ability to support replication initiation. Example 13 below details a study in which functional truncated variants of ColE2-P9 were developed and characterized. Such functional variants of the ColE2-P9 replication origin include SEQ ID NOs: 12-17.
[0240] For instances, in some embodiments, a DNA vector (e.g., circular DNA vector) includes a replication origin which is a truncated ColE2-P9 replication origin comprises or consists of (in one strand) the nucleotide sequence of SEQ ID NO: 12 (TGTTATCTGATAAGGCTTATCTGGTCT), e.g., wherein the truncated ColE2-P9 replication origin lacks one or more of nucleic acid bases 1-7 or 35-40 of SEQ ID NO: 2. In some instances, the truncated ColE2-P9 replication origin comprises or consists of (in one strand) the nucleotide sequence of SEQ ID NO: 13 (TGTTATCTGATAAGGCTTATCTGGTCTC). In some instances, the truncated ColE2-P9 replication origin comprises or consists of (in one strand) the nucleotide sequence of SEQ ID NO: 14 (TGTTATCTGATAAGGCTTATCTGGTCTCA). In some instances, the truncated ColE2-P9 replication origin comprises or consists of (in one strand) the nucleotide sequence of SEQ ID NO:
[0241] 15 (CTGTTATCTGATAAGGCTTATCTGGTCTCA). In some instances, the truncated ColE2-P9 replication origin comprises or consists of (in one strand) the nucleotide sequence of SEQ ID NO:
[0242] 16 (GCTGTTATCTGATAAGGCTTATCTGGTCTCA). In some instances, the truncated ColE2-P9 replication origin comprises or consists of (in one strand) the nucleotide sequence of SEQ ID NO:
[0243] 17 (CGCTGTTATCTGATAAGGCTTATCTGGTCTCA). In some instances, the truncated ColE2-P9 replication origin comprises or consists of (in one strand) the nucleotide sequence of SEQ ID NO: 4 (GCGCTGTTATCTGATAAGGCTTATCTGGTCTCA). In some instances, the replication origin comprises or consists of (in one strand) the nucleic acid sequence of SEQ ID NO: 18 (X1X2X3X4X5TGTTATCTGATAAGGCTTATCTGGTCTX6X7), wherein X is A, T, C, or G. In some embodiments: Xi is A, T, or C; Xe is C; X? is A; X2 is A, T, or C; X3 is A, T, or G; X4 is A, T, or C; Xs is A, T, or G; or any combination thereof.
[0244] V. Pharmaceutical Compositions
[0245] Improvements in production efficiency render the present methods particularly amenable to scalable manufacturing of pharmaceutical compositions containing circular DNA vectors (e.g., a circular DNA vector made by any of the methods herein, e.g., a circular DNA vector having an origin of replication (e.g., an origin of replication of less than 50 bp, e.g., a ColE2-P9 replication origin or functional variant thereof) and lacking a selectable marker)). Any of the methods of producing circular DNA vectors described herein can be adapted for production of pharmaceutical compositions containing the circular DNA vector in a pharmaceutically acceptable carrier.
[0246] As part of any of the methods described herein, downstream purification processes can be readily applied. For instance, various chromatography steps are known in the art and can be suitably adapted for removal of bacterial byproducts, endotoxin, bacterial artificial chromosomes (BAC), helper plasmids, etc. In some instances, pharmaceutical compositions of bacterially produced circular DNA vectors are purified by anion exchange chromatography or hydrophobic interaction chromatography.
[0247] In some embodiments, a pharmaceutical composition of the invention contains at least about 0.1 mg of DNA vector, or at least about 0.5 mg, or at least about 1 .0 mg DNA vector or at least about 2.0 mg of DNA vector, or at least 5 mg of DNA vector, or at least 10 mg of DNA vector in a pharmaceutically acceptable carrier.
[0248] In some embodiments, the pharmaceutical composition of the invention is substantially devoid of impurities. For instance, in some embodiments, the pharmaceutical formulation contains <2.0% protein content by mass (e.g., <1.5%, <1.0%, <0.5%, <0.1%, <0.05%, or <0.01% protein content by mass). In some instances, protein content is determined by bicinchoninic acid assay. Additionally or alternatively, protein content is determined by ELISA.
[0249] In some instances, the pharmaceutical composition contains <5.0% RNA content by mass (e.g., <4.0%, <3.0%, <2.0%, <1.5%, <0.5%, <0.1%, <0.05%, or <0.01 % RNA content by mass). In some embodiments, the RNA content is determined by agarose gel electrophoresis. In some embodiments, the RNA content is determined by quantitative PCR. In some embodiments, the RNA content is determined by fluorescence assay (e.g., Ribogreen).
[0250] In some embodiments, the pharmaceutical composition contains <5.0% gDNA content by mass (e.g., <4.0%, <3.0%, <2.0%, <1.5%, <1.0%, <0.5%, <0.1%, <0.05%, or <0.01% gDNA content by mass). In some embodiments, the gDNA content is determined by agarose gel electrophoresis or capillary electrophoresis. In some embodiments, the gDNA content is determined by quantitative PCR. In some embodiments, the gDNA content is determined by Southern blot.
[0251] In some embodiments, the pharmaceutical composition contains <40 EU / mg endotoxin. In some embodiments, the pharmaceutical formulation contains <20 EU / mg endotoxin. In some embodiments, the pharmaceutical formulation contains <10 EU / mg endotoxin. In some embodiments, the pharmaceutical formulation contains <5 EU / mg endotoxin (e.g., <4 EU / mg endotoxin, <3 EU / mg endotoxin, <2 EU / mg endotoxin, <1 EU / mg endotoxin, <0.5 EU / mg endotoxin), e.g., as measured by Limulus Ameobocyte Lysate (LAL) assay.
[0252] In some embodiments, pharmaceutical compositions disclosed herein comply with current good manufacturing practice (GMP) according to the standards promulgated by the U.S. Food & Drug Administration and set forth in 21 C.F.R. Parts 210 and 21 1 , which are incorporated herein by reference in their entirety.
[0253] Pharmaceutical compositions provided herein may include one or more pharmaceutically acceptable carriers, such as excipients and / or stabilizers that are nontoxic to the individual being treated (e.g., human patient) at the dosages and concentrations employed. In some embodiments, the pharmaceutically acceptable carrier is an aqueous pH buffered solution. Examples of pharmaceutically acceptable carriers include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptide; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and / or nonionic surfactants such as tween, polyethylene glycol (PEG), and pluronics.
[0254] If the pharmaceutical composition is provided in liquid form, the pharmaceutically acceptable carrier may be water (e.g., pyrogen-free water), isotonic saline, or a buffered aqueous solution, e.g., a phosphate buffered solution or a citrate buffered solution. Injection of the pharmaceutical composition may be carried out in water or a buffer, such as an aqueous buffer, e.g., containing a sodium salt (e.g., at least 50 mM of a sodium salt), a calcium salt (e.g., at least 0.01 mM of a calcium salt), or a potassium salt (e.g., at least 3 mM of a potassium salt). According to a particular embodiment, the sodium, calcium, or potassium salt may occur in the form of their halogenides, e.g., chlorides, iodides, or bromides, in the form of their hydroxides, carbonates, hydrogen carbonates, or sulfates, etc. Without being limited thereto, examples of sodium salts include NaCI, Nal, NaBr, Na2CO2, NaHCO2, and Na2SO4. Examples of potassium salts include, e.g., KCI, KI, KBr, K2CO2, KHCO2, and K2SO4. Examples of calcium salts include, e.g., CaCh, Cah, CaBr2, CaCO?, CaSC>4, and Ca(0H)2.
[0255] Additionally, organic anions of the aforementioned cations may be contained in the buffer. According to a particular embodiment, the buffer suitable for injection purposes as defined above, may contain salts selected from sodium chloride (NaCI), calcium chloride (CaCh) or potassium chloride (KCI), wherein further anions may be present. CaCh can also be replaced by another salt, such as KCI. In some embodiments, salts in the injection buffer are present in a concentration of at least 50 mM sodium chloride (NaCI), at least 3 mM potassium chloride (KCI), and at least 0.01 mM calcium chloride (CaCh). The injection buffer may be hypertonic, isotonic, or hypotonic with reference to the specific reference medium, i.e., the buffer may have a higher, identical or lower salt content with reference to the specific reference medium, wherein preferably such concentrations of the afore mentioned salts may be used, which do not lead to damage of cells due to osmosis or other concentration effects. Reference media can be liquids such as blood, lymph, cytosolic liquids, other body liquids, or common buffers. Such common buffers or liquids are known to a skilled person. Ringer-Lactate solution is particularly preferred as a liquid basis.
[0256] One or more compatible solid or liquid fillers, diluents, or encapsulating compounds may be suitable for administration to a person. The constituents of the pharmaceutical composition according to the invention are capable of being mixed with the nucleic acid vector according to the invention as defined herein, in such a manner that no interaction occurs, which would substantially reduce the pharmaceutical effectiveness of the (pharmaceutical) composition according to the invention under typical use conditions. Pharmaceutically acceptable carriers, fillers and diluents can have sufficiently high purity and sufficiently low toxicity to make them suitable for administration to an individual being treated. Some examples of compounds which can be used as pharmaceutically acceptable carriers, fillers, or constituents thereof are sugars, such as lactose, glucose, trehalose, and sucrose; starches, such as corn starch or potato starch; dextrose; cellulose and its derivatives, such as sodium carboxymethylcellulose, ethylcellulose, cellulose acetate; powdered tragacanth; malt; gelatin; tallow; solid glidants, such as stearic acid, magnesium stearate; calcium sulfate; vegetable oils, such as groundnut oil, cottonseed oil, sesame oil, olive oil, corn oil; polyols, such as polypropylene glycol, glycerol, sorbitol, mannitol, and polyethylene glycol; or alginic acid.
[0257] The choice of a pharmaceutically acceptable carrier can be determined, according to the manner in which the pharmaceutical composition is administered.
[0258] Suitable unit dose forms for injection include sterile solutions of water, physiological saline, and mixtures thereof. The pH of such solutions may be adjusted to about 7.4. Suitable carriers for injection include hydrogels, devices for controlled or delayed release, polylactic acid, and collagen matrices. Suitable pharmaceutically acceptable carriers for topical application include those which are suitable for use in lotions, creams, gels and the like. If the pharmaceutical composition is to be administered perorally, tablets, capsules and the like are the preferred unit dose form.
[0259] Further additives which may be included in the pharmaceutical composition are emulsifiers, such as tween; wetting agents, such as sodium lauryl sulfate; coloring agents; pharmaceutical carriers; stabilizers; antioxidants; and preservatives.
[0260] The pharmaceutical composition according to the present invention may be provided in liquid or in dry (e.g., lyophilized) form. In a particular embodiment, the nucleic acid vector of the pharmaceutical composition is provided in lyophilized form. Lyophilized compositions including nucleic acid vector of the invention may be reconstituted in a suitable buffer, advantageously based on an aqueous carrier, prior to administration, e.g., Ringer-Lactate solution, Ringer solution, or a phosphate buffer solution.
[0261] In certain embodiments of the invention, any of the DNA vectors of the invention can be complexed with one or more cationic or polycationic compounds, e.g., cationic or polycationic polymers, cationic or polycationic peptides or proteins, e.g. protamine, cationic or polycationic polysaccharides, and / or cationic or polycationic lipids.
[0262] According to a particular embodiment, the DNA vector of the invention may be complexed with lipids to form one or more liposomes, lipoplexes, or lipid nanoparticles. Therefore, in one embodiment, the pharmaceutical composition comprises liposomes, lipoplexes, and / or lipid nanoparticles comprising a DNA vector.
[0263] Lipid-based formulations can be effective delivery systems for nucleic acid vectors due to their biocompatibility and their ease of large-scale production. Cationic lipids have been widely studied as synthetic materials for delivery of nucleic acids. After mixing together, nucleic acids are condensed by cationic lipids to form lipid / nucleic acid complexes known as lipoplexes. These lipid complexes are able to protect genetic material from the action of nucleases and deliver it into cells by interacting with the negatively charged cell membrane. Lipoplexes can be prepared by directly mixing positively charged lipids at physiological pH with negatively charged nucleic acids.
[0264] Conventional liposomes include of a lipid bilayer that can be composed of cationic, anionic, or neutral phospholipids and cholesterol, which encloses an aqueous core. Both the lipid bilayer and the aqueous space can incorporate hydrophobic or hydrophilic compounds, respectively. Liposome characteristics and behavior in vivo can be modified by addition of a hydrophilic polymer coating, e.g., polyethylene glycol (PEG), to the liposome surface to confer steric stabilization. Furthermore, liposomes can be used for specific targeting by attaching ligands (e.g., antibodies, peptides, and carbohydrates) to its surface or to the terminal end of the attached PEG chains.
[0265] Liposomes are colloidal lipid-based and surfactant-based delivery systems composed of a phospholipid bilayer surrounding an aqueous compartment. They may present as spherical vesicles and can range in size from 20 nm to a few microns. Cationic lipid-based liposomes are able to complex with negatively charged nucleic acids via electrostatic interactions, resulting in complexes that offer biocompatibility, low toxicity, and the possibility of the large-scale production required for in vivo clinical applications. Liposomes can fuse with the plasma membrane for uptake; once inside the cell, the liposomes are processed via the endocytic pathway and the genetic material is then released from the endosome / carrier into the cytoplasm.
[0266] Cationic liposomes can serve as delivery systems for circular DNA vectors. Cationic lipids, such as MAP, (1 ,2-dioleoyl-3-trimethylammonium-propane) and DOTMA (N-[1-(2,3- dioleoyloxy)propyl]-N,N,N-trimethyl-ammonium methyl sulfate) can form complexes or lipoplexes with negatively charged nucleic acids to form nanoparticles by electrostatic interaction, providing high in vitro transfection efficiency. Furthermore, neutral lipid-based nanoliposomes for nucleic acid vector delivery as e.g., neutral 1,2-dioleoyl-sn-glycero-3-phosphatidylcholine (DOPC)-based nanoliposomes are available.
[0267] Thus, in one embodiment of the invention, a circular DNA vector is complexed with cationic lipids and / or neutral lipids and thereby forms liposomes, lipid nanoparticles, lipoplexes or neutral lipid-based nanoliposomes in the present pharmaceutical compositions.
[0268] In a particular embodiment, a pharmaceutical composition comprises the circular DNA vector of the invention that is formulated together with a cationic or polycationic compound and / or with a polymeric carrier. Accordingly, in a further embodiment of the invention, the circular DNA vector as defined herein is associated with or complexed with a cationic or polycationic compound or a polymeric carrier, optionally in a weight ratio selected from a range of about 5:1 (w / w) to about 0.25:1 (w / w), e.g., from about 5:1 (w / w) to about 0.5:1 (w / w), e.g., from about 4:1 (w / w) to about 1 :1 (w / w) or of about 3:1 (w / w) to about 1 :1 (w / w), e.g., from about 3:1 (w / w) to about 2:1 (w / w) of nucleic acid vector to cationic or polycationic compound and / or with a polymeric carrier; or optionally in a nitrogen / phosphate (N / P) ratio of nucleic acid vector to cationic or polycationic compound and / or polymeric carrier in the range of about 0.1-10, e.g., in a range of about 0.3-4 or 0.3-1, e.g., in a range of about 0.5-1 or 0.7-1 , e.g., in a range of about 0.3-0.9 or 0.5-0.9. For example, the N / P ratio of the circular DNA vector to the one or more polycations is in the range of about 0.1 to 10, including a range of about 0.3 to 4, of about 0.5 to 2, of about 0.7 to 2 and of about 0.7 to 1.5. The nucleic acid vectors described herein can also be associated with a vehicle, transfection or complexation agent for increasing the transfection efficiency and / or the expression of the modulatory gene according to the invention.
[0269] In some instances, the circular DNA vector according to the invention is complexed with one or more polycations, preferably with protamine or oligofectamine. Further cationic or polycationic compounds, which can be used as transfection or complexation agent may include cationic polysaccharides, for example chitosan, polybrene, cationic polymers, e.g. polyethyleneimine (PEI), cationic lipids, e.g. DOTMA: [1-(2,3-sioleyloxy)propyl)]-N,N,N- trimethylammonium chloride, DMRIE, di-C14-amidine, DOTIM, SAINT, DC-Chol, BGTC, CTAP, DOPE, LEAP, DOPE: Dioleyl phosphatidylethanol-amine, DOSPA, DODAB, DOIC, DMEPC, DOGS: Dioctadecylamidoglicylspermin, DIMRI: Dimyristo-oxypropyl dimethyl hydroxyethyl ammonium bromide, MAP: dioleoyloxy-3-(trimethylammonio)propane, DC-6-14: O,O-ditetradecanoyl-N-(a- trimethylammonioacetyl)diethanolamine chloride, CLIP1 : rac-[(2,3-dioctadecyloxypropyl)(2- hydroxyethyl)]-dimethylammonium chloride, CLIP6: rac-[2(2,3-dihexadecyloxypropyl- oxymethyloxy)ethyl]trimethylammonium, CLIP9: rac-[2(2,3-dihexadecyloxypropyl- oxysuccinyloxy)ethyl]-trimethylammonium, oligofectamine, or cationic or polycationic polymers, e.g. modified polyaminoacids, such as p-aminoacid-polymers or reversed polyamides, etc., modified polyethylenes, such as PVP (poly(N-ethyl-4-vinylpyridinium bromide)), etc., modified acrylates, such as pDMAEMA (poly(dimethylaminoethyl methylacrylate)), etc., modified amidoamines such as pAMAM (poly(amidoamine)), etc., modified polybetaaminoester (PBAE), (e.g., diamine end modified 1,4 butanediol diacrylate-co-5-amino-1 -pentanol polymers, or polymers described in U.S. Patent No. 8,557,231 ; PEGylated PBAE, such as those described in U.S. Patent Application No.
[0270] 2018 / 0112038; any suitable polymer disclosed in Green et aL, Acc. Chem. Res. 2008, 41(6): 749- 759, such as diamine end modified 1,4 butanediol diacrylate-co-5-amino-1-pentanol polymers; any suitable modified PBAE as described in International Patent Publication No. WO 2020 / 077159 or WO 2019 / 070727; PBAE 457 as disclosed in Shen et aL, Sci. Adv. 2020, 6: eaba1606, etc.), dendrimers, such as polypropylamine dendrimers or pAMAM based dendrimers, etc., polyimine(s), such as PEI: poly(ethyleneimine), poly(propyleneimine), etc., polyallylamine, sugar backbone based polymers, such as cyclodextrin based polymers, dextran based polymers, chitosan, etc., silan backbone based polymers, such as PMOXA-PDMS copolymers, etc., block polymers consisting of a combination of one or more cationic blocks (e.g.. selected from a cationic polymer as mentioned above) and of one or more hydrophilic or hydrophobic blocks (e.g. polyethyleneglycole); etc.
[0271] According to a particular embodiment, the pharmaceutical composition includes the DNA vector encapsulated within or attached to a polymeric carrier. A polymeric carrier used according to the invention might be a polymeric carrier formed by disulfide-crosslinked cationic components. The disulfide-crosslinked cationic components may be the same or different from each other. The polymeric carrier can also contain further components. It is also particularly preferred that the polymeric carrier used according to the present invention comprises mixtures of cationic peptides, proteins or polymers and optionally further components as defined herein, which are crosslinked by disulfide bonds as described herein. In this context, the disclosure of WO 2012 / 013326 is incorporated herein by reference. In this context, the cationic components that form basis for the polymeric carrier by disulfide-crosslinkage are typically selected from any suitable cationic or polycationic peptide, protein or polymer suitable for this purpose, particular any cationic or polycationic peptide, protein or polymer capable of complexing the nucleic acid vector as defined herein or a further nucleic acid comprised in the composition, and thereby preferably condensing the nucleic acid vector. The cationic or polycationic peptide, protein or polymer, may be a linear molecule; however, branched cationic or polycationic peptides, proteins or polymers may also be used.
[0272] In some embodiments, any of the DNA vectors described herein can be complexed with, or encapsulated using, any of the components, peptides, or particles taught in International Patent Application No. PCT / US2023 / 065763, which is hereby incorporated by reference.
[0273] Every disulfide-crosslinking cationic or polycationic protein, peptide or polymer of the polymeric carrier, which may be used to complex the DNA vector according to the invention included as part of the pharmaceutical composition may contain at least one SH moiety (e.g., at least one cysteine residue or any further chemical group exhibiting an SH moiety) capable of forming a disulfide linkage upon condensation with at least one further cationic or polycationic protein, peptide or polymer as cationic component of the polymeric carrier as mentioned herein.
[0274] Such polymeric carriers used to complex the DNA vector of the present invention may be formed by disulfide-crosslinked cationic (or polycationic) components. In particular, such cationic or polycationic peptides or proteins or polymers of the polymeric carrier, which comprise or are additionally modified to comprise at least one SH moiety, can be selected from proteins, peptides, and polymers as a complexation agent.
[0275] In other embodiments, the DNA vector according to the invention may be administered naked in a suitable buffer without being associated with any further vehicle, transfection, or complexation agent.
[0276] VI. Methods of Use
[0277] Provided herein are methods of inducing expression (e.g., persistent expression) of a sequence of interest (e.g., a therapeutic sequence) in a subject in need thereof (e.g., as part of a gene therapy regimen) by administering to the subject any of the vectors (e.g., circular DNA vectors (e.g., a circular DNA vector made by any of the methods herein, or pharmaceutical compositions thereof. Target cells or tissues of a subject can be characterized by examining a nucleic acid sequence (e.g., an RNA sequence, e.g., an mRNA sequence) of the host cell, such as by Southern Blotting or PCR analysis or RNA sequencing, to detect or quantify the presence (e.g., persistence) of the therapeutic sequence delivered. Alternatively, expression of the therapeutic sequence in the subject can be characterized (e.g., quantitatively or qualitatively) by monitoring the progress of a disease being treated by delivery of the therapeutic sequence (e.g., associated with a defect or mutation targeted by the therapeutic sequence). In some embodiments, transcription or expression (e.g., persistent transcription or persistent expression) of the therapeutic sequence is confirmed by observing a decline in one or more symptoms associated with the disease.
[0278] Accordingly, embodiments of the invention include methods of treating a disease in a subject by administering to the subject any of the circular DNA vectors, or pharmaceutical compositions thereof, described herein. Any of the circular DNA vectors, or pharmaceutical compositions thereof, described herein can be administered to a subject in a dosage from 1 pg to 10 mg of DNA (e.g., from 5 pg to 5.0 mg, from 10 pg to 2.0 mg, or from 100 pg to 1.0 mg of DNA, e.g., from 10 pg to 20 pg, from 20 pg to 30 pg, from 30 pg to 40 pg, from 40 pg to 50 pg, from 50 pg to 75 pg, from 75 pg to 100 pg, from 100 pg to 200 pg, from 200 pg to 300 pg, from 300 pg to 400 pg, from 400 pg to 500 pg, from 500 pg to 1.0 mg, from 1.0 mg to 5.0 mg, or from 5.0 mg to 10 mg of DNA, e.g., about 10 pg, about 20 pg, about 30 pg, about 40 pg, about 50 pg, about 60 pg, about 70 pg, about 80 pg, about 90 pg, about 100 pg, about 150 pg, about 200 pg, about 250 pg, about 300 pg, about 350 pg, about 400 pg, about 450 pg, about 500 pg, about 600 pg, about 700 pg, about 750 pg, about 1 .0 mg, about 2.0 mg, about 2.5 mg, about 5.0 mg, about 7.5 mg, or about 10 mg of DNA).
[0279] In some embodiments, administration of a circular DNA vector, or a pharmaceutical composition thereof, is less likely to induce an immune response in a subject compared with administration of other gene therapy vectors (e.g., plasmid DNA vectors and viral vectors).
[0280] In some instances, the circular DNA vectors, and pharmaceutical compositions thereof, provided herein are amenable to repeat dosing due to their ability to transfect target cells without triggering an immune response or inducing a reduced immune response relative to a reference vector, such as a plasmid DNA vector or an AAV vector, as discussed above. Thus, the invention provides methods of repeatedly administering the circular DNA vectors and pharmaceutical compositions described herein. Any of the aforementioned dosing quantities may be repeated at a suitable frequency and duration. In some embodiments, the subject receives a dose no more frequently than about once per month, or no more frequently than about once every three months, or no more frequently than about once every four month, or no more frequently than about once every six months (e.g., no more than twice per year), or no more frequently than once per year. In some embodiments, the number and frequency of doses corresponds with the rate of turnover of the target cell. It will be understood that in long-lived post-mitotic target cells transfected using the vectors described herein, a single dose of vector may be sufficient to maintain expression of the heterologous gene within the target cell for a substantial period of time. Thus, in other embodiments, a circular DNA vector provided herein may be administered to a subject in a single dose. The number of occasions in which a circular DNA vector is delivered to the subject can be that which is required to maintain a clinical (e.g., therapeutic) benefit.
[0281] Methods of the invention include administration of a DNA vector or pharmaceutical composition thereof through any suitable route. The circular DNA vector or pharmaceutical composition thereof can be administered systemically or locally, e.g., intravenously, ocularly (e.g., intravitreally (e.g., by intravitreal injection), subretinally, by eye drop, intraocularly, intraorbitally), intramuscularly, intradermally, intrahepatically, intracerebrally, intramuscularly, percutaneously, intraarterially, intraperitoneally, intralesionally, intracranially, intraarticularly, intraprostatically, intrapleurally, intratracheally, intrathecally, intranasally, intravaginally, intrarectally, intratumorally, subcutaneously, subconjunctivally, intravesicularly, mucosally, intrapericardially, intraumbilically, orally, topically, transdermally, by inhalation, by aerosolization, by injection (e.g., by jet injection), by electroporation, by implantation, by infusion (e.g., by continuous infusion), by localized perfusion bathing target cells directly, by catheter, by lavage, in creams, or in lipid compositions.
[0282] DNA vectors described herein can be delivered into cells via in vivo electrotransfer (e.g., in vivo electroporation). In vivo electroporation has been demonstrated in certain tissues, such as skin, skeletal muscle, certain tumor types, and lung epithelium. Delivery of naked DNA into cells by in vivo electroporation involves administration of the DNA into target tissue, followed by application of electrical field to temporarily increase cell membrane permeability within the tissue by generating pores, allowing the DNA molecules to cross cell membranes. As an example, delivery to skin using in vivo electroporation is described in Cha & Daud Hum. Vaccin. immunother. 2012, 8(1 1):1734- 1738, which is incorporated by reference in its entirety, in vivo electroporation of skeletal muscle is described in Sokolowska & Blachnio-Zabielska, int. J. Molecular Sci. 2019, 20:2776, which is incorporated by reference in its entirety. Intratumoral delivery using in vivo electroporation is described in Aung et al. Gene Therapy2009, 16:830-839, which is incorporated by reference in its entirety, in vivo electroporation of DNA into lung cells is described in Pringle et al. J. Gene Med. 2007, 9:369-380, which is incorporated by reference in its entirety, in vivo electrotransfer of circular DNA vectors to cells in the eye (e.g., retinal cells and / or photoreceptor cells) is described in International Patent Publication No. WO 2022 / 198138, which is incorporated by reference in its entirety. In some instances, after administration of the circular DNA vector to the eye, an electrode can be positioned within the interior of the eye (e.g., within about 1 mm from the retina), and an electric field can be transmitted through the electrode into a target ocular tissue at conditions suitable for electrotransfer of the circular DNA vector into the target cell (e.g., by applying six to ten pulses from 10-100 V each). Devices and systems having electrodes suitable for transmitting electric fields in mammalian tissues are commercially available and can be useful in the methods disclosed herein. In some instances, the electric field is transmitted through an electrode comprising a needle (e.g., a needle positioned within the vitreous humor or in the subretinal space). Suitable needle electrodes include CLINIPORATOR® electrodes marketed by IGEA® and needle electrodes marketed by AMBU®. Methods of the invention include administration of any of the circular DNA vectors described herein, or pharmaceutical compositions thereof, to skin, skeletal muscle, tumors (including, e.g., melanomas), eye, and lung via in vivo electrotransfer.
[0283] In some embodiments, a DNA vector of this disclosure, or a pharmaceutical composition thereof, carrying an ocular gene (e.g., ABCA4) is administered to the eye using electroporation according to a method described in International Patent Publication No. WO 2022 / 198138, which is incorporated by reference in its entirety, and a therapeutic product encoded by the ocular gene (e.g., ABCA4) is expressed in the target ocular cell (e.g., a retinal cell, e.g., an RPE cell or a photoreceptor cell). In some embodiments, the expression of the ocular gene persists for at least 6 months, e.g., at least 12 months after administration of the DNA vector. Such methods can be performed for treatment of an ocular disease, such as a retinal disease or disorder (e.g., an ABCA4-associated retinal disorder).
[0284] In some embodiments, a DNA vector of the disclosure, or a pharmaceutical composition thereof, carrying a respiratory gene (e.g., cystic fibrosis transmembrane receptor (CFTR) (e.g., human CFTR), e.g., any of the CFTR-encoding DNA vectors described herein) is administered to the airway (e.g., lung) according to a method described in International Patent Application No. PCT / US2022 / 082365 or International Patent Publication No. WO 2023 / 064934, which are incorporated herein by reference in their entirety (e.g., by respiratory administration and / or in vivo electroporation), and a therapeutic product encoded by the respiratory gene (e.g., CFTR) is expressed in the target airway cell (e.g., a respiratory epithelial cell). Such methods can be performed for treatment of a respiratory disease, such as cystic fibrosis.
[0285] In some embodiments, a DNA vector of the disclosure or a pharmaceutical composition thereof, carrying a therapeutic sequence (e.g., an modulatory protein encoding sequence, e.g., an immunodulatory protein encoding sequence (e.g., a dendritic cell chemoattractant-encoding geneencoding sequence, a dendritic cell growth factor or activator-encoding gene-encoding sequence, and / or a lymphocyte signaling protein-encoding gene-encoding sequence)) is delivered to the subject (e.g., at or around a tumor) by electroporation according to a method described in International Patent Application No. PCT / US2022 / 017575, which is incorporated herein by reference in its entirety, and a therapeutic product encoded by the therapeutic sequence is expressed in the subject (e.g., in an amount sufficient to modulate the immune response, e.g., to the tumor). Such methods can be performed for treatment of a disease or disorder, such as cancer.
[0286] Additionally, or alternatively, DNA vectors or pharmaceutical compositions thereof can be administered to host cells (e.g., eukaryotic, mammalian, or human cells) ex vivo, such as by cells explanted (or otherwise derived from, e.g., induced differentiation) from a subject (e.g., human patient), followed by reimplantation of the host cells into the subject, e.g., after selection for cells which have incorporated the vector. Thus, in some aspects, the disclosure provides transfected host cells, cultures thereof, pharmaceutical compositions thereof, and methods of administration thereof for treating a disease or disorder in the subject or to another subject, e.g., by allogeneic transfer.
[0287] Thus, the present invention includes methods of treating a subject (e.g., a human subject) having a disease or disorder by administering to the subject the DNA vector (or a composition thereof) of the invention using the techniques described herein and those known in the art.
[0288] Assessment of the efficiency of transfection (e.g., expression and / or persistence) of any of the DNA vectors described herein can be performed using any method known in the art or described herein. Isolating a transfected cell can also be performed in accordance with standard techniques. For example, a cell comprising a therapeutic gene can express a visible marker, such as a fluorescent protein (e.g., GFP) or other reporter protein, encoded by the sequence of the heterologous gene that aids in the identification and isolation of a cell or cells comprising the heterologous gene. Cells containing a therapeutic gene can also be characterized by examining the nucleic acid sequence (e.g., an RNA sequence, e.g., an mRNA sequence) of the host cell, such as by Southern Blotting or PCR analysis, to assay for the presence of the heterologous gene contained in the vector.
[0289] Accordingly, methods of the present invention include, after administering any of the circular DNA vectors encoding a sequence of interest (e.g., a therapeutic sequence) as described herein to a subject, subsequently detecting the expression of the gene in the subject. Expression can be detected one week to four weeks after administration, one month to four months after administration, four months to one year after administration, one year to five years after administration, or five years to twenty years after administration (e.g., at least one week, at least two weeks, at least one month, at least four months, at least one year, at least two years, at least five years, at least ten years after administration). At any of these detection timepoints, persistence (e.g., episomal persistence) of the circular DNA vector may be observed.
[0290] VII. Kits and Articles of Manufacture
[0291] In another aspect of the invention, described herein is an article of manufacture or a kit containing any of the circular DNA vectors, or pharmaceutical compositions thereof. The article of manufacture includes a container and a label or package insert on or associated with the container. Suitable containers include, for example, bottles, vials, syringes, IV solution bags, etc. The containers may be formed from a variety of materials, such as glass or plastic. The container holds a composition which is by itself or combined with another composition effective for treating, preventing and / or diagnosing a condition and may have a sterile access port (for example the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle). At least one active agent in the composition is a circular DNA vector of the invention or a pharmaceutical composition comprising the circular DNA vector. The label or package insert indicates that the composition is used for treating the condition treatable by its contents. Moreover, the article of manufacture may comprise (a) a first container with a composition contained therein, wherein the composition comprises a circular DNA vector, or pharmaceutical composition thereof; and (b) a second container with a composition contained therein, wherein the composition comprises an additional therapeutic agent. The article of manufacture may further comprise a package insert indicating that the compositions can be used to treat a particular condition. Alternatively, or additionally, the article of manufacture may further comprise a second (or third) container comprising a pharmaceutically acceptable carrier, such as bacteriostatic water for injection (BWFI), phosphate-buffered saline, Ringer’s solution, dextrose solution, or any of the pharmaceutically acceptable carriers disclosed above. It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, syringes, or other delivery devices.
[0292] EXAMPLES
[0293] Example 1. ColE2-P9 replication origin confers stable plasmid maintenance
[0294] To test whether a ColE2-P9 replication origin (or / ) positioned within a plasmid could confer stable maintenance of the plasmid in £ co / / , plasmids containing one of three variations of the or / (SEQ ID NOs: 2-4), an R6K origin, and a carbenicillin resistant marker were constructed and prepared in pir+ cells. Plasmids were transformed into S1037 and selected on LB agar plates supplemented with carbenicillin. A colony from each plate was cultured in LB without antibiotics at 37C. Overnight cultures were diluted 1000-fold in fresh LB without antibiotics and cultured at 37C. After five passages, each overnight culture was re-streaked on LB agar plate without antibiotics and grown overnight at 37C. From each plate, 20 colonies were plated on LB agar plate with or without carbenicillin. After six days total (during which an estimated >210 population doublings occurred colony size for all origin variants was normal, and plasmid was detected in all 20 colonies for all three origin variants (FIG. 1). These results demonstrate that the 40-bp replication origin allowed plasmids to remain stable over many population doublings in E. coii.
[0295] Example 2. Production of Parental Plasmid for Circular DNA Vectors
[0296] FIG. 2 shows an example of a production process for a parental plasmid that can be used to produce a circular DNA vector according to embodiments disclosed herein. Individual components of transcription units are assembled into transcription units by Golden Gate assembly. The transcription units are then assembled into a parental plasmid by Golden Gate assembly. In this example, the parental plasmid includes LoxP recombination site sequences flanking a vector sequence (the segment that includes ori and the MYO7A gene) and separating the vector sequence from a backbone sequence (the segment that includes SpecR, KanR, and RFP genes).
[0297] Example 3. In Vivo Production of Circular DNA Vector from Parental Plasmid
[0298] FIG. 3 shows an experimental process for in vivo production of a circular DNA vector. A test parental plasmid containing a vector sequence flanked by LoxP recombination sites is produced using a Golden Gate assembly method. The test vector sequence of the test parental plasmid includes a ColE2-P9 ori sequence and a reporter gene (sfGFP). For purposes of the experiment, the test vector sequence also includes a chloramphenicol resistance gene (CmR), although embodiments of circular DNA vectors described herein lack antibiotic resistance genes. The test parental plasmid also includes a test backbone sequence that includes antibiotic resistance genes SpecR and KanR and a reporter gene (RFP). The test parental plasmid was transformed into an engineered E. co / / cell that had a ColE2-P9 Rep gene under control of a constitutive promoter (J23119) integrated into the genome. Additional versions of the test parental plasmid were made that had, instead of LoxP sites flanking the test vector sequence, two l-Ppol restriction sites, two l-Scel restriction sites, two Pl-Scel restriction sites, two l-Ceul restriction sites, or one Pl-Pspl restriction site and one Seel restriction site flanking the test vector sequence. The test parental plasmid with LoxP sites was designated p1603, and the test parental plasmid with two Pl-Scel restriction sites was designated p1600.
[0299] Bacterial colonies harboring the parental test plasmid were identified by being positive for RFP fluorescence. Cre recombinase was electroporated into cells harboring p1603 to induce recombination at the LoxP sites and produce test circular DNA vector. The procedure for Cre electroporation was as follows: Electrocompetent engineered E. co / / harboring a parental plasmid cultured to OD of 0.8 in SOB at 30° C. £ coli as washed three times with ice cold 10% glycerol and resuspended in 10% glycerol. 1 pl of Cre (15 units, NEB, M0298M) was mixed with 50 pl of electrocompetent cells. The mixture was transferred to a cuvette (1 mm gap) and electroporated using an electroporator (BTX) using 1800 volt setting. The cells were rescued by growing in SOC for 1 hr at 37° C, and plated on LB agar plate without antibiotics. Colonies were grown and DNA was purified using QIAGEN miniprep kit. The electroporated cells were spread on LB plates without antibiotics. Colonies on the LB plates that were GFP-positive were streaked on LB with kanamycin (Kan) and spectinomycin (Spec) to test for loss of the test backbone sequence (Kan / Spec-sensitive colonies).
[0300] FIG. 4 shows an agarose gel electrophoresis of extragenomic DNA purified from cultures of individual colonies and shows that (1) test circular DNA vector was produced by Cre electroporation of cells harboring p1603 and (2) the test circular DNA vector was maintained in the cells in the absence of selective pressure. Lanes 2, 3, and 5, show extragenomic DNA derived from p1603-transformed cells that were GFP-positive and Kan / Spec-sensitive after Cre electroporation and that were grown in rich media lacking chloramphenicol. The bands in these lanes run at approximately 1500 bp, which is the expected size for the test circular DNA vector, showing that Cre electroporation resulted in production of test circular DNA vector. Lanes 8, 9, and 11 correspond to lanes 2, 3, and 5, respectively, but were grown in chloramphenicol-containing rich media. The abundance of DNA in lanes 2, 3, and 5, were similar to lanes 8, 9, and 11 , showing that the circular DNA vector is maintained in the cells without selective pressure. Lane 4 shows extragenomic DNA derived from p1603-transformed cells that were GFP-positive, RFP-positive, and Kan / Spec-resistant after Cre electroporation. The band in this lane runs at approximately 5000 bp, which is the expected size for the test parental plasmid. Lane 10 corresponds with lane 4, but shows DNA from cells grown in chloramphenicol-containing media. Lane 1 shows extrachromosomal DNA purified from a GFP-positive, RFP-positive, Kan / Spec-resistant colony from p1600-transformed cells. The band in this lane runs at approximately 5000 bp, which is the expected size for the test parental plasmid. Lane 7 corresponds with lane 1 but shows DNA from cells grown in chloramphenicol-containing media. Lane 6 shows extrachromosomal DNA purified from the same engineered E. co / / cells transformed with a plasmid lacking the ColE2-P9 or / and grown in media lacking chloramphenicol. No detectable plasmid was recovered from this culture, which may indicate that the or / is required for maintenance of the plasmid in the absence of selective pressure. Lane 12 shows DNA purified from a culture of the same cells used for lane 6 but grown in the presence of chloramphenicol. Plasmid was recovered from these cells, which may indicate that selective pressure maintained the plasmid in the cells. Example 4. Circular DNA Vectors with ColE2-P9 ori Are Maintained in Engineered Cells Expressing ColE2-P9 Replication Protein Without Selective Pressure
[0301] To test the ability of circular DNA vectors having an ori sequence (e.g., SEQ ID 2) from ColE2-P9 to be maintained in cells expressing ColE2-P9 replication protein (e.g., SEQ ID 1) in the absence of selective pressure, cells harboring a test circular DNA vector produced by Cre recombination as described in Example 2 were cultured in various broths with and without chloramphenicol. The percentage of sfGFP-positive cells in each culture was quantified. The results are shown in FIG. 5. The test circular DNA vector was maintained at a high level in all media with and without chloramphenicol, other than SOC media, which had lower maintenance levels both with and without chloramphenicol.
[0302] Test circular DNA vector was purified from TB and ZB cultures without chloramphenicol and quantified. The TB culture yielded 0.33 mg / L of test circular DNA vector, and the SB culture yielded 0.45 mg / L of test circular DNA vector. These results demonstrate that the circular DNA vectors were maintained regardless of selective pressure.
[0303] Example 5. Process for In Vivo Production of Circular DNA Vector with Counterselection
[0304] FIG. 6 shows an exemplary process of producing a circular DNA vector of the invention using counterselection. The transgene in this example is ABCA4, but it will be appreciated that a promoter driving ABCA4 could be substituted with other transgene cassettes. At day 0, competent engineered bacterial cells expressing a Rep gene are prepared using any of the processes described herein (e.g., by transforming cells with recombinase encoded on a bacterial artificial chromosome (BAC)). At day 1 , cells are plated on LB agar plate supplemented with Kan, and template plasmid is added. In this example, the template plasmid included the ABCA4 transgene downstream of a promoter and a replication origin (ori). This ori-ABCA4 cassette was flanked by recombination sites (attP-GA and attB-GA). On the opposite side of the plasmid (backbone region) were selectable markers: antibiotic resistance genes SpR and KanR, counterselection marker PheS, and fluorescent marker RFP. On day 2, white colonies were picked out from the red colonies and grown in LB supplemented with 4CP for counterselection. At day 3, circular DNA vectors are purified.
[0305] Example 6. Testing Inducible Bxb1 to Produce Circular DNA Vectors
[0306] To test whether Bxb1 could be effective as an exogenous recombinase to produce circular DNA vectors, Bxb1 recombinase was encoded on a bacterial artificial chromosome (BAC) and transformed into host E. co / / having a Rep gene (SEQ ID NO: 1) integrated into its genome and driven by a constitutive promoter (FIG. 7 A)). Two inducible Bxb1 BACs were tested: 1696 (FIG. 7B; SEQ ID NO: 5) included a cuminic acid inducible promoter and a chloramphenicol (Cm) resistance (CmR) gene, and 1697 (FIG. 7C; SEQ ID NO: 6) included an arabinose inducible promoter and a CmR gene. Each BAC was transformed by electroporation into S1037 cells and plated in the presence of chloramphenicol.
[0307] Next, the cells were transformed with a template plasmid carrying GFP as a reporter transgene (FIG. 7D). The ColE2-P9 replication origin (ori) was positioned upstream of GFP and its promoter, and recombination sites (attP-GA and attB-GA) flanked the ori-GFP cassette. On the opposite side of the plasmid (backbone region) were selectable markers (antibiotic resistance genes SpR and KanR, counterselection marker PheS, and fluorescent marker RFP). Thus, cells containing the template plasmid are GFP+, RFP+, Kan resistant, Spec resistant, and 4CP sensitive, whereas the cells containing only the circular DNA vector (FIG. 7E) (without the backbone byproduct (FIG. 7F)) are GFP+, RFP-, Kan-sensitive, Spec-sensitive, and 4CP resistant.
[0308] Template plasmids were electroporated into S1037 cells without inducers and plated on Cm+Kan plates. Results 24 and 72-hours post-transformation are shown in FIGS. 8 and 9. FIGS. 8A and 8B show that the majority of colonies harboring 1696 BAC were green at 24 and 72 hours post-transformation, respectively. A few red colonies were observed. Green colonies were selected and circular DNA vector presence and sequence was confirmed by Sanger sequencing and gel electrophoresis. In contrast to 1696, FIGS. 9A and 9B show that most colonies harboring 1697 BAC were yellow at 24 and 72-hours post-transformation, respectively, while a few green colonies were observed at 72 hours (FIG. 9B).
[0309] To assess the effects from Cm and arabinose inducers, various colored colonies from each plate were picked and incubated with Cm and either cuminic acid or arabinose for 24 hours. Results are shown in FIG. 10 (1696) and FIG. 11 (1697). Next, each culture was diluted 500-fold and grown overnight in LB supplemented with 4CP for counterselection, with or without inducers. Overnight cultures were re-streaked on plain LB agar plates and observed for fluorescence. Results are shown in FIGS. 12 (1696) and 13 (1697). A single colony from each plate was grown overnight in LB supplemented with 4CP, miniprepped, and digestion mapped (Bsal). Gel electrophoresis results are shown in FIG. 14. Predicted bands for each expected species 1-4 are shown in Table 1, below:
[0310] Table 1. Predicted bands for each digestion species
[0311] For colonies harboring either type of BAC (1696 or 1697), addition of either inducer appeared to increase GFP expressing colonies, indicating that expression of Bxb1 occurred in the absence of inducing agent. In fact, Bxb1 recombination had already occurred after transformation of template plasmid and plating on Cm / Kan plate. In 1606 BAC containing bacteria, non-induced Bxb1 resulted in >90% green colonies, indicating that more than 90% contained circular DNA vector with little or no template plasmid.
[0312] Example 7. Production of circular DNA vectors containing therapeutic transgenes
[0313] In this study, circular DNA vectors were made to include various types of therapeutic transgenes: (1) ABCA4, (2) IL-12, and (3) a tri-cistronic cassette encoding Flt3L, IL-12, and XCL1. ABCA4 and IL-12 constructs included a CAG promoter, and the tricistronic construct included CAG promoters upstream of each of the three genes. Exemplary sequences for the ABCA4 template plasmid and resulting circular DNA vector are illustrated by FIG. 15A (SEQ ID NO: 7) and FIG. 15B (SEQ ID NO: 8), respectively.
[0314] First, S1037 cells were transformed with 1696 BAC and grown overnight. After one day, cells were made competent and transformed with template plasmid encoding ABCA4, IL-12, or tricistronic cassette. Cells were plated on LB agar plate supplemented with Kan. After a three-day culture, small white colonies were picked (leaving red colonies) and grown overnight in LB+4CP for counterselection before purification.
[0315] Purified constructs were screened from a single colony in each group using digestion mapping with BsaL All colonies yielded circular DNA vector bands of the expected sizes, as shown in FIGS. 16A (theoretical gel profile) and 16B (actual gel profile). These results demonstrate that the circular DNA vector production process described herein can be broadly utilized to efficiently produce circular DNA vectors having transgenes of various sizes and configurations (e.g., multicistronic).
[0316] Example 8. Stability of circular DNA vector over bacterial growth and scale-up
[0317] A meaningful advantage of the vector system described herein is the ability to grow bacterial cells harboring circular DNA vectors without selection markers (e.g., after selectable markers and other bacterial backbone elements have been removed from culture). Toward this end, Applicant tested whether circular DNA vectors containing a therapeutic transgene could be stably expressed in bacterial culture over the many cell divisions associated with scaled up vector production.
[0318] Cells identified as containing ABCA4-encoding circular DNA vector without backbone, as in Example 7, were cultured overnight (14-16 hours each) over seven sequential nights. After the seventh culture, presence of circular DNA vector was confirmed by sequencing. Based on an average rate of three divisions per hour, this culture had undergone at least 294 divisions, and, surprisingly, had maintained expression of circular DNA vector despite the absence of selection.
[0319] Leveraging this remarkable stability, cells were scaled up to produce a larger quantity of circular DNA vector containing an ABCA4 transgene. Cells were re-streaked on LB plates and grown to produce a 2.5 L prep. A glycerol stock was produced, and this stock was re-streaked to produce a 25 L prep. Circular DNA vectors were purified from this prep, which yielded 18 mg of circular DNA vectors.
[0320] Example 9. Detection of monomeric circular DNA vectors.
[0321] In this study, circular DNA vectors containing the ABCA4 transgene produced using 1696 BAC were sequenced to confirm that circular DNA vector is in monomeric form (as opposed to dimeric, which can result from recombination in trans with another template plasmid). In this study, S1037 bacteria were cultured in LB broth containing 25 ug / mL Kan at 37C for two hours. Next, cells were transferred to a plate containing 4CP and 10 ng of DNA and incubated overnight at 37C. Samples were analyzed by long read sequencing using conventional methods (Oxford Nanopore). As shown in FIG. 17A, a monomer peak was observed, and no dimers we observed. In contrast, when cultures were incubated with Kan overnight, circular DNA vectors were primarily dimeric (FIG. 17B).
[0322] Example 10. Circular DNA Vectors Made Using Bxb1 Helper Plasmid
[0323] As an alternative strategy to BAC-Bxb1 , circular DNA vectors were made using Bxb1 transformed into host cells using helper plasmids. An exemplary helper plasmid is shown in FIG. 18, which includes a cumate inducible promoter (CuO). Additionally, the helper plasmid included a temperature sensitive backbone to allow for removal of the helper plasmid following production of the circular DNA vector. The DNA sequence of this helper plasmid is given by SEQ ID NO: 11. Host cells used in this method were the same as in similar examples - S1037 cells having Rep (SEQ ID NO: 1) integrated in the host genome and driven by a constitutive promoter. Template plasmid was the same as in Example 6 (FIG. 7D). In this study, helper plasmid was transformed into S1037 cells and incubated with 100 ug / mL carbenicillin (carblOO) overnight. Then plasmid template was transformed and plated with carblOO and 500 uM Cuma, and cells were grown at 30 C. Using this helper plasmid approach, several green colonies were observed (FIG. 19), indicating successful production of cells containing circular DNA vector without backbone byproducts.
[0324] Example 11 . Circular DNA Vectors Made by Integrating Bxb1 into the Host Genome
[0325] Another source of recombinase provided herein is via integration into the bacterial host genome. In this example, integration of Bxb1 was performed following the process illustrated in FIG. 20. First, S1037 cells harboring lambda red recombination helper plasmid were grown with 0.2% arabinose and made electrocompetent. Then 500 ng of linearized 1696 BAG was electroporated. After BAC 1696 was integrated into rsd-thiC locus, the lambda red recombination plasmid was removed.
[0326] Colony PCR was performed on the resulting colonies, and positive clones were identified using gel electrophoresis (FIG. 21). Resulting cells are engineered to express both Rep and Bxb1 by genomic integration.
[0327] Example 12. Circular DNA vectors produced by transposition
[0328] Methods for bacterial production of circular DNA vectors in which a recombinase is used to separate plasmid backbone components from a therapeutic sequence result in a recombination scar, which can account for a few dozen extra base pairs within the backbone that are exogenous to a host. For instance, methods described herein that employ recombinase result in a recombination scar of 43 base pairs. Thus, the recombination scar, together with a ColE2-P9 replication origin, results in a backbone with over 70 nucleotide bases directly connecting the 3’ end of the therapeutic sequence to the 5' end of the therapeutic sequence. While this size is substantially smaller than backbones taught for production of other replication origin-containing circular DNA vectors (which exceed 400 bases), the present inventors sought to further reduce the backbone size to simplify the backbone structure, thereby reducing safety risks and the likelihood of silenced expression. To do so, recombinase is substituted with transposase using the following method, which is illustrated in FIG. 22.
[0329] A plasmid template includes a first segment containing an ori (which corresponds with the Rep gene integrated into the host bacterial cell) and a sequence of interest (a promoter and a reporter gene (sfGFP) (the reporter gene is replaced with a therapeutic sequence for production of a therapeutic circular DNA vector)). The first segment is flanked by two transposase overhangs (Tos), which are adjacent to a left end repeat (inverted repeat left; IRL) and a right end repeat (inverted repeat right; IRR). On the other side of the IRR and IRL is a second segment, the plasmid backbone, which contains drug resistance genes SpecR and KanR, and an RFP reporter gene. Here, the RFP is used for marker purposes only (it can be readily omitted for adaptation to therapeutic vector production).
[0330] Also within the host bacterial cell is a second circular construct encoding a transposase and an IEE and containing a second replication origin (ts ori).
[0331] The bacterial cells are cultured under standard conditions to allow expression of the transposase and IEE. The transposase protein acts on the plasmid template to excise the second segment (plasmid backbone) from the first segment (sequence of interest). Each of the first and second segments are recircularized as part of the transposition process to create two daughter constructs: (1) a circular DNA vector containing the sfGFP sequence of interest, the ori, and one of the transposase overhangs and (2) a backbone byproduct containing the RFP reporter, the two drug resistance genes, and the two inverted repeats.
[0332] As the bacterial cells grow, Rep protein is expressed by the genomic Rep gene, which in turn acts on the ori to continually replicate the circular DNA vector. As replication of the circular DNA vector occurs, the backbone byproduct gets diluted from the cell culture. This process can be monitored using the GFP and RFP marker genes to identify colonies that contain only the sequence of interest, without backbone. As the cultures are maintained and desirable colonies are selected, the host cell population obtained ultimately contains a pure population of circular DNA vectors without plasmid backbone byproduct.
[0333] Example 13. Identification of functional variants of a ColE2-P9 replication origin
[0334] This example describes the systematic study of the effect of shortening the ColE2-P9 replication origin from both its 5’ and 3’ end. The results shown herein provide a number of suitable functional variants of ColE2-P9 and delineate the point at which further truncation is detrimental to function.
[0335] ColE2P-9 replication origin is shown at the top of FIG. 23A. A series of deletion variants, labelled 55001-550036 are shown at the bottom portion of FIG. 23A. Deletions (indicated by dashed lines) were introduced into circular DNA vectors, and S1037 E. co / / cells were transformed with each of the variants and grown on carb plates. Colony size was observed. Each culture plate showing colony size is shown in FIG. 23B. Colony size was visually characterized and noted at the right-hand side next to the respective variant in FIG. 23A.
[0336] Normal colony size was observed in cultures transfected with DNA vectors containing replication origins that had been truncated by two and three bases on the right (55002 and 55003) and by four bases on the left (55004) (“right” and “left” correspond to the sequence orientation shown in FIG. 23A). However, mixed colony size was observed when just one more base was removed from the left, relative to 55004 (55005). Removal of yet another base on the left also resulted in mixed colony size (55006). And, unpredictably, removal of one more base on the left completely abrogated cell growth (55007), revealing a critical boundary for truncation while maintaining function of the ColE2-P9 replication origin. Variants of 55004-55006 were then tested in which three bases on the right were removed from each (55008-55010). Such truncations had not effect on the colony size relative to the corresponding variants (i.e. , 55008 colony size matched that of 55004 (normal), 55009 colony size matched that of 55005 (mixed), and 55010 colony size matched that of 55006 (mixed)). These tests confirmed that the three bases on the right (CCT) were dispensable for ColE2-P9 replication origin function. Next, additional bases on the right were removed and tested in 55033-55036, all of which showed normal colony growth.
[0337] In sum, these results showed that, while certain bases of the ColE2-P9 replication origin could be deleted (thereby allowing improved vector design by reducing backbone size), removing the left-terminal A, as done in 55007, was not tolerated and led to loss of function of the replication origin.
[0338] Example 14. ABCA4 protein expression by circular DNA vectors having a ColE2-P9 ori.
[0339] To determine whether bacterially produced circular DNA vectors having a ColE2-derived origin of replication are capable of expressing protein in human cells, an in vitro study was performed in which such circular DNA vectors carrying a human ABCA4 gene (SEQ ID NO: 21) were transfected into HEK293T cells, and ABCA4 protein expression was assessed by western blot.
[0340] HEK293T cells were seeded in 24 well plates at 150,000 cells in 0.5 mL of standard media. Plates were incubated for 24 hours at 37C. At time of transfection, cells were 60-80% confluent. Cells were transfected with circular DNA vectors using Lipofectamine 3000 (Invitrogen) following the manufacturer’s protocol. The total amount of DNA added per well was 500 ng. After 24 hours of incubation at 37C, cells were harvested for analysis by western blot, using beta actin as a control. Western blot results are shown in FIG. 24, and each lane is identified in Table 2, below.
[0341] Table 2: Sample identification for protein expression assay These results show that bacterially produced circular DNA vectors having a ColE2-derived origin expressed their ABCA4 transgene in HEK293T human cells.
[0342] Sequences
[0343]
[0344]
[0345]
[0346] Ill
Claims
What is claimed is:CLAIMS1. A circular DNA vector or pharmaceutical composition thereof, wherein the circular DNA vector comprises a therapeutic sequence and a sequence comprising a bacterial replication origin, wherein the sequence comprising the bacterial replication origin is less than 50 bp in length, and wherein the circular DNA vector lacks a selectable marker.
2. The circular DNA vector of claim 1 , wherein the vector lacks a recombination site.
3. The circular DNA vector of claim 1 or 2, wherein the vector comprises a transposase scar.
4. The circular DNA vector of claim 1 , wherein the sequence comprising the bacterial replication origin directly connects the 3’ end of the therapeutic sequence to the 5’ end of the therapeutic sequence.
5. The circular DNA vector of any one of claims 1 to 4, wherein the vector has about 200 base pairs (bp) or less, or about 150 bp or less, or about 100 bp or less, or about 75 bp or less, or about 50 bp or less of bacterially-derived sequences.
6. The circular DNA vector of claim 5, wherein the replication origin is from a ColE2-related plasmid, and which is optionally ColE2-P9.
7. The circular DNA vector of claim 6, wherein the replication origin is recognized by a ColE2- P9 replication protein.
8. The circular DNA vector of claim 7, wherein the ColE2-P9 replication protein comprises the amino acid sequence of SEQ ID NO: 1 .
9. The circular DNA vector of any one of claims 6 to 8, wherein the replication origin is 40 bp or less in length.
10. The circular DNA vector of claim 9, wherein the replication origin is 36 bp or less in length, or 34 bp or less in length, or 32 bp of less in length, or 30 bp or less in length, or 28 bp or less.
11. The circular DNA vector of claim 9 or 10, wherein the replication origin has the nucleotide sequence of SEQ ID NO: 2, or a functional variant or truncated variant thereof.
12. The circular DNA vector of claim 11 , wherein the replication origin is a truncated ColE2-P9 replication origin, where one strand of the replication origin comprises or consists of the nucleotide sequence of SEQ ID NO: 12.
13. The circular DNA vector of claim 11 , wherein the replication origin is a truncated ColE2-P9 replication origin, wherein one strand of the replication origin comprises or consists of the nucleotide sequence of SEQ ID NO: 13.
14. The circular DNA vector of claim 11 , wherein the replication origin is a truncated ColE2-P9 replication origin, wherein one strand of the replication origin comprises or consist of the nucleotide sequence of SEQ ID NO: 14.
15. The circular DNA vector of claim 11 , wherein the replication origin is a truncated ColE2-P9 replication origin, wherein one strand of the replication origin comprises or consists of the nucleotide sequence of SEQ ID NO: 15.
16. The circular DNA vector of claim 11 , wherein the replication origin is a truncated ColE2-P9 replication origin, wherein one strand of the replication origin comprises or consists of the nucleotide sequence of SEQ ID NO: 16.
17. The circular DNA vector of claim 11 , wherein the replication origin is a truncated ColE2-P9 replication origin, wherein one strand of the replication origin comprises or consists of the nucleotide sequence of SEQ ID NO: 17.
18. The circular DNA vector of claim 11 , wherein the replication origin is a truncated ColE2-P9 replication origin, wherein one strand of the replication origin comprises or consists of the nucleotide sequence of SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4.
19. The circular DNA vector of claim 11 , wherein the replication origin comprises or consists of the nucleic acid sequence of X1X2X3X4X5TGTTATCTGATAAGGCTTATCTGGTCTX6X7 (SEQ ID NO: 18), wherein each X is selected from A, T, C, or G.
20. The circular DNA of claim 19, wherein: Xi is A, T, or C; X2 is A, T, or C; X3 is A, T, or G; X4 isA, T, or C; X5 is A, T, or G; Xs is C; X? is A.
21. The circular DNA vector of any one of claims 1 to 20, wherein the circular DNA vector is a non-integrating circular DNA vector.
22. The circular DNA vector of claim 21 , wherein the therapeutic sequence comprises a scaffold-matrix attachment region (S / MAR).
23. The circular DNA vector of any one of claims 1 to 22, wherein the therapeutic sequence is 4.5 kb or greater.
24. The circular DNA vector of any one of claims 1 to 23, wherein the circular DNA vector is monomeric and supercoiled.
25. The circular DNA vector of any one of claims 1 to 24, wherein the therapeutic sequence comprises an ocular gene.
26. The circular DNA vector of claim 25, wherein the ocular gene is MYO7A, BEST 1 , CFH, CEP290, USH2A, ADGRV1 , CDH23, CRB1 , PCDH15, RPGR, ABCA4, ABCC6, RIMS1, LRPS, CC2D2A, TRPM1, C3, IFT172, COL11A1, TUBGCP6, KIAA1549, CACNA1 F, SNRNF200, PRPF8, VCAN, USH2A, HMCN1 , RPE65, NR2E3, NRL, RHO, RP1, RP2, or OFDI .
27. The circular DNA vector of claim 26, wherein the ocular gene comprises a nucleic acid sequence that is at least 90% identical to SEQ ID NO: 19 or SEQ ID NO: 20.
28. The circular DNA vector of claim 27, wherein the ocular gene encodes a polypeptide having the amino acid sequence of SEQ ID NO: 63.
29. The circular DNA vector of claim 26, wherein the ocular gene comprises a nucleic acid sequence that is at least 90% identical to SEQ ID NO: 21 .
30. The circular DNA vector of claim 29, wherein the ocular gene encodes a polypeptide having the amino acid sequence of SEQ ID NO: 61 .31 . The circular DNA vector of claim 29 or 30, comprising a nucleic acid sequence that is at least 90% identical to SEQ ID NO: 8, and optionally comprising the nucleic acid sequence of SEQ ID NO: 8.
32. The circular DNA vector of claim 26, wherein the ocular gene comprises a nucleic acid sequence that is at least 90% identical to SEQ ID NO: 22.
33. The circular DNA vector of claim 32, wherein ocular gene encodes a polypeptide having the amino acid sequence of SEQ ID NO: 62.
34. The circular DNA vector of claim 32 or 33, comprising a nucleic acid sequence that is at least 90% identical to SEQ ID NO: 23, and optionally comprising the nucleic acid sequence of SEQ ID NO: 23.
35. The circular DNA vector of any one of claims 1 to 34, wherein the therapeutic sequence comprises a GAG promoter controlling expression of a therapeutic gene, which is optionally an ocular gene.
36. The circular DNA vector of any one of claims 26 to 35, wherein the therapeutic sequence further comprises a regulatory element comprising a sequence derived from ABCA4 intron 6.
37. The circular DNA vector of claim 36, wherein the regulatory element is derived from the 5’ half of ABCA4 intron 6.
38. The circular DNA vector of claim 36, wherein the regulatory element comprises at least 90% identity to at least 500 consecutive nucleotides within ABCA4 intron 6, wherein the at least 500 consecutive nucleotides comprise any of nucleotides 3,158 to 4,822 of intron 6, and wherein the regulatory element optionally comprises the nucleic acid sequence of SEQ ID NO: 24, or a functional variant thereof.
39. A method of expressing a therapeutic sequence in an ocular cell of a subject, the method comprising delivering the circular DNA vector of any one of claims 26 to 38, to the ocular cell.
40. The method of claim 39, wherein the circular DNA vector is delivered to the ocular cell by ocular administration to a subject.41 . The method of claim 39 or 40, wherein the expression persists for at least 12 months after the administration of the circular DNA vector to the subject.
42. The method of any one of claims 39 to 41 , wherein the circular DNA is administered no more frequently than about once every three months, once every four months, once every six months, once every eight months, and once every year.
43. The method of any one of claims 39 to 42, wherein the subject has an ocular disease.
44. The circular DNA vector of any one of claims 1 to 24, wherein the therapeutic sequence comprises a respiratory gene.
45. The circular DNA vector of claim 44, wherein the respiratory gene encodes cystic fibrosis transmembrane receptor (CFTR), and the therapeutic sequence optionally comprises an elongation factor 1 (EF1A) promoter.
46. The circular DNA vector of claim 44 or 45, wherein the therapeutic sequence comprises a hypersensitivity sequence 5’ to the respiratory gene, and wherein the hypersensitivity sequence optionally comprises the nucleotide sequence of SEQ ID NO: 28, or a functional variant thereof.
47. A method of expressing a therapeutic sequence in an airway cell of a subject, the method comprising delivering the circular DNA vector of any one of claims 44 to 46 to the airway cell.
48. The method of claim 47, wherein the respiratory disease is cystic fibrosis.
49. The circular DNA vector of any one of claims 1 to 24, wherein the therapeutic sequence comprises a modulatory protein-encoding gene, which is optionally an immunomodulatory proteinencoding gene.
50. The circular DNA vector of claim 49, wherein the immunomodulatory protein-encoding gene is a dendritic cell chemoattractant-encoding gene, a dendritic cell growth factor or activatorencoding gene, or a lymphocyte signaling protein-encoding gene.51 . The circular DNA vector of claim 50, wherein: (a) the dendritic cell chemoattractantencoding gene is XCL1, XCL2, CCL5, or CCL4; (b) the dendritic cell growth factor or activator-encoding gene is FLT3L, GMCSF, or CD40; or (c) the lymphocyte signaling protein-encoding gene is IL-12, IL-15, CXCL9, or CXCL10.
52. The circular DNA vector of any one of claims 49 to 51 , wherein the circular DNA vector is a bi-cistronic or multi-cistronic vector encoding two, three, or more modulatory protein-encoding genes.
53. A method of expressing a therapeutic sequence in a target cell of a subject, the method comprising delivering the circular DNA vector of any one of claims 49 to 52 to the target cell.
54. The method of claim 53, wherein the subject has cancer, and the method modulates a tumor microenvironment in the subject.
55. The circular DNA vector of any one of claims 1 to 24, wherein the therapeutic sequence encodes an antigen-binding protein.
56. The circular DNA vector of any one of claims 1 to 24, wherein the therapeutic sequence encodes an enzyme, a growth factor, a hormone, an interleukin, an interferon, a cytokine, an antiapoptosis factor, an anti-diabetic factor, a coagulation factor, an anti-tumor factor, a liver secreted protein, or a neuroprotective factor.
57. The circular DNA vector of any one of claims 1 to 24, wherein the therapeutic sequence comprises a transcriptional knockdown sequence, and which is optionally a micro-RNA-encoding sequence, a short hairpin RNA-encoding sequence, a zinc finger nuclease-encoding sequence, a TALEN-encoding sequence, a dCAS9-encoding sequence, a guide RNA-encoding sequence, or a combination thereof.
58. The circular DNA vector of claim 57, wherein the transcriptional knockdown sequence comprises one or more guide RNA-encoding sequences and a dCAS9-encoding sequence.
59. The circular DNA vector of claim 57 or 58, wherein the dCAS9-encoding sequence is fused to one or more repressor proteins.
60. The circular DNA vector of any one of claims 57 to 59, wherein the therapeutic sequence further comprises a therapeutic protein-encoding sequence, wherein the transcriptional knockdown sequence is configured to silence transcription of endogenous expression of a target gene, andwherein the therapeutic sequence encodes a therapeutic replacement protein encoded by a functional version of the target gene.61 . A method of knocking down transcription of a mutated target gene in a cell in a subject in need, the method comprising contacting the circular DNA vector of any one of claims 57 to 60 with the cell under conditions suitable to knock down transcription of the mutated target gene.
62. The circular DNA vector of any one of claims 1 to 22, wherein the therapeutic sequence comprises a gene editing sequence.
63. The circular DNA vector of claim 62, wherein the gene editing sequence encodes a guide RNA and / or a CRISPR-associated (Cas) endonuclease.
64. An engineered bacterial cell comprising:(a) the circular DNA vector of any one of claims 1 to 24, and(b) a Rep gene encoding a bacterial replication protein that binds to the bacterial replication origin of the circular DNA vector, wherein the Rep gene replicates the circular DNA vector.
65. The engineered bacterial cell of claim 64, wherein the therapeutic sequence comprises a transposase overhang sequence, which is optionally TTAA.
66. The engineered bacterial cell of claim 65, further comprising a transposase protein, wherein the transposase protein hydrolyzes DNA adjacent to a transposase overhang sequence.
67. The engineered bacterial cell of claim 66, wherein the transposase protein is encoded by a transposase gene expressed by the engineered bacterial cell.
68. The engineered bacterial cell of claim 67, wherein the transposase gene is integrated into the bacterial genome.
69. The engineered bacterial cell of any one of claims 64 to 68, wherein the engineered bacterial cell comprises an insertion sequence excision enhancer (IEE), which is optionally encoded by a gene that is integrated into the bacterial genome.
70. The engineered bacterial cell of any one of claims 64 to 69, wherein the engineered bacterial cell further comprises a closed-ended linear DNA molecule comprising a plasmid backbone.71 . The engineered bacterial cell of claim 70, wherein the plasmid backbone comprises a selectable marker.
72. The engineered bacterial cell of any one of claims 64 to 71 , wherein the replication origin is the only bacterial sequence in the circular DNA vector.
73. The engineered bacterial cell of any one of claims 64 to 72, wherein the engineered bacterial cell comprises at least 10 copies of the circular DNA vector on average.
74. The engineered bacterial cell of any one of claims 64 to 73, wherein the circular DNA vector is monomeric.
75. The engineered bacterial cells of any one of claims 64 to 74 in culture, wherein the mean copy number of the circular DNA vector per engineered bacterial cell is at least 10, or at least 15, or at least 20.
76. An engineered bacterial cell comprising:(a) a plasmid template, wherein the plasmid template comprises:(i) a first segment comprising a therapeutic sequence and a sequence comprising a bacterial replication origin, wherein the first segment is flanked by two transposase overhang sequences; and(ii) a second segment comprising a plasmid backbone, wherein the second segment is flanked by a left end (LE) repeat and a right end (RE) repeat, wherein the LE repeat and the RE repeat can be bound by the transposase protein; and(b) a Rep gene encoding a bacterial replication protein that binds to the bacterial replication origin.
77. The engineered bacterial cell of claim 76, further comprising a transposase protein, wherein the transposase protein hydrolyzes DNA adjacent to a transposase overhang sequence.
78. The engineered bacterial cell of claim 76 or 77, further comprising:(c) a circular DNA vector comprising the therapeutic sequence, the sequence comprising the bacterial replication origin, and one of the two transposase overhang sequences; and / or(d) a linear closed-ended DNA molecule comprising the plasmid backbone flanked by the LE repeat and the RE repeat.
79. The engineered bacterial cell of any one of claims 76 to 78, wherein the transposase protein is encoded by a transposase gene expressed by the engineered bacterial cell, and which is optionally integrated into the bacterial genome.
80. The engineered bacterial cell of any one of claims 76 to 79, wherein the engineered bacterial cell expresses an IEE, wherein the IEE is optionally encoded by a gene that is integrated into the bacterial genome.81 . The engineered bacterial cell of any one of claims 76 to 80, wherein the sequence comprising the bacterial replication origin directly connects the 3’ end of the therapeutic sequence to the 5’ end of the therapeutic sequence.
82. The engineered bacterial cell of any one of claims 76 to 81 , wherein the sequence comprising the bacterial replication origin is less than 50 bp in length.
83. The engineered bacterial cell of claim 82, wherein the bacterial replication origin is a ColE2-P9 replication origin.
84. The engineered bacterial cell of any one of claims 76 to 83, wherein the first segment and the circular DNA vector lack a selectable marker, and wherein the second segment and the plasmid backbone comprises a selectable marker.
85. The engineered bacterial cell of any one of claims 76 to 84, wherein the therapeutic sequence is a eukaryotic sequence.
86. The engineered bacterial cell of any one of claims 64 to 85, wherein the engineered bacterial cell does not comprise any extragenomic circular DNA molecules other than one or more copies of the circular DNA vector, plasmid template, or second segment comprising the plasmid backbone.
87. A method of making the circular DNA vector of any one of claims 1 to 24, the method comprising:(a) providing a bacterial cell comprising a Rep gene encoding a bacterial replication protein that binds to a bacterial replication origin and a plasmid template, wherein the plasmid template comprises:(i) a first segment comprising a therapeutic sequence and a sequence comprising the bacterial replication origin; and(ii) a second segment comprising a plasmid backbone; and(b) contacting the plasmid within the bacterial cell with an enzyme to circularize the first segment, thereby producing the circular DNA vector containing the therapeutic sequence and the replication origin.
88. The method of claim 87, wherein the method further comprises culturing the bacterial cell under conditions suitable for replication of the circular DNA vector, thereby preparing a bacterial cell culture replicating the circular DNA vector.
89. The method of claim 87 or 88, wherein the enzyme is encoded on a helper plasmid or a bacterial artificial chromosome (BAG) within the bacterial cell.
90. The method of any one of claims 87 to 89, wherein the bacterial cell culture is substantially devoid of helper plasmid or BAC.91 . The method of any one of claims 87 to 90, wherein the mean copy number of the circular DNA vector per bacterial cell is at least 10, or is at least 15, or is at least 20.
92. The method of any one of claims 87 to 91 , wherein the enzyme is a transposase.
93. The method of claim 92, wherein the second segment is flanked by a left end (LE) repeat and a right end (RE) repeat, wherein the LE repeat and the RE repeat can be bound by the transposase protein.
94. The method of any one of claims 87 to 93, wherein the second segment comprises a selectable marker and the first segment lacks a selectable marker.
95. The method of claim 94, wherein the selectable marker is selected from one or more of an antibiotic resistance gene and a counterselection marker.
96. The method of any one of claims 87 to 95, wherein the bacterial cell expresses an I EE.
97. The method of any one of claims 87 to 96, further comprising isolating the circular DNA vector from the bacterial cell.
Citation Information
Patent Citations
Replicative minicircle vectors with improved expression
WO2014077866A1
Bacterial host strains
WO2021183827A2
Production of gene therapy vector in engineered bacteria
WO2023122625A2