Gene silencing of cardiovascular genes
A nucleic acid molecule with linked double stranded RNA molecules and a DNA linker stabilizes the linkage for simultaneous silencing of multiple cardiovascular genes, addressing inefficiencies in existing methods and enhancing therapeutic efficacy for conditions like hypercholesterolemia.
Patent Information
- Application Number
- GB2026005720
- Authority / Receiving Office
- GB · GB
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-07-03
- Filing Date
- 2025-10-17
- Publication Date
- 2026-07-08
AI Technical Summary
Existing methods for delivering multiple inhibitory RNA molecules to silence gene expression are complex and inefficient, lacking a simple and stable approach for simultaneous silencing of multiple cardiovascular disease-related genes.
A nucleic acid molecule comprising a first and second double stranded inhibitory RNA molecule linked by a DNA linker molecule, where the linker has a specific melting temperature, allowing for simultaneous silencing of two cardiovascular genes, such as Apo B and DGAT2, using complementary DNA strands to stabilize the linkage.
Enhances therapeutic efficacy by providing a stable and efficient method to silence multiple cardiovascular genes, potentially treating conditions like hypercholesterolemia and related cardiovascular diseases.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
Field of the Disclosure The disclosure relates to bispecific nucleic acid molecules comprising at least two double stranded inhibitory ribonucleic acid (RNA) molecules adapted to silence by RNA interference either the same gene or different genes to enhance silencing thereby modulating gene expression wherein said at least two double stranded inhibitory RNA molecules are linked by a DNA linker molecule; and a treatment regimen comprising administration of at least two inhibitory monospecific RNA molecules adapted to silence at least two cardiovascular gene targets. Sequence Listing The instant application contains a Sequence Listing which has been submitted herewith and is hereby incorporated by reference in its entirety. Background to the Disclosure A technique to specifically ablate gene function is through the introduction of double stranded inhibitory RNA, also referred to as small inhibitory or interfering RNA (siRNA), into a cell which results in the destruction of mRNA complementary to the sequence included in the siRNA molecule. The siRNA molecule comprises two complementary strands of RNA (a sense strand and an antisense strand) annealed to each other to form a double stranded RNA molecule. The siRNA molecule is typically, but not exclusively, derived from exons of the gene which is to be ablated. Many organisms respond to the presence of double stranded RNA by activating a cascade that leads to the formation of siRNA. The presence of double stranded RNA activates a protein complex comprising RNase III which processes the double stranded RNA into smaller fragments (siRNAs, approximately 21-29 nucleotides in length) which become part of a ribonucleoprotein complex. The siRNA acts as a guide for the RNase complex to cleave mRNA complementary to the antisense strand of the siRNA thereby resulting in destruction of the mRNA. Typically, RNA silencing utilises a single siRNA species directed to a single gene to silence expression. It is known to link siRNAs to enable the silencing of two or more genes. For example, WO2016205410 discloses oligonucleotides linked together directly, via functional end-substitutions, or indirectly by way of a linking agent. The oligonucleotide can be bound directly to a linker. Such bonding can be achieved, for example, through use of 3'-thionucleosides. WO2018145086 discloses oligonucleotides in the form of a multimeric oligonucleotide having monomeric subunits of oligonucleotide joined by covalent linkers to decrease clearance due to glomerular filtration. WO2013040429A1 discloses multi-oligomeric complexes that comprise two or more targeting oligonucleotides linked together by a cleavable linker. WO2015113922 discloses oligo oligonucleotides conjugates where two or more antisense oligonucleotides are covalently linked by physiologically labile linkers, and to a biocleavable functional group such as a conjugate group. WO2010141511 discloses bivalent or multivalent nucleic acid molecules or complexes of nucleic acid molecules having two or more target-specific regions, in which the target-specific regions are complementary to a single target gene at more than one distinct nucleotide site, and / or in which the target regions are complementary to more than one target gene or target sequence. WO2017188707 discloses a dicer substrate RNA nanostructure exhibiting enhanced gene silencing effects. The RNA nanostructure includes a plurality of the same or different RNAi sequences in a single RNA nanostructure. The use of oligomeric nanostructures comprising more than one siRNA or antisense molecule is known in the art. WO2017 / 015109 discloses multi-targeted nucleic acid constructs comprising at least two inhibitory RNAs that are covalently linked by nucleic acid linkers via the 3’ ends of sense and antisense strands of corresponding inhibitory RNAs. There is a desire to provide alternative and simpler approaches to the delivery of more than one inhibitory RNA to a cell with the objective of silencing the expression of one or more gene targets to obtain enhanced therapeutic effects. In our currently unpublished PCT application PCT / GB2024 / 051168, the content of which is incorporated by reference it its entirety, there is disclosure of dual silencing constructs comprising a short DNA linker molecule that silences two cardiovascular gene targets in the liver of mice and is efficacious. This disclosure relates to the identification of variant DNA linker molecules that stably link at least two siRNAs, for example and not by way of limitation, genes associated with cardiovascular disease, that silence expression of the same target gene or different target gene to modulate gene expression simultaneously or co-ordinately. STATEMENT OF INVENTION According to an aspect of the invention there is provided a nucleic acid molecule comprising: i) a first nucleic acid comprising a double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense and an antisense strand designed with reference to a nucleotide sequence comprising a gene to be silenced and wherein there is provided a first single stranded deoxyribonucleic acid (DNA) molecule conjugated to either the 5’ or 3’ end of said sense or antisense strand; and ii) a second nucleic acid comprising a double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense and an antisense strand designed with reference to a different or the same gene to be silenced as set forth in i) above and wherein there is provided a second single stranded deoxyribonucleic acid (DNA) molecule conjugated to either the 5’ or 3’ end of said sense or antisense strand wherein the second single stranded deoxyribonucleic acid (DNA) molecule is substantially complementary to the first single stranded deoxyribonucleic acid (DNA) molecule set forth in i) above and anneals by complementary base pairing to form a double stranded DNA linker that links the first and second double stranded inhibitory ribonucleic acid (RNA) molecules wherein said DNA linker molecule comprises a nucleotide sequence having a melting temperature (TM) that is 73°C +1- 5%. In a preferred embodiment of the invention said DNA linker molecule comprises a nucleotide sequence wherein the TM is about 69°C to 76°C. In a preferred embodiment of the invention said DNA linker molecule comprises a nucleotide sequence wherein the TM is about 73°C. In a preferred embodiment of the invention said first single stranded deoxyribonucleic acid (DNA) molecule comprises the nucleotide sequence: 5’ CGAAGCG 3’. In a preferred embodiment of the invention said single stranded DNA comprises the nucleotide sequence 5’ CGAAGCGCCCTACTCCACT 3’ (SEQ ID NO: 17155). Preferably said complementary single stranded DNA comprises the nucleotide sequence 5’ AGTGGAGTAGGGCGCTTCG 3’ (SEQ ID NO: 17156). In a preferred embodiment of the invention said single stranded DNA comprises the nucleotide sequence CGAAGCGCCCTACTCCACT (SEQ ID NO: 17155) and is attached to the 5’ end of the sense nucleotide sequence. In a preferred embodiment of the invention said complementary single stranded DNA comprises the nucleotide sequence AGTGGAGTAGGGCGCTTCG (SEQ ID NO: 17156) and is attached to the 5’ end of the sense nucleotide sequence. According to an aspect or embodiment of the invention there is provided a nucleic acid molecule comprising: i) a first nucleic acid comprising a double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense and an antisense strand designed with reference to a nucleotide sequence comprising a gene to be silenced and wherein there is provided a first single stranded deoxyribonucleic acid (DNA) molecule conjugated to either the 5’ or 3’ end of said sense or antisense strand; and ii) a second nucleic acid comprising a double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense and an antisense strand designed with reference to a different or the same gene to be silenced as set forth in i) above and wherein there is provided a second single stranded deoxyribonucleic acid (DNA) molecule conjugated to either the 5’ or 3’ end of said sense or antisense strand wherein the second single stranded deoxyribonucleic acid (DNA) molecule is substantially complementary to the first single stranded deoxyribonucleic acid (DNA) molecule set forth in i) above and anneals by complementary base pairing to form a double stranded DNA linker that links the first and second double stranded inhibitory ribonucleic acid (RNA) molecules wherein said DNA linker molecule is not 5’ CGAAGCGCCCTACTCCACT 3’ (SEQ ID NO: 17155) 3’ GCTTCGCGGGATGAGGTGA 5’ (SEQ ID NO: 17156) wherein the DNA linker molecule comprises a nucleotide sequence having a melting temperature (TM) that is 73°C +1- 5%. In a preferred embodiment of the invention said DNA linker molecule comprises a nucleotide sequence wherein the TM is about 69°C to 76°C. In a preferred embodiment of the invention said DNA linker molecule comprises a nucleotide sequence wherein the TM is about 73°C. In a preferred embodiment of the invention said first single stranded deoxyribonucleic acid (DNA) molecule comprises the nucleotide sequence: CGAAGCG. In a preferred embodiment of the invention said first single stranded DNA molecule comprises a nucleotide sequence selected from the group: SEQ ID NO: 1 to SEQ ID NO: 6170. In a preferred embodiment of the invention said second single stranded complementary DNA molecule is selected from the group: SEQ ID NO: 6171 to SEQ ID NO: 12340 and is fully complementary to said first single stranded DNA molecule as set forth in SEQ ID NO: 1 to SEQ ID NO: 6170 and is a stable double stranded DNA linker molecule. Preferably said stable double stranded DNA linker molecule has a TM of about 73°C. In a preferred embodiment of the invention said a single stranded deoxyribonucleic acid (DNA) is linked to said first or second double stranded inhibitory RNA molecule wherein said linkage is selected from the group: i) 5’ sense strand of said first double stranded inhibitory RNA and 5’ antisense stand of said second double stranded inhibitory RNA molecule; ii) 5’ sense strand of said first double stranded inhibitory RNA and 3’ sense strand of said second double stranded inhibitory RNA molecule; iii) 5’ sense strand of said first double stranded inhibitory RNA and 5’ sense strand of said second double stranded inhibitory RNA molecule; iv) 5’ sense strand of said first double stranded inhibitory RNA and the 3’ antisense strand of said second double stranded inhibitory RNA molecule; v) 3’ sense strand of said first double stranded inhibitory RNA and the 5’ sense strand of said second double stranded inhibitory RNA molecule; vi) 3’ sense strand of said first double stranded inhibitory RNA and the 3’ sense strand of said second double stranded inhibitory RNA molecule; vii) 3’ sense strand of said first double stranded inhibitory RNA and the 5’ antisense strand of said second double stranded inhibitory RNA molecule; viii) 3’ sense strand of said first double stranded inhibitory RNA and the 3’ antisense of said second double stranded inhibitory RNA molecule; ix) 5’ antisense strand of said first double stranded inhibitory RNA and the 5’ sense strand of said second double stranded inhibitory RNA molecule; x) 5’ antisense strand of said first double stranded inhibitory RNA and the 3’ sense strand of said second double stranded inhibitory RNA molecule; xi) 5’ antisense strand of said first double stranded inhibitory RNA and the 5’ antisense strand of said second double stranded inhibitory RNA molecule; xii) 5’ antisense strand of said first double stranded inhibitory RNA and the 3’ antisense strand of said second double stranded inhibitory RNA molecule; xiii) 3’ antisense strand of said first double stranded inhibitory RNA and the 5’ sense strand of said second double stranded inhibitory RNA molecule; xiv) 3’ antisense strand of said first double stranded inhibitory RNA and the 3’ sense strand of said second double stranded inhibitory RNA molecule; xv) 3’ antisense strand of said first double stranded inhibitory RNA and the 3’ antisense of said second double stranded inhibitory RNA molecule; and xvi) 3’ antisense strand of said first double stranded inhibitory RNA and the 5’ antisense of said second double stranded inhibitory RNA molecule. In a preferred embodiment of the invention said the first and second gene to be silenced is the same gene. In an alternative preferred embodiment of the invention said first and second gene to be silenced are different genes. In a preferred embodiment of the invention said first and second double stranded inhibitory RNA molecules comprise different nucleotide sequences. In a preferred embodiment of the invention said first or second gene to be silenced is the apolipoprotein B (Apo B) gene. In a preferred embodiment of the invention said Apo B gene comprises a nucleotide sequence set forth in SEQ ID NO: 12341 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length. In a preferred embodiment of the invention said Apo B double stranded inhibitory RNA comprise or consists of a sense nucleotide sequence selected from the group: SEQ ID NO: 12947-13246. In a preferred embodiment of the invention said Apo B double stranded inhibitory RNA comprise or consists of an antisense nucleotide sequence selected from the group: SEQ ID NO: 13247-13546. In an alternative preferred embodiment of the invention said first or second gene to be silenced is proprotein convertase subtilisin / kexin type 9 (PCSK9). In a preferred embodiment of the invention said PCSK9 gene comprises a nucleotide sequence set forth in SEQ ID NO: 12342 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length. In a preferred embodiment of the invention said double stranded PCSK9 inhibitory RNA comprise or consists of a sense nucleotide sequence selected from the group: SEQ ID NO: 13547-13850 and SEQ ID NO 17161. In a preferred embodiment of the invention said double stranded PCSK9 inhibitory RNA comprise or consists of an antisense nucleotide sequence selected from the group: SEQ ID NO: 13851-14154 and 17162. In a further alternative embodiment of the invention said first or second gene to be silenced is lipoprotein A (Lp(a)). In a preferred embodiment of the invention said Lp(a) gene comprises a nucleotide sequence set forth in SEQ ID NO: 12343 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length. In a preferred embodiment of the invention said Lp(a) double stranded inhibitory RNA comprise or consists of a sense nucleotide sequence selected from the group: SEQ ID NO: 14155-14454 and 17163. In a preferred embodiment of the invention said Lp(a) double stranded inhibitory RNA comprise or consists of an antisense nucleotide sequence selected from the group: SEQ ID NO: 14455-14754 and 17164. In a further alternative embodiment of the invention said first or second gene to be silenced is angiotensinogen. In a preferred embodiment of the invention said angiotensinogen gene comprises a nucleotide sequence set forth in SEQ ID NO: 12344 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length. In a preferred embodiment of the invention said double stranded angiotensinogen inhibitory RNA comprise or consists of a sense nucleotide sequence selected from the group: SEQ ID NO: 14755-15054. In a preferred embodiment of the invention said double stranded angiotensinogen inhibitory RNA comprise or consists of an antisense nucleotide sequence selected from the group: SEQ ID NO: 15055-15354. In a further alternative preferred embodiment of the invention said first or second gene to be silenced is apolipoprotein CHI (Apo CHI). In a preferred embodiment of the invention said Apo Cl 11 gene comprises a nucleotide sequence set forth in SEQ ID NO: 12345 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length. In a preferred embodiment of the invention said double stranded Apo CHI inhibitory RNA comprise or consists of a sense nucleotide sequence selected from the group: SEQ ID NO: 15355-15654 and 17200. In a preferred embodiment of the invention said double stranded Apo CHI inhibitory RNA comprise or consists of an antisense nucleotide sequence selected from the group: SEQ ID NO: 15655-15954 and 17199. In a further alternative preferred embodiment of the invention said first or second gene to be silenced is diacylglycerol acyltransferase 2 (DGAT2). In a preferred embodiment of the invention said DGAT2 gene comprises a nucleotide sequence set forth in SEQ ID NO: 12346 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length. In a preferred embodiment of the invention said double stranded DGAT2 inhibitory RNA comprise or consists of a sense nucleotide sequence selected from the group: SEQ ID NO: 12348-12646, 17169 and 17171 to 17179. In a preferred embodiment of the invention said double stranded DGAT2 inhibitory RNA comprise or consists of an antisense nucleotide sequence selected from the group: SEQ ID NO: 12647-12946, 17170 and 17180 to 17188. In a preferred embodiment of the invention said first or second gene to be silenced is angiopoietin-like protein 3 (ANGPTL3). In a preferred embodiment of the invention said ANGPTL3 gene comprises a nucleotide sequence set forth in SEQ ID NO: 17159 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length. In a preferred embodiment of the invention said double stranded ANGPTL3 inhibitory RNA comprise or consists of a sense nucleotide sequence selected from the group: SEQ ID NO: 15955-16254, 17165 and 17167. In a preferred embodiment of the invention said double stranded ANGPTL3 inhibitory RNA comprise or consists of an antisense nucleotide sequence selected from the group: SEQ ID NO: 16255-16554, 17166 and 17168. In a preferred embodiment of the invention said first or second gene to be silenced is angiopoietin-related protein 4 (ANGPTL4). In a preferred embodiment of the invention said ANGPTL4 gene comprises a nucleotide sequence set forth in SEQ ID NO: 17160 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length. In a preferred embodiment of the invention said ANGPTL4 double stranded inhibitory RNA comprise or consists of a sense nucleotide sequence selected from the group: SEQ ID NO: 16555-16854. In a preferred embodiment of the invention said ANGPTL4 double stranded inhibitory RNA comprise or consists of an antisense nucleotide sequence selected from the group: SEQ ID NO: 16855-17154. In a preferred embodiment of the invention said first or second gene to be silenced is selected from the group consisting of: Apo B, DGAT2, PCSK9, Lp(a), APOCIII, angiotensinogen, ANGPTL3 and ANGPTL4. In a preferred embodiment of the invention said first gene is Apo B and said second gene is DGAT2. In a preferred embodiment of the invention said first gene is Apo B and said second gene is PCSK9. In a preferred embodiment of the invention said first gene is Apo B and said second gene is angiotensinogen. In a preferred embodiment of the invention said first gene is Apo B and said second gene is Apo Clll. In a preferred embodiment of the invention said first gene is Apo B and said second gene is Lp(a). In a preferred embodiment of the invention said first gene is PCSK9 and said second gene is angiotensinogen. In a preferred embodiment of the invention said first gene is PCSK9 and said second gene is Apo Clll. In a preferred embodiment of the invention said first gene is PCSK9 and said second gene is DGAT2. In a preferred embodiment of the invention said first gene is PCSK9 and said second gene is Lp(a). In a preferred embodiment of the invention said first gene is angiotensinogen and said second gene is Apo Clll. In a preferred embodiment of the invention said first gene is angiotensinogen and said second gene is DGAT2. In a preferred embodiment of the invention said first gene is angiotensinogen and said second gene is Lp(a). In a preferred embodiment of the invention said first gene is Apo Clll and said second gene is DGAT2. In a preferred embodiment of the invention said first gene is Apo Cl 11 and said second gene is Lipoprotein (a). In a preferred embodiment of the invention said first gene is DGAT2 and said second gene is Lipoprotein (a). In a preferred embodiment of the invention said first gene is ANGPLT3 and said second gene is ApoB. In a preferred embodiment of the invention said first gene is ANGPLT3 and said second gene is PCSK9. In a preferred embodiment of the invention said first gene is ANGPLT3 and said second gene is angiotensinogen. In a preferred embodiment of the invention said first gene is ANGPLT3 and said second gene is APOCIII. In a preferred embodiment of the invention said first gene is ANGPLT3 and said second gene is Lp(a). In a preferred embodiment of the invention said first gene is ANGPLT3 and said second gene is DGAT2. In a preferred embodiment of the invention said first gene is ANGPLT3 and said second gene is ANGPLT4. In a preferred embodiment of the invention said first gene is ANGPLT4 and said second gene is Apo B. In a preferred embodiment of the invention said first gene is ANGPLT4 and said second gene is PCSK9. In a preferred embodiment of the invention said first gene is ANGPLT4 and said second gene is angiotensinogen. In a preferred embodiment of the invention said first gene is ANGPLT4 and said second gene is Apo CHI. In a preferred embodiment of the invention said first gene is ANGPLT4 and said second gene is Lp(a). In a preferred embodiment of the invention said first gene is ANGPLT4 and said second gene is DGAT2. In a preferred embodiment of the invention said first and / or said second double stranded inhibitory RNA molecule comprises or consists of natural nucleotides. In an alternative preferred embodiment of the invention said first and / or said second double stranded inhibitory RNA molecule comprises modified nucleotides and / or modified sugar(s). In a preferred embodiment of the invention said modified nucleotides / sugars are selected from the group: a 3 '-terminal deoxy- thymine (dT) nucleotide, a 2'-0-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an unlocked nucleotide, a conformationally restricted nucleotide, a constrained ethyl nucleotide, an abasic nucleotide, a 2'-amino-modified nucleotide, a 2'-O-allyl-modified nucleotide, 2'-C-alkyl-modified nucleotide, 2' -hydroxyl- modified nucleotide, a 2'-methoxyethyl modified nucleotide, a 2'-0- alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, a non-natural base comprising nucleotide, a tetrahydropyran modified nucleotide, a 1,5-anhydrohexitol modified nucleotide, a cyclohexenyl modified nucleotide, a nucleotide comprising a phosphorothioate group, a nucleotide comprising phosphorodithioate (PS2), a nucleotide comprising a methylphosphonate group, a nucleotide comprising a 5’- phosphate, and a nucleotide comprising a 5 ‘-phosphate mimic, for example a 5’-vinyl phosphate, a nucleotide comprising a 2’-deoxy-2’-fluro and a 2’ methyl sugar base and glycol nucleic acid. In a preferred embodiment of the invention said first or and / or second double stranded inhibitory RNA molecule comprises at least one modified nucleotide wherein said modification is 2'-deoxy-2'-fluoro. In a preferred embodiment of the invention said first and / or said second double stranded inhibitory RNA molecule comprises at least one modified nucleotide wherein said modification is 2'-O-methyl. In a further preferred embodiment of the invention said first and / or said second double stranded inhibitory RNA molecule comprises at least one phosphorothioate linkage. In a further preferred embodiment of the invention said first and / or said second double stranded inhibitory RNA molecule comprises at least one 5'-vinyl phosphate. In an embodiment of the invention said first and / or said second double stranded inhibitory RNA molecule comprises at least one modified sugar. A sugar modification includes a modified version of the ribosyl moiety, such as -O-modified RNA such as '-O-alkyl or 2'-0-(substituted)alkyl e.g. 2'-0-methyl, T-0-(2-cyanoethyl), 2'-0-(2-methoxy)ethyl (2-MOE), 2'-0-(2-thiomethyl)ethyl, 2'-0-butyryl, -O-propargyl, 2'-O-allyl, 2'-O-(2-amino)propyl, 2'-O-(2-(dimethylamino)propyl), 2'-O-(2-amino)ethyl, 2'-O-(2-(dimethylamino)ethyl); 2'-deoxy (DNA); 2'-O-(haloalkoxy)methyl, e.g. 2'-0-(2-chloroethoxy)methyl (MCEM), -0- (2,2-dichloroethoxy)methyl (DCEM); 2'-<3-alkoxycarbonyl e.g. T-0-[2- (methoxycarbonyl)ethyl] (MOCE), 2'-O-[2-(N-methylcarbamoyl)ethyl] (MCE), T-0-[2-(N,N- dimethylcarbamoyl)ethyl] (DOME); 2'-halo e.g. 2'-F, FANA (2'-F arabinosyl nucleic acid); carbasugar and azasugar modifications; 3 '-O-alkyl e.g. 3'-0-methyl, 3 '-O-butyryl, V-0- propargyl and their derivatives. In a preferred embodiment of the invention said first double stranded inhibitory RNA comprises or consists of a sense nucleotide sequence selected from the group: i) 5’ CCCTCAACTTTTCTAAACT3’ (SEQ ID NO: 13003) ii) 5’GTCCCAGGTAUATTCGAAA3’ (SEQ ID NO: 12968) iii) 5’GUUCCAUGUCCCAUUUACA3’ (SEQ ID NO: 12969) iv) 5’GCACGUGGGUUCCAAAUUA3’ (SEQ ID NO: 12967) v) 5’CAAGGGUGUUAUUUCCAUA3’ (SEQ ID NO: 12986) vi) 5’CUCAAGACCCAAUUUAACA3’ (SEQ ID NO: 12999) vii) 5’GUACUGUCCCAGGUAUAUU3’ (SEQ ID NQ:12970) viii)5’CCAAUUUCCCUGUGGAUCU3’ (SEQ ID NO:12971) ix) 5’GGGUUCCAAAUUAAUAGUU3’ (SEQ ID NO: 13005) x) 5’CAGGAAGGGCUCAAAGAAU3’ (SEQ ID NO: 13003) xi) 5’GGGAACUGUUGAAAGAUUU3’ (SEQ ID NO: 12951) xii) 5’GAAACAACCCAGUCUCAAA3’ (SEQ ID NO: 12993) xiii)5’CCCAUGGUCUUGAGUUAAA3’ (SEQ ID NO: 12957) xiv) 5’ CAAAGUUAAUUGGGAAGAA3’ (SEQ ID NO: 13004) xv) 5’CCCUAUUCUCUGGUAACUA3’ (SEQ ID NO: 12977) xvi) 5’CAAUGAAGGGAAUUUGAAA3’ (SEQ ID NO: 12961) xvii) 5’CCCUGAAGUUGAUGUGUUA3’ (SEQ ID NO: 12947) xviii) 5’GAGGGUAGUCAUAACAGUA3’ (SEQ ID NO: 13002) xix)5’CACUAAAUUCCCAUGGUCU3’; and (SEQ ID NO: 12992) or xx) 5’ GUACUGGGUUAAUGGUCAA3 (SEQ ID NO: 12959), wherein said double stranded inhibitory RNA inhibits the expression of said Apo B gene. In a preferred embodiment of the invention said first double stranded inhibitory RNA 5 comprises or consists of an antisense nucleotide sequence selected from the group: i) 5’AGUUUAGAAAAGUUGAGGG3’ (SEQ ID NO: 13303) ii) 5’UUUCGAAUAUACCUGGGAC3’ (SEQ ID NO: 13268) iii) 5’UGUAAAUGGGACAUGGAAC3’ (SEQ ID NO: 13269) iv) 5’UAAUUUGGAACCCACGUGC3’ (SEQ ID NO: 13267) v) 5’UAUGGAAAUAACACCCUUG3’ (SEQ ID NO: 13286) vi) 5’UGUUAAAUUGGGUCUUGAG3’ (SEQ ID NO:13299) vii) 5’AAUAUACCUGGGACAGUAC3’ (SEQ ID NO: 13270) viii)5’AGAUCCACAGGGAAAUUGG3’ (SEQ ID NO: 13271) ix) 5’AACUAUUAAUUUGGAACCC3’ (SEQ ID NO: 13305) x) 5’AUUCUUUGAGCCCUUCCUG3’ (SEQ ID NO: 13278) xi) 5’AAAUCUUUCAACAGUUCCC3’ (SEQ ID NO: 13251) xii) 5’UUUGAGACUGGGUUGUUUC3’ (SEQ ID NO: 13293) xiii)5’UUUAACUCAAGACCAUGGG3’ (SEQ ID NO: 13257) xiv)5’UUCUUCCCAAUUAACUUUG3’ (SEQ ID NO: 13304) xv) 5’UAGUUACCAGAGAAUAGGG3’(SEQ ID NO: 13277) xvi)5’UUUCAAAUUCCCUUCAUUG3’ (SEQ ID NO: 13261) xvii) 5’UAACACAUCAACUUCAGGG3’ (SEQ ID NO: 13247) xviii) 5’UACUGUUAUGACUACCCUC3’ (SEQ ID NO: 13302) xix)5’AGACCAUGGGAAUUUAGUG3’; and (SEQ ID NO: 13292) or xx) 5’UUGACCAUUAACCCAGUAC3’ (SEQ ID NO: 13259), wherein said double stranded inhibitory RNA inhibits the expression of said Apo B gene. 10 Ina preferred embodiment of the invention said Apo B double inhibitory RNA comprises or consists of a sense nucleotide sequence set forth in SEQ ID NO: 5’CCAAUUUCCCUGUGGAUCU3’ (SEQ ID NO: 12971) and corresponding antisense nucleotide sequence set forth in SEQ ID NO: 5’AGAUCCACAGGGAAAUUGG3’ (SEQ ID NO: 13271). In a preferred embodiment of the invention said Apo B double stranded inhibitory RNA comprises or consists of a modified sense and / or antisense nucleotide sequence. In a preferred embodiment of the invention said Apo B double stranded inhibitory RNA is modified and comprises one or more 2'-O-methyl moieties. In a preferred embodiment of the invention said Apo B double stranded inhibitory RNA is modified and comprises one or more 2'-deoxy-2'-fluoro moieties. In a preferred embodiment of the invention said sense nucleotide sequence comprises substantially 2'-O-methyl moieties. In a preferred embodiment of the invention said antisense nucleotide sequence comprises substantially 2'-deoxy-2'-fluoro moieties. In a preferred embodiment of the invention said sense nucleotide sequence is modified wherein said modification pattern comprises the following: 5’mmmmmmfffmmmmmmmmmm3’ wherein m - 2'-O-methyl and f - 2'-deoxy-2'-fluoro. In a preferred embodiment of the invention said antisense nucleotide sequence is modified wherein said modification patter comprises the following: 5’mfmfmfmfmfmfmfmfmfm + mllmU3’ wherein m - 2'-O-methyl and f - 2'-deoxy-2'-fluoro. In a preferred embodiment of the invention said second inhibitory RNA comprises or consists of a sense nucleotide sequence wherein said double stranded inhibitory RNA inhibits the expression of the DGAT2 gene. In a preferred embodiment of the invention said DGAT2 double stranded inhibitory RNA comprises or consists of a modified sense and / or antisense nucleotide sequence. In a preferred embodiment of the invention said DGAT2 double stranded inhibitory RNA is modified and comprises one or more 2'-O-methyl moieties. In a preferred embodiment of the invention said DGAT2 double stranded inhibitory RNA is modified and comprises one or more 2'-deoxy-2'-fluoro moieties. In a preferred embodiment of the invention said sense nucleotide sequence comprises substantially 2'-O-methyl moieties. In a preferred embodiment of the invention said antisense nucleotide sequence comprises substantially 2'-deoxy-2'-fluoro moieties. According to an aspect of the invention there is provided a nucleic acid molecule comprising: i) a first nucleic acid comprising a double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense and an antisense strand with reference to a nucleotide sequence comprising a cardiovascular disease associated gene to be silenced wherein said cardiovascular disease gene is apolipoprotein B (Apo B) and wherein there is provided a first single stranded deoxyribonucleic acid (DNA) molecule conjugated to either the 5’ or 3’ end of said sense or antisense strand; and ii) a second nucleic acid comprising a double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense and an antisense strand with reference to a different cardiovascular disease associated gene to be silenced wherein said cardiovascular disease gene is diacylglyceroi O acyltransferase 2 (DGAT2) and wherein there is provided a second single stranded deoxyribonucleic acid (DNA) molecule conjugated to either the 5’ or 3’ end of said sense or antisense strand wherein the second single stranded deoxyribonucleic acid (DNA) molecule is substantially complementary to the first single stranded deoxyribonucleic acid (DNA) molecule set forth in i) above and anneals by complementary base pairing to form a double stranded DNA linker that links the first and second double stranded inhibitory ribonucleic acid (RNA) molecules wherein said DNA linker molecule comprises a nucleotide sequence having a melting temperature (TM) that is 73°C +1- 5%. In a preferred embodiment of the invention said DNA linker molecule comprises a nucleotide sequence wherein the TM is about 69°C to 76°C In a preferred embodiment of the invention said DNA linker molecule comprises a nucleotide sequence wherein the TM is about 73°C. In a further preferred embodiment of the invention said first single stranded deoxyribonucleic acid (DNA) molecule comprises the nucleotide sequence: 5’ CGAAGCG 3’. In a preferred embodiment of the invention said single stranded DNA comprises the nucleotide sequence 5’ CGAAGCGCCCTACTCCACT 3’ (SEQ ID NO: 17155). In a further preferred embodiment of the invention said complementary single stranded DNA comprises the nucleotide sequence 5’ AGTGGAGTAGGGCGCTTCG 3’ (SEQ ID NO: 17156). In a preferred embodiment of the invention said first single stranded DNA molecule comprises a nucleotide sequence selected from the group: SEQ ID NO: 1 to SEQ ID NO: 6170. Preferably, said second single stranded complementary DNA molecule is selected from the group: SEQ ID NO: 6171 to SEQ ID NO: 12340 and is fully complementary to said first single stranded DNA molecule as set forth in SEQ ID NO: 1 to SEQ ID NO: 6170 and is a stable double stranded DNA linker molecule. In a preferred embodiment of the invention said Apo B and / or DGAT2 double stranded inhibitory RNA comprises or consists of a modified sense and / or antisense nucleotide sequence. Preferably, said Apo B and / or DGAT2 double stranded inhibitory RNA is modified and comprises one or more 2'-O-methyl moieties. In a preferred embodiment of the invention said ApoB and / or DGAT2 double stranded inhibitory RNA is modified and comprises one or more 2'-deoxy-2'-fluoro moieties. Preferably, said sense nucleotide sequence comprises substantially 2'-O-methyl moieties. Preferably, said antisense nucleotide sequence comprises substantially 2'-deoxy-2'-fluoro moieties. In a preferred embodiment of the invention said sense nucleotide sequence is modified wherein said modification pattern comprises the following: mmmmmmfffmmmmmmmmmm wherein m - 2'-O-methyl and f - 2'-deoxy-2'-fluoro. In a preferred embodiment of the invention said antisense nucleotide sequence is modified wherein said modification patter comprises the following: mfmfmfmfmfmfmfmfmfm + mUrnll wherein m - 2'-O-methyl and f - 2'-deoxy-2'-fluoro. In a preferred embodiment of the invention said DGAT2 double stranded inhibitory RNA comprises a sense nucleotide sequence set forth in SEQ IDs presented in Table 16 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length. In a preferred embodiment of the invention said DGAT2 double stranded inhibitory RNA comprises an antisense nucleotide sequence set forth in SEQ IDs presented in Table 16 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length. In a preferred embodiment of the invention said DGAT2 double stranded inhibitory RNA comprises a sense nucleotide sequence set forth in SEQ IDs presented in Table 17 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length. In a preferred embodiment of the invention said DGAT2 double stranded inhibitory RNA comprises an antisense nucleotide sequence set forth in SEQ IDs presented in Table 17 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length. In a preferred embodiment of the invention said APOB double stranded inhibitory RNA comprises a sense nucleotide sequence set forth in SEQ IDs presented in Table 18 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length. In a preferred embodiment of the invention said APOB double stranded inhibitory RNA comprises an antisense nucleotide sequence set forth in SEQ IDs presented in Table 18 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length. In a preferred embodiment of the invention said APOB double stranded inhibitory RNA comprises a sense nucleotide sequence set forth in SEQ IDs presented in Table 19 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length. In a preferred embodiment of the invention said APOB double stranded inhibitory RNA comprises an antisense nucleotide sequence set forth in SEQ IDs presented in Table 19 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length. In a preferred embodiment of the invention said double stranded inhibitory RNA comprises sense and antisense nucleotide sequences linked by a double stranded DNA linker wherein said sense nucleotide sequence is: 5’_CGAAGCGCCCTACTCCACTmC*mC*mAmAmUmUfUfCfCmCmUmGmUmGmGmA mU*mC*mU / Gal3C2 / 3’; and (SEQ ID NO: 17238) said antisense nucleotide sequence is: AGTGGAGTAGGGCGCTTCGmG*mU*mCmAmUmGmGmGfUfGfUmCmUmGmUmGm G mGmU*mU*mA / Gal3C2 / 3.’ (SEQ ID NO: 17239) In a preferred embodiment of the invention said double stranded inhibitory RNA comprises sense and antisense nucleotide sequences linked by a double stranded DNA linker wherein said sense nucleotide sequence is: 5’_CGAAGCGTAGCCGGGGGAAmC*mC*mAmAmUmUfUfCfCmCmUmGmUmGmGmA mU*mC*mU / Gal3C2 / 3’ (SEQ ID NO: 17240) and said antisense nucleotide sequence is: 5’TTCCCCCGGCTACGCTTCGmG*mU*mCmAmUmGmGmGfUfGfUmCmUmGmUmGm G mGmU*mU*mA / Gal3C2 / 3’. (SEQ ID NO: 17241) In a preferred embodiment of the invention said double stranded inhibitory RNA comprises sense and antisense nucleotide sequences linked by a double stranded DNA linker wherein said sense nucleotide sequence is: 5’_CGAAGCGTGACGGGGTCGAmC*mC*mAmAmUmUfUfCfCmCmUmGmUmGmGmA mU *mC*mU / Gal3C2 / 3’ (SEQ ID NO: 17242) and said antisense nucleotide sequence is: TCGACCCCGTCACGCTTCGmG*mU*mCmAmUmGmGmGfUfGfUmCmUmGmUmGmG m GmU*rnll*mA / Gal3C2 / 3’. (SEQ ID NO: 17243) In a preferred embodiment of the invention said double stranded inhibitory RNA comprises sense and antisense nucleotide sequences linked by a double stranded DNA linker wherein said sense nucleotide sequence is: 5’_CGAAGCGTGACCGGGTCGAmC*mC*mAmAmUmUfUfCfCmCmUmGmUmGmGmA mU *mC*mU / Gal3C2 / 3’ (SEQ ID NO: 17244) and said antisense nucleotide sequence is: 5TCGACCCGGTCACGCTTCGmG*mU*mCmAmUmGmGmGfUfGfUmCmUmGmUmGm G mGmU*mU*mA / Gal3C2 / 3’. (SEQ ID NO: 17245). In a preferred embodiment of the invention said double stranded inhibitory RNA comprises sense and antisense nucleotide sequences linked by a double stranded DNA linker wherein said sense nucleotide sequence is: 5’_CGAAGCGCCCTACTCCACTmC*mC*mUmGmGmAmCmAfUfUfCmAmGmAmAmCm AmAmG*mA*mA / Gal3C2 / 3’ (SEQ ID NO: 17246) and said antisense nucleotide sequence is: 5’ AGTGGAGTAGGGCGCTTCGmU*mG*mGmGmUmUmAfUfUfllmAfAmAmAmGmA* mA*mA / Gal3C2 / 3’. (SEQ ID NO: 17247). According to a further aspect of the invention there is provided a nucleic acid molecule or a pharmaceutical composition according to the invention for use in the treatment or prevention of a subject that has or is predisposed to hypercholesterolemia. In a preferred embodiment of the invention said use is the treatment or prevention of diseases associated with hypercholesterolemia. In a preferred embodiment of the invention said disease associated with hypercholesterolemia is selected from the group consisting of: stroke prevention, hyperlipidaemia, cardiovascular disease, atherosclerosis, coronary heart disease, aortic stenosis, cerebrovascular disease, peripheral arterial disease, hypertension, metabolic syndrome, type II diabetes, non-alcoholic fatty acid liver disease, non-alcoholic steatohepatitis, Buerger’s disease, renal artery stenosis, hyper-apobetalipoproteinemia, cerebrovascular atherosclerosis, cerebrovascular disease and venous thrombosis. In a preferred embodiment of the invention said nucleic acid molecule is covalently linked to / V-acetylgalactosamine. The sugar moiety in N-acetylgalactosamine can comprise glycosidic linkages to improve stability. A variety of glycosidic bonds are known in the art and formed between the hemiacetal of the sugar moiety and several chemical groups forming O-, N-, S- or C-glycosidic bonds. Preferably the N-acetylgalactosamine comprises an 0-, N-, S- or C-glycosidic bond. In a further embodiment of the invention said N-acetylgalactosamine is linked to either the antisense part of said inhibitory RNA or the sense part of said inhibitory RNA. In a further embodiment of the invention said N-acetylgalactosamine is linked to either the antisense strand or the sense strand of said double stranded inhibitory RNA molecule of said first nucleic acid. In a further embodiment of the invention said N-acetylgalactosamine is linked to either the antisense strand or the sense strand of said double stranded inhibitory RNA molecule of said second nucleic. In a further embodiment of the invention N-acetylgalactosamine is linked to either the antisense strand or the sense strand of said double stranded inhibitory RNA molecule of said first nucleic acid and is linked to either the antisense strand or the sense strand of said double stranded inhibitory RNA molecule of said second nucleic molecule. Preferably, N-acetylgalactosamine is linked to the 3’ terminus is of said sense RNA. In an alternative embodiment of the invention N-acetylgalactosamine is linked to the 5’ terminus of said sense RNA. In an alternative preferred embodiment of the invention said N-acetylgalactosamine is linked to the 3’ terminus of said antisense RNA. In a preferred embodiment of the invention N-acetylgalactosamine is monovalent. In a preferred embodiment of the invention N-acetylgalactosamine is divalent. In an alternative embodiment of the invention N-acetylgalactosamine is trivalent. In a preferred embodiment of the invention said nucleic acid molecule is covalently linked to a molecule comprising the structure: OH XOH AcHN In an alternative embodiment of the invention said nucleic acid molecule is covalently linked to a molecule comprising the structure: In an alternative embodiment of the invention said nucleic acid molecule is covalently linked to a molecule comprising the structure: In an alternative embodiment of the invention said nucleic acid molecule is covalently linked to a molecule comprising the structure: 10 HO AcHN OH .OH O N H OH OH 1 A P Oligonucleotide 6 In an alternative embodiment of the invention said nucleic acid molecule is covalently linked to a molecule comprising the structure: OH.OH o HO O AcHN OHOH 0 ! I O 0 AcHN H O 0 " OHZOH NH -^0 AcHN 15 In an alternative embodiment of the invention said nucleic acid molecule is covalently linked to a molecule comprising the structure: According to a further aspect of the invention there is provided a medicament comprising a nucleic acid according to the invention. According to a further aspect of the invention there is provided a pharmaceutical composition comprising a nucleic acid molecule according to the invention. In a preferred embodiment of the invention said composition further includes a pharmaceutical carrier and / or excipient. According to a further aspect of the invention there is provided a nucleic acid molecule or a pharmaceutical composition according to the invention for use in the treatment or prevention of a subject that has or is predisposed to hypercholesterolemia. In a preferred embodiment of the invention said use is the treatment or prevention of diseases associated with hypercholesterolemia. In a preferred embodiment of the invention said disease associated with hypercholesterolemia is selected from the group consisting of: stroke prevention, hyperlipidaemia, cardiovascular disease, atherosclerosis, coronary heart disease, aortic stenosis, cerebrovascular disease, peripheral arterial disease, hypertension, metabolic syndrome, type II diabetes, non-alcoholic fatty acid liver disease, non-alcoholic steatohepatitis, Buerger’s disease, renal artery stenosis, hyper-apobetalipoproteinemia, cerebrovascular atherosclerosis, cerebrovascular disease and venous thrombosis. According to an aspect of the invention there is provided a treatment regimen for use in the treatment or prevention of at least one cardiovascular disease comprising administration of a first and second double stranded inhibitory RNA molecule wherein said first double stranded inhibitory RNA molecule is designed with reference to a cardiovascular gene target to be silenced and wherein said second double stranded inhibitory RNA molecule is designed with reference to a different cardiovascular gene target to be silenced wherein said at least first and second double stranded inhibitory RNA molecules are co-administered as simultaneous, sequential, or temporally separate effective dosages to a subject. In a preferred embodiment of the invention said first and / or said second double stranded inhibitory RNA molecule comprises modified nucleotides and / or modified sugar(s). In a preferred embodiment of the invention said modified nucleotides / sugars are selected from the group: a 3 '-terminal deoxy- thymine (dT) nucleotide, a 2'-0-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an unlocked nucleotide, a conformationally restricted nucleotide, a constrained ethyl nucleotide, an abasic nucleotide, a 2'-amino-modified nucleotide, a 2'-O-allyl-modified nucleotide, 2'-C-alkyl-modified nucleotide, 2' -hydroxyl- modified nucleotide, a 2'-methoxyethyl modified nucleotide, a 2'-0- alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, a non-natural base comprising nucleotide, a tetrahydropyran modified nucleotide, a 1,5-anhydrohexitol modified nucleotide, a cyclohexenyl modified nucleotide, a nucleotide comprising a phosphorothioate group, a nucleotide comprising phosphorodithioate (PS2), a nucleotide comprising a methylphosphonate group, a nucleotide comprising a 5’- phosphate, and a nucleotide comprising a 5 ‘-phosphate mimic, for example a 5’-vinyl phosphate, a nucleotide comprising a 2’-deoxy-2’-fluro and a 2’ methyl sugar base and glycol nucleic acid. In a preferred embodiment of the invention said first or and / or second double stranded inhibitory RNA molecule comprises at least one modified nucleotide wherein said modification is 2'-deoxy-2'-fluoro. In a preferred embodiment of the invention said first and / or said second double stranded inhibitory RNA molecule comprises at least one modified nucleotide wherein said modification is 2'-O-methyl. In a further preferred embodiment of the invention said first and / or said second double stranded inhibitory RNA molecule comprises at least one phosphorothioate linkage. In a further preferred embodiment of the invention said first and / or said second double stranded inhibitory RNA molecule comprises at least one 5'-vinyl phosphate. In an embodiment of the invention said first and / or said second double stranded inhibitory RNA molecule comprises at least one modified sugar. A sugar modification includes a modified version of the ribosyl moiety, such as -O-modified RNA such as '-O-alkyl or 2'-0-(substituted)alkyl e.g. 2'-0-methyl, T-0-(2-cyanoethyl), 2'-0-(2-methoxy)ethyl (2-MOE), 2'-0-(2-thiomethyl)ethyl, 2'-0-butyryl, -O-propargyl, 2'-O-allyl, 2'-O-(2-amino)propyl, 2'-O-(2-(dimethylamino)propyl), 2'-O-(2-amino)ethyl, 2'-O-(2-(dimethylamino)ethyl); 2'-deoxy (DNA); 2'-O-(haloalkoxy)methyl, e.g. 2'-0-(2-chloroethoxy)methyl (MCEM), -O- (2,2-dichloroethoxy)methyl (DCEM); 2'-<3-alkoxycarbonyl e.g. T-0-[2- (methoxycarbonyl)ethyl] (MOCE), 2'-O-[2-(N-methylcarbamoyl)ethyl] (MCE), T-0-[2-(N,N- dimethylcarbamoyl)ethyl] (DOME); 2'-halo e.g. 2'-F, FANA (2'-F arabinosyl nucleic acid); carbasugar and azasugar modifications; 3 '-O-alkyl e.g. 3'-0-methyl, 3 '-O-butyryl, V-0- propargyl and their derivatives. Preferably, said first and / or second double stranded inhibitory RNA molecule is modified and comprises one or more 2-0-methyl moieties. In a preferred embodiment of the invention said double stranded inhibitory RNA molecule is modified and comprises one or more 2'-deoxy-2'-fluoro moieties. Preferably, said sense nucleotide sequence comprises substantially 2'-0-methyl moieties. Preferably, said antisense nucleotide sequence comprises substantially 2'-deoxy-2'-fluoro moieties. In a preferred embodiment of the invention said sense nucleotide sequence is modified wherein said modification pattern comprises the following: mmmmmmfffmmmmmmmmmm wherein m - 2'-O-methyl and f - 2'-deoxy-2'-fluoro. In a preferred embodiment of the invention said antisense nucleotide sequence is modified wherein said modification patter comprises the following: mfmfmfmfmfmfmfmfmfm + mUrnll wherein m - 2'-O-methyl and f - 2'-deoxy-2'-fluoro. In a preferred embodiment of the invention said cardiovascular gene to be silenced is apolipoprotein B (ApoB). In a preferred embodiment of the invention said Apo B gene comprises a nucleotide sequence set forth in SEQ ID NO: 12341 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length. In a preferred embodiment of the invention said Apo B double stranded inhibitory RNA comprise or consists of a sense nucleotide sequence selected from the group: SEQ ID NO: 12947-13246. In a preferred embodiment of the invention said Apo B double stranded inhibitory RNA comprise or consists of an antisense nucleotide sequence selected from the group: SEQ ID NO: 13247-13546. In a preferred embodiment of the invention said ApoB double stranded inhibitory RNA comprises a sense nucleotide sequence set forth in SEQ IDs presented in Table 18 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length. In a preferred embodiment of the invention said APOB double stranded inhibitory RNA comprises an antisense nucleotide sequence set forth in SEQ IDs presented in Table 18 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length. In a preferred embodiment of the invention said ApoB double stranded inhibitory RNA comprises a sense nucleotide sequence set forth in SEQ IDs presented in Table 19 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length. In a preferred embodiment of the invention said APOB double stranded inhibitory RNA comprises an antisense nucleotide sequence set forth in SEQ IDs presented in Table 19 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length. In a preferred embodiment of the invention said cardiovascular gene to be silenced is DGAT2. In a preferred embodiment of the invention said DGAT2 gene comprises a nucleotide sequence set forth in SEQ ID NO: 12346 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length. In a preferred embodiment of the invention said double stranded DGAT2 inhibitory RNA comprise or consists of a sense nucleotide sequence selected from the group: SEQ ID NO: 12348-12646, 17169 and 17171 to 17179. In a preferred embodiment of the invention said double stranded DGAT2 inhibitory RNA comprise or consists of an antisense nucleotide sequence selected from the group: SEQ ID NO: 12647-12946, 17170 and 17180 to 17188. In a preferred embodiment of the invention said DGAT2 double stranded inhibitory RNA comprises a sense nucleotide sequence set forth in SEQ IDs presented in Table 16 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length. In a preferred embodiment of the invention said DGAT2 double stranded inhibitory RNA comprises an antisense nucleotide sequence set forth in SEQ IDs presented in Table 16 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length. In a preferred embodiment of the invention said DGAT2 double stranded inhibitory RNA comprises a sense nucleotide sequence set forth in SEQ IDs presented in Table 17 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length. In a preferred embodiment of the invention said DGAT2 double stranded inhibitory RNA comprises an antisense nucleotide sequence set forth in SEQ IDs presented in Table 17 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length. In an alternative preferred embodiment of the invention said cardiovascular gene to be silenced is ANGPLT3. In a preferred embodiment of the invention said ANGPTL3 gene comprises a nucleotide sequence set forth in SEQ ID NO: 17159 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length. In a preferred embodiment of the invention said double stranded ANGPTL 3 inhibitory RNA comprise or consists of a sense nucleotide sequence selected from the group: SEQ ID NO: 15955-16254, 17165 and 17167. In a preferred embodiment of the invention said double stranded ANGPTL 3 inhibitory RNA comprise or consists of an antisense nucleotide sequence selected from the group: SEQ ID NO: 16255-16554, 17167 and 17168. In an alternative preferred embodiment of the invention said cardiovascular gene to be silenced is ANGPLT4. In a preferred embodiment of the invention said ANGPTL4 gene comprises a nucleotide sequence set forth in SEQ ID NO: 17160 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length. In a preferred embodiment of the invention said ANGPTL4 double stranded inhibitory RNA comprise or consists of a sense nucleotide sequence selected from the group: SEQ ID NO: 16555-16854. In a preferred embodiment of the invention said ANGPTL4 double stranded inhibitory RNA comprise or consists of an antisense nucleotide sequence selected from the group: SEQ ID NO: 16855-17154. In an alternative preferred embodiment of the invention said cardiovascular gene to be silenced is PCSK9. In a preferred embodiment of the invention said PCSK9 gene comprises a nucleotide sequence set forth in SEQ ID NO: 12342 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length. In a preferred embodiment of the invention said double stranded PCSK9 inhibitory RNA comprise or consists of a sense nucleotide sequence selected from the group: SEQ ID NO: 13547-13850 and SEQ ID NO 17161. In a preferred embodiment of the invention said double stranded PCSK9 inhibitory RNA comprise or consists of an antisense nucleotide sequence selected from the group: SEQ ID NO: 13851-14154 and 17162. In an alternative preferred embodiment of the invention said cardiovascular gene to be silenced is lipoprotein A (LP(a)). In a preferred embodiment of the invention said lipoprotein A gene comprises a nucleotide sequence set forth in SEQ ID NO: 12343 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length. In a preferred embodiment of the invention said lipoprotein A double stranded inhibitory RNA comprise or consists of a sense nucleotide sequence selected from the group: SEQ ID NO: 14155-14454 and 17163. In a preferred embodiment of the invention said lipoprotein A double stranded inhibitory RNA comprise or consists of an antisense nucleotide sequence selected from the group: SEQ ID NO: 14455-14754 and 17164. In an alternative preferred embodiment of the invention said cardiovascular gene to be silenced is APOCIII. In a preferred embodiment of the invention said Apo Cl 11 gene comprises a nucleotide sequence set forth in SEQ ID NO: 12345 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length. In a preferred embodiment of the invention said double stranded ApoCIII inhibitory RNA comprise or consists of a sense nucleotide sequence selected from the group: SEQ ID NO: 15355-15654 and 17200. In a preferred embodiment of the invention said double stranded ApoCIII inhibitory RNA comprise or consists of an antisense nucleotide sequence selected from the group: SEQ ID NO: 15655-15954 and 17199. In an alternative preferred embodiment of the invention said cardiovascular gene to be silenced is angiotensinogen. In a preferred embodiment of the invention said angiotensinogen gene comprises a nucleotide sequence set forth in SEQ ID NO: 12344 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length. In a preferred embodiment of the invention said double stranded angiotensinogen inhibitory RNA comprise or consists of a sense nucleotide sequence selected from the group: SEQ ID NO: 14755-15054. In a preferred embodiment of the invention said double stranded angiotensinogen inhibitory RNA comprise or consists of an antisense nucleotide sequence selected from the group: SEQ ID NO: 15055-15354. In a preferred embodiment of the invention said nucleic acid molecule is covalently linked to / V-acetylgalactosamine. In a preferred embodiment of the invention said first and second double stranded inhibitory RNAs are admixed in a single pharmaceutical composition adapted for administration in said treatment regimen. In an alternative embodiment of the invention said first and second double stranded inhibitory RNA are separate compositions adapted for administration in said treatment regimen. In a preferred embodiment of the invention said regimen is the treatment or prevention of diseases associated with hypercholesterolemia. In a preferred embodiment of the invention said disease associated with hypercholesterolemia is selected from the group consisting of: stroke prevention, hyperlipidaemia, cardiovascular disease, atherosclerosis, coronary heart disease, aortic stenosis, cerebrovascular disease, peripheral arterial disease, hypertension, metabolic syndrome, type II diabetes, non-alcoholic fatty acid liver disease, non-alcoholic steatohepatitis, Buerger’s disease, renal artery stenosis, hyper-apobetalipoproteinemia, cerebrovascular atherosclerosis, cerebrovascular disease and venous thrombosis. When administered the compositions of the present invention are administered in pharmaceutically acceptable preparations. Such preparations may routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible carriers and optionally other therapeutic agents, such as cholesterol lowering agents, which can be administered separately from the nucleic acid molecule according to the invention or in a combined preparation if a combination is compatible. The combination of a nucleic acid according to the invention and the other, different therapeutic agent is administered as simultaneous, sequential, or temporally separate dosages. The therapeutics of the invention can be administered by any conventional route, including injection or by gradual infusion over time. The administration may, for example, be oral, intravenous, intraperitoneal, intramuscular, intracavity, subcutaneous, transdermal or transepithelial. The compositions of the invention are administered in effective amounts. An “effective amount” is that amount of a composition that alone, or together with further doses, produces the desired response. In the case of treating a disease, such as cardiovascular disease, the desired response is inhibiting or reversing the progression of the disease. This may involve only slowing the progression of the disease temporarily, although more preferably, it involves halting the progression of the disease permanently. This can be monitored by routine methods. Such amounts will depend, of course, on the particular condition being treated, the severity of the condition, the individual patient parameters including age, physical condition, size and weight, the duration of the treatment, the nature of concurrent therapy (if any), the specific route of administration and like factors within the knowledge and expertise of the health practitioner. These factors are well known to those of ordinary skill in the art and can be addressed with no more than routine experimentation. It is generally preferred that a maximum dose of the individual components or combinations thereof be used, that is, the highest safe dose according to sound medical judgment. It will be understood by those of ordinary skill in the art, however, that a patient may insist upon a lower dose or tolerable dose for medical reasons, psychological reasons or for virtually any other reasons. The pharmaceutical compositions used in the foregoing methods preferably are sterile and contain an effective amount of a nucleic acid molecule according to the invention for producing the desired response in a unit of weight or volume suitable for administration to a patient. The response can, for example, be measured by determining regression of cardiovascular disease and decrease of disease symptoms etc. The doses of the nucleic acid molecule according to the invention administered to a subject can be chosen in accordance with different parameters, in particular in accordance with the mode of administration used and the state of the subject. Other factors include the desired period of treatment. If a response in a subject is insufficient at the initial doses applied, higher doses (or effectively higher doses by a different, more localized delivery route) may be employed to the extent that patient tolerance permits. It will be apparent that the method of detection of the nucleic acid according to the invention facilitates the determination of an appropriate dosage for a subject in need of treatment. In general, for example, doses of the nucleic acid molecules herein generally will be formulated and administered according to standard procedures. Other protocols for the administration of compositions will be known to one of ordinary skill in the art, in which the dose amount, schedule of injections, sites of injections, mode of administration and the like vary from the foregoing. The administration of compositions to mammals other than humans, (e.g., for testing purposes or veterinary therapeutic purposes), is carried out under substantially the same conditions as described above. A subject, as used herein, is a mammal, preferably a human, and including a nonhuman primate, cow, horse, pig, sheep, goat, dog, cat or rodent. When administered, the pharmaceutical preparations of the invention are applied in pharmaceutically acceptable amounts and in pharmaceutically acceptable compositions. The term “pharmaceutically acceptable” means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredients. Such preparations may routinely contain salts, buffering agents, preservatives, compatible carriers, and optionally other therapeutic agents e.g. statins. When used in medicine, the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically acceptable salts thereof and are not excluded from the scope of the invention. Such pharmacologically and pharmaceutically acceptable salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulfuric, nitric, phosphoric, maleic, acetic, salicylic, citric, formic, malonic, succinic, and the like. Also, pharmaceutically acceptable salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts. Compositions may be combined, if desired, with a pharmaceutically acceptable carrier. The term “pharmaceutically acceptable carrier” as used herein means one or more compatible solid or liquid fillers, diluents or encapsulating substances which are suitable for administration into a human. The term “pharmaceutically acceptable carrier” in this context denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate, for example, solubility and / or stability. The components of the pharmaceutical compositions also are capable of being co-mingled with the molecules of the present invention, and with each other, in a manner such that there is no interaction which would substantially impair the desired pharmaceutical efficacy. The pharmaceutical compositions may contain suitable buffering agents, including acetic acid in a salt; citric acid in a salt; boric acid in a salt; and phosphoric acid in a salt. The pharmaceutical compositions also may contain, optionally, suitable preservatives. The pharmaceutical compositions may conveniently be presented in unit dosage form and may be prepared by any of the methods well-known in the art of pharmacy. All methods include the step of bringing the active agent into association with a carrier which constitutes one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing the active compound into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product. Compositions suitable for parenteral administration conveniently comprise a sterile aqueous or non-aqueous preparation of nucleic acid, which is preferably isotonic with the blood of the recipient. This preparation may be formulated according to known methods using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation also may be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent, for example, as a solution in 1, 3-butane diol. Among the acceptable solvents that may be employed are water, Ringer’s solution, and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose, any bland fixed oil may be employed including synthetic mono-or di-glycerides. In addition, fatty acids such as oleic acid may be used in the preparation of injectables. Carrier formulation suitable for oral, subcutaneous, intravenous, intramuscular, etc. administrations can be found in Remington’s Pharmaceutical Sciences, Mack Publishing Co., Easton, PA. According to a further aspect of the invention there is provided a method to treat a subject that has or is predisposed to hypercholesterolemia comprising administering an effective dose of a nucleic acid or a pharmaceutical composition according to the invention thereby treating or preventing hypercholesterolemia. In a preferred method of the invention the hypercholesterolemia is familial hypercholesterolemia. In a preferred method of the invention there is provided the treatment or prevention of diseases associated with hypercholesterolemia. In a preferred method of the invention said disease associated with hypercholesterolemia is selected from the group consisting of: stroke prevention, hyperlipidaemia, cardiovascular disease, atherosclerosis, coronary heart disease, aortic stenosis, cerebrovascular disease, peripheral arterial disease, hypertension, metabolic syndrome, type II diabetes, non-alcoholic fatty acid liver disease, non-alcoholic steatohepatitis, Buerger’s disease, renal artery stenosis, hyper-apobetalipoproteinemia, cerebrovascular atherosclerosis, cerebrovascular disease and venous thrombosis. Throughout the description and claims of this specification, the words “comprise” and “contain” and variations of the words, for example “comprising” and “comprises”, means “including but not limited to”, and is not intended to (and does not) exclude other moieties, additives, components, integers or steps. “Consisting essentially” means having the essential integers but including integers which do not materially affect the function of the essential integers. Throughout the description and claims of this specification, the singular encompasses the plural unless the context otherwise requires. In particular, where the indefinite article is used, the specification is to be understood as contemplating plurality as well as singularity, unless the context requires otherwise. Features, integers, characteristics, compounds, chemical moieties or groups described in conjunction with a particular aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein unless incompatible therewith. An embodiment of the invention will now be described by example only and with reference to the following materials, methods, figure, and examples: Figure 1. TBE (Tris-borate-EDTA) Polyacrylamide gel (20%) of bi-specific siRNA with various Crook variants (CVO, CV1, CV2, CV3, CV4, CV5, CV6, CV9, CV10) preincubated (+) or not pre-incubated (-) in 80 % Human Serum (HS) for 2 h at 37°C. Mono-specific siRNAs (ApoB_Cr, DGAT2_Acr) were included for reference, and HS only control (no siRNA) also included. Ultra Low Range DNA Ladder used as a size marker; Figure 2 A-E (SEQ ID NOs: 17238-17247, 17253-17254, 18434, 18529) are embodiments of APOB / DGAT2 double stranded inhibitory RNAs linked via a DNA linker molecule; and Figure 3 (SEQ ID NOs: 18503-18508) are embodiments of DNA linkers according to the invention. MATERIALS &METHODS Preparation of the siRNA Crook variants for the PAGE Duplex siRNA, and bispecific siRNA (Table 1) and its DNA fragment variants (Table 2) were synthesized by CatSci (Cardiff, UK). For serum stability assay, stock siRNAs were incubated in vehicle (nuclease-free water) or in 80 % of human serum (HS) for 2 hours at 37°C. The pre-incubated or freshly prepared siRNAs (100 ng / well) were then mixed with 5 x loading buffer (50 % 10 x TBE, 50 % glycerol) and loaded into 20 % TBE (Tris / Borate / EDTA) Polyacrylamide gel. Serum samples also contained 0.1 % SDS. GeneRuler Ultra Low Range DNA Ladder (Thermo Scientific, SM1211) was used for reference. The PAGE was run for 120 min at 120 V. After the electrophoresis, gel was removed from the cassette and stained with Sybr-Safe (Invitrogen, S33102) in 1 x TBE buffer for 10 min on a gentle shaker and protected from light. The bands on the gel were visualised with SafeVIEW MINI2 LED Transilluminator (Fisherbrand). Table 1 siRNA ID Sense (5’ - 3’) Antisense (3’ - 5’) PAR_ApoB_Cr CGAAGCGCCCTACTCCAC TfC*mC*fUmGfGmAfCmAfUf UfCmAfGmAfAmCfAmAfGm AfA / Gal3C2 / (SEQ ID NO 17223) mU*mG*mGfGmAfCmCfU mGfUmAmAmGfUmCfUm UfGmUfUmC*fU* / VPU / (SEQ ID NO 17231) DGAT2_Acr AGTGGAGTAGGGCGCTTC GfG*mU*fCmAfUmGfGmGfU mGfUmCfUmGfUmGfGmGfU *mU*fA / Gal3C2 / (SEQ ID NO 17232) mC*fA*mGfUmAfCmCfCm AfCmAfGmAfCmAfCmCfC mA*fA*mU (SEQ ID NO 17233) PAR_ApoB _Cr-DGAT2_Acr PAR_ApoB_ Or DGAT2_Acr CGAAGCGCCCTACTCCAC TfC*mC*fUmGfGmAfCmAfUf UfCmAfGmAfAmCfAmAfGm AfA / Gal3C2 / 1 (SEQ ID NO 17223) mU*mG*mGfGmAfCmCfU mGfUmAmAmGfUmCfUm UfGmUfUmC*fU* / VPU / (SEQ ID NO: 17231) AGTGGAGTAGGGCGCTTC GfG*mU*fCmAfUmGfGmGfU mGfUmCfUmGfUmGfGmGfU *mU*fA / Gal3C2 / 1 (SEQ ID NO 17232) mC*fA*mGfUmAfCmCfCm AfCmAfGmAfCmAfCmCfC mA*fA*mU (SEQ ID NO: 17233) 1AGTGGAG" complementa * = internucle / VPU / - 5’-V / Gal3C2 / - N- fA, fU, fC, fG mA, mil, mC A, T, C, G = rAGGGCGCTTCG (SEQ ID NO: 17156) (19 nt DNA fragment hybridised with ry DNA at the 5' end of ApoB and DGAT2) otide linkage phosphorothioate (PS) nyl phosphonate 2’-OMe U acetylgalactosamine = 2’-deoxy-2’-fluro mG = 2’ OMe ribonucleotides DNA bases Table 2 Sequences of the DNA fragments tested, 5’ to 3’ orientation, with 3’ end attached to the 5’ of the PAR_ApoB_Cr sense strand. Sequence ID SEQ ID NOs: Sequence of the 19 nt DNA fragment on PAR ApoB Cr Sense strand CVO 17155 CGAAGCGCCCTACTCCACT CV1 18510 CGAAGCGCCCTACT CV2 18511 CGAAGCGCCCTACTCCACTCCATC CV3 18512 CGAAGGCCCCTACTCCACT CV4 18513 CGAAGCGCA CG TCAATTCA CV5 18514 AGAAGAACATGTAAATTCA CV6 CGAAGCGCC CV9 17155 CGAAGCGCCCTACTCCACT CV10 17155 CGAAGCGCCCTACTCCACT Example 1 PAGE Analysis of Linker Stability The stability of DNA linkers (Table 2) connecting bispecific ApoB-DGAT2 siRNAs (Table 1) was investigated by polyacrylamide gel electrophoresis (PAGE) following exposure to (+) or absence of (-) human serum (Figure 1). DNA linker (CVO) showed excellent stability, with ApoB-DGAT2 bispecific remaining intact in the gel. In contrast linker CV1 showed the least stability, with the bispecific separating into single siRNAs. DNA linkers CV2, CV3, CV4, CV5, CV6, CV9 and CV10 showed varying degrees of stability, with both bispecific and single siRNAs evident in the gel. Example 2 Target mRNA Knock-down of ApoB-DGAT2 bispecific siRNA in primary mouse hepatocytes As shown in Table 3, ApoB-DGAT2 (CS15 and CS16) bispecific siRNAs showed ApoB KD levels of 64% and 60% respectively at 25 nM and KD levels of 49% and 50% respectively at 4 nM by receptor-mediated uptake in primary mouse hepatocytes. When cells were treated with single siRNA counterpart, CS13, ApoB KD was 72% and 53% respectively at 25nM and 4nM. For DGAT2 target KD, bispecific siRNAs showed KD levels of 76% and 65% at 25nM and 55% and 57% at 4nM. In comparison, single siRNA CS8 led to 76% DGAT2 KD at 25nM and 48% at 4nM. These results demonstrate that ApoB-DGAT2 bispecific siRNAs perform as well as single ApoB or DGAT2 siRNAs of the same sequence, in receptor-mediated assays, leading to highly effective silencing of two targets in the same cell. A full description of siRNA structures used can be found in Table 4. Table 3. Target mRNA Knock-down (%) in primary mouse hepatocytes by bispecific siRNAs or single siRNA controls, with or without preincubation in 80 % human serum for 2 h at 37°C. siRNA ID Target gene mRNA KD levels (%) Freshly prepared Pre-incubated in 80% HS 25n M 4nM 1nM 0.1 nM 25n M 4nM 1nM 0.1nM CS13 PAR _Apo B Cr ApoB 72 53 37 9 71 60 38 6 CS8 DGA DGAT2 76 48 25 0 80 67 47 17 T2_A cr CS15 PAR _Apo B_Cr DGA T2_A cr ApoB 64 49 37 10 71 52 31 6 DGAT2 76 55 43 6 75 64 48 22 CS16 PAR _Apo B_Ac r-DGA T2_C r ApoB 60 50 26 3 69 49 31 18 DGAT2 65 57 32 1 73 58 39 0 PAR _Apo B ApoB 69 61 45 20 66 64 49 2 mTT R mTTR 93 91 89 74 94 95 95 77 Example 3 Stability of ApoB-DGAT2 bispecific siRNA in human serum To test stability in human serum, siRNA constructs were preincubated in 80% human serum (HS) for 2 hours at 37C and receptor-mediated uptake assays subsequently performed in primary mouse hepatocytes. Knockdown of target genes was measured after 48hrs by RT-qPCR. As shown in Table 3, ApoB-DGAT2 bispecific siRNAs, CS15 and CS16, showed equivalent levels of target KD when compared to single siRNAs of the same sequence, CS13 and CS8. After pre-incubation in 80% human serum, ApoB KD was 71% and 69% respectively for CS15 and CS16 bispecific siRNAs at 25nm and 52% and 49% at 4nM. This level of silencing compares favourably with that shown by single siRNA counterpart CS13; 71% and 60% KD at 25nM and 4nM, respectively. Similarly, levels of DGAT2 KD achieved by bispecific siRNAs was 75% and 73% at 25nM (64% and 58% at 4nM) versus 80% and 67% from single siRNA CS8 at 25nM and 4nM, respectively. These results demonstrate that ApoB-DGAT2 bispecific siRNAs are highly stable in 80% human serum and perform as well as single siRNAs of the same sequence in receptor-mediated uptake assays. A full description of siRNA structures used can be found in Table 4. Table 4. ApoB-DGAT2 bispecific siRNAs and single siRNA constructs siR NA ID Sense (5’ - 3’) Antisense (3’ - 5’) CS13 PAR_ApoB_ Cr CGAAGCGCCCTACTCCAC 7TC*mC*fUmGfGmAfCmAfUf UfCmAfGmAfAmCfAmAfGm AfA / Gal3C2 / (SEQ ID NO: 17223) mU*mG*mGfGmAfCmCf UmGfUmAmAmGfUmCf UmUfGmUfUmC*fU* / VP U / (SEQ ID NO: 17231) CS8 DGAT2_Acr AGTGGAGTAGGGCGCTTC GfG*mU*fCmAfUmGfGmGfU mGfUmCfUmGfUmGfGmGfU *mU*fA / Gal3C2 / (SEQ ID NO: 17232) mC*fA*mGfUmAfCmCfC m Af C m Af G m Af C m Af C m CfCmA*fA*mU (SEQ ID NO: 17233) CS15 PAR_ApoB_ Cr-DGAT2_Acr CGAAGCGCCCTACTCCAC 7TC*mC*fUmGfGmAfCmAfUf UfCmAfGmAfAmCfAmAfGm AfA / Gal3C2 / 1(SEQ ID NO: 17223) mU*mG*mGfGmAfCmCf UmGfUmAmAmGfUmCf UmUfGmUfUmC*fU* / VP U / (SEQ ID NO: 17231) AGTGGAGTAGGGCGCTTC GfG*mU*fCmAfUmGfGmGfU mGfUmCfUmGfUmGfGmGfU *mU*fA / Gal3C2 / 1 (SEQ ID NO: 17232) mC*fA*mGfUmAfCmCfC m Af C m Af G m Af C m Af C m CfCmA*fA*mU (SEQ ID NO: 17233) CS16 PAR_ApoB_ Acr-DGAT2_Cr AGTGGAGTAGGGCGCTTC GfC*mC*fUmGfGmAfCmAfUf UfCmAfGmAfAmCfAmAfGm AfA / Gal3C2 / 1 (SEQ ID NO 17222) mU*mG*mGfGmAfCmCf UmGfUmAmAmGfUmCf UmUfGmUfUmC*fU* / VP U / (SEQ ID NO: 17231) CGAAGCGCCCTACTCCAC 7TG*mU*fCmAfUmGfGmGfU mGfUmCfUmGfUmGfGmGfU *mU*fA / Gal3C2 / 1 (SEQ ID NO 17235) mC*fA*mGfUmAfCmCfC m Af C m Af G m Af C m Af C m CfCmA*fA*mU (SEQ ID NO: 17233) PAR_ApoB fC*mC*fUmGfGmAfCmAfUfU fCmAfGmAfAmCfAmAfGmAf A / Gal3C2 / (SEQ ID NO 17220) mU*mG*mGfGmAfCmCf UmGfUmAmAmGfUmCf UmUfGmUfUmC*fU* / VP U / (SEQ ID NO: 17236) Mttr fA*mA*fCmAfGmUfGmUfUfC f U m UfGmCf U mCf U mAf U mAf A / Gal3C2 / (SEQ ID NO 17205) mU*mU*mUfUmGfUmCf AmCfAmAmGmAfAmCf GmAfGmAfUmA*fU*mU (SEQ ID NO 17237) 1 AGTGGAGTAGGGCGCTTCG (SEQ ID NO: 17156) (19 nt DNA fragment hybridised with complementary DNA at the 5' end of ApoB and DGAT2) * = internucleotide linkage phosphorothioate (PS) / VPU / - 5’-Vinyl phosphonate 2’-0Me II / Gal3C2 / - N-acetylgalactosamine fA, fU, fC, fG = 2’-deoxy-2’-fluro mA, mil, mC, mG = 2’ OMe ribonucleotides A, T, C, G = DNA bases Example 4 Comparing in vivo silencing effect of bispecific siRNA (ApoB-DGAT2) to single siRNA controls. Mouse study Groups of 4 mice for each treatment group were injected subcutaneously (SC) with either vehicle (PBS), or GalNAc-conjugated ApoB-DGAT2 (CS15 or CS16) bispecific, or ApoB (CS13) or DGAT2 (CS8) single siRNA controls (Table 4). Positive siRNA controls included PAR-ApoB and mTTR (Table 4). Each compound was administered at either 5mg / kg or 10mg / kg (single siRNAs); equivalent to 10mg / kg and 20mg / kg, respectively, for heterodimer siRNAs. Following sacrifice at either day 5 or day 14, levels of liver target mRNA was measured by RT-qPCR and % knockdown (KD) measured relative to vehicle-treated controls. Table 5 shows in vivo silencing of liver target mRNAs (ApoB and DGAT2) by bispecific siRNA compounds (CS15 and CS16) compared to single ApoB or DGAT2 siRNA controls (CS13 and CS8, respectively). CS15 bispecific (20mg / kg) led to a 53% KD of both ApoB and DGAT2 mRNA at Day 5, with CS16 bispecific providing 62% and 54% KD of ApoB and DGAT2, respectively. Single siRNAs, CS13 and CS8, at the equivalent dose (10mg / kg) led to 61% and 49% KD of ApoB and DGAT2, respectively. A positive control siRNA (PAR-ApoB; Alnylam) performed similarly, leading to 63% ApoB KD at Day 5. The silencing of ApoB was reduced at Day 14 for bispecific CS15 and single siRNA CS13 (13% and 11%, respectively) which was not unexpected, given the positive control of the same sequence (PAR-ApoB; Alnylam) performed similarly (17% KD). The bispecific CS16 however, provided a KD of 34% at D14. In contrast, silencing of DGAT2 mRNA was maintained in mice receiving either bispecific (CS15 67% KD; CS16 57%) or single siRNA CS8 (51%) at Day 14. Importantly, there was a significant increase in silencing of DGAT2 by CS15 bispecific (Day 14) at both doses when compared to single DGAT2 siRNA CS8 (P=0.02 lower dose; P=0.008 higher dose). For CS16 bispecific at the lower dose, ApoB knockdown at Day14 was significantly greater when compared to single ApoB siRNA CS13 (P= 0.04). Statistical analysis performed: Two-way Anova and Tukey post-hoc tests. These results demonstrate that both ApoB and DGAT2 target KD (%) in vivo by bispecific siRNAs is equivalent or superior to single siRNA controls at both low (5mg / kg) and high dose (10mg / kg), and at both time points (day 5 and day 14). Table 5. Mouse study comparing knock-down (%KD) of liver target mRNA following SC administration of either ApoB-DGAT2 bispecific siRNA or equivalent single ApoB or DGAT2 siRNAs. siRNA ID Primer used Dose (mg / kg) % KD On day 5 % KD On day 14 CS13 PAR_ApoB_Cr ApoB 5 26 7 10 61 11 CS8 DGAT2_Acr DGAT2 5 33 31 10 49 51 CS15 PAR_ApoB_Cr-DGAT2_Acr ApoB 10 34 15 DGAT2 10 41 46 ApoB 20 53 13 DGAT2 20 53 67 CS16 PAR_ApoB_Acr-DGAT2_Cr ApoB 10 42 20 DGAT2 10 28 32 ApoB 20 62 34 DGAT2 20 54 57 PAR_ApoB ApoB 5 44 0 10 63 17 mTTR mTTR 10 91 70 Table 6 shows Comparative Efficacy (%) of ApoB-DGAT2 bispecific siRNA compared to each single siRNA (ApoB or DGAT2) on day 5 and day 14. [%KD ApoB or DGAT2 by bispecificr siRNA divided by %KD by mono siRNA (x100)]. Equivalent or superior performance is achieved by bispecific siRNAs compared to single siRNA controls. At the lower dose, for ApoB KD, bispecifics show efficacy of 134 - 164% (Day 5) and 210 - 280% (Day 14) and at higher dose; 87-102% (Day 5) and 114 - 298% (D14). For DGAT2 KD, at the lower dose, comparative efficacy is 84 - 124% (Day 5) and 102 - 147% (Day 14); whereas at higher dose, 109 - 111% (Day 5) and 112 - 131% (Day 14). Table 6 Comparative efficacy (%) of ApoB-DGAT2 bispecific siRNAs to single ApoB or DGAT2 siRNAs Bispecific Target mRNA Low dose High dose Day 5 Day 14 Day 5 Day 14 CS15 ApoB 134 210 87 114 CS16 ApoB 164 280 102 298 CS15 DGAT2 124 147 109 131 CS16 DGAT2 84 102 111 112 EXAMPLE 5 Comparing in vitro performance of ApoB-DGAT2 bispecific siRNAs joined by linker variants Primary mouse hepatocytes were plated with the indicated concentrations of APOB-DGAT2 bispecific siRNAs linked by our standard linker or one of three linker variants (Table 7). Cells were incubated with compounds to allow for GalNAc-mediated uptake for 24 hours, media was replaced and cells incubated for a further 24 hours. Cells were then 5 lysed with Cells-to-Ct lysis buffer and relative gene expression measured by TaqMan qPCR, normalising to Gapdh expression and to the average of untreated control cells. No significant differences were identified between the primary linker and linker variants (two-way ANOVA with Sidak’s multiple comparison test). 10 Table 7. In vitro knockdown performance of linker variants. Apob (relative expression ± SD) Dgat2 (relative expression ± SD) Compound 0.1 nM 1 nM 10 nM 0.1 nM 1 nM 10 nM Untreated 1.00 ± 0.05 1.00 ±0.06 Standard linker (n=3) 0.63 ±0.09 0.40 ± 0.02 0.14 ±0.01 0.64 ± 0.08 0.37 ± 0.03 0.12 + 0.02 Linker variant 1 (n=3) 0.53 ±0.10 0.36 ± 0.05 0.14 ±0.02 0.59 ± 0.02 0.31 ± 0.07 0.11 + 0.02 Linker variant 2 (n=3) 0.59 ±0.03 0.40 ± 0.07 0.15 ±0.02 0.57 ± 0.05 0.33 ± 0.03 0.11 + 0.03 Linker variant 3 (n=3) 0.65 ±0.02 0.35 ± 0.04 0.13 ±0.02 0.72 ± 0.09 0.35 ± 0.04 0.12 + 0.01 EXAMPLE 6 15 Comparing in vivo performance of ApoB-DGAT2 bispecific siRNAs joined by linker variants Healthy C57BI6 mice were injected subcutaneously with either RNase-free PBS (Vehicle) or 20 mg / kg of an APOB-DGAT2 bispecific siRNA linked by our standard linker or one of three linker variants; see Figure 3. Seven days after injection mice were sacrificed and livers collected for RNA isolation. Apob and Dgat2 relative expression was measured by TaqMan qPCR, normalised to Gapdh levels within samples and to the average of vehicle treated mice. No significant differences were identified between the primary linker and linker variants (one-way ANOVA with Dunnett’s multiple comparisons test) (Table 8). Table 8 In vivo knockdown performance of linker variants. Compound Apob (relative expression ± SD) Dgat2 (relative expression ± SD) Vehicle (n=8) 1.00 ±0.09 1.01 ± 0.13 Standard linker (n=8) 0.07 ±0.01 0.16 ±0.01 Linker variant 1 (n=4) 0.10 ±0.02 0.15 ±0.02 Linker variant 2 (n=4) 0.09 ±0.01 0.14 ±0.02 Linker variant 3 (n=4) 0.07 ±0.01 0.14 ±0.02 EXAMPLE 7 In vivo mouse study (Angptl3 -DGAT2 bispecific siRNAs) Methodology Male C57BL / 6J mice (20-25 g) were group housed in the Saretius animal unit at the University of Reading, and maintained under a 12 h light / dark cycle, at 23°C with humidity controlled according to Home Office regulations. Diet On arrival mice were given access to standard rodent chow SDS rat expanded diet (RM3-E-FG). On initiation of the study, diet was switched to LBS F3282 mouse high fat diet (HFD) (60% kcal% fat) supplied by LBS, Surrey, UK. Mice were kept on HFD for 6 weeks prior to administration of compounds and for the duration of the study. Mice were weighed prior to compound administration (Day 0) and allocated to groups of 12. Groups of 12 mice were then injected subcutaneously with either vehicle (RNase free PBS), control single siRNAs or heterodimer siRNAs (as described below). Mice were then returned to their home cages. On Day 7, 21 or 42, four mice from each treatment group of 12 mice were terminally sampled by cardiac puncture under isoflurane. Blood samples and liver tissue were collected immediately as described below. For mice culled on Day 7, mice were weighed and assessed for any signs of overt tolerability issues atT=2h and on days 1, 2, 5. For mice culled on Day 21, mice were weighed and assessed for any signs of overt tolerability issues on days 9, 14, 16, 21. For mice culled on Day 42, mice were weighed and assessed for any signs of overt tolerability issues on days 23, 26, 30, 33, 37, 42. Formulation of siRNA compounds Bispecific compounds Angptl3-Cr / DGAT2-Acr and DGAT2-Cr / Angptl3-Acr (Table 10 ) were formulated in RNase free PBS to concentrations of 0.8, 2 and 4 mg / mL to provide doses of 4, 10 and 20 mg / kg, respectively, when given subcutaneously in 5 mL / kg dosing volumes. Single siRNA control compounds Angptl3-Cr and DGAT2-Acr (Table 10) were each formulated in RNase free PBS to concentrations of 0.4, 1 and 2 mg / mL to provide doses of 2, 5 and 10 mg / kg, respectively, when given subcutaneously in 5 mL / kg dosing volumes. mTTR control siRNA was formulated in RNase free PBS to concentration of 2 mg / mL to provide a dose of 10 mg / kg when given subcutaneously in a 5 mL / kg dosing volume. NB: fresh vials of compound were used for each formulation and any remaining material frozen and stored for later measurement of compound analysis (concentration and stability). Liver processing for RT-qPCR At Day 7, 21 and 42 following siRNA compound or Vehicle injection (n=4), each treatment group was terminally sampled by cardiac puncture under isoflurane. Liver tissue was excised and snap frozen in liquid N2. Total RNA was extracted from homogenates of snap-frozen whole liver using QIAGEN RNeasy Mini Kit (74104). Duplex RT-qPCR was performed using the ThermoFisher TaqMan Fast 1-Step Master Mix with TaqMan probes forGAPDH (VIC_PL, Assay Id Mm99999915_g1), mTTR (FAM, Assay Id Mm00443267_m1), Angptl3 (FAM, Assay Id Mm00803820_m1) or DGAT2 (FAM, Assay Id Mm00499536_m1). Relative quantification (RQ) of target mRNA was determined using the AACT method, where GAPDH was used as internal control and the expression changes of the target gene were normalized to the vehicle control. Liver histology, one lobe of liver snap frozen in liquid N2 and stored at -20 °C was kept separately for possible histology; staining sections with H&E or oil red O (for detection of fat deposits). Blood assays Measuring plasma biomarkers; blood samples were taken from 4 mice from each treatment group 7, 21 and 42 days later by cardiac puncture under isoflurane. Blood (>300 pL) was placed into Eppendorf tubes on ice containing 6.5 pL EDTA (93 mg / mL). Following gentle mixing, samples were centrifuged at 10,000 rpm x 3 min and plasma (1 x 30 pL for LDL and HDL, 1 x 20 pL for ApoB, 1 x 20 pL for AST and 1 x 20 pL for triglycerides and rest of sample (ANGPTL3), collected into separate Eppendorf tubes on dry ice before storing at -20C (until measured by ELISA). Plasma LDL and HDL levels were measured using a CrystalChem mouse LDL assay kit (Cat no # 79980) and CrystalChem mouse HDL assay kit (Cat no # 79990), respectively. Verification of LDL calibration curves were ensured by use of a #79983 mouse LDL control. Plasma Triglyceride levels were measured using a Cayman 10010303 kit (Cambridge Bioscience). Plasma ApoB levels were measured using an AbCam mouse Apo B ELISA Kit (ab230932). AST was measured using an AbCam mouse AST (ab263882) ELISA kit. Plasma Angptl3 levels were measured using an R&D systems, cat. no. MANL30 ELISA kit. Data from Angptl3-DGAT2 Mouse Study Groups of 4 mice for each treatment group were injected subcutaneously (SC) with either vehicle (PBS), or GalNAc-conjugated bispecific siRNA (Angptl3-Cr / DGAT2-Acr or DGAT2-Cr / Angptl3-Acr) shown in Table 10. Single siRNA control compounds, Angptl3-Cr and DGAT2-Acr, were included in order to compare levels of target KD with those achieved by bispecific Angptl3-Cr / DGAT2-Acr (Table 9). Compound mTTR was used as a further control for the mouse study. All control compounds were administered to groups of 4 mice. Single siRNA compounds (Angptl3-Cr or DGAT2-Acr) were administered at either 2, 5, or 10mg / kg, and bispecific compounds were administered at 4, 10, or 20mg / kg (to ensure equivalent amount of each siRNA). Following sacrifice (n=4) at either day 7, 21 or 42, levels of liver target mRNA was measured by RT-qPCR and % knockdown (KD) measured relative to vehicle-treated controls. Table 9 shows in vivo silencing of two liver target mRNAs (Angptl3 and DGAT2) by bispecific siRNA compound compared to single siRNA equivalents. Bispecific compound (Angptl3-Cr / DGAT2-Acr) showed superior performance at day 7 compared to equivalent single siRNAs. At the lowest dose (4mg / kg), Angptl3-Cr / DGAT2-Acr led to 94.6% and 90.3% KD of Angptl3 and DGAT2 mRNA, respectively, compared to 88.8% and 81.7% KD achieved by Angptl3-Cr and DGAT2-Acr single siRNAs, respectively (2mg / kg). At higher doses (10 and 20mg / kg), levels of target mRNA silencing was comparable between bispecific (Angptl3-Cr / DGAT2-Acr) and equivalent single siRNAs (5 and 10mg / kg), with target KD of Angptl3 ( >95%) and that of DGAT2 (90-93%). At Day 21 and Day 42 time-points, bispecific (Angptl3-Cr / DGAT2-Acr) sustained high levels of target KD (Angptl3) across all doses (92-97%) comparable to the single equivalent siRNA (Angptl3-Cr) between 92-96% KD. Similarly, target KD of DGAT2 achieved by this heterodimer remained high at Day 21 (although slightly less than at Day7); 87% (lowest dose) and 91.5% (highest dose), while at Day 42, DGAT2 silencing was further slightly reduced to 70% KD (lowest dose) and 89% (highest). Again, these levels of target KD were comparable to the equivalent single siRNA (DGAT2-Acr) at Day 21 (85% - 91.5%) and Day 42 (71.5% - 81%), at equivalent lowest (2mg / kg) and highest dose (10mg / kg), respectively. Bispecific compound (DGAT2-Cr / Angptl3-Acr) also showed high levels of target KD (albeit not as high for DGAT2 KD at the lower dose of 4mg / kg), performing comparably to equivalent single siRNAs. At Day 7, this bispecific led to 92.6% KD (Angptl3) and 74.2% KD (DGAT2) at the lowest dose (4mg / kg); whereas at 10mg / kg and 20mg / kg there was 96% KD (Angptl3) and 92.5% - 94% KD for DGAT2, respectively. At Day 21 and Day 42, target silencing was sustained for this bispecific at all doses, achieving >93% KD for Angptl3. For DGAT2; silencing at Day 21 was sustained at 85% KD (4mg / kg), 88% KD (10mg / kg) and 94% (20mg / kg), while at Day 42 there was a slight loss of KD, displaying 78%, 90 and 92%, at respective doses. Table 9. Mouse study comparing knock-down (%KD) of liver target mRNA following SC administration of either Angptl3-DGAT2 bispecific siRNA or equivalent single Angptl3 or DGAT2 siRNAs. %KD Dose (mg / kg) Angptl3_Cr DGAT2_Acr mTTR Monospecifics Day 7 2 88.8 81.7 - 5 95.6 90.6 - 10 95.8 93.8 98.5 Day 21 2 94.3 85.2 - 5 95.6 87.8 - 10 95.9 91.5 95.3 Day 42 2 92.2 71.5 5 95.4 86.5 10 96.2 88.1 35.6 Dose (mg / kg) Angp DGA1 tl3_Cr-f2_Acr DG / Ang XT2_Cr-ptl3_Acr Angptl3 DGAT2 Angptl3 DGAT2 Target mRNA Bispecifics Day 7 4 94.6 90.3 92.6 74.2 10 96.5 92.3 95.9 92.5 20 97.2 93.2 95.6 94.0 Day 21 4 95.3 87.2 95.1 85.0 10 94.6 84.4 95.9 88.1 20 96.8 91.5 96.9 94.0 Day 42 4 92.3 69.6 93.5 77.8 10 95.9 86.2 95.9 89.6 20 96.8 88.9 96.8 92.3 Table 10 Single siRNA controls Single siRNA controls SENSE STRAND (5’-3’) ANTISENSE STRAND (5’-3’) Angptl3-Cr CGAAGCGCCCTACTCCACT*(invAb)*mGm CmUmCmAmAmCmAfUfAfUmUmUmGmAm UmCmAmGmUmA* / invAb / * / Gal3C2 / (SEQ ID NO: 17248) mU*fA*mC*fUmGfAmU fCm AfAm Af U mAf U mGf UmUfGmAfG*Mc (SEQ ID NO: 17252) DGAT2-Acr AGTGGAGTAGGGCGCTTCGmU*mG*mGm GmUmUmAfUfUfUmAfAmAmAmGmA*mA*m A / Gal3C2 / (SEQ ID NO: 17247) / VPU / *fU*mUmCmUfU mUmUmAmAmAmUm A*fA*mC*fC*mC*mA*m C*fA (SEQ ID NO: 18529) 2 Heterodimer siRNAs: ANGPTL3-DGAT2 ANGPTL3-Cr / DGAT2-Acr ANGPTL3-Cr CGAAGCGCCCTACTCCACT*(invAb)*mGm CmUmCmAmAmCmAfUfAfUmUmUmGmAm UmCmAmGmUmA* / invAb / * / Gal3C2 / (SEQ ID NO: 17248) mU*fA*mC*fUmGfAmU fCm AfAm Af U mAf U mGf UmUfGmAfG*mC (SEQ ID NO: 17252) DGAT2-Acr AGTGGAGTAGGGCGCTTCGmU*mG*mGm GmUmUmAfUfUfUmAfAmAmAmGmA*mA*m A / Gal3C2 / (SEQ ID NO: 17247) / VPU / *fU*mUmCmUfU mUmUmAmAmAmUm A*fA*mC*fC*mC*mA*m C*fA (SEQ ID NO: 18529) DGAT2-Cr / ANGPT L3-Acr DGAT2-Cr CGAAGCGCCCTACTCCACTmU*mG*mGm GmUmUmAfUfUfUmAfAmAmAmGmA*mA*m A / Gal3C2 / (SEQ ID NO: 17250) / VPU / *fU*mUmCmUfU mUmUmAmAmAmUm A*fA*mC*fC*mC*mA*m C*fA (SEQ ID NO: 18529) ANGPTL3-Acr AGTGGAGTAGGGCGCTTCG*(invAb)*mGm CmUmCmAmAmCmAfUfAfUmUmUmGmAm UmCmAmGmUmA* / invAb / * / Gal3C2 / (SEQ ID NO: 17251) mU*fA*mC*fUmGfAmU fCm AfAm Af U mAf U mGf UmUfGmAfG*mC (SEQ ID NO: 17252) fA, fll, fC, fG = 2’-F ribonucleotides mA, mil, mC, mG = 2’ OMe ribonucleotides / VPU / = 5’-Vinyl phosphonate 2’-0Me U / invAb / = inverted abasic deoxyribose 5 * = internucleotide linkage phosphorothioate (PS) A, T, C, G = DNA bases Bispecific siRNAs formed by hybridising crook with complementary anticrook to form DNA linker Crook = 19nt single stranded DNA (5’-3’) CGAAGCGCCCTACTCCACT(SEQ ID NO 10 17155) Anticrook = 19nt single stranded DNA (5’-3’) AGTGGAGTAGGGCGCTTCG (SEQ ID NO 17156) 10 Table 11 SEQ ID NO Description 12341 ApoB 12342 PCSK9 12343 Lp(a) 12344 Angiotensinogen 12345 APOCIII 12346 DGAT2 12348-12646 DGAT2 sense 12647 to 12946 DGAT2 antisense 12947 to 13246 ApoB sense 13247-13546 ApoB antisense 13547-13850 PCSK9 sense 13851-14154 PCSK9 antisense 14155-14454 Lp(a) sense 14455-14754 Lp(a) antisense 14755-15054 Angiotensinogen sense 15055-15354 Angiotensinogen antisense 15355-15654 APOCIII sense 15655-15954 APOCIII antisense 15955-16254 ANGPTL3 sense 16255-16554 ANGPTL3 antisense 16555-16854 ANGPTL4 sense 16855-17154 ANGPTL4 antisense 17155 Single stranded DNA 17156 Single stranded DNA 17157 Single stranded DNA 17158 Single stranded DNA 17159 ANGPTL3 17160 ANGPTL4 17161 PCSK9 sense 17162 PCSK9 antisense 17163 Lp(a) sense 17164 Lp(a) antisense 17165 ANGPTL3 sense 17166 ANGPTL3 antisense 17167 ANGPTL3 sense 17168 ANGPTL3 antisense 17169 DGAT2 sense 17170 DGAT2 antisense 17171-17179 DGAT2 sense 17180-17188 DGAT2 antisense 17189-17190 PCSK9 sense crook and anticrook 17191-17192 Lp(a) sense crook and anticrook 17193-17194 ANGPTL3 sense crook and anticrook 17195-17196 ANGPTL3 sense crook and anticrook 17197-17198 DGAT 2 sense crook and anticrook 17199 APOCIII antisense 17200 APOCIII sense 17201-17202 APOCIII crook and anticrook Table 12 ApoB sequence screen in HepG2 cells. HepG2 cells were transfected with the indicated concentration of siRNAs, using 5 RNAiMAX lipofectamine, in triplicate. 48-hours after transfection cells were lysed and RT-qPCR performed to measure the relative expression level of APOB, normalised to GAPDH gene expression levels. Relative knockdown of APOB was calculated against cells treated with RNAiMAX and no siRNA. Ove rail ran k Sequ ence ID 0.1 nM KD (%) 1 nM KD (%) 10 nM KD (%) SEQ ID NOs: Sense (5’-3’) SEQ ID NOs: Antisense (5-3) 1 APOB 57 64 75 84 18435 CCCTCAACTTT TCTAAACT 18455 AGUUUAGAAAA GUUGAGGG 2 APOB 64 74 78 18436 GTCCCAGGTAU 18456 UUUCGAAUAUA _22 ATTCGAAA CCUGGGAC 3 APOB 23 59 72 78 18437 GUUCCAUGUC CCAUUUACA 18457 UGUAAAUGGGA CAUGGAAC 4 APOB 21 61 73 75 18438 GCACGUGGGU UCCAAAUUA 18458 UAAUUUGGAAC CCACGUGC 5 APOB 40 60 73 75 18439 CAAGGGUGUU AUUUCCAUA 18459 UAUGGAAAUAA CACCCUUG 6 APOB 53 60 69 77 18440 CUCAAGACCCA AUUUAACA 18460 UGUUAAAUUGG GUCUUGAG 8 APOB 24 63 70 74 18441 GUACUGUCCCA GGUAUAUU 18461 AAUAUACCUGG GACAGUAC 7 APOB 25 57 70 77 18442 CCAAUUUCCCU GUGGAUCU 18462 AGAUCCACAGG GAAAUUGG 9 APOB 59 56 72 76 18443 GGGUUCCAAAU UAAUAGUU 18463 AACUAUUAAUU UGGAACCC 10 APOB 32 47 69 80 18444 CAGGAAGGGC UCAAAGAAU 18464 AUUCUUUGAGC CCUUCCUG 11 APOB 5 61 69 72 18445 GGGAACUGUU GAAAGAUUU 18465 AAAUCUUUCAA CAGUUCCC 12 APOB 47 60 67 77 18446 GAAACAACCCA GUCUCAAA 18466 UUUGAGACUGG GUUGUUUC 13 APOB 11 53 69 79 18447 CCCAUGGUCU UGAGUUAAA 18467 UUUAACUCAAG ACCAUGGG 14 APOB 58 50 67 79 18448 CAAAGUUAAUU GGGAAGAA 18468 UUCUUCCCAAU UAACUUUG 16 APOB 31 58 69 72 18449 CCCUAUUCUCU GGUAACUA 18469 UAGUUACCAGA GAAUAGGG 15 APOB 15 55 69 76 18450 CAAUGAAGGGA AUUUGAAA 18470 UUUCAAAUUCC CUUCAUUG 17 APOB 1 60 68 69 18451 CCCUGAAGUU GAUGUGUUA 18471 UAACACAUCAA CUUCAGGG 18 APOB 56 52 67 78 18452 GAGGGUAGUC AUAACAGUA 18472 UACUGUUAUGA CUACCCUC 19 APOB 46 54 57 78 18453 CACUAAAUUCC CAUGGUCU 18473 AGACCAUGGGA AUUUAGUG 20 APOB 13 39 63 78 18454 GUACUGGGUU AAUGGUCAA 18474 UUGACCAUUAA CCCAGUAC Sense modification pattern - mmmmmmfffmmmmmmmmmm Antisense modification pattern - mfmfmfmfmfmfmfmfmfm + mUrnll m - 2'-O-methyl; f - 2'-fluoro; KD - knockdown 5 Table 13 ApoB sequence screen in primary NHP hepatocytes. Primary NHP (cynomolgus monkey) hepatocytes were transfected with the indicated concentration of siRNAs, using RNAiMAX lipofectamine, in triplicate. 48-hours after transfection cells were lysed and RT-qPCR performed to measure the relative expression level of APOB, 10 normalised to GAPDH gene expression levels. Relative knockdown of APOB was calculated against cells treated with RNAiMAX and no siRNA. Ov er all ra nk Seq uen ce ID 10 nM KD (%) 1 nM KD (%) 0.1 nM KD (%) SEQ ID NOs: Sense (5’-3’) SEQ ID NOs: Antisense (5-3’) 1 AP OB_ 57 98 98 95 18475 CCCUCAACUUUUC UAAACU 18489 AGUUUAGA AAAGUUGA GGG 2 AP OB_ 47 97 98 96 18476 GAAACAACCCAGU CUCAAA 18490 UUUGAGAC UGGGUUGU UUC 3 AP OB_ 53 97 97 94 18477 CUCAAGACCCAAU UUAACA 18491 UGUUAAAU UGGGUCUU GAG 4 AP OB_ 25 97 96 86 18478 CCAAUUUCCCUGU GGAUCU 18492 AGAUCCAC AGGGAAAU UGG 5 AP OB_ 59 96 97 91 18479 GGGUUCCAAAUUA AUAGUU 18493 AACUAUUA AUUUGGAA CCC 6 AP OB_ 21 96 96 91 18480 GCACGUGGGUUC CAAAUUA 18494 UAAUUUGG AACCCACG UGC 7 AP OB_ 11 96 95 84 18481 CCCAUGGUCUUGA GUUAAA 18495 UUUAACUC AAGACCAU GGG 8 AP OB_ 23 95 94 92 18482 GUUCCAUGUCCCA UUUACA 18496 UGUAAAUG GGACAUGG AAC 9 AP OB_ 58 97 95 74 18483 CAAAGUUAAUUGG GAAGAA 18497 UUCUUCCC AAUUAACU UUG 10 AP OB_ 32 94 95 89 18484 CAGGAAGGGCUCA AAGAAU 18498 AUUCUUUG AGCCCUUC CUG 11 AP OB_ 24 93 91 78 18485 GUACUGUCCCAGG UAUAUU 18499 AAUAUACC UGGGACAG UAC 12 AP OB_ 22 94 88 75 18486 GUCCCAGGUAUAU UCGAAA 18500 UUUCGAAU AUACCUGG GAC 13 AP OB_ 40 41 28 10 18487 CAAGGGUGUUAUU UCCAUA 18501 UAUGGAAA UAACACCC UUG 14 AP OB_ 5 12 4 -7 18488 GGGAACUGUUGAA AGAUUU 18502 AAAUCUUU CAACAGUU CCC Sense modification pattern - mmmmmmfffmmmmmmmmmm Antisense modification pattern - mfmfmfmfmfmfmfmfmfmfm + mUrnll m - 2'-O-methyl; f - 2'-fluoro; KD - knockdown Table 14 ApoB-DGAT2 Bispecific siRNAs and single siRNA constructs Sequence ID Sequence (5’-3’) Crook-ApoB_25 Sense CGAAGCGCCCTACTCCACTmC*mC*mAmAmUmUfUfCfC mCmUmGmUmGmGmAmU*mC*mU / Gal3C2 / (SEQ ID NO: 17238) Crook2-ApoB_25 Sense CGAAGCGTAGCCGGGGGAAmC*mC*mAmAmUmUfUfCfC mCmUmGmUmGmGmAmU*mC*mU / Gal3C2 / (SEQ ID NO: 17240) Crook3-ApoB_25 Sense CGAAGCGTGACGGGGTCGAmC*mC*mAmAmUmUfUfCfC mCmUmGmUmGmGmAmU*mC*mU / Gal3C2 / (SEQ ID NO: 17242) Crook4-ApoB_25 Sense CGAAGCGTGACCGGGTCGAmC*mC*mAmAmUmUfUfCfC mCmUmGmUmGmGmAmU*mC*mU / Gal3C2 / (SEQ ID NO: 17244) ApoB_25 Antisense mA*fG*mAfUmCfCmAfCmAfG mGfG mAfAmAfUmUfG mG*m U*mU (SEQ ID NO: 17253) Anticrook-DGAT2_09 Sense AGTGGAGTAGGGCGCTTCGmG*mU*mCmAmUmGmGmG fUfGfUmCmUmGmUmGmGmGmU*mU*mA / Gal3C2 / (SEQ ID NO: 17239) Anticrook2-DGAT2_09 Sense TTCCCCCGGCTACGCTTCGmG*mU*mCmAmUmGmGmGf UfGfUmCmUmGmUmGmGmGmU*mU*mA / Gal3C2 / (SEQ ID NO: 17241) Anticrook3-DGAT2_09 Sense TCGACCCCGTCACGCTTCGmG*mU*mCmAmUmGmGmGf UfGfUmCmUmGmUmGmGmGmU*mU*mA / Gal3C2 / (SEQ ID NO: 17243) Anticrook4-DGAT2_09 Sense TCGACCCGGTCACGCTTCGmG*mU*mCmAmUmGmGmG fUfGfUmCmUmGmUmGmGmGmU*mU*mA / Gal3C2 / (SEQ ID NO: 17245) DGAT2_09 Antisense mU*fA*mAfCmCfCmAfCmAfGmAfCmAfCmCfCmAfUmG*fA* mC (SEQ ID NO: 17254) Crook-ApoB_25 Mono Crook-ApoB_25 Sense + ApoB_25 Antisense Crook2-ApoB_25 Mono Crook2-ApoB_25 Sense + ApoB_25 Antisense Crook3-ApoB_25 Mono Crook3-ApoB_25 Sense + ApoB_25 Antisense Crook4-ApoB_25 Mono Crook4-ApoB_25 Sense + ApoB_25 Antisense Anticrook-DGAT2_09 Mono Anticrook-DGAT2_09 Sense + DGAT2_09 Antisense Anticrook2-DGAT2_09 Mono Anticrook2-DGAT2_09 Sense + DGAT2_09 Antisense Anticrook3-DGAT2_09 Mono Anticrook3-DGAT2_09 Sense + DGAT2_09 Antisense Anticrook4-DGAT2_09 Mono Anticrook4-DGAT2_09 Sense + DGAT2_09 Antisense Bispecific 1 Crook-ApoB_25 Mono + Anticrook-DGAT2_09 Mono Bispecific 2 Crook2- ApoB_25 Mono + Anticrook2-DGAT2_09 Mono Bispecific 3 Crook3- ApoB_25 Mono + Anticrook3-DGAT2_09 Mono Bispecific 4 Crook4- ApoB_25 Mono + Anticrook4-DGAT2_09 Mono fA, fll, fC, fG = 2’-F ribonucleotides mA, mil, mC, mG = 2’ OMe ribonucleotides A, T, C, G = DNA bases * = internucleotide linkage phosphorothioate (PS) / Gal3C2 / = GalNAc Bispecific siRNAs formed by hybridising crook with complementary anticrook to form DNA linker Table 15 Control ApoB-DGAT2 Bispecific siRNAs and single siRNA constructs Sequence ID Sequence (5’-3’) Crook-PAR_APOB Sense CGAAGCGCCCTACTCCACTmC*mC*mUmGmGmAmC mAfUfUfCmAmGmAmAmCmAmAmG*mA*mA / Gal3C2 / (SEQ ID NO: 17246) PAR_APOB Antisense A / PU / *fU*mCfUmUfGmUfUmCfUmGfAmAfUmGfUmCfC mAfGmG*mG*mU (SEQ ID NO: 17255) Anticrook-DGAT2_1473 Sense AGTGGAGTAGGGCGCTTCGmU*mG*mGmGmUmUm AfUfUfUmAfAmAmAmGmA*mA*mA / Gal3C2 / (SEQ ID NO: 17247) DGAT2_1473 Antisense A / PU / *fU*mUmCmUfUmUmUmAmAmAmUmA*fA*mC*f C*mC*mA*mC*fA (SEQ ID NO: 18529) Crook-PAR_APOB Mono Crook-PAR_APOB Sense + PAR_APOB Antisense Anticrook-DGAT2_1473 Mono Anticrook-DGAT2_1473 Sense + DGAT2_1473 Antisense Bispecific 5 Crook-PAR_APOB Mono + Anticrook-DGAT2_1473 Mono fA, fll, fC, fG = 2’-F ribonucleotides mA, mil, mC, mG = 2’ OMe ribonucleotides A, T, C, G = DNA bases / VPU / = 5’-Vinyl phosphonate 2’-OMe U * = internucleotide linkage phosphorothioate (PS) / Gal3C2 / = GalNAc Bispecific siRNAs formed by hybridising crook with complementary anticrook to form DNA linker Table 16: selected DGAT2 sense and antisense nucleotide sequences ID SEQ ID NOs: Sense DGAT2 SEQ ID NOs: Antisense DGAT2 DGAT- 1473 18521 UGGGUUAUUUAAAAGAAA 18522 UUUCUUUUAAAUAACCCA DGAT21 12347 CUGUAAAUUUGGAAGUGUC 12647 GACACUUCCAAAUUUACAG DGAT22 12348 CCAUGAGCUAGGUGGAGUA 12648 UACUCCACCUAGCUCAUGG DGAT23 12349 C GAG CAGGAACUAUAUCUU 12649 AAGAUAUAGUUCCUGGUGG DGAT24 12350 UCCAGAAAUACAUUGGUUU 12650 AAACCAAUGUAUUUCUGGA DGAT25 12351 CCGCAAGGGCUUUGUGAAA 12651 UUUCACAAAGCCCUUGCGG DGAT26 12352 GCAAGAAGUUC C CAGGCAU 12652 AUGCCUGGGAACUUCUUGC DGAT27 12353 CAUGGGUGUCUGUGGGUUA 12653 UAAC C CACAGACAC C CAU G DGAT28 12354 UCUGUAAAUUUGGAAGUGU 12654 ACACUUCCAAAUUUACAGA DGAT29 12355 UUGGAGAGAAUGAAGUGUA 12655 UACACUUCAUUCUCUCCAA DGAT210 12356 CCAGUUAGAUGAUUCACUU 12656 AAGUGAAUCAUCUAACUGG DGAT211 12357 CGAUGGGUCCAGAAGAAGU 12657 ACUUCUUCUGGACCCAUCG DGAT212 12358 GCAGCAGAUUAGUUCCAAA 12658 UUUGGAACUAAUCUGCUGC DGAT213 12359 GUCUGUGGGUUAUUUAAAA 12659 UUUUAAAUAAC C CACAGAC DGAT214 12360 UCACUUGGCUGGUGUUUGA 12660 UCAAACACCAGCCAAGUGA DGAT215 12361 CCUUUGGAGAGAAUGAAGU 12661 ACUUCAUUCUCUCCAAAGG DGAT216 12362 CCAUCCUCAUGUACAUAUU 12662 AAUAUGUACAUGAGGAUGG DGAT217 12363 GCAAGGGCUUUGUGAAACU 12663 AGUUUCACAAAGCCCUUGC DGAT218 12364 GCGAAAGCCACUUCUCAUA 12664 UAUGAGAAGUGGCUUUCGC DGAT219 12365 CAAGAAGUUC C CAGGCAUA 12665 UAUGCCUGGGAACUUCUUG DGAT220 12366 UGUACAAGCAGGUGAUCUU 12666 AAGAUCACCUGCUUGUACA DGAT221 12367 UGUUCUAGGUGGUGGCUAA 12667 UUAGC CAC CAC CUAGAACA DGAT222 12368 UGGACCAGUUAGAUGAUUC 12668 GAAUCAUCUAACUGGUCCA DGAT223 12369 CUGAC GAG CAGGAACUAUA 12669 UAUAGUUCCUGGUGGUCAG DGAT224 12370 GCUCUGUAAAUUUGGAAGU 12670 ACUUCCAAAUUUACAGAGC DGAT225 12371 GAUGGGUCCAGAAGAAGUU 12671 AACUUCUUCUGGACCCAUC DGAT226 12372 UGGAGAGAAUGAAGUGUAC 12672 GUACACUUCAUUCUCUCCA DGAT227 12373 GCACCAUGUCAGACUUUUG 12673 CAAAAGUCUGACAUGGUGC DGAT228 12374 GCGCUACUUUCGAGACUAC 12674 GUAGUCUCGAAAGUAGCGC DGAT229 12375 CCAUUAGUGACUUGGACCA 12675 UGGUCCAAGUCACUAAUGG DGAT230 12376 GUCUAGUCCUGAAACUGCA 12676 UGCAGUUUCAGGACUAGAC DGAT231 12377 CUGUGGGUUAUUUAAAAGA 12677 U CUUUUAAAUAAC C CACAG DGAT232 12378 CUUGGGUGGCUGAUGACAU 12678 AUGUCAUCAGCCACCCAAG DGAT233 12379 UGCCUGUGUUGAGGGAGUA 12679 UACUCCCUCAACACAGGCA DGAT234 12380 UGUCUGUGGGUUAUUUAAA 12680 UUUAAAUAAC C CACAGACA DGAT235 12381 UUCCAGAAAUACAUUGGUU 12681 AACCAAUGUAUUUCUGGAA DGAT236 12382 UGAGCUAGGUGGAGUAACU 12682 AGUUACUCCACCUAGCUCA DGAT237 12383 UACAUAUUCUGCACUGAUU 12683 AAUCAGUGCAGAAUAUGUA DGAT238 12384 GAAGUGAGCAAGAAGUUCC 12684 GGAACUUCUUGCUCACUUC DGAT239 12385 GGUGUCUGUGGGUUAUUUA 12685 UAAAUAAC C CACAGACAC C DGAT240 12386 UCAUGGAGCUGACCUGGUU 12686 AACCAGGUCAGCUCCAUGA DGAT241 12387 CUGAGCAGCAGAUUAGUUC 12687 GAACUAAUCUGCUGCUCAG DGAT242 12388 GGUCUAGGCUGUUUCUCUC 12688 GAGAGAAACAGC CUAGAC C DGAT243 12389 CAGAUUAGUUCCAAAGCAG 12689 CUGCUUUGGAACUAAUCUG DGAT244 12390 CGCAAGGGCUUUGUGAAAC 12690 GUUUCACAAAGCCCUUGCG DGAT245 12391 CCAGGAACUAUAUCUUUGG 12691 CCAAAGAUAUAGUUCCUGG DGAT246 12392 GAAGUGUACAAGCAGGUGA 12692 UCACCUGCUUGUACACUUC DGAT247 12393 UCCUCAUGUACAUAUUCUG 12693 CAGAAUAUGUACAUGAGGA DGAT248 12394 CGUCUAGUCCUGAAACUGC 12694 GCAGUUUCAGGACUAGACG DGAT249 12395 GGACCAGUUUCUCUGCCAA 12695 UUGGCAGAGAAACUGGUCC DGAT250 12396 GGGUGUCUGUGGGUUAUUU 12696 AAAUAAC C CACAGACAC C C DGAT251 12397 GGAACACAC C CAAGAAAGG 12697 CCUUUCUUGGGUGUGUUCC DGAT252 12398 CCAUGUCAGACUUUUGUAU 12698 AUACAAAAGUCUGACAUGG DGAT253 12399 CAAAGGAAACUCAGUCUUC 12699 GAAGACUGAGUUUCCUUUG DGAT254 12400 UUCUGUUAUCUCUUGAUGA 12700 UCAUCAAGAGAUAACAGAA DGAT255 12401 GUGUCUGUGGGUUAUUUAA 12701 UUAAAUAAC C CACAGACAC DGAT256 12402 CAUGUCAGACUUUUGUAUA 12702 UAUACAAAAGUCUGACAUG DGAT257 12403 UCGCUGUGCUCUACUUCAC 12703 GUGAAGUAGAGCACAGCGA DGAT258 12404 UGGCAAUGCUAUCAUCAUC 12704 GAUGAUGAUAGCAUUGCCA DGAT259 12405 UCAAAGAAUGGGAGUGGCA 12705 UGCCACUCCCAUUCUUUGA DGAT260 12406 GGGUCCAGAAGAAGUUCCA 12706 UGGAACUUCUUCUGGACCC DGAT261 12407 UCAUGGGUGUCUGUGGGUU 12707 AAC C CACAGACAC C CAU GA DGAT262 12408 CUGGAACACACCCAAGAAA 12708 UUUCUUGGGUGUGUUCCAG DGAT263 12409 GCUACUUUCGAGACUACUU 12709 AAGUAGUCUCGAAAGUAGC DGAT264 12410 GCAGUGCCAUCCUCAUGUA 12710 UACAUGAGGAUGGCACUGC DGAT265 12411 UUGCUCUGUAAAUUUGGAA 12711 UUCCAAAUUUACAGAGCAA DGAT266 12412 GGAGAGAAUGAAGUGUACA 12712 UGUACACUUCAUUCUCUCC DGAT267 12413 UUCCCAUCCAGCUGGUGAA 12713 UUCACCAGCUGGAUGGGAA DGAT268 12414 GUUCUAGGUGGUGGCUAAA 12714 UUUAGC CAC CAC CUAGAAC DGAT269 12415 CUAGGUGGAGUAACUGGUU 12715 AAC CAGUUACUC CAC CUAG DGAT270 12416 CUACUUUCGAGACUACUUU 12716 AAAGUAGUCUCGAAAGUAG DGAT271 12417 GGCGAAAGCCACUUCUCAU 12717 AUGAGAAGUGGCUUUCGCC DGAT272 12418 CUAGGGAUGAGAGGCGAAA 12718 UUUCGCCUCUCAUCCCUAG DGAT273 12419 CACCAGGAACUAUAUCUUU 12719 AAAGAUAUAGUUCCUGGUG DGAT274 12420 GUGGCAAUGCUAUCAUCAU 12720 AUGAUGAUAGCAUUGCCAC DGAT275 12421 GUGUUGAGGGAGUACCUGA 12721 UCAGGUACUCCCUCAACAC DGAT276 12422 CAGUUAGAUGAUUCACUUU 12722 AAAGUGAAUCAUCUAACUG DGAT277 12423 GUUCUGUUAUCUCUUGAUG 12723 CAUCAAGAGAUAACAGAAC DGAT278 12424 UGUCAGACUUUUGUAUAUG 12724 CAUAUACAAAAGUCUGACA DGAT279 12425 UGGGUGUCUGUGGGUUAUU 12725 AAUAAC C CACAGACAC C CA DGAT280 12426 UCUGUGGGUUAUUUAAAAG 12726 CUUUUAAAUAAC C CACAGA DGAT281 12427 CAAAGAAUGGGAGUGGCAA 12727 UUGCCACUCCCAUUCUUUG DGAT282 12428 GCUGUGCUCUACUUCACUU 12728 AAGUGAAGUAGAGCACAGC DGAT283 12429 GAAUGAAGUGUACAAGCAG 12729 CUGCUUGUACACUUCAUUC DGAT284 12430 CUCUGUAAAUUUGGAAGUG 12730 CACUUCCAAAUUUACAGAG DGAT285 12431 CAUGGAUGCAGCACAGACU 12731 AGUCUGUGCUGCAUCCAUG DGAT286 12432 CCUAGUCACUCAUAUCGGA 12732 UCCGAUAUGAGUGACUAGG DGAT287 12433 GCAGAUUAGUUCCAAAGCA 12733 UGCUUUGGAACUAAUCUGC DGAT288 12434 UGAGGGAGUACCUGAUGUC 12734 GACAUCAGGUACUCCCUCA DGAT289 12435 GUCAGACUUUUGUAUAUGC 12735 GCAUAUACAAAAGUCUGAC DGAT290 12436 GGUGCCUUCUGCAACUUCA 12736 UGAAGUUGCAGAAGGCACC DGAT291 12437 CGCUCGUCUAGUCCUGAAA 12737 UUUCAGGACUAGAC GAGC G DGAT292 12438 UUGCCCUGUUCUAGGUGGU 12738 AC CAC CUAGAACAGGGCAA DGAT293 12439 CUGUUCUAGGUGGUGGCUA 12739 UAGC CAC CAC CUAGAACAG DGAT294 12440 UCAUGUACAUAUUCUGCAC 12740 GUGCAGAAUAUGUACAUGA DGAT295 12441 CUGGCAAGAAUGCAGUCAC 12741 GUGACUGCAUUCUUGCCAG DGAT296 12442 UGAC GAG CAGGAACUAUAU 12742 AUAUAGUUCCUGGUGGUCA DGAT297 12443 CUGUGUUGAGGGAGUACCU 12743 AGGUACUCCCUCAACACAG DGAT298 12444 UUUCAAAGAAUGGGAGUGG 12744 CCACUCCCAUUCUUUGAAA DGAT299 12445 GUACAAGCAGGUGAUCUUC 12745 GAAGAUCACCUGCUUGUAC DGAT2100 12446 CUGAUGUCUGGAGGUAUCU 12746 AGAUACCUCCAGACAUCAG DGAT2101 12447 CUUUUGUAUAUGCCUUGAA 12747 UUCAAGGCAUAUACAAAAG DGAT2102 12448 UAGGUGGAGUAACUGGUUU 12748 AAAC CAGUUACUC CAC CUA DGAT2103 12449 GCUAGGUGGAGUAACUGGU 12749 AC CAGUUACUC CAC CUAGC DGAT2104 12450 GGAGUGGCAAUGCUAUCAU 12750 AUGAUAGCAUUGCCACUCC DGAT2105 12451 UUACCUGGCUACACUGGCA 12751 UGCCAGUGUAGCCAGGUAA DGAT2106 12452 UUUCUUGGGUGGCUGAUGA 12752 UCAUCAGCCACCCAAGAAA DGAT2107 12453 CUAGGUGGUGGCUAAAUCU 12753 AGAUUUAGC CAC CAC CUAG DGAT2108 12454 UCGUCUAGUCCUGAAACUG 12754 CAGUUUCAGGACUAGACGA DGAT2109 12455 UCUGUUAUCUCUUGAUGAG 12755 CUCAUCAAGAGAUAACAGA DGAT2110 12456 CUCAUGUACAUAUUCUGCA 12756 UGCAGAAUAUGUACAUGAG DGAT2111 12457 UCUAGGUGGUGGCUAAAUC 12757 GAUUUAGC CAC CAC CUAGA DGAT2112 12458 CAGUAGUAGGCAUCUGGAA 12758 UUCCAGAUGCCUACUACUG DGAT2113 12459 GCUGGUGUUUGACUGGAAC 12759 GUUCCAGUCAAACACCAGC DGAT2114 12460 UUACCUUCCCCAGAUCCUA 12760 UAGGAUCUGGGGAAGGUAA DGAT2115 12461 UGGCUGAUGACAUGGAUGC 12761 GCAUCCAUGUCAUCAGCCA DGAT2116 12462 GCCUCACUUUUCUGUGCCU 12762 AGGCACAGAAAAGUGAGGC DGAT2117 12463 GUUCCAGAAAUACAUUGGU 12763 ACCAAUGUAUUUCUGGAAC DGAT2118 12464 UUGGGUGGCUGAUGACAUG 12764 CAUGUCAUCAGCCACCCAA DGAT2119 12465 GCAGUAGUAGGCAUCUGGA 12765 UCCAGAUGCCUACUACUGC DGAT2120 12466 GUACAUAUUCUGCACUGAU 12766 AUCAGUGCAGAAUAUGUAC DGAT2121 12467 UCCCCAGAUCCUAGAUUCU 12767 AGAAUCUAGGAUCUGGGGA DGAT2122 12468 GAAGUUCCAGAAAUACAUU 12768 AAUGUAUUUCUGGAACUUC DGAT2123 12469 UUUCGAGACUACUUUCCCA 12769 UGGGAAAGUAGUCUCGAAA DGAT2124 12470 UUCCCCAGAUCCUAGAUUC 12770 GAAUCUAGGAUCUGGGGAA DGAT2125 12471 GGUGGCUGAUGACAUGGAU 12771 AUCCAUGUCAUCAGCCACC DGAT2126 12472 GUGUACAAGCAGGUGAUCU 12772 AGAUCACCUGCUUGUACAC DGAT2127 12473 GCACUGAUUGCUGGCUCAU 12773 AUGAGCCAGCAAUCAGUGC DGAT2128 12474 UGCUGACCACCAGGAACUA 12774 UAGUUCCUGGUGGUCAGCA DGAT2129 12475 GGGAGUGGCAAUGCUAUCA 12775 UGAUAGCAUUGCCACUCCC DGAT2130 12476 GCAAUGCUAUCAUCAUCGU 12776 ACGAUGAUGAUAGCAUUGC DGAT2131 12477 GCCAUCCUCAUGUACAUAU 12777 AUAUGUACAUGAGGAUGGC DGAT2132 12478 UUUGGAGAGAAUGAAGUGU 12778 ACACUUCAUUCUCUCCAAA DGAT2133 12479 GAGUGGCAAUGCUAUCAUC 12779 GAUGAUAGCAUUGCCACUC DGAT2134 12480 GAACACAC C CAAGAAAGGU 12780 ACCUUUCUUGGGUGUGUUC DGAT2135 12481 CAUUGCACCAUGUCAGACU 12781 AGUCUGACAUGGUGCAAUG DGAT2136 12482 CUUGGCUGGUGUUUGACUG 12782 CAGU CAAACAC CAGC CAAG DGAT2137 12483 GUCCAGAAGAAGUUCCAGA 12783 UCUGGAACUUCUUCUGGAC DGAT2138 12484 CCCUAGUCACUCAUAUCGG 12784 CCGAUAUGAGUGACUAGGG DGAT2139 12485 UGGAACACACCCAAGAAAG 12785 CUUUCUUGGGUGUGUUCCA DGAT2140 12486 GUGCUCUACUUCACUUGGC 12786 GCCAAGUGAAGUAGAGCAC DGAT2141 12487 CUACUUCACUUGGCUGGUG 12787 CAC CAGC CAAGU GAAGUAG DGAT2142 12488 GGUGAAGACACACAACCUG 12788 CAGGUUGUGUGUCUUCACC DGAT2143 12489 UGUUGAGGGAGUACCUGAU 12789 AUCAGGUACUCCCUCAACA DGAT2144 12490 GGCUCAGCUAACCUCUCUU 12790 AAGAGAGGUUAGCUGAGCC DGAT2145 12491 UUGCCAUUAGUGACUUGGA 12791 UCCAAGUCACUAAUGGCAA DGAT2146 12492 CAACCCUCUCCUGUGUGUU 12792 AACACACAGGAGAGGGUUG DGAT2147 12493 GAGCUAGGUGGAGUAACUG 12793 CAGUUACUCCACCUAGCUC DGAT2148 12494 UAUUCUGCACUGAUUGCUG 12794 CAGCAAUCAGUGCAGAAUA DGAT2149 12480 GAACACAC C CAAGAAAGGU 12795 ACCUUUCUUGGGUGUGUUC DGAT2150 12496 GUGGGUUAUUUAAAAGAAA 12796 UUU CUUUUAAAUAAC C CAC DGAT2151 12497 CAGUUUAC CUU C C C CAGAU 12797 AUCUGGGGAAGGUAAACUG DGAT2152 12498 CCAGUUUGAUCUCCCUUCU 12798 AGAAGGGAGAUCAAACUGG DGAT2153 12499 GAGACUACUUUCCCAUCCA 12799 UGGAUGGGAAAGUAGUCUC DGAT2154 12500 CACCCCUAGUCACUCAUAU 12800 AUAUGAGUGACUAGGGGUG DGAT2155 12501 CUUCCCCAGAUCCUAGAUU 12801 AAUCUAGGAUCUGGGGAAG DGAT2156 12502 GGCUAAAUCUGGGCCUAAU 12802 AUUAGGC C CAGAUUUAGC C DGAT2157 12503 CUAAAUCUGGGCCUAAUCU 12803 AGAUUAGGC C CAGAUUUAG DGAT2158 12504 CUUUAUUGC CACUAC C C CA 12804 UGGGGUAGUGGCAAUAAAG DGAT2159 12505 CUCAUACAAGC C C CUUUAU 12805 AUAAAGGGGCUUGUAUGAG DGAT2160 12506 CUUCUCAUACAAGCCCCUU 12806 AAGGGGCUUGUAUGAGAAG DGAT2161 12507 CGGCUUCCCGCGGGGCCGU 12807 ACGGCCCCGC GGGAAGC C G DGAT2162 12508 GCUUCCCGCGGGGCCGUGA 12808 UCACGGCCCCGCGGGAAGC DGAT2163 12509 GGCCGUGACUGGGCGGGCU 12809 AGC C C GC C CAGUCAC GGC C DGAT2164 12510 GCCGUGACUGGGCGGGCUU 12810 AAGC C C GC C CAGUCAC GGC DGAT2165 12511 CGUGACUGGGCGGGCUUCA 12811 UGAAGCCCGCCCAGUCACG DGAT2166 12512 CUGGGCGGGCUUCAGCCAU 12812 AUGGCUGAAGCCCGCCCAG DGAT2167 12513 GGGCGGGCUUCAGCCAUGA 12813 UCAUGGCUGAAGCCCGCCC DGAT2168 12514 GGCGGGCUUCAGCCAUGAA 12814 UUCAUGGCUGAAGCCCGCC DGAT2169 12515 C GGGACAC CAUAGACUAUU 12815 AAUAGUCUAUGGUGUCCCG DGAT2170 12516 GGGACAC CAUAGACUAUUU 12816 AAAUAGUCUAUGGUGUCCC DGAT2171 12517 GCUUUCAAAGAAUGGGAGU 12817 ACUCCCAUUCUUUGAAAGC DGAT2172 12518 GGGUUAUUUAAAAGAAAUU 12818 AAUUUCUUUUAAAUAACCC DGAT2173 12519 CUUCUUCCCUUCCUGAAGU 12819 ACUUCAGGAAGGGAAGAAG DGAT2174 12520 CCCUUCCUGAAGUGACAAA 12820 UUUGUCACUUCAGGAAGGG DGAT2175 12521 CAGUCUUCUUGGGGAAGAA 12821 UUCUUCCCCAAGAAGACUG DGAT2176 12522 CUUCUUGGGGAAGAAGGAU 12822 AUCCUUCUUCCCCAAGAAG DGAT2177 12523 GAUUCACUUUUUGCCCCUA 12823 UAGGGGCAAAAAGUGAAUC DGAT2178 12524 GUUUUUCUUGGGUGGCUGA 12824 U CAGC CAC C CAAGAAAAAC DGAT2179 12525 GAAC C CAAGC CUCACUUUU 12825 AAAAGUGAGGCUUGGGUUC DGAT2180 12526 CUCUUCUUCCCUUCCUGAA 12826 UUCAGGAAGGGAAGAAGAG DGAT2181 12458 CAGUAGUAGGCAUCUGGAA 12827 UUCCAGAUGCCUACUACUG DGAT2182 12460 UUACCUUCCCCAGAUCCUA 12828 UAGGAUCUGGGGAAGGUAA DGAT2183 12463 GUUCCAGAAAUACAUUGGU 12829 ACCAAUGUAUUUCUGGAAC DGAT2184 12466 GUACAUAUUCUGCACUGAU 12830 AUCAGUGCAGAAUAUGUAC DGAT2185 12467 UCCCCAGAUCCUAGAUUCU 12831 AGAAUCUAGGAUCUGGGGA DGAT2186 12468 GAAGUUCCAGAAAUACAUU 12832 AAUGUAUUUCUGGAACUUC DGAT2187 12469 UUUCGAGACUACUUUCCCA 12833 UGGGAAAGUAGUCUCGAAA DGAT2188 12472 GUGUACAAGCAGGUGAUCU 12834 AGAUCACCUGCUUGUACAC DGAT2189 12475 GGGAGUGGCAAUGCUAUCA 12835 UGAUAGCAUUGCCACUCCC DGAT2190 12476 GCAAUGCUAUCAUCAUCGU 12836 ACGAUGAUGAUAGCAUUGC DGAT2191 12477 GCCAUCCUCAUGUACAUAU 12837 AUAUGUACAUGAGGAUGGC DGAT2192 12481 CAUUGCACCAUGUCAGACU 12838 AGUCUGACAUGGUGCAAUG DGAT2193 12483 GUCCAGAAGAAGUUCCAGA 12839 UCUGGAACUUCUUCUGGAC DGAT2194 12489 UGUUGAGGGAGUACCUGAU 12840 AUCAGGUACUCCCUCAACA DGAT2195 12492 CAACCCUCUCCUGUGUGUU 12841 AACACACAGGAGAGGGUUG DGAT2196 12542 CUUCACUUGGCUGGUGUUU 12842 AAACACCAGCCAAGUGAAG DGAT2197 12543 CUCGUCUAGUCCUGAAACU 12843 AGUUUCAGGACUAGACGAG DGAT2198 12544 GAGCAGCAGAUUAGUUCCA 12844 UGGAACUAAUCUGCUGCUC DGAT2199 12545 GAGGGAGUACCUGAUGUCU 12845 AGACAUCAGGUACUCCCUC DGAT2 200 12546 CUGACCUGGUUCCCAUCUA 12846 UAGAUGGGAACCAGGUCAG DGAT2 201 12547 GACUGGAACACAC C CAAGA 12847 UCUUGGGUGUGUUCCAGUC DGAT2 202 12548 UUGAGGGAGUACCUGAUGU 12848 ACAUCAGGUACUCCCUCAA DGAT2 203 12549 GCAAGAAUGCAGUCACCCU 12849 AGGGUGACUGCAUUCUUGC DGAT2 204 12550 GAAUGGGAGUGGCAAUGCU 12850 AGCAUUGCCACUCCCAUUC DGAT2 205 12551 GAAUGCCUGUGUUGAGGGA 12851 UCCCUCAACACAGGCAUUC DGAT2 206 12552 UUCGAGACUACUUUCCCAU 12852 AUGGGAAAGUAGUCUCGAA DGAT2 207 12553 CUUUCGAGACUACUUUCCC 12853 GGGAAAGUAGUCUCGAAAG DGAT2 208 12554 CAAGGGCUUUGUGAAACUG 12854 CAGUUUCACAAAGCCCUUG DGAT2 209 12555 CAAUUUUGCUAAACCAUUA 12855 UAAUGGUUUAGCAAAAUUG DGAT2210 12556 CAGACUUUUGUAUAUGCCU 12856 AGGCAUAUACAAAAGUCUG DGAT2211 12557 GAAAGCCACUUCUCAUACA 12857 UGUAUGAGAAGUGGCUUUC DGAT2212 12558 CAGGAACUAUAUCUUUGGA 12858 UCCAAAGAUAUAGUUCCUG DGAT2213 12559 CAUGAGCUAGGUGGAGUAA 12859 UUACUCCACCUAGCUCAUG DGAT2214 12560 CAUGUACAUAUUCUGCACU 12860 AGUGCAGAAUAUGUACAUG DGAT2215 12561 CGCUACUUUCGAGACUACU 12861 AGUAGUCUCGAAAGUAGCG DGAT2216 12562 CUUCUGCAACUUCAGCACA 12862 UGUGCUGAAGUUGCAGAAG DGAT2217 12563 CACCAUGUCAGACUUUUGU 12863 ACAAAAGUCUGACAUGGUG DGAT2218 12564 CUUGAAAAUAAAUGAAAGU 12864 ACUUUCAUUUAUUUUCAAG DGAT2219 12565 GCCGAUGGGUCCAGAAGAA 12865 UUCUUCUGGACCCAUCGGC DGAT2 220 12566 GGUCACAGUGGGUCCGAAA 12866 UUUCGGACCCACUGUGACC DGAT2 221 12567 UGUGGGUUAUUUAAAAGAA 12867 UU CUUUUAAAUAAC C CACA DGAT2 222 12568 UUGACUGGAACACACCCAA 12868 UUGGGUGUGUUCCAGUCAA DGAT2 223 12569 C GAAC C CAAGC CUCACUUU 12869 AAAGUGAGGCUUGGGUUCG DGAT2 224 12570 AAAGAAUGGGAGUGGCAAU 12870 AUUGCCACUCCCAUUCUUU DGAT2 225 12571 UUUACCUUCCCCAGAUCCU 12871 AGGAUCUGGGGAAGGUAAA DGAT2 226 12572 CAGUUUGAUCUCCCUUCUG 12872 CAGAAGGGAGAUCAAACUG DGAT2 227 12573 UCACCCCUAGUCACUCAUA 12873 UAUGAGUGACUAGGGGUGA DGAT2 228 12574 UCAGUUUACCUUCCCCAGA 12874 UCUGGGGAAGGUAAACUGA DGAT2 229 12575 C CUAGGGAUGAGAGGC GAA 12875 UUCGCCUCUCAUCCCUAGG DGAT2 230 12576 ACUCAGUCUUCUUGGGGAA 12876 UUCCCCAAGAAGACUGAGU DGAT2 231 12577 UUUGAUCUCCCUUCUGCCA 12877 UGGCAGAAGGGAGAUCAAA DGAT2 232 12578 UGGCUAAAUCUGGGCCUAA 12878 UUAGGC C CAGAUUUAGC CA DGAT2 233 12579 GUGGCUAAAUCUGGGCCUA 12879 UAGGC C CAGAUUUAGC CAC DGAT2 234 12580 GAGCUGACCUGGUUCCCAU 12880 AUGGGAACCAGGUCAGCUC DGAT2 235 12581 GAAACUCAGUCUUCUUGGG 12881 CCCAAGAAGACUGAGUUUC DGAT2 236 12582 GGAGGUAUCUGCCCUGUCA 12882 UGACAGGGCAGAUACCUCC DGAT2 237 12583 UUUGACUGGAACACACCCA 12883 UGGGUGUGUUCCAGUCAAA DGAT2 238 12584 GCCUAAUCUGGGUGGCUCA 12884 UGAGC CAC C CAGAUUAGGC DGAT2 239 12585 GC C GGGACAC CAUAGACUA 12885 UAGUCUAUGGUGUCCCGGC DGAT2 240 12586 AAUGGGAGUGGCAAUGCUA 12886 UAGCAUUGCCACUCCCAUU DGAT2 241 12587 GCAGGAGGUCACAGUGGGU 12887 ACCCACUGUGACCUCCUGC DGAT2 242 12588 GGCCGAUGGGUCCAGAAGA 12888 UCUUCUGGACCCAUCGGCC DGAT2 243 12589 GGAGCAC C CAAC C CAGCAA 12889 UUGCUGGGUUGGGUGCUCC DGAT2 244 12590 GGCUGGUGCCCUACUCCAA 12890 UUGGAGUAGGGCAC CAGC C DGAT2 245 12591 ACUGGAACACAC C CAAGAA 12891 UUCUUGGGUGUGUUCCAGU DGAT2 246 12592 CUGCUGGGGUCUAGGCUGU 12892 ACAGC CUAGAC C C CAGCAG DGAT2 247 12593 CUGGGUGCCUUCUGCAACU 12893 AGUUGCAGAAGGCAC C CAG DGAT2 248 12594 AUACAUUGGUUUCGCCCCA 12894 UGGGGCGAAACCAAUGUAU DGAT2 249 12595 GCUAAAUCUGGGCCUAAUC 12895 GAUUAGGC C CAGAUUUAGC DGAT2 250 12596 GGGCCUAAUCUGGGUGGCU 12896 AGC CAC C CAGAUUAGGC C C DGAT2 251 12597 GAAACUGGCCCUGCGUCAU 12897 AUGACGCAGGGCCAGUUUC DGAT2 252 12598 GCCUGGGUGCCUUCUGCAA 12898 UUGCAGAAGGCAC C CAGGC DGAT2 253 12599 UCUCAUACAAGCCCCUUUA 12899 UAAAGGGGCUUGUAUGAGA DGAT2 254 12600 CAAGCCCAUCACCACUGUU 12900 AACAGUGGUGAUGGGCUUG DGAT2 255 12601 GUCCGAAACUGGGCUGUGU 12901 ACACAGC C CAGUUUC GGAC DGAT2 256 12602 C C CUAGGGAUGAGAGGC GA 12902 UCGCCUCUCAUCCCUAGGG DGAT2 257 12603 AUGGGUGUCUGUGGGUUAU 12903 AUAAC C CACAGACAC C CAU DGAT2 258 12604 GCUUUGUGAAACUGGCCCU 12904 AGGGCCAGUUUCACAAAGC DGAT2 259 12605 GGGUGGCUGAUGACAUGGA 12905 UCCAUGUCAUCAGCCACCC DGAT2 260 12606 CCAACCCUCUCCUGUGUGU 12906 ACACACAGGAGAGGGUUGG DGAT2 261 12607 CAGUUGCCCCGUUGUGUGA 12907 UCACACAACGGGGCAACUG DGAT2 262 12608 GGUGGCUAAAUCUGGGCCU 12908 AGGC C CAGAUUUAGC CAC C DGAT2 263 12609 AUGGGAGUGGCAAUGCUAU 12909 AUAGCAUUGCCACUCCCAU DGAT2 264 12610 CCUCACCCCUAGUCACUCA 12910 UGAGUGACUAGGGGUGAGG DGAT2 265 12611 C C CAAGCUGGAGCAC C CAA 12911 UUGGGUGCUCCAGCUUGGG DGAT2 266 12612 GUCUGGAGGUAUCUGCCCU 12912 AGGGCAGAUAC CUC CAGAC DGAT2 267 12613 AAGUGUCAUGGGUGUCUGU 12913 ACAGACAC C CAU GACACUU DGAT2 268 12614 CCCUACUCCAAGCCCAUCA 12914 UGAUGGGCUUGGAGUAGGG DGAT2 269 12615 GGUUUCGCCCCAUGCAUCU 12915 AGAUGCAUGGGGCGAAACC DGAT2 270 12616 GGGCUGUGUGGCGCUACUU 12916 AAGUAGC GC CACACAGC C C DGAT2 271 12617 CUCACCCCUAGUCACUCAU 12917 AUGAGUGACUAGGGGUGAG DGAT2 272 12618 CCUUCCCCAGAUCCUAGAU 12918 AUCUAGGAUCUGGGGAAGG DGAT2 273 12619 GGAGCUGACCUGGUUCCCA 12919 UGGGAACCAGGUCAGCUCC DGAT2 274 12620 GGGUCCGAAACUGGGCUGU 12920 ACAGC C CAGUUUC GGAC C C DGAT2 275 12621 GCUGGGGUCUAGGCUGUUU 12921 AAACAGC CUAGAC C C CAGC DGAT2 276 12622 GUCAUGGGUGUCUGUGGGU 12922 AC C CACAGACAC C CAU GAC DGAT2 277 12623 C C GAAC C CAAGC CUCACUU 12923 AAGUGAGGCUUGGGUUCGG DGAT2 278 12624 ACUACUUUCCCAUCCAGCU 12924 AGCUGGAUGGGAAAGUAGU DGAT2 279 12625 CCAAGCCCAUCACCACUGU 12925 ACAGUGGUGAUGGGCUUGG DGAT2 280 12626 GGGGAGGAAACCCAACCCU 12926 AGGGUUGGGUUUCCUCCCC DGAT2 281 12627 AACUCAGUCUUCUUGGGGA 12927 UCCCCAAGAAGACUGAGUU DGAT2 282 12628 CCUCAGUUUACCUUCCCCA 12928 UGGGGAAGGUAAACUGAGG DGAT2 283 12629 CCCAUCCAGCUGGUGAAGA 12929 UCUUCACCAGCUGGAUGGG DGAT2 284 12630 GAGGUCACAGUGGGUCCGA 12930 UCGGACCCACUGUGACCUC DGAT2 285 12631 CUGGAGGUAUCUGCCCUGU 12931 ACAGGGCAGAUACCUCCAG DGAT2 286 12632 CCUACCUCACCCCUAGUCA 12932 UGACUAGGGGUGAGGUAGG DGAT2 287 12633 ACCCAAGCCUCACUUUUCU 12933 AGAAAAGUGAGGCUUGGGU DGAT2 288 12634 GGAAC C GCAAGGGCUUUGU 12934 ACAAAGCCCUUGCGGUUCC DGAT2 289 12635 C C C GAAC C CAAGC CUCACU 12935 AGUGAGGCUUGGGUUCGGG DGAT2 290 12636 GCUGACCUGGUUCCCAUCU 12936 AGAUGGGAACCAGGUCAGC DGAT2 291 12637 GUUAGAUGAUUCACUUUUU 12937 AAAAAGUGAAUCAUCUAAC DGAT2 292 12638 GGAACUAUAUCUUUGGAUA 12938 UAUCCAAAGAUAUAGUUCC DGAT2 293 12639 GACUAUUUGCUUUCAAAGA 12939 UCUUUGAAAGCAAAUAGUC DGAT2 294 12640 CUAUUUGCUUUCAAAGAAU 12940 AUUCUUUGAAAGCAAAUAG DGAT2 295 12641 GCUAAACCAUUACAAUGUU 12941 AACAUUGUAAUGGUUUAGC DGAT2 296 12642 CUAAACCAUUACAAUGUUA 12942 UAACAUUGUAAUGGUUUAG DGAT2 297 12643 GGAAAAAGUCAGUAUUUCA 12943 UGAAAUACUGACUUUUUCC DGAT2 298 12644 GAAAAAGUCAGUAUUUCAA 12944 UUGAAAUACUGACUUUUUC DGAT2 299 12645 GGAGUAACUGGUUUUUCUU 12945 AAGAAAAAC CAGUUACU C C DGAT2 300 12646 AUAGACUAUUUGCUUUCAA 12946 UUGAAAGCAAAUAGUCUAU Table 17: selected modified DGAT2 sense and antisense modified nucleotide sequences. fA, fll, fC, fG = 2’-F ribonucleotides and mA, mil, mC, mG = 2’ OMe ribonucleotides. SEQ ID NOs: SEQ ID NOs: Modified sense DGAT2 sequences Modified antisense DGAT2 sequences 17256 17541 DGAT-1473 mUmGmGmGmUmUfAfUfUmU mAmAmAmAmGmAmAmA mUfUmUfCmUfUmUfU m AfAm Af U mAfAmCfCmCfAmCmA 17257 17542 DGAT2_1 m C m U m G m U m Am AfAf Uf U m U mGmGmAmAmGmUmGmUmC m GfAm CfAm Cf U m Uf C m CfAm AfA m Uf U m UfAm CfAm G m U m U 17258 17543 DGAT2_2 mCmCmAmUmG m Af GfCf U mA mGmGmUmGmGmAmGmUmA mUfAmCfUmCfCmAfCmCfUmAfG m Cf U m CfAm UfG m G m U m U 17259 17544 DGAT2_3 m C m C m Am C m C m AfGf GfAm A mCmUmAmUmAmUmCmUmU m AfAm GfAm UfAm UfAm Gf U m Uf C mCfUmGfGmUfGmGmUmU 17260 17545 DGAT2_4 m U m C m Cm Am G m AfAfAf U m A mCmAmUmUmGmGmUmUmU mAfAmAfCmCfAmAfUmGfUmAfU m Uf U m Cf U m Gf G m Am U m U 17261 17546 DGAT2_5 m C m C m G m C m Am Af Gf Gf G m C mUmUmUmGmUmGmAmAmA mUfUmUfCmAfCmAfAmAfGmCfC mCfUmUfGmCfGmGmUmU 17262 17547 DGAT2_6 m G m C m Am Am G m AfAfGf U m U mCmCmCmAmGmGmCmAmU mAfUmGfCmCfUmGfGmGfAmAfC mUfUmCfUmUfGmCmUmU 17263 17548 DGAT2_7 mCmAmUmGmGmGfUfGfUmC mUmGmUmGmGmGmUmUmA m UfAm AfC m Cf C m Af C m Af Gm Af C m Af C m Cf C m Af U m G m U m U 17264 17549 DGAT2_8 m U m C m U m Gm U m AfAfAf U m U mUmGmGmAmAmGmUmGmU mAfCmAfCmUfUmCfCmAfAmAfU m UfUm AfCm AfGmAm Um U 17265 17550 DGAT2 9 m U m U m G m G m Am GfAfGfAm A mUmGmAmAmGmUmGmUmA mUfAmCfAmCfUmUfCmAfUmUfC m UfC m UfC m CfAm Am U m U 17266 17551 DGAT2_10 m C m C m Am Gm U m Uf AfGf Am U mGmAmUmUmCmAmCmUmU m AfAm Gf U m GfAm Af U m CfAm UfC m UfAm AfC m Uf G m G m U m U 17267 17552 DGAT2_11 m C m G m Am U m G m Gf Gf Uf C m C mAmGmAmAmGmAmAmGmU mAfCmUfUmCfUmUfCmUfGmGfA m CfC m CfAm UfC m G m U m U 17268 17553 DGAT2_12 m G m C m Am G m C m Af GfAf U m U m Am G m U m U m C m C m Am Am A m Uf U m UfG m GfAm AfC m UfAm Af U mCfUmGfCmUfGmCmUmU 17269 17554 DGAT2_13 mGmUmCmUmGmUfGfGfGmU m U m Am U m U m U m Am Am Am A m Uf U m Uf U m AfAm Af U m AfAm CfC m CfAm CfAm GfAm C m U m U 17270 17555 DGAT2_14 m U m C m Am C m U m Uf GfGf C m U mGmGmUmGmUmUmUmGmA m UfC m AfAm Af C m Af C m CfAm GfC m CfAm AfGm UfGm Am U m U 17271 17556 DGAT2_15 m C m C m U m U m U m Gf GfAf G m A m G m Am Am U m G m Am Am G m U mAfCmUfUmCfAmUfUmCfUmCfU m CfC m AfAm Af G m G m U m U 17272 17557 DGAT2_16 m C m C m Am U m C m Cf UfCfAm U m G m U m Am C m Am U m Am U m U m AfAm UfAm Uf G m UfAm CfAm UfG m AfG m GfAm UfG m G m U m U 17273 17558 DGAT2_17 m G m C m Am Am G m Gf Gf Cf U m U m U m G m U m G m Am Am Am C m U m AfGm UfUm UfCmAfCmAfAmAfG mCfCmCfUmUfGmCmUmU 17274 17559 DGAT2_18 m G m C m G m Am Am Af GfCf C mA mCmUmUmCmUmCmAmUmA mUfAmUfGmAfGmAfAmGfUmGfG m CfU m UfU m CfGm Cm U m U 17275 17560 DGAT2_19 mCmAmAmGmAmAfGfUfUmC mCmCmAmGmGmCmAmUmA mUfAmUfGmCfCmUfGmGfGmAfA m Cf U m UfC m Uf U m G m U m U 17276 17561 DGAT2_20 m U m G m U m Am C m AfAf GfC mA mGmGmUmGmAmUmCmUmU mAfAmGfAmUfCmAfCmCfUmGfC m Uf U m Gf U m AfC m Am U m U 17277 17562 DGAT2_21 mUmGmUmUmCmUfAfGfGmU mGmGmUmGmGmCmUmAmA mUfUmAfGmCfCmAfCmCfAmCfC m UfAm GfAm AfC m Arn U m U 17278 17563 DGAT2_22 m U m G m G m Am C m CfAfGf U m U m Am G m Am U m G m Am U m U m C m GfAm Af U m CfAm UfC m UfAm Af C mUfGmGfUmCfCmAmUmU 17279 17564 DGAT2_23 m C m U m G m Am C m CfAfCf Cm A m G m G m Am Am C m U m Am U m A mUfAmUfAmGfUmUfCmCfUmGfG mUfGmGfUmCfAmGmUmU 17280 17565 DGAT2_24 m G m C m U m Cm U m Gf UfAfAm A mUmUmUmGmGmAmAmGmU mAfCmUfUmCfCmAfAmAfUmUfU mAfCmAfGmAfGmCmUmU 17281 17566 DGAT2_25 m G m Am U m Gm G m Gf UfCf C m A mGmAmAmGmAmAmGmUmU mAfAmCfUmUfCmUfUmCfUmGfG mAfCmCfCmAfUmCmUmU 17282 17567 DGAT2_26 m U m G m G m Am G m Af GfAfAm U mGmAmAmGmUmGmUmAmC mGfUmAfCmAfCmUfUmCfAmUfU mCfUmCfUmCfCmAmUmU 17283 17568 DGAT2_27 m G m C m Am Cm C m Af UfGf U m C mAmGmAmCmUmUmUmUmG mCfAmAfAmAfGmUfCmUfGmAfC mAfUmGfGmUfGmCmUmU 17284 17569 DGAT2_28 m G m C m G m Cm U m Af Cf Uf U m U mCmGmAmGmAmCmUmAmC mGfUmAfGmUfCmUfCmGfAmAfA mGfUmAfGmCfGmCmUmU 17285 17570 DGAT2_29 m C m C m Am U m U m AfGf UfG m A mCmUmUmGmGmAmCmCmA mUfGmGfUmCfCmAfAmGfUmCfA mCfUmAfAmUfGmGmUmU 17286 17571 DGAT2_30 m G m U m C m U m Am Gf UfCf C m U mGmAmAmAmCmUmGmCmA mUfGmCfAmGfUmUfUmCfAmGfG mAfCmUfAmGfAmCmUmU 17287 17572 DGAT2_31 m C m U m G m U m G m Gf Gf Uf U m A m U m U m U m Am Am Am Am G m A m UfCm UfU m UfU m AfAm Af Um AfA mCfCmCfAmCfAmGmUmU 17288 17573 DGAT2_32 mCmUmUmGmGmGfUfGfGmC m U m G m Am U m G m Am C m Am U mAfUmGfUmCfAmUfCmAfGmCfC mAfCmCfCmAfAmGmUmU 17289 17574 DGAT2_33 mUmGmCmCmUmGfUfGfUmU m G m Am G m Gm G m Am G m U m A mUfAmCfUmCfCmCfUmCfAmAfC mAfCmAfGmGfCmAmUmU 17290 17575 DGAT2_34 mUmGmUmCmUmGfUfGfGmG m U m U m Am U m U m U m Am Am A m Uf U m UfAm AfAm UfAm AfC m CfC mAfCmAfGmAfCmAmUmU 17291 17576 DGAT2_35 m U m U m Cm Cm AmGf AfAfAm U mAmCmAmUmUmGmGmUmU m AfAm CfC m AfAm Uf G m UfAm Uf U mUfCmUfGmGfAmAmUmU 17292 17577 DGAT2_36 m U m G m Am G m C m UfAf Gf G m U mGmGmAmGmUmAmAmCmU mAfGmUfUmAfCmUfCmCfAmCfC mUfAmGfCmUfCmAmUmU 17293 17578 DGAT2_37 m U m Am Cm Am Um AfUf UfCm U mGmCmAmCmUmGmAmUmU mAfAmUfCmAfGmUfGmCfAmGfA mAfUmAfUmGfUmAmUmU 17294 17579 DGAT2_38 m G m Am Am Gm U m GfAfGf C m A mAmGmAmAmGmUmUmCmC mGfGmAfAmCfUmUfCmUfUmGfC mUfCmAfCmUfUmCmUmU 17295 17580 DGAT2_39 mGmGmUmGmUmCfUfGfUmG m UfAm AfAm UfAm AfCm CfCm AfC mGmGmUmUmAmUmUmUmA m Af G m Af C m Af C m C m U m U 17296 17581 DGAT2_40 m U m C m Am U m G m GfAfGf C m U mGmAmCmCmUmGmGmUmU m AfAm CfC m Af G m Gf U m CfAm GfC m UfC m CfAm UfG m Am U m U 17297 17582 DGAT2_41 m C m U m G m Am G m CfAfGf C m A mGmAmUmUmAmGmUmUmC mGfAmAfCmUfAmAfUmCfUmGfC m UfG m Cf U m CfAm G m U m U 17298 17583 DGAT2_42 m G m G m U m C m U m Af Gf Gf C m U mGmUmUmUmCmUmCmUmC m GfAm GfAm GfAm AfAm CfAm GfC m Cf U m Af G m Af C m C m U m U 17299 17584 DGAT2_43 m Cm Am Gm Am U m UfAfGfU m U mCmCmAmAmAmGmCmAmG mCfUmGfCmUfUmUfGmGfAmAfC m UfAm Af U m Cf U m G m U m U 17300 17585 DGAT2_44 m C m G m C m Am Am Gf GfGf C m U mUmUmGmUmGmAmAmAmC m Gf U m Uf U m CfAm CfAm AfAm GfC mCfCmUfUmGfCmGmUmU 17301 17586 DGAT2_45 m C m C m Am Gm G m Af AfCf U m A mUmAmUmCmUmUmUmGmG mCfCmAfAmAfGmAfUmAfUmAfG mUfUmCfCmUfGmGmUmU 17302 17587 DGAT2_46 m G m Am Am Gm U m Gf UfAf C m A mAmGmCmAmGmGmUmGmA mUfCmAfCmCfUmGfCmUfUmGfU m Af C m Af C m U f U m C m U m U 17303 17588 DGAT2_47 m U m C m Cm U m C m Af UfGf U m A mCmAmUmAmUmUmCmUmG m CfAm GfAm Af U m Af U m Gf U m AfC m AfU m GfAm GfGm Am U m U 17304 17589 DGAT2_48 m C m G m U m Cm U m Af Gf Uf C m C m U m G m Am Am Am C m U m G m C mGfCmAfGmUfUmUfCmAfGmGfA m Cf U m Af G m Af C m G m U m U 17305 17590 DGAT2_49 m G m G m Am Cm C m Af Gf Uf U m U mCmUmCmUmGmCmCmAmA m Uf U m GfG m CfAm GfAm GfAm AfA mCfUmGfGmUfCmCmUmU 17306 17591 DGAT2_50 mGmGmGmUmGmUfCfUfGmU mGmGmGmUmUmAmUmUmU mAfAmAfUmAfAmCfCmCfAmCfA m GfAm CfAm CfC m C m U m U 17307 17592 DGAT2_51 m G m G m Am Am C m Af CfAf Cm C m C m Am Am G m Am Am Am G m G mCfCmUfUmUfCmUfUmGfGmGf UmGfUmGfUmUfCmCmUmU 17308 17593 DGAT2_52 m C m C m Am U m G m Uf CfAf Gm A mCmUmUmUmUmGmUmAmU m AfU m AfC m AfAm AfAm Gf U m Cf U m GfAm CfAm UfG m Gm U m U 17309 17594 DGAT2_53 m C m Am Am Am Gm GfAfAfAm C mUmCmAmGmUmCmUmUmC mGfAmAfGmAfCmUfGmAfGmUfU m UfC m Cf U m Uf U m G m U m U 17310 17595 DGAT2_54 m U m U m Cm U m G m Uf UfAf U m C mUmCmUmUmGmAmUmGmA mUfCmAfUmCfAmAfGmAfGmAfU m AfAmCfAmGfAmAm Um U 17311 17596 DGAT2_55 mGmUmGmUmCmUfGfUfGmG mGmUmUmAmUmUmUmAmA m Uf U m AfAm Af U m AfAm CfC m CfA m CfAm GfAm CfAm C m U m U 17312 17597 DGAT2_56 m C m Am U m Gm U m CfAfGfAm C mUmUmUmUmGmUmAmUmA m UfAm UfAmCfAmAfAm AfGmUfC m U f G m Af C m Af U m G m U m U 17313 17598 DGAT2_57 mUmCmGmCmUmGfUfGfCmU mCmUmAmCmUmUmCmAmC mGfUmGfAmAfGmUfAmGfAmGfC m Af C m Af G m Cf G m Am U m U 17314 17599 DGAT2_58 m U m G m G m Cm Am Af UfGf C m U mAmUmCmAmUmCmAmUmC m GfAm UfG m AfU m GfAm UfAm GfC m Af U m UfG m CfC m Am U m U 17315 17600 DGAT2_59 m U m C m Am Am Am GfAfAf U m G mGmGmAmGmUmGmGmCmA mUfGmCfCmAfCmUfCmCfCmAfU m UfC m Uf U m UfG m Am U m U 17316 17601 DGAT2_60 m G m G m G m U m C m CfAfGfAm A mGmAmAmGmUmUmCmCmA mUfGmGfAmAfCmUfUmCfUmUfC m UfG m GfAm CfC m Cm U m U 17317 17602 DGAT2_61 m U m C m Am U m G m Gf Gf Uf G m U mCmUmGmUmGmGmGmUmU m AfAm CfC m CfAm CfAm GfAm CfA m CfC m CfAm UfGmAmUmU 17318 17603 DGAT2_62 mCmUmGmGmAmAfCfAfCmA mCmCmCmAmAmGmAmAmA mUfUmUfCmUfUmGfGmGfUmGf UmGfUmUfCmCfAmGmUmU 17319 17604 DGAT2_63 m G m C m U m Am C m Uf Uf Uf Cm G mAmGmAmCmUmAmCmUmU mAfAmGfUmAfGmUfCmUfCmGfA m AfAm Gf U m Af G m C m U m U 17320 17605 DGAT2_64 m G m C m Am G m U m Gf Cf CfAm U mCmCmUmCmAmUmGmUmA mUfAmCfAmUfGmAfGmGfAmUfG m Gf C m Af C m U f G m C m U m U 17321 17606 DGAT2_65 m U m U m G m Cm U m Cf UfGf U m A m Am Am U m U m U m G m G m Am A m Uf U m CfC m AfAm Af U m Uf U m Af C m AfG m AfG m CfAm Am U m U 17322 17607 DGAT2_66 mGmGmAmGmAmGfAfAfUmG m Am Am G m U m G m U m Am C m A mUfGmUfAmCfAmCfUmUfCmAfU mUfCmUfCmUfCmCmUmU 17323 17608 DGAT2_67 m U m U m Cm Cm Cm Af UfCfCm A mGmCmUmGmGmUmGmAmA mUfUmCfAmCfCmAfGmCfUmGfG m AfU m GfGm GfAm Am U m U 17324 17609 DGAT2_68 m G m U m U m Cm U m Af GfGf U m G mGmUmGmGmCmUmAmAmA mUfUmUfAmGfCmCfAmCfCmAfC m Cf U m Af G m AfAm C m U m U 17325 17610 DGAT2_69 m C m U m Am Gm G m Uf GfGf Am G mUmAmAmCmUmGmGmUmU m AfAm CfC m Af G m Uf U m Af Cm Uf C m CfAm CfC m UfAm G m U m U 17326 17611 DGAT2_70 m C m U m Am C m U m Uf UfCf Gm A mGmAmCmUmAmCmUmUmU mAfAmAfGmUfAmGfUmCfUmCfG m AfAm AfG m UfAm G m U m U 17327 17612 DGAT2_71 m G m G m C m G m Am AfAfGf C m C mAmCmUmUmCmUmCmAmU mAfUmGfAmGfAmAfGmUfGmGfC m Uf U m UfC m GfC m Cm U m U 17328 17613 DGAT2_72 m C m U m Am Gm G m Gf Af Uf G m A mGmAmGmGmCmGmAmAmA mUfUmUfCmGfCmCfUmCfUmCfA m UfC m CfC m UfAm G m U m U 17329 17614 DGAT2_73 m C m Am Cm C m Am GfGf Af Am C mUmAmUmAmUmCmUmUmU m AfAm AfGm Af U m Af U m AfGm UfU mCfCmUfGmGfUmGmUmU 17330 17615 DGAT2_74 m G m U m G m G m C m AfAf Uf G m C m U m Am U m C m Am U m C m Am U mAfUmGfAmUfGmAfUmAfGmCfA m Uf U m GfC m CfAm C m U m U 17331 17616 DGAT2_75 mGmUmGmUmUmGfAfGfGmG mAmGmUmAmCmCmUmGmA mUfCmAfGmGfUmAfCmUfCmCfC m UfCm AfAmCfAmCm Um U 17332 17617 DGAT2_76 m C m Am Gm U m U m Af Gf Af U m G mAmUmUmCmAmCmUmUmU mAfAmAfGmUfGmAfAmUfCmAfU m Cf U m AfAm Cf U m G m U m U 17333 17618 DGAT2_77 m G m U m U m Cm U m Gf Uf UfAm U mCmUmCmUmUmGmAmUmG mCfAmUfCmAfAmGfAmGfAmUfA m AfCm AfGm AfAmCm Um U 17334 17619 DGAT2_78 m U m G m U m Cm Am GfAfCf U m U m U m U m G m U m Am U m Am U m G m CfAm UfAm UfAm CfAm AfAm Af G m UfC m UfG m AfC m Am U m U 17335 17620 DGAT2_79 mUmGmGmGmUmGfUfCfUmG mUmGmGmGmUmUmAmUmU m AfAm UfAmAfCmCfCmAfCmAfG m AfCm AfCmCfCmAm Um U 17336 17621 DGAT2_80 m U m C m U m G m U m Gf Gf Gf U m U m Am U m U m U m Am Am Am Am G m Cf U m Uf U m UfAm AfAm UfAm Af C mCfCm AfCm AfGmAm Um U 17337 17622 DGAT2_81 m C m Am Am Am Gm AfAf UfG m G m G m Am G m U m G m G m C m Am A mUfUmGfCmCfAmCfUmCfCmCfA m Uf U m Cf U m Uf U m G m U m U 17338 17623 DGAT2_82 m G m C m U m G m U m Gf Cf Uf C m U mAmCmUmUmCmAmCmUmU m AfAm Gf U m GfAm Af G m UfAm GfA m Gf C m Af C m Af G m C m U m U 17339 17624 DGAT2_83 m G m Am Am U m G m AfAfGf U m G mUmAmCmAmAmGmCmAmG m CfU m GfCm UfU m GfU m AfCm AfC m Uf U m CfAm Uf U m C m U m U 17340 17625 DGAT2_84 m C m U m Cm U m G m UfAfAfAm U m U m U m G m G m Am Am G m U m G m CfAm CfU m UfC m CfAm AfAm UfU m UfAm CfAm GfAm G m U m U 17341 17626 DGAT2_85 m C m Am U m Gm G m Af UfGf C m A mGmCmAmCmAmGmAmCmU mAfGmUfCmUfGmUfGmCfUmGf CmAfUmCfCmAfUmGmUmU 17342 17627 DGAT2_86 m C m C m U m Am G m Uf CfAf C m U m C m Am U m Am U m C m G m G m A mUfCmCfGmAfUmAfUmGfAmGfU m GfAm Cf U m Af G m G m U m U 17343 17628 DGAT2_87 mGmCmAmGmAmUfUfAfGmU mUmCmCmAmAmAmGmCmA mUfGmCfUmUfUmGfGmAfAmCfU mAfAmUfCmUfGmCmUmU 17344 17629 DGAT2_88 m U m G m Am G m G m GfAf Gf U m A mCmCmUmGmAmUmGmUmC mGfAmCfAmUfCmAfGmGfUmAfC m UfC m CfC m UfC m Am U m U 17345 17630 DGAT2_89 m G m U m C m Am G m Af Cf Uf U m U m U m G m U m Am U m Am U m G m C m GfC m Af U m Af U m Af C m AfAm AfA mGfUmCfUmGfAmCmUmU 17346 17631 DGAT2_90 mGmGmUmGmCmCfUfUfCmU mGmCmAmAmCmUmUmCmA mUfGmAfAmGfUmUfGmCfAmGfA m Af G m Gf C m Af C m C m U m U 17347 17632 DGAT2_91 m C m G m C m U m C m Gf UfCf U m A mGmUmCmCmUmGmAmAmA mUfUmUfCmAfGmGfAmCfUmAfG m Af C m GfAm Gf C m G m U m U 17348 17633 DGAT2_92 mUmUmGmCmCmCfUfGfUmU mCmUmAmGmGmUmGmGmU m AfC m CfAm CfC m UfAm GfAm Af C m Af G m Gf G m Cf Am Am U m U 17349 17634 DGAT2_93 mCmUmGmUmUmCfUfAfGmG mUmGmGmUmGmGmCmUmA mUfAmGfCmCfAmCfCmAfCmCfU m Af G m AfA m CfA m G m U m U 17350 17635 DGAT2_94 m U m C m Am U m G m UfAfCfAm U mAmUmUmCmUmGmCmAmC m GfU m GfC m AfG m AfAm UfAm UfG m UfAm CfAm Uf G m Am U m U 17351 17636 DGAT2_95 m C m U m G m Gm C m AfAfGfAm A m U m G m C m Am G m U m Cm Am C m GfU m GfAm CfU m GfC m Af U m Uf C m Uf U m GfC m CfAm G m U m U 17352 17637 DGAT2_96 m U m G m Am C m C m Af Cf CfAm G mGmAmAmCmUmAmUmAmU mAfUmAfUmAfGmUfUmCfCmUfG m Gf U m Gf G m Uf C m Am U m U 17353 17638 DGAT2_97 m C m U m G m U m G m Uf UfGfAm G mGmGmAmGmUmAmCmCmU mAfGmGfUmAfCmUfCmCfCmUfC m AfAm CfAm CfAm G m U m U 17354 17639 DGAT2_98 m U m U m Um Cm Am AfAfGfAm A mUmGmGmGmAmGmUmGmG mCfCmAfCmUfCmCfCmAfUmUfC m Uf U m UfG m AfAm Am U m U 17355 17640 DGAT2_99 m Gm U m Am Cm Am AfGfCfAmG mGmUmGmAmUmCmUmUmC mGfAmAfGmAfUmCfAmCfCmUfG m Cf U m UfG m UfAm C m U m U 17356 17641 DGAT2_10 0 m C m U m G m Am U m Gf UfCf U m G m G m Am G m Gm U m Am U m C m U mAfGmAfUmAfCmCfUmCfCmAfG m Af C m Af U m CfAm G m U m U 17357 17642 DGAT2_10 1 m C m U m U m U m U m Gf UfAf U m A mUmGmCmCmUmUmGmAmA mUfUmCfAmAfGmGfCmAfUmAfU m AfCm AfAmAfAmGm Um U 17358 17643 DGAT2_10 2 m U m Am G m G m U m Gf GfAf G m U mAmAmCmUmGmGmUmUmU mAfAmAfCmCfAmGfUmUfAmCfU m CfC m AfC m Cf U m Am U m U 17359 17644 DGAT2_10 3 m G m C m U m Am G m Gf UfGf G m A mGmUmAmAmCmUmGmGmU mAfCmCfAmGfUmUfAmCfUmCfC m Af C m Cf U m Af G m C m U m U 17360 17645 DGAT2_10 m G m G m Am Gm U m Gf GfCfAm A m Af U m GfAm UfAm GfC m Af U m UfG 4 mUmGmCmUmAmUmCmAmU m CfC m AfC m UfC m C m U m U 17361 17646 DGAT2_10 5 mUmUmAmCmCmUfGfGfCmU mAmCmAmCmUmGmGmCmA mUfGmCfCmAfGmUfGmUfAmGfC m Cf Am GfG m Uf Am Am U m U 17362 17647 DGAT2_10 6 mUmUmUmCmUmUfGfGfGmU mGmGmCmUmGmAmUmGmA mUfCmAfUmCfAmGfCmCfAmCfC mCfAm AfGm AfAmAm Um U 17363 17648 DGAT2_10 7 mCmUmAmGmGmUfGfGfUmG mGmCmUmAmAmAmUmCmU mAfGmAfUmUfUmAfGmCfCmAfC m CfAm CfC m UfAm G m U m U 17364 17649 DGAT2_10 8 mUmCmGmUmCmUfAfGfUmC mCmUmGmAmAmAmCmUmG mCfAmGfUmUfUmCfAmGfGmAfC m UfAm GfAm CfG m Am U m U 17365 17650 DGAT2_10 9 mUmCmUmGmUmUfAfUfCmU mCmUmUmGmAmUmGmAmG mCfUmCfAmUfCmAfAmGfAmGfA m UfAm AfCmAfGmAm Um U 17366 17651 DGAT2_11 0 m Cm U m Cm Am U mGf UfAfCm A mUmAmUmUmCmUmGmCmA m UfG m CfAm GfAm Af U m Af U m Gf U m Af C m Af U m GfAm G m U m U 17367 17652 DGAT2_11 1 mUmCmUmAmGmGfUfGfGmU mGmGmCmUmAmAmAmUmC mGfAmUfUmUfAmGfCmCfAmCfC m AfC m Cf U m AfG m Am U m U 17368 17653 DGAT2_11 2 m C m Am Gm U m Am Gf Uf Af G m G mCmAmUmCmUmGmGmAmA mUfUmCfCmAfGmAfUmGfCmCfU m AfC m UfAm CfU m G m U m U 17369 17654 DGAT2_11 3 mGmCmUmGmGmUfGfUfUmU mGmAmCmUmGmGmAmAmC mGfUmUfCmCfAmGfUmCfAmAfA m CfAm Cf C m Af G m C m U m U 17370 17655 DGAT2_11 4 mUmUmAmCmCmUfUfCfCmC mCmAmGmAmUmCmCmUmA mUfAmGfGmAfUmCfUmGfGmGf G m AfAm GfG m UfAm Am U m U 17371 17656 DGAT2_11 5 mUmGmGmCmUmGfAfUfGmA mCmAmUmGmGmAmUmGmC mGfCmAfUmCfCmAfUmGfUmCfA m UfC m AfG m CfC m Am U m U 17372 17657 DGAT2_11 6 mGmCmCmUmCmAfCfUfUmU mUmCmUmGmUmGmCmCmU m Af G m Gf C m Af C m Af G m AfA m AfA m Gf U m GfAm GfG m C m U m U 17373 17658 DGAT2_11 7 mGmUm UmCmC m Af GfAfAm A mUmAmCmAmUmUmGmGmU mAfCmCfAmAfUmGfUmAfUmUfU m Cf U m Gf G m AfAm C m U m U 17374 17659 DGAT2_11 8 mUmUmGmGmGmUfGfGfCmU mGmAmUmGmAmCmAmUmG mCfAm UfGmUfCmAfUmCfAmGfC m CfAm CfC m CfAm Am U m U 17375 17660 DGAT2_11 9 m G m C m Am G m U m Af Gf UfAm G mGmCmAmUmCmUmGmGmA mUfCmCfAmGfAmUfGmCfCmUfA mCfUmAfCmUfGmCmUmU 17376 17661 DGAT2_12 0 m G m U m Am C m Am UfAf Uf U m C mUmGmCmAmCmUmGmAmU mAfUmCfAmGfUmGfCmAfGmAfA m UfAm UfG m UfAm C m U m U 17377 17662 DGAT2_12 1 m U m C m Cm C m C m Af GfAf U m C mCmUmAmGmAmUmUmCmU mAfGmAfAmUfCmUfAmGfGmAfU m Cf U m Gf G m Gf G m Am U m U 17378 17663 DGAT2_12 2 m G m Am Am G m U m U f Cf Cf Am G mAmAmAmU mAm C mAm U m U m AfAm UfG m UfAm Uf U m Uf Cm Uf G m GfAm AfC m Uf U m C m U m U 17379 17664 DGAT2_12 3 m U m U m U m C m G m Af GfAf C m U mAmCmUmUmUmCmCmCmA mUfGmGfGmAfAmAfGmUfAmGfU m CfU m CfG m AfAmAm U m U 17380 17665 DGAT2_12 4 m U m U m C m C m C m CfAf GfAm U mCmCmUmAmGmAmUmUmC m GfAm Af U m CfU m Af G m GfAm UfC m UfG m GfG m GfAm Am U m U 17381 17666 DGAT2_12 5 m G m G m U m G m G m Cf UfGfAm U mGmAmCmAmUmGmGmAmU mAfUmCfCmAfUmGfUmCfAmUfC m Af G m Cf C m Af C m C m U m U 17382 17667 DGAT2_12 6 m G m U m G m U m Am CfAfAf G m C mAmGmGmUmGmAmUmCmU mAfGmAfUmCfAmCfCmUfGmCfU m UfG m UfAm CfAm C m U m U 17383 17668 DGAT2_12 7 m G m C m Am C m U m GfAf Uf U m G mCmUmGmGmCmUmCmAmU m Af U m GfAm GfC m CfAm Gf C m AfA m Uf C m Af G m Uf G m C m U m U 17384 17669 DGAT2_12 8 m U m G m C m U m G m AfCfCfAm C mCmAmGmGmAmAmCmUmA mUfAmGfUmUfCmCfUmGfGmUf G m Gf U m CfAm GfC m Am U m U 17385 17670 DGAT2_12 9 m G m G m G m Am G m Uf GfGf C m A m Am U m Gm Cm U m Am U m Cm A mUfGmAfUmAfGmCfAmUfUmGfC mCfAmCfUmCfCmCmUmU 17386 17671 DGAT2_13 0 m G m C m Am Am U m Gf Cf U f Am U mCmAmUmCmAmUmCmGmU mAfCmGfAmUfGmAfUmGfAmUfA m Gf C m Af U m Uf G m C m U m U 17387 17672 DGAT2_13 1 m G m C m C m Am U m CfCf Uf Cm A m U m G m U m Am C m Am U m Am U mAfUmAfUmGfUmAfCmAfUmGfA m Gf G m Af U m Gf G m C m U m U 17388 17673 DGAT2_13 2 m U m U m U m G m G m AfGfAf G m A mAmUmGmAmAmGmUmGmU mAfCmAfCmUfUmCfAmUfUmCfU m CfU m CfC m AfAmAm U m U 17389 17674 DGAT2_13 3 m G m Am G m U m G m Gf CfAfAm U mGmCmUmAmUmCmAmUmC mGfAmUfGmAfUmAfGmCfAmUfU m GfC m CfAm Cf U m C m U m U 17390 17675 DGAT2_13 4 m G m Am Am C m Am Cf Af CfC m C mAmAmGmAmAmAmGmGmU mAfCmCfUmUfUmCfUmUfGmGfG m UfG m UfG m Uf U m Cm U m U 17391 17676 DGAT2_13 5 m C m Am U m U m G m CfAfCf Cm A mUmGmUmCmAmGmAmCmU mAfGmUfCmUfGmAfCmAfUmGfG m UfG m CfAm Af U m G m U m U 17392 17677 DGAT2_13 6 mCmUmUmGmGmCfUfGfGmU mGmUmUmUmGmAmCmUmG m CfAm Gf U m CfAm AfAm CfAm CfC m Af G m Cf C m AfA m G m U m U 17393 17678 DGAT2_13 7 m G m U m C m Cm Am GfAfAf G m A mAmGmUmUmCmCmAmGmA mUfCmUfGmGfAmAfCmUfUmCfU m UfC m UfG m Gf Am Cm U m U 17394 17679 DGAT2_13 8 mCmCmCmUmAmGfUfCfAmC mUmCmAmUmAmUmCmGmG mCfCmGfAmUfAmUfGmAfGmUfG m AfC m UfAm Gf G m G m U m U 17395 17680 DGAT2_13 9 m U m G m G m Am Am CfAfCfAm C mCmCmAmAmGmAmAmAmG mCfUmUfUmCfUmUfGmGfGmUf GmUfGmUfUmCfCmAmUmU 17396 17681 DGAT2_14 0 mGmUmGmCmUmCfUfAfCmU mUmCmAmCmUmUmGmGmC mGfCmCfAmAfGmUfGmAfAmGfU m Af G m Af G m CfA m C m U m U 17397 17682 DGAT2_14 1 mCmUmAmCmUmUfCfAfCmU mUmGmGmCmUmGmGmUmG m CfAm CfC m AfG m CfC m AfAm Gf U m GfAm AfG m UfAm G m U m U 17398 17683 DGAT2_14 2 m G m G m U m G m Am AfGfAf C m A m C m Am Cm Am Am C m C m U m G mCfAmGfGmUfUmGfUmGfUmGf UmCfUmUfCmAfCmCmUmU 17399 17684 DGAT2_14 3 m U m G m U m U m G m AfGfGf G m A mGmUmAmCmCmUmGmAmU mAfUmCfAmGfGmUfAmCfUmCfC m Cf U m CfAm AfC m Am U m U 17400 17685 DGAT2_14 4 m G m G m C m U m C m AfGfCf U m A mAmCmCmUmCmUmCmUmU m AfAm GfAm GfAm Gf G m Uf U m AfG m Cf U m GfAm Gf C m C m U m U 17401 17686 DGAT2_14 5 m U m U m G m C m C m Af Uf UfAm G mUmGmAmCmUmUmGmGmA mUfCmCfAmAfGmUfCmAfCmUfA m AfU m GfGm CfAm Am U m U 17402 17687 DGAT2_14 6 m C m Am Am C m Cm Cf Uf Cf U m C mCmUmGmUmGmUmGmUmU m AfAm CfAm CfAm CfAm GfG m Af G m Af G m Gf G m Uf U m G m U m U 17403 17688 DGAT2_14 7 m G m Am G m Cm U m AfGfGf U m G m G m Am G m U m Am Am C m U m G mCfAmGfUmUfAmCfUmCfCmAfC m Cf U m Af G m Cf U m C m U m U 17404 17689 DGAT2_14 8 m U m Am U m U m C m Uf GfCfAm C mUmGmAmUmUmGmCmUmG mCfAmGfCmAfAmUfCmAfGmUfG m CfAm GfAm Af U m Am U m U 17390 17675 DGAT2_14 9 m G m Am Am C m Am Cf Af CfC m C mAmAmGmAmAmAmGmGmU mAfCmCfUmUfUmCfUmUfGmGfG m UfG m UfG m Uf U m Cm U m U 17405 17690 DGAT2_15 0 mGmUmGmGmGmUfUfAfUmU m U mAmAmAmAm GmAmAmA mUfUmUfCmUfUmUfU m AfAm Af U m AfAm CfC m CfAm C m U m U 17406 17691 DGAT2_15 1 m C m A m G m U m U m U fAf Cf C m U mUmCmCmCmCmAmGmAmU mAfUmCfUmGfGmGfGmAfAmGf G m UfAm AfAm Cf U m G m U m U 17407 17692 DGAT2_15 2 m C m C m Am G m U m U f Uf GfAm U mCmUmCmCmCmUmUmCmU m AfG m AfAm GfG m GfAm GfAm UfC m AfA m Af C m U f G m G m U m U 17408 17693 DGAT2_15 3 m G m Am G m Am C m UfAfCf U m U mUmCmCmCmAmUmCmCmA mUfGmGfAmUfGmGfGmAfAmAfG m UfAm Gf U m Cf U m C m U m U 17409 17694 DGAT2_15 4 m C m Am Cm C m C m Cf Uf AfG m U m C m Am Cm U m C m Am U m Am U mAfUmAfUmGfAmGfUmGfAmCfU m Af G m Gf G m Gf U m G m U m U 17410 17695 DGAT2_15 5 m C m U m U m C m C m CfCfAf Gm A m U m C m Cm U m Am G m Am U m U mAfAmUfCmUfAmGfGmAfUmCfU m Gf G m Gf G m AfAm G m U m U 17411 17696 DGAT2_15 6 m G m G m C m U m Am AfAf Uf Cm U mGmGmGmCmCmUmAmAmU mAfUmUfAmGfGmCfCmCfAmGfA m Uf U m UfAm GfC m C m U m U 17412 17697 DGAT2_15 7 m C m U m Am Am Am UfCf UfG m G mGmCmCmUmAmAmUmCmU mAfGmAfUmUfAmGfGmCfCmCfA m GfAm Uf U m UfAm G m U m U 17413 17698 DGAT2_15 8 m C m U m U m U m Am Uf UfGf Cm C mAmCmUmAmCmCmCmCmA mUfGmGfGmGfUmAfGmUfGmGf Cm AfAm UfAm AfAmGm Um U 17414 17699 DGAT2_15 9 m C m U m Cm Am U m AfCfAfAm G mCmCmCmCmUmUmUmAmU mAfUmAfAmAfGmGfGmGfCmUfU m GfU m AfU m GfAm Gm U m U 17415 17700 DGAT2_16 0 m C m U m U m C m U m CfAf UfAm C mAmAmGmCmCmCmCmUmU mAfAmGfGmGfGmCfUmUfGmUfA mUfGmAfGm AfAmGm UmU 17416 17701 DGAT2_16 1 mCmGmGmCmUmUfCfCfCmG mCmGmGmGmGmCmCmGmU m AfC mGfGmCfCmCfCmGfCmGf G m GfAm AfG m CfC m G m U m U 17417 17702 DGAT2_16 2 mGmCmUmUmCmCfCfGfCmG mGmGmGmCmCmGmUmGmA m Uf C m AfC mGfGmCfCmCfCmGfC m GfG m GfAm AfG m C m U m U 17418 17703 DGAT2_16 3 m G m G m C m C m G m Uf GfAf C m U mGmGmGmCmGmGmGmCmU m AfG mCfCmCfGmCfCmCfAmGfU m CfAm CfG m GfC m C m U m U 17419 17704 DGAT2_16 4 mGmCmCmGmUmGfAfCfUmG mGmGmCmGmGmGmCmUmU m AfAm GfC m CfC m GfC m CfC m AfG m U f C m Af C m Gf G m C m U m U 17420 17705 DGAT2_16 5 m C m G m U m G m Am Cf UfGf G m G mCmGmGmGmCmUmUmCmA m UfG m AfAm GfC m CfC m GfC m CfC m Af G m U f C m Af C m G m U m U 17421 17706 DGAT2_16 6 mCmUmGmGmGmCfGfGfGmC mUmUmCmAmGmCmCmAmU mAfUmGfGmCfUmGfAmAfGmCfC m CfG m CfC m CfAm G m U m U 17422 17707 DGAT2_16 7 mGmGmGmCmGmGfGfCfUmU m C m Am Gm Cm C m Am U m G m A mUfCmAfUmGfGmCfUmGfAmAfG m Cf C m Cf G m Cf C m C m U m U 17423 17708 DGAT2_16 8 mGmGmCmGmGmGfCfUfUmC mAmGmCmCmAmUmGmAmA mUfUmCfAmUfGmGfCmUfGmAfA m Gf C m Cf C m Gf C m C m U m U 17424 17709 DGAT2_16 m C m G m G m G m Am CfAfCf C m A mAfAmUfAmGfUmCfUmAfUmGfG 9 mUmAmGmAmCmUmAmUmU mUfGmUfCmCfCmGmUmU 17425 17710 DGAT2_17 0 m G m G m G m Am C m AfCfCfAm U mAmGmAmCmUmAmUmUmU m AfAm Af U m Af G m Uf C m UfAm Uf G mGfUmGfUmCfCmCmUmU 17426 17711 DGAT2_17 1 m G m C m U m U m U m CfAfAfAm G mAmAmUmGmGmGmAmGmU mAfCmUfCmCfCmAfUmUfCmUfU m U f G m AfA m Af G m C m U m U 17427 17712 DGAT2_17 2 mGmGmGmUmUmAfUfUfUmA mAmAmAmGmAmAmAmUmU m AfAm Uf U m Uf C m Uf U m Uf U m AfA m Af U m AfAm Cf C m C m U m U 17428 17713 DGAT2_17 3 mCmUmUmCmUmUfCfCfCmU mUmCmCmUmGmAmAmGmU mAfCmUfUmCfAmGfGmAfAmGfG m GfA m Af G m AfA m G m U m U 17429 17714 DGAT2_17 4 mCmCmCmUmUmCfCfUfGmA mAmGmUmGmAmCmAmAmA mUfUmUfGmUfCmAfCmUfUmCfA m Gf G m AfAm Gf G m G m U m U 17430 17715 DGAT2_17 5 mCmAmGmUmCmUfUfCfUmU m G m G m G m G m Am Am G m Am A mUfUmCfUmUfCmCfCmCfAmAfG m AfAm GfAm Cf U m G m U m U 17431 17716 DGAT2_17 6 mCmUmUmCmUmUfGfGfGmG mAmAmGmAmAmGmGmAmU mAfUmCfCmUfUmCfUmUfCmCfC m CfA m Af G m AfA m G m U m U 17432 17717 DGAT2_17 7 mGmAmUmUmCmAfCfUfUmU mUmUmGmCmCmCmCmUmA m UfAm GfG m GfG m CfAm AfAm AfA m GfU m GfAm AfU m Cm U m U 17433 17718 DGAT2_17 8 mGmUmUmUmUmUfCfUfUmG mGmGmUmGmGmCmUmGmA m UfC m AfG m CfC m Af C m Cf C m AfA mGfAm AfAm AfAmCm Um U 17434 17719 DGAT2_17 9 m G m Am Am C m C m Cf Af AfG m C mCmUmCmAmCmUmUmUmU mAfAmAfAmGfUmGfAmGfGmCfU m UfG m GfG m Uf U m C m U m U 17435 17720 DGAT2_18 0 mCmUmCmUmUmCfUfUfCmC mCmUmUmCmCmUmGmAmA mUfUmCfAmGfGmAfAmGfGmGfA m Af G m AfA m GfA m G m U m U 17368 17653 DGAT2_18 1 m C m Am Gm U m Am Gf Uf Af G m G mCmAmUmCmUmGmGmAmA mUfUmCfCmAfGmAfUmGfCmCfU m AfC m UfAm Cf U m G m U m U 17370 17655 DGAT2_18 2 mUmUmAmCmCmUfUfCfCmC mCmAmGmAmUmCmCmUmA mUfAmGfGmAfUmCfUmGfGmGf G m AfAm GfG m UfAm Am U m U 17373 17658 DGAT2_18 3 mGmUm UmCmC m Af GfAfAm A mUmAmCmAmUmUmGmGmU mAfCmCfAmAfUmGfUmAfUmUfU mCfUmGfGm AfAmCm UmU 17376 17661 DGAT2_18 4 m G m U m Am C m Am UfAf Uf U m C mUmGmCmAmCmUmGmAmU mAfUmCfAmGfUmGfCmAfGmAfA m UfAm UfG m UfAm C m U m U 17377 17662 DGAT2_18 5 m U m C m Cm C m C m Af GfAf U m C mCmUmAmGmAmUmUmCmU mAfGmAfAmUfCmUfAmGfGmAfU m Cf U m Gf G m Gf G m Am U m U 17378 17663 DGAT2_18 6 m G m Am Am G m U m U f Cf Cf Am G mAmAmAmU mAm C mAm U m U m AfAm UfG m UfAm Uf U m Uf Cm Uf G m GfAm AfC m UfU m C m U m U 17379 17664 DGAT2_18 7 m U m U m U m C m G m Af GfAf C m U mAmCmUmUmUmCmCmCmA mUfGmGfGmAfAmAfGmUfAmGfU m Cf U m CfG m AfAm Am U m U 17382 17667 DGAT2_18 8 m G m U m G m U m Am CfAfAf G m C mAmGmGmUmGmAmUmCmU mAfGmAfUmCfAmCfCmUfGmCfU m UfG m UfAm CfAm C m U m U 17385 17670 DGAT2_18 9 m G m G m G m Am G m Uf GfGf C m A m Am U m Gm Cm U m Am U m Cm A mUfGmAfUmAfGmCfAmUfUmGfC mCfAmCfUmCfCmCmUmU 17386 17671 DGAT2_19 0 m G m C m Am Am U m Gf Cf U f Am U mCmAmUmCmAmUmCmGmU mAfCmGfAmUfGmAfUmGfAmUfA m Gf C m Af U m Uf G m C m U m U 17387 17672 DGAT2_19 1 m G m C m C m Am U m CfCf Uf Cm A m U m G m U m Am C m Am U m Am U mAfUmAfUmGfUmAfCmAfUmGfA m Gf G m Af U m Gf G m C m U m U 17391 17676 DGAT2_19 2 m C m Am U m U m G m CfAfCf Cm A mUmGmUmCmAmGmAmCmU mAfGmUfCmUfGmAfCmAfUmGfG m UfG m CfAm Af U m G m U m U 17393 17678 DGAT2_19 3 m G m U m C m Cm Am GfAfAf G m A m Am G m U m U m C m C m Am G m A mUfCmUfGmGfAmAfCmUfUmCfU m UfC m UfG m Gf Am Cm U m U 17399 17684 DGAT2_19 4 m U m G m U m U m G m AfGfGf G m A mGmUmAmCmCmUmGmAmU mAfUmCfAmGfGmUfAmCfUmCfC m Cf U m CfAm AfC m Am U m U 17402 17687 DGAT2_19 5 m C m Am Am C m Cm Cf Uf Cf U m C mCmUmGmUmGmUmGmUmU m AfAm CfAm CfAm CfAm GfG m Af G m Af G m Gf G m Uf U m G m U m U 17436 17721 DGAT2_19 6 m C m U m U m C m Am Cf Uf Uf Gm G mCmUmGmGmUmGmUmUmU m AfAm AfC m Af C m CfAm Gf C m CfA m Af G m U f G m AfA m G m U m U 17437 17722 DGAT2_19 7 mCmUmCmGmUmCfUfAfGmU m C m C m U m G m Am Am Am Cm U mAfGmUfUmUfCmAfGmGfAmCfU m Af G m Af C m GfA m G m U m U 17438 17723 DGAT2_19 8 m G m Am G m Cm Am Gf CfAf G m A mUmUmAmGmUmUmCmCmA mUfGmGfAmAfCmUfAmAfUmCfU mGfCmUfGmCfUmCmUmU 17439 17724 DGAT2_19 9 m G m Am G m Gm G m Af Gf UfAm C mCmUmGmAmUmGmUmCmU mAfGmAfCmAfUmCfAmGfGmUfA mCfUmCfCmCfUmCmUmU 17440 17725 DGAT2_20 0 m C m U m G m Am C m Cf UfGf G m U mUmCmCmCmAmUmCmUmA mUfAmGfAmUfGmGfGmAfAmCfC m Af G m Gf U m CfAm G m U m U 17441 17726 DGAT2_20 1 m G m Am Cm U m G m GfAfAf C mA mCmAmCmCmCmAmAmGmA mUfCmUfUmGfGmGfUmGfUmGf UmUfCmCfAmGfUmCmUmU 17442 17727 DGAT2_20 2 m U m U m G m Am G m Gf GfAf G m U mAmCmCmUmGmAmUmGmU mAfCmAfUmCfAmGfGmUfAmCfU m CfC m Cf U m CfAm Am U m U 17443 17728 DGAT2_20 3 mGmCmAmAmGmAfAfUfGmC mAmGmUmCmAmCmCmCmU mAfGmGfGmUfGmAfCmUfGmCfA m Uf U m Cf U m UfG m Cm U m U 17444 17729 DGAT2_20 4 m G m Am Am U m G m Gf Gf Af G m U mGmGmCmAmAmUmGmCmU mAfGmCfAmUfUmGfCmCfAmCfU mCfCmCfAmUfUmCmUmU 17445 17730 DGAT2_20 5 m G m Am Am U m G m CfCf Uf G m U mGmUmUmGmAmGmGmGmA mUfCmCfCmUfCmAfAmCfAmCfA m GfG m CfAm Uf U m Cm U m U 17446 17731 DGAT2_20 6 m U m U m Cm G m Am GfAfCf U m A mCmUmUmUmCmCmCmAmU m Af U m GfG m GfAm AfAm Gf U m AfG m UfC m UfC m GfAm Arn U m U 17447 17732 DGAT2_20 7 m C m U m U m U m C m GfAf GfAm C mUmAmCmUmUmUmCmCmC m GfG m GfAm AfAm Gf U m Af G m Uf C mUfCmGfAmAfAmGmUmU 17448 17733 DGAT2_20 8 m C m Am Am G m G m Gf Cf Uf U m U m G m U m G m Am Am Am C m U m G m CfAm Gf U m Uf U m CfAm CfAm AfA mGfCmCfCmUfUmGmUmU 17449 17734 DGAT2_20 9 m C m Am Am U m U m Uf Uf GfC m U mAmAmAmCmCmAmUmUmA mUfAmAfUmGfGmUfUmUfAmGfC mAfAmAfAmUfUmGmUmU 17450 17735 DGAT2_21 0 mCmAmGmAmCmUfUfUfUmG mUmAmUmAmUmGmCmCmU mAfGmGfCmAfUmAfUmAfCmAfA mAfAmGfUmCfUmGmUmU 17451 17736 DGAT2_21 1 mGmAmAmAmGmCfCfAfCmU m U m C m U m C m Am U m Am Cm A mUfGmUfAmUfGmAfGmAfAmGfU mGfGmCfUmUfUmCmUmU 17452 17737 DGAT2_21 2 m Cm Am Gm Gm Am AfCfUfAm U mAmUmCmUmUmUmGmGmA m UfC m CfAm AfAm GfAm UfAm UfA mGfUmUfCmCfUmGmUmU 17453 17738 DGAT2_21 3 m C m Am U m Gm Am Gf Cf UfAm G m G m U m G m G m Am Gm U m Am A mUfUmAfCmUfCmCfAmCfCmUfA mGfCmUfCmAfUmGmUmU 17454 17739 DGAT2_21 4 m C m Am U m Gm U m Af CfAf U m A mUmUmCmUmGmCmAmCmU m AfG m UfG m CfAm GfAm Af U m Af U mGfUmAfCmAfUmGmUmU 17455 17740 DGAT2_21 5 mCmGmCmUmAmCfUfUfUmC m G m Am G m Am C m U m Am C m U mAfGmUfAmGfUmCfUmCfGmAfA mAfGmUfAmGfCmGmUmU 17456 17741 DGAT2_21 6 m C m U m U m C m U m Gf CfAfAm C mUmUmCmAmGmCmAmCmA mUfGmUfGmCfUmGfAmAfGmUfU mGfCmAfGmAfAmGmUmU 17457 17742 DGAT2_21 7 m C m Am Cm C m Am UfGf UfC m A mGmAmCmUmUmUmUmGmU mAfCmAfAmAfAmGfUmCfUmGfA mCfAmUfGmGfUmGmUmU 17458 17743 DGAT2_21 8 mCmUmUmG m Am AfAfAf U mA m Am Am U m G m Am Am Am G m U mAfCmUfUmUfCmAfUmUfUmAfU mUfUmUfCmAfAmGmUmU 17459 17744 DGAT2_21 9 m G m C m C m G m Am Uf GfGf G m U mCmCmAmGmAmAmGmAmA mUfUmCfUmUfCmUfGmGfAmCfC mCfAmUfCmGfGmCmUmU 17460 17745 DGAT2_22 0 m G m G m U m C m Am CfAfGf U m G mGmGmUmCmCmGmAmAmA mUfUmUfCmGfGmAfCmCfCmAfC mUfGmUfGmAfCmCmUmU 17461 17746 DGAT2_22 1 m U m G m U m G m G m Gf Uf UfAm U mUmUmAmAmAmAmGmAmA m Uf U m Cf U m Uf U m UfAm AfAm UfA mAfCmCfCmAfCmAmUmU 17462 17747 DGAT2_22 2 m U m U m G m Am C m UfGfGfAm A mCmAmCmAmCmCmCmAmA m Uf U m GfG m Gf U m Gf U m Gf U m Uf C m CfAm Gf U m CfAm Am U m U 17463 17748 DGAT2_22 3 m C m G m Am Am C m Cf Cf Af Am G mCmCmUmCmAmCmUmUmU mAfAmAfGmUfGmAfGmGfCmUfU mGfGmGfUmUfCmGmUmU 17464 17749 DGAT2_22 4 mAmAmAmGmAmAfUfGfGmG mAmGmUmGmGmCmAmAmU mAfUmUfGmCfCmAfCmUfCmCfC mAfUmUfCmUfUmUmUmU 17465 17750 DGAT2_22 5 m U m U m U m Am C m Cf Uf Uf Cm C mCmCmAmGmAmUmCmCmU mAfGmGfAmUfCmUfGmGfGmGf AmAfGmGfUmAfAmAmUmU 17466 17751 DGAT2_22 6 m C m Am Gm U m U m UfGf Af U m C mUmCmCmCmUmUmCmUmG m CfAm GfAm AfG m GfG m Af G m Af U m CfAm AfAm CfUmGmUmU 17467 17752 DGAT2_22 7 m U m C m Am C m C m Cf Cf UfAm G mUmCmAmCmUmCmAmUmA mUfAmUfGmAfGmUfGmAfCmUfA mGfGmGfGmUfGmAmUmU 17468 17753 DGAT2_22 8 m U m C m Am G m U m U f UfAf C m C mUmUmCmCmCmCmAmGmA mUfCmUfGmGfGmGfAmAfGmGf UmAfAmAfCmUfGmAmUmU 17469 17754 DGAT2_22 9 m C m C m U m Am G m Gf GfAf U m G mAmGmAmGmGmCmGmAmA mUfUmCfGmCfCmUfCmUfCmAfU mCfCmCfUmAfGmGmUmU 17470 17755 DGAT2_23 0 m Am C m U m C m Am Gf Uf Cf U m U mCmUmUmGmGmGmGmAmA mUfUmCfCmCfCmAfAmGfAmAfG mAfCmUfGmAfGmUmUmU 17471 17756 DGAT2_23 1 m U m U m U m G m Am UfCf Uf Cm C mCmUmUmCmUmGmCmCmA m Uf G m Gf C m AfG m AfAm Gf G m GfA mGfAmUfCmAfAmAmUmU 17472 17757 DGAT2_23 2 m U m G m G m C m U m AfAfAf U m C mUmGmGmGmCmCmUmAmA mUfUmAfGmGfCmCfCmAfGmAfU mUfUmAfGmCfCmAmUmU 17473 17758 DGAT2_23 3 m G m U m G m G m C m UfAfAfAm U mCmUmGmGmGmCmCmUmA mUfAmGfGmCfCmCfAmGfAmUfU mUfAmGfCmCfAmCmUmU 17474 17759 DGAT2_23 m G m Am G m Cm U m GfAfCf C m U m Af U m Gf G m GfAm Af C m CfAm Gf G 4 mGmGmUmUmCmCmCmAmU mUfCmAfGmCfUmCmUmU 17475 17760 DGAT2_23 5 mGmAmAmAmCmUfCfAfGmU mCmUmUmCmUmUmGmGmG m CfC m CfAm AfG m AfAm GfAm Cf U m GfAm GfU m UfU m Cm U m U 17476 17761 DGAT2_23 6 mGmGmAmGmGmUfAfUfCmU mGmCmCmCmUmGmUmCmA m Uf G m Af C m AfG m Gf G m CfAm GfA mUfAmCfCmUfCmCmUmU 17477 17762 DGAT2_23 7 mUmUmUmGmAmCfUfGfGmA mAmCmAmCmAmCmCmCmA mUfGmGfGmUfGmUfGmUfUmCf C m AfG m UfC m AfAm Am U m U 17478 17763 DGAT2_23 8 mGmCmCmUmAmAfUfCfUmG mGmGmUmGmGmCmUmCmA m Uf G m AfG m Cf C m Af C m Cf C m Af G m Af U m UfAm Gf G m C m U m U 17479 17764 DGAT2_23 9 mGmCmCmGmGmGfAfCfAmC mCmAmUmAmGmAmCmUmA m UfAm Gf U m Cf U m Af U m Gf G m Uf G m Uf C m Cf C m Gf G m C m U m U 17480 17765 DGAT2_24 0 m Am Am U m G m G m GfAfGf U m G mGmCmAmAmUmGmCmUmA mUfAmGfCmAfUmUfGmCfCmAfC m Uf C m Cf C m Af U m U m U m U 17481 17766 DGAT2_24 1 m G m C m Am G m G m AfGfGf U m C mAmCmAmGmUmGmGmGmU mAfCmCfCmAfCmUfGmUfGmAfC mCfUmCfCmUfGmCmUmU 17482 17767 DGAT2_24 2 mGmGmCmCmGmAfUfGfGmG m U m C m Cm Am G m Am Am G m A mUfCmUfUmCfUmGfGmAfCmCfC m Af U m Cf G m Gf C m C m U m U 17483 17768 DGAT2_24 3 m G m G m Am Gm C m Af CfCf C m A mAmCmCmCmAmGmCmAmA mUfUmGfCmUfGmGfGmUfUmGf GmGfUmGfCmUfCmCmUmU 17484 17769 DGAT2_24 4 mGmGmCmUmGmGfUfGfCmC mCmUmAmCmUmCmCmAmA mUfUmGfGmAfGmUfAmGfGmGf C m Af C m CfAm Gf C m C m U m U 17485 17770 DGAT2_24 5 m Am C m U m Gm G m AfAfCfAm C mAmCmCmCmAmAmGmAmA mUfUmCfUmUfGmGfGmUfGmUf GmUfUmCfCmAfGmUmUmU 17486 17771 DGAT2_24 6 mCmUmGmCmUmGfGfGfGmU mCmUmAmGmGmCmUmGmU m AfC m AfG m CfC m UfAm GfAm CfC m Cf C m Af G m CfAm G m U m U 17487 17772 DGAT2_24 7 mCmUmGmGmGmUfGfCfCmU mUmCmUmGmCmAmAmCmU mAfGmUfUmGfCmAfGmAfAmGfG m CfAm CfC m CfAm G m U m U 17488 17773 DGAT2_24 8 mAmUmAmCmAmUfUfGfGmU mUmUmCmGmCmCmCmCmA m UfG m GfG m GfC m GfAm AfAm CfC m AfAm UfG m UfAm U m U m U 17489 17774 DGAT2_24 9 m G m C m U m Am Am Af Uf Cf U m G mGmGmCmCmUmAmAmUmC mGfAmUfUmAfGmGfCmCfCmAfG m Af U m Uf U m Af G m C m U m U 17490 17775 DGAT2_25 0 mGmGmGmCmCmUfAfAfUmC mUmGmGmGmUmGmGmCmU m AfG m Cf C m AfC mCfCmAfGmAfU m UfAm GfG m CfC m Cm U m U 17491 17776 DGAT2_25 1 mGmAmAmAmCmUfGfGfCmC mCmUmGmCmGmUmCmAmU m Af U m GfAm CfG m CfAm GfG m GfC m CfAm Gf U m Uf U m C m U m U 17492 17777 DGAT2_25 2 mGmCmCmUmGmGfGfUfGmC mCmUmUmCmUmGmCmAmA mUfUmGfCmAfGmAfAmGfGmCfA m Cf C m CfAm Gf G m C m U m U 17493 17778 DGAT2_25 3 m U m C m U m C m Am UfAf CfAm A mGmCmCmCmCmUmUmUmA mUfAmAfAmGfGmGfGmCfUmUfG m UfAm UfG m AfG m Am U m U 17494 17779 DGAT2_25 4 m C m Am Am G m C m Cf Cf Af U m C mAmCmCmAmCmUmGmUmU mAfAmCfAmGfUmGfGmUfGmAfU mGfGmGfCmUfUmGmUmU 17495 17780 DGAT2_25 5 m G m U m C m C m G m AfAfAf C m U mGmGmGmCmUmGmUmGmU m AfC m AfC mAfGmCfCmCfAmGfU m Uf U m CfG m Gf Am Cm U m U 17496 17781 DGAT2_25 6 m C m C m Cm U m Am Gf GfGfAm U m G m Am G m Am G m G m Cm G m A mUfCmGfCmCfUmCfUmCfAmUfC m CfC m UfAm GfG m Gm U m U 17497 17782 DGAT2_25 7 m Am U m Gm Gm Gm UfGfUfCm U mGmUmGmGmGmUmUmAmU m Af U m AfAm CfCmCfAmCfAmGfA m CfAm CfC m CfAm U m U m U 17498 17783 DGAT2_25 8 m G m C m U m U m U m Gf UfGfAm A mAmCmUmGmGmCmCmCmU mAfGmGfGmCfCmAfGmUfUmUfC m AfCm AfAmAfGmCm Um U 17499 17784 DGAT2_25 9 m G m G m G m U m G m Gf Cf Uf G m A mUmGmAmCmAmUmGmGmA mUfCmCfAmUfGmUfCmAfUmCfA mGfCmCfAmCfCmCmUmU 17500 17785 DGAT2_26 0 mCmCmAmAmCmCfCfUfCmU mCmCmUmGmUmGmUmGmU m AfC m AfC m Af C m Af G m GfAm GfA mGfGmGfUmUfGmGmUmU 17501 17786 DGAT2_26 1 m C m Am Gm U m U m Gf CfCf C m C mGmUmUmGmUmGmUmGmA mUfCmAfCmAfCmAfAmCfGmGfG m Gf C m AfAm Cf U m G m U m U 17502 17787 DGAT2_26 2 m G m G m U m G m G m Cf UfAfAm A mUmCmUmGmGmGmCmCmU mAfGmGfCmCfCmAfGmAfUmUfU m Af G m Cf C m Af C m C m U m U 17503 17788 DGAT2_26 3 mAmUmGmGmGmAfGfUfGmG mCmAmAmUmGmCmUmAmU mAfUmAfGmCfAmUfUmGfCmCfA mCfUmCfCmCfAmUmUmU 17504 17789 DGAT2_26 4 m C m C m U m C m Am Cf CfCf Cm U mAmGmUmCmAmCmUmCmA mUfGmAfGmUfGmAfCmUfAmGfG m GfG m UfG m AfG m G m U m U 17505 17790 DGAT2_26 5 m C m C m Cm Am Am GfCf UfG m G mAmGmCmAmCmCmCmAmA mUfUmGfGmGfUmGfCmUfCmCf AmGfCmUfUmGfGmGmUmU 17506 17791 DGAT2_26 6 mGmUmCmUmGmGfAfGfGmU mAmUmCmUmGmCmCmCmU m AfG m GfG m CfAm GfAm UfAm CfC m UfC m CfAm GfAm C m U m U 17507 17792 DGAT2_26 7 mAmAmGmUmGmUfCfAfUmG mGmGmUmGmUmCmUmGmU m Af C m Af G m Af C m Af C m Cf C m Af U m GfAm CfAm Cf U m U m U m U 17508 17793 DGAT2_26 8 mCmCmCmUmAmCfUfCfCmA mAmGmCmCmCmAmUmCmA mUfGmAfUmGfGmGfCmUfUmGf G m AfG m UfAm GfG m G m U m U 17509 17794 DGAT2_26 9 mGmGmUmUmUmCfGfCfCmC mCmAmUmGmCmAmUmCmU mAfGmAfUmGfCmAfUmGfGmGf G m Cf G m AfA m Af C m C m U m U 17510 17795 DGAT2_27 0 mGmGmGmCmUmGfUfGfUmG mGmCmGmCmUmAmCmUmU m AfAm Gf U m AfG mCfGmCfC m Af C m Af C m Af G m Cf C m C m U m U 17511 17796 DGAT2_27 1 mCmUmCmAmCmCfCfCfUmA mGmUmCmAmCmUmCmAmU m Af U m GfAm Gf U m GfAm Cf U m AfG m GfG m Gf U m GfAm G m U m U 17512 17797 DGAT2_27 2 mCmCmUmUmCmCfCfCfAmG mAmUmCmCmUmAmGmAmU mAfUmCfUmAfGmGfAmUfCmUfG m Gf G m GfAm Af G m G m U m U 17513 17798 DGAT2_27 3 mGmGmAmGmCmUfGfAfCmC mUmGmGmUmUmCmCmCmA mUfGmGfGmAfAmCfCmAfGmGfU m CfAm GfC m UfC m C m U m U 17514 17799 DGAT2_27 4 m G m G m G m U m C m Cf GfAfAm A mCmUmGmGmGmCmUmGmU mAfCmAfGmCfCmCfAmGfUmUfU m Cf G m GfAm Cf C m C m U m U 17515 17800 DGAT2_27 5 mGmCmUmGmGmGfGfUfCmU mAmGmGmCmUmGmUmUmU m AfAm AfC m Af G m Cf C m UfAm GfA mCfCmCfCmAfGmCmUmU 17516 17801 DGAT2_27 6 m G m U m C m Am U m Gf GfGf U m G mUmCmUmGmUmGmGmGmU m Af C m Cf C m Af C m Af G m Af C m Af C m Cf C m Af U m GfAm C m U m U 17517 17802 DGAT2_27 7 m C m C m G m Am Am Cf CfCfAm A mGmCmCmUmCmAmCmUmU mAfAmGfUmGfAmGfGmCfUmUfG mGfGmUfUmCfGmGmUmU 17518 17803 DGAT2_27 8 mAmCmUmAmCmUfUfUfCmC mCmAmUmCmCmAmGmCmU mAfGmCfUmGfGmAfUmGfGmGf Am AfAm GfU m AfGm U m U m U 17519 17804 DGAT2_27 9 m C m C m Am Am G m Cf Cf Cf Am U mCmAmCmCmAmCmUmGmU mAfCmAfGmUfGmGfUmGfAmUfG mGfGmCfUmUfGmGmUmU 17520 17805 DGAT2_28 0 m G m G m G m G m Am Gf GfAfAm A mCmCmCmAmAmCmCmCmU mAfGmGfGmUfUmGfGmGfUmUf UmCfCmUfCmCfCmCmUmU 17521 17806 DGAT2_28 1 mAmAmCmUmCmAfGfUfCmU mUmCmUmUmGmGmGmGmA m UfC m CfC m CfAm Af G m AfAm GfA m Cf U m GfAm Gf U m U m U m U 17522 17807 DGAT2_28 2 mCmCmUmCmAmGfUfUfUmA mCmCmUmUmCmCmCmCmA mUfGmGfGmGfAmAfGmGfUmAfA m Af C m U f G m Af G m G m U m U 17523 17808 DGAT2_28 3 mCmCmCmAmUmCfCfAfGmC mUmGmGmUmGmAmAmGmA mUfCmUfUmCfAmCfCmAfGmCfU m Gf G m Af U m Gf G m G m U m U 17524 17809 DGAT2_28 4 m G m Am G m Gm U m CfAfCfAm G mUmGmGmGmUmCmCmGmA mUfCmGfGmAfCmCfCmAfCmUfG mUfGmAfCmCfUmCmUmU 17525 17810 DGAT2_28 5 m C m U m G m G m Am Gf Gf UfAm U mCmUmGmCmCmCmUmGmU m AfC m AfG m GfG m CfAm GfAm UfA m CfC m UfC m CfAm G m U m U 17526 17811 DGAT2_28 6 m C m C m U m Am C m Cf UfCfAm C mCmCmCmUmAmGmUmCmA mUfGmAfCmUfAmGfGmGfGmUf G m Af G m Gf U m Af G m G m U m U 17527 17812 DGAT2_28 7 m Am C m C m C m Am Af Gf Cf C m U mCmAmCmUmUmUmUmCmU m AfGm AfAm AfAmGfUmGfAmGfG m Cf U m UfG m GfG m U m U m U 17528 17813 DGAT2_28 8 m G m G m Am Am C m CfGfCfAm A mGmGmGmCmUmUmUmGmU mAfCmAfAmAfGmCfCmCfUmUfG mCfGmGfUmUfCmCmUmU 17529 17814 DGAT2_28 9 m C m C m Cm G m Am Af CfCf Cm A mAmGmCmCmUmCmAmCmU mAfGmUfGmAfGmGfCmUfUmGf GmGfUmUfCmGfGmGmUmU 17530 17815 DGAT2_29 0 m G m C m U m G m Am Cf Cf Uf G m G mUmUmCmCmCmAmUmCmU m AfG m Af U m Gf G m GfAm Af C m CfA m Gf G m U f C m Af G m C m U m U 17531 17816 DGAT2_29 1 m G m U m U m Am G m Af UfGfAm U mUmCmAmCmUmUmUmUmU mAfAmAfAmAfGmUfGmAfAmUfC m AfU m CfU m AfAm C m U m U 17532 17817 DGAT2_29 2 m G m G m Am Am C m UfAf UfAm U mCmUmUmUmGmGmAmUmA m UfAm UfC m CfAm AfAm GfAm UfA m UfAm Gf U m UfC m C m U m U 17533 17818 DGAT2_29 3 mGmAmCmUmAmUfUfUfGmC mUmUmUmCmAmAmAmGmA mUfCmUfUmUfGmAfAmAfGmCfA m AfAm UfAm Gf U m C m U m U 17534 17819 DGAT2_29 4 m C m U m Am U m U m Uf GfCf U m U mUmCmAmAmAmGmAmAmU m Af U m UfC m Uf U m Uf G m AfAm AfG m CfAm AfAm UfAmGmUmU 17535 17820 DGAT2_29 5 m G m C m U m Am Am AfCf CfAm U m U m Am Cm Am Am U m G m U m U m AfAm CfAm Uf U m Gf U m AfAm UfG m Gf U m Uf U m Af G m C m U m U 17536 17821 DGAT2_29 6 m Cm U m Am Am Am CfCfAfU m U mAmCmAmAmUmGmUmUmA m UfAm AfC m Af U m Uf G m UfAm Af U mGfGmUfUm UfAmGmUmU 17537 17822 DGAT2_29 7 m G m G m Am Am Am AfAf Gf U m C mAmGmUmAmUmUmUmCmA mUfGmAfAmAfUmAfCmUfGmAfC mUfUmUfUmUfCmCmUmU 17538 17823 DGAT2_29 8 mGmAmAmAmAmAfGfUfCmA mGmUmAmUmUmUmCmAmA mUfUmGfAmAfAmUfAmCfUmGfA mCfUmUfUmUfUmCmUmU 17539 17824 DGAT2_29 m G m G m Am Gm U m Af AfCf U m G m AfAm GfAm AfAm AfAm CfCm AfG 9 mGmUmUmUmUmUmCmUmU mUfUmAfCmUfCmCmUmU 17540 17825 DGAT2_30 0 m Am U m Am Gm Am CfUfAfU m U mUmGmCmUmUmUmCmAmA mUfUmGfAmAfAmGfCmAfAmAfU m AfG m UfC m UfAm U m U m U Table 18 SEQ ID NOs: ID Sense APO_B SEQ ID NOs: Antisense APO_B 18523 ctrl_ApoB CCUGGACAUUCAGAAC AAGAA 18527 UUCUUGUUCUGAAUGUC CAGG 18524 ctrl_DGAT GUCAUGGGUGUCUGU GGGUUA 16840 UAACCCACAGACACCCA UGAC 18525 ctrl_mTTR AACAGUGUUCUUGCUC UAUAA 18528 UUAUAGAGCAAGAACAC UGUU 18526 ctrl_ANGPTL 3 GCUCAACAUAUUUGAU CAGUA 16811 UACUGAUCAAAUAUGUU GAGC 18521 ctrl_DGAT-1473 UGGGUUAUUUAAAAGA AA 18522 UUUCUUUUAAAUAACCC A 12947 APOB_1 CCCUGAAGUUGAUGUG UUA 13247 UAACACAUCAACUUCAG GG 12948 APOB_2 CUCUCAAACCCUAAGA UUA 13248 UAAUCUUAGGGUUUGAG AG 12949 APOB_3 CCCUAAAGUAUGAGAA CUA 13249 UAGUUCUCAUACUUUAG GG 12950 APOB_4 GCACUGGGGAUGAAGA UUA 13250 UAAUCUUCAUCCCCAGU GC 12951 APOB_5 GGGAACUGUUGAAAGA UUU 13251 AAAUCUUUCAACAGUUC CC 12952 APOB_6 GACAAGAGCUUAUGGG AUU 13252 AAUCCCAUAAGCUCUUG UC 12953 APOB_7 GAUCAAAGUUAAUUGG GAA 13253 UUCCCAAUUAACUUUGA UC 12954 APOB_8 CGAGAGACCCUAGAAG AUA 13254 UAUCUUCUAGGGUCUCU CG 12955 APOB_9 GGAAAAGGGUCAUGGA AAU 13255 AUUUCCAUGACCCUUUU CC 12956 APOB_10 CGGGAAUAUUCAGGAA CUA 13256 UAGUUCCUGAAUAUUCC CG 12957 APOB_11 CCCAUGGUCUUGAGUU AAA 13257 UUUAACUCAAGACCAUG GG 12958 APOB_12 CGUGGGUUCCAAAUUA AUA 13258 UAUUAAUUUGGAACCCA CG 12959 APOB_13 GUACUGGGUUAAUGG UCAA 13259 UUGACCAUUAACCCAGU AC 12960 APOB_14 CCCUGGACAUUCAGAA CAA 13260 UUGUUCUGAAUGUCCAG GG 12961 APOB_15 CAAUGAAGGGAAUUUG AAA 13261 UUUCAAAUUCCCUUCAU UG 12962 APOB_16 GGAAGGGCUCAAAGAA UGA 13262 UCAUUCUUUGAGCCCUU CC 12963 APOB_17 GAAAUGCUAUUGAGGG AAA 13263 UUUCCCUCAAUAGCAUU UC 12964 APOB_18 GGGAGGAGGAACAAAU AAA 13264 UUUAUUUGUUCCUCCUC CC 12965 APOB_19 GUAUAGGGAACUGUUG AAA 13265 UUUCAACAGUUCCCUAU AC 12966 APOB_20 CACGUGGGUUCCAAAU 13266 UUAAUUUGGAACCCACG UAA UG 12967 APOB_21 GCACGUGGGUUCCAAA UUA 13267 UAAUUUGGAACCCACGU GC 12968 APOB_22 GUCCCAGGUAUAUUCG AAA 13268 UUUCGAAUAUACCUGGG AC 12969 APOB_23 GUUCCAUGUCCCAUUU ACA 13269 UGUAAAUGGGACAUGGA AC 12970 APOB_24 GUACUGUCCCAGGUAU AUU 13270 AAUAUACCUGGGACAGU AC 12971 APOB_25 CCAAUUUCCCUGUGGA UCU 13271 AGAUCCACAGGGAAAUU GG 12972 APOB_26 CCAUGGGCAAUAUUAC CUA 13272 UAGGUAAUAUUGCCCAU GG 12973 APOB_27 GGGUCCUUUAUGAUUA UGU 13273 ACAUAAUCAUAAAGGAC CC 12974 APOB_28 GUUCAGGGUGUGGAG UUUA 13274 UAAACUCCACACCCUGA AC 12975 APOB_29 CCCUGAAUGCUAACAC UAA 13275 UUAGUGUUAGCAUUCAG GG 12976 APOB_30 CGGGAAUCUGAUGAG GAAA 13276 UUUCCUCAUCAGAUUCC CG 12977 APOB_31 CCCUAUUCUCUGGUAA CUA 13277 UAG U UACCAGAGAAUAG GG 12978 APOB_32 CAGGAAGGGCUCAAAG AAU 13278 AUUCUUUGAGCCCUUCC UG 12979 APOB_33 CAAACAAUGAAGGGAA UUU 13279 AAAUUCCCUUCAUUGUU UG 12980 APOB_34 GCCCUGAAUGCUAACA CUA 13280 UAGUGUUAGCAUUCAGG GC 12981 APOB_35 GGUAAAAUUCCCUGAA GUU 13281 AACUUCAGGGAAUUUUA CC 12982 APOB_36 CCAUGAUUUCCCUGAC CUU 13282 AAGGUCAGGGAAAUCAU GG 12983 APOB_37 GGAAAUGCUAUUGAGG GAA 13283 UUCCCUCAAUAGCAUUU CC 12984 APOB_38 CACAAACAAUGAAGGG AAU 13284 AUUCCCUUCAUUGUUUG UG 12985 APOB_39 GGAUAUACACUAGGGA GGA 13285 UCCUCCCUAGUGUAUAU CC 12986 APOB_40 CAAGGGUGUUAUUUCC AUA 13286 UAUGGAAAUAACACCCU UG 12987 APOB_41 CCCUAGAAAUCUCAAG CUU 13287 AAGCUUGAGAUUUCUAG GG 12988 APOB_42 CAUUCAAUUGGGAGAG ACA 13288 UGUCUCUCCCAAUUGAA UG 12989 APOB_43 GGGAACACAUGAAUCA CAA 13289 UUGUGAUUCAUGUGUUC CC 12990 APOB_44 GUCAAGGGUUCGGUU CUUU 13290 AAAGAACCGAACCCUUG AC 12991 APOB_45 CUCAAACCCUAAGAUU AAU 13291 AUUAAUCUUAGGGUUUG AG 12992 APOB_46 CACUAAAUUCCCAUGG UCU 13292 AGACCAUGGGAAUUUAG UG 12993 APOB_47 GAAACAACCCAGUCUC AAA 13293 UUUGAGACUGGGUUGU UUC 12994 APOB_48 GCCCUAUUCUCUGGUA ACU 13294 AGUUACCAGAGAAUAGG GC 12995 APOB_49 GUGACAAAUAUGGGCA UCA 13295 UGAUGCCCAUAUUUGUC AC 12996 APOB_50 GGAUUCAUUCUGGGU CUUU 13296 AAAGACCCAGAAUGAAU CC 12997 APOB_51 GGAGGGUAGUCAUAAC AGU 13297 ACUGUUAUGACUACCCU CC 12998 APOB_52 CAAUGGGAAACUACGG CUA 13298 UAGCCGUAGUUUCCCAU UG 12999 APOB_53 CUCAAGACCCAAUUUA ACA 13299 UGUUAAAUUGGGUCUUG AG 13000 APOB_54 CAUUGGUAGAGCAAGG GUU 13300 AACCCUUGCUCUACCAA UG 13001 APOB_55 GGGAUGAAGAUUACAC CUA 13301 UAGGUGUAAUCUUCAUC CC 13002 APOB_56 GAGGGUAGUCAUAACA GUA 13302 UACUGUUAUGACUACCC UC 13003 APOB_57 CCCUCAACUUUUCUAA ACU 13303 AGUUUAGAAAAGUUGAG GG 13004 APOB_58 CAAAGUUAAUUGGGAA GAA 13304 UUCUUCCCAAUUAACUU UG 13005 APOB_59 GGGUUCCAAAUUAAUA GUU 13305 AAC UAUUAAUUUGGAAC CC 13006 APOB_60 CCCUCAAACAGACAUG ACU 13306 AGUCAUGUCUGUUUGAG GG 13007 APOB_61 GGGAACUACAAUUUCA UUU 13307 AAAUGAAAUUGUAGUUC CC 13008 APOB_62 GGUUAACAGGGAAGAU AGA 13308 UCUAUCUUCCCUGUUAA CC 13009 APOB_63 GAAGGGAAGGCAGAGU UUA 13309 UAAACUCUGCCUUCCCU UC 13010 APOB_64 CCCACUUGCUCUCAUC AAA 13310 UUUGAUGAGAGCAAGUG GG 13011 APOB_65 GGGAGGAACUUUGCAC UAU 13311 AUAGUGCAAAGUUCCUC CC 13012 APOB_66 GAGAUUCCCUCCAUUA AGU 13312 ACUUAAUGGAGGGAAUC UC 13013 APOB_67 CCCAGUCUCAAAAGGU UUA 13313 UAAACCUUUUGAGACUG GG 13014 APOB_68 GAUAUACACUAGGGAG GAA 13314 UUCCUCCCUAGUGUAUA UC 13015 APOB_69 GCAGGGCACUUCCAAA AUU 13315 AAUUUUGGAAGUGCCCU GC 13016 APOB_70 CCCAAUUUAACAACAA UGA 13316 UCAUUGUUGUUAAAUUG GG 13017 APOB_71 CUCCAUCCCUGUAAAA GUU 13317 AACUUUUACAGGGAUGG AG 13018 APOB_72 CCCUUCUGAUAGAUGU GGU 13318 ACCACAUCUAUCAGAAG GG 13019 APOB_73 GGGUAGUCAUAACAGU ACU 13319 AGUACUGUUAUGACUAC CC 13020 APOB_74 GGUACUGUCCCAGGUA UAU 13320 AUAUACCUGGGACAGUA CC 13021 APOB_75 CUUUGUGGCUUCCCAU AUU 13321 AAUAUGGGAAGCCACAA AG 13022 APOB_76 GGGAGAGACAAGUUUC ACA 13322 UGUGAAACUUGUCUCUC CC 13023 APOB_77 CGAUGUAUAGGGAACU GUU 13323 AACAGUUCCCUAUACAU CG 13024 APOB_78 GACACCAAUGGGAAGU AUA 13324 UAUACUUCCCAUUGGUG UC 13025 APOB_79 GCCAUGGGCAAUAUUA 13325 AGGUAAUAUUGCCCAUG CCU GC 13026 APOB_80 CCCUAACAGAUUUGAG GAU 13326 AUCCUCAAAUCUGUUAG GG 13027 APOB_81 CUGACACCAAUGGGAA GUA 13327 UACUUCCCAUUGGUGUC AG 13028 APOB_82 CCAUGUCCCAUUUACA GAU 13328 AUCUGUAAAUGGGACAU GG 13029 APOB_83 GCAAAUGCUGACAUAG GGA 13329 UCCCUAUGUCAGCAUUU GC 13030 APOB_84 CAGGGAACACAAUGCA AAA 13330 UUUUGCAUUGUGUUCCC UG 13031 APOB_85 CUGGGUUAAUGGUCAA GUU 13331 AACUUGACCAUUAACCC AG 13032 APOB_86 GGGCAGCUGUAUAGCA AAU 13332 AUUUGCUAUACAGCUGC CC 13033 APOB_87 CAAUUGGGAGAGACAA GUU 13333 AACUUGUCUCUCCCAAU UG 13034 APOB_88 GGGAAUAUUCAGGAAC UAU 13334 AUAGUUCCUGAAUAUUC CC 13035 APOB_89 CAAGAUUGGGCUAAAC GUA 13335 UACGUUUAGCCCAAUCU UG 13036 APOB_90 CCCCAGGACCUUUCAA AUU 13336 AAUUUGAAAGGUCCUGG GG 13037 APOB_91 GACCCAAU U UAACAAC AAU 13337 AUUGUUGUUAAAUUGGG UC 13038 APOB_92 CCCACAUCUCACACAC AAU 13338 AUUGUGUGUGAGAUGU GGG 13039 APOB_93 CCCUGGAUAGCAACAC UAA 13339 UUAGUGUUGCUAUCCAG GG 13040 APOB_94 CCAUUGAGAUUCCCUC CAU 13340 AUGGAGGGAAUCUCAAU GG 13041 APOB_95 GCUGACAUAGGGAAUG GAA 13341 UUCCAUUCCCUAUGUCA GC 13042 APOB_96 CGGAUUCAUUCUGGG UCUU 13342 AAGACCCAGAAUGAAUC CG 13043 APOB_97 CAGCCCUAUUCUCUGG UAA 13343 UUACCAGAGAAUAGGGC UG 13044 APOB_98 CACCAACAAUGGGAAA CUA 13344 UAGUUUCCCAUUGUUGG UG 13045 APOB_99 GAUUGGGCUAAACGUA UGA 13345 UCAUACGUUUAGCCCAA UC 13046 APGB_100 GGGCACUUCCAAAAUU GAU 13346 AUCAAUUUUGGAAGUGC CC 13047 APOB_101 CCCUAGAAGAUACACG AGA 13347 UCUCGUGUAUCUUCUAG GG 13048 APOB_102 CCCUUGUCAACUCUGA UCA 13348 UGAUCAGAGUUGACAAG GG 13049 APOB_103 CUAUGUGUUCCCAAAA GCA 13349 UGCUUUUGGGAACACAU AG 13050 APOB_104 CUGGAAACUCAAGACC CAA 13350 UUGGGUCUUGAGUUUC CAG 13051 APOB_105 CUUCCCAACUCUCAAG UCA 13351 UGACUUGAGAGUUGGG AAG 13052 APOB_106 CGCCGAGGCCCGCGC UGCU 13352 AGCAGCGCGGGCCUCG GCG 13053 APOB_107 GGCCCGCGCUGCUGG CGCU 13353 AGCGCCAGCAGCGCGG GCC 13054 APOB_108 CACCCUGAAAGAGGUG UAU 13354 AUACACCUCUUUCAGGG UG 13055 APOB_109 CCUUUACCCGGAGAAA GAU 13355 AUCUUUCUCCGGGUAAA GG 13056 APOB_110 GUAUGGGAUGGUAGC ACAA 13356 UUGUGCUACCAUCCCAU AC 13057 APOB_111 CAACCCCCUUCUGAUA GAU 13357 AUCUAUCAGAAGGGGGU UG 13058 APOB_112 GGCUUCCCAUAUUGCC AAU 13358 AUUGGCAAUAUGGGAAG CC 13059 APOB_113 GCUUCCCAUAUUGCCA AUA 13359 UAUUGGCAAUAUGGGAA GC 13060 APOB_114 CUUCCCAUAUUGCCAA UAU 13360 AUAUUGGCAAUAUGGGA AG 13061 APOB_115 CUUUUUGGGAAGCAAG GAU 13361 AUCCUUGCUUCCCAAAA AG 13062 APOB_116 GAAGCAAGGAUUUUUC CCA 13362 UGGGAAAAAUCCUUGCU UC 13063 APOB_117 CAAGGAUUUUUCCCAG ACA 13363 UGUCUGGGAAAAAUCCU UG 13064 APOB_118 GAUUUUUCCCAGACAG UGU 13364 ACACUGUCUGGGAAAAA UC 13065 APOB_119 CCCAGACAGUGUCAAC AAA 13365 UUUGUUGACACUGUCUG GG 13066 APOB_120 CAAAGCUUUGUACUGG GUU 13366 AACCCAGUACAAAGCUU UG 13067 APOB_121 CUAAAAGCUGGGAAGC UGA 13367 UCAGCUUCCCAGCUUUU AG 13068 APOB_122 CCCUGAAGUUUGUAAC UCA 13368 UGAGUUACAAACUUCAG GG 13069 APOB_123 CUUCCAAUUUCCCUGU GGA 13369 UCCACAGGGAAAUUGGA AG 13070 APOB_124 CACAUCCCAGAAAACC UCU 13370 AGAGGUUUUCUGGGAU GUG 13071 APOB_125 CCCAGAAAACCUCUUC UUA 13371 UAAGAAGAGGUUUUCUG GG 13072 APOB_126 GAUGGCCGGGUCAAAU AUA 13372 UAUAUUUGACCCGGCCA UC 13073 APOB_127 CGGGUCAAAUAUACCU UGA 13373 UCAAGGUAUAUUUGACC CG 13074 APOB_128 GGGUCAAAUAUACCUU GAA 13374 UUCAAGGUAUAUUUGAC CC 13075 APOB_129 GAGUUCCAAGUCCCUA CUU 13375 AAGUAGGGACUUGGAAC UC 13076 APOB_130 GUUCCAAGUCCCUACU UUU 13376 AAAAGUAGGGACUUGGA AC 13077 APOB_131 CAAGUCCCUACUUUUA CCA 13377 UGGUAAAAGUAGGGACU UG 13078 APOB_132 GUCAAGAUUGAUGGGC AGU 13378 ACUGCCCAUCAAUCUUG AC 13079 APOB_133 GAUAUGAAGAUGGAAC CCU 13379 AGGGUUCCAUCUUCAUA UC 13080 APOB_134 CUAUCACUGGGAAGUG CUU 13380 AAGCACUUCCCAGUGAU AG 13081 APOB_135 CACUGGGAAGUGCUUA UCA 13381 UGAUAAGCACUUCCCAG UG 13082 APOB_136 CAUGAUGGGCUCAUAU GCU 13382 AGCAUAUGAGCCCAUCA UG 13083 APOB_137 CAUACUGGGCAGCUGU AUA 13383 UAUACAGCUGCCCAGUA UG 13084 APOB_138 CUUUUACUCAGUGAGC 13384 UGGGCUCACUGAGUAAA CCA AG 13085 APOB_139 GAGAAGCCCCAAGAAU UUA 13385 UAAAUUCUUGGGGCUUC UC 13086 APOB_140 GCCCCAAGAAUUUACA AUU 13386 AAUUGUAAAUUCUUGGG GC 13087 APOB_141 CCCAAGAAUUUACAAU UGU 13387 ACAAUUGUAAAUUCUUG GG 13088 APOB_142 CACUCCAUUAACCUCC CAU 13388 AUGGGAGGUUAAUGGA GUG 13089 APOB_143 CCAUUAACCUCCCAUU UUU 13389 AAAAAUGGGAGGUUAAU GG 13090 APOB_144 CAUUAACCUCCCAUUU UUU 13390 AAAAAAUGGGAGGUUAA UG 13091 APOB_145 CUCCCAUUUUUUGAGA CCU 13391 AGGUCUCAAAAAAUGGG AG 13092 APOB_146 CAAUUGGGAACUACAA UUU 13392 AAAUUGUAGUUCCCAAU UG 13093 APOB_147 CUAUCCAAGAUUGGGC UAA 13393 UUAGCCCAAUCUUGGAU AG 13094 APOB_148 CCAAGAUUGGGCUAAA CGU 13394 ACGUUUAGCCCAAUCUU GG 13095 APOB_149 GGGUUCACUGUUCCU GAAA 13395 UUUCAGGAACAGUGAAC CC 13096 APOB_150 GUCCCCCUAACAGAUU UGA 13396 UCAAAUCUGUUAGGGGG AC 13097 APOB_151 CAGAUAUAUAUCUCAG GGA 13397 UCCCUGAGAUAUAUAUC UG 13098 APOB_152 GCACAACUCUCAAACC CUA 13398 UAGGGUUUGAGAGUUG UGC 13099 APOB_153 GCUAUUGAGGGAAAAU CAA 13399 UUGAUUUUCCCUCAAUA GC 13100 APOB_154 CUAUUGAGGGAAAAUC AAA 13400 UUUGAUUUUCCCUCAAU AG 13101 APOB_155 CAGAUUCUCAGAUGAG GGA 13401 UCCCUCAUCUGAGAAUC UG 13102 APOB_156 CUCAGAUGAGGGAACA CAU 13402 AUGUGUUCCCUCAUCUG AG 13103 APOB_157 CCACAAACAAUGAAGG GAA 13403 UUCCCUUCAUUGUUUGU GG 13104 APOB_158 CCAUUAAGGUUAACAG GGA 13404 UCCCUGUUAACCUUAAU GG 13105 APOB_159 CAUUAAGGUUAACAGG GAA 13405 UUCCCUGUUAACCUUAA UG 13106 APOB_160 CAGGGAAGAUAGACUU CCU 13406 AGGAAGUCUAUCUUCCC UG 13107 APOB_161 GGGAAGAUAGACUUCC UGA 13407 UCAGGAAGUCUAUCUUC CC 13108 APOB_162 GAACAUUAUGGAGGCC CAU 13408 AUGGGCCUCCAUAAUGU UC 13109 APOB_163 CAUUAUGGAGGCCCAU GUA 13409 UACAUGGGCCUCCAUAA UG 13110 APOB_164 GAUUUCUCUCUAUGGG AAA 13410 UUUCCCAUAGAGAGAAA UC 13111 APOB_165 CUCUCUAUGGGAAAAA ACA 13411 UGUUUUUUCCCAUAGAG AG 13112 APOB_166 CUAUGGGAAAAAACAG GCU 13412 AGCCUGUUUUUUCCCAU AG 13113 APOB_167 GGGAAAAAACAGGCUU GAA 13413 UUCAAGCCUGUUUUUUC CC 13114 APOB_168 CCUGCCAUGGGCAAUA UUA 13414 UAAUAUUGCCCAUGGCA GG 13115 APOB_169 CAAGAAAAAGGGGAUU GAA 13415 UUCAAUCCCCUUUUUCU UG 13116 APOB_170 GAAAAAGGGGAUUGAA GUU 13416 AACUUCAAUCCCCUUUU UC 13117 APOB_171 CAACAAAUUUGUGGAG GGU 13417 ACCCUCCACAAAUUUGU UG 13118 APOB_172 CAACAACCACAAAAGC CCA 13418 UGGGCUUUUGUGGUUG UUG 13119 APOB_173 GCCCAAAUUCCAAUUU UGA 13419 UCAAAAUUGGAAUUUGG GC 13120 APOB_174 GCAUAUAUUCCCUCUG GGA 13420 UCCCAGAGGGAAUAUAU GC 13121 APOB_175 CUAGAGGGCCUCUUUU UCA 13421 UGAAAAAGAGGCCCUCU AG 13122 APOB_176 CAUUCUGGGUCUUUCC AGA 13422 UCUGGAAAGACCCAGAA UG 13123 APOB_177 G UG UACACCAAAAACC CCA 13423 UGGGGUUUUUGGUGUA CAC 13124 APOB_178 GUACACCAAAAACCCC AAU 13424 AUUGGGGUUUUUGGUG UAC 13125 APOB_179 CCAAAAACCCCAAUGG CUA 13425 UAGCCAUUGGGGUUUU UGG 13126 APOB_180 CAAAAACCCCAAUGGC UAU 13426 AUAGCCAUUGGGGUUUU UG 13127 APOB_181 CCCAAUGGCUAUUCAU UCU 13427 AGAAUGAAUAGCCAUUG GG 13128 APOB_182 CCAUCCCUGUAAAAGU UUU 13428 AAAACUUUUACAGGGAU GG 13129 APOB_183 CCCUGUAAAAGUUUUG GCU 13429 AGCCAAAACUUUUACAG GG 13130 APOB_184 CUCCUUGAUUCCCUUU UUU 13430 AAAAAAG G G AAU C AAG G AG 13131 APOB_185 CCUUGAUUCCCUUUUU UGA 13431 UCAAAAAAGGGAAUCAA GG 13132 APOB_186 GAUUCCCUUUUUUGAG AUA 13432 UAUCUCAAAAAAGGGAA UC 13133 APOB_187 GUUUUGGGAACACACA AAA 13433 UUUUGUGUGUUCCCAAA AC 13134 APOB_188 CUUCAGGAAUGGGAAG GAA 13434 UUCCUUCCCAUUCCUGA AG 13135 APOB_189 GCACUAUGUUCAUAAG GGA 13435 UCCCUUAUGAACAUAGU GC 13136 APOB_190 CUAUGUUCAUAAGGGA GGU 13436 ACCUCCCUUAUGAACAU AG 13137 APOB_191 CAGUGAUUAUAUCCCA UAU 13437 AUAUGGGAUAUAAUCAC UG 13138 APOB_192 GUGAUUAUAUCCCAUA UGU 13438 ACAUAUGGGAUAUAAUC AC 13139 APOB_193 GAUUAUAUCCCAUAUG UUU 13439 AAACAUAUGGGAUAUAA UC 13140 APOB_194 GGCCCUUCGUGAAGAA UAU 13440 AUAUUCUUCACGAAGGG CC 13141 APOB_195 GCCCUUCGUGAAGAAU AUU 13441 AAUAUUCUUCACGAAGG GC 13142 APOB_196 CCCUUCGUGAAGAAUA UUU 13442 AAAUAUUCUUCACGAAG GG 13143 APOB_197 GAUCCAGAUGGAAAAG 13443 UCCCUUUUCCAUCUGGA GGA UC 13144 APOB_198 CAGUCAUGAACCCCUA CAU 13444 AUGUAGGGGUUCAUGAC UG 13145 APOB_199 GUCAUGAACCCCUACA UGA 13445 UCAUGUAGGGGUUCAU GAC 13146 APGB_200 GUAAAAGCUCAGUAUA AGA 13446 UCUUAUACUGAGCUUUU AC 13147 APOB_201 CUGAAACUAAAUGAUC UAA 13447 UUAGAUCAUUUAGUUUC AG 13148 APOB_202 CACAAAUUUCUAGAUU CGA 13448 UCGAAUCUAGAAAUUUG UG 13149 APOB_203 GUGAUUGUCAAGAUAA ACA 13449 UGUUUAUCUUGACAAUC AC 13150 APOB_204 GAGAAAUUGGUUGGAU UUA 13450 UAAAUCCAACCAAUUUC UC 13151 APOB_205 GAACUGUUGAAAGAUU UAU 13451 AUAAAUCUUUCAACAGU UC 13152 APOB_206 GAUAAACUUCAAAGAC UUA 13452 UAAGUCUUUGAAGUUUA UC 13153 APOB_207 GUCAAGAAGCUUAAUG AAU 13453 AUUCAUUAAGCUUCUUG AC 13154 APOB_208 CUUAAGCUCUCAAAUG ACA 13454 UGUCAUUUGAGAGCUUA AG 13155 APOB_209 GGAAUAUUCAGGAACU AUU 13455 AAUAGUUCCUGAAUAUU CC 13156 APOB_210 CUUAUCAGCAAGCUAU AAA 13456 UUUAUAGCUUGCUGAUA AG 13157 APOB_211 CUCUGAUUACUAUGAA AAA 13457 UUUUUCAUAGUAAUCAG AG 13158 APOB_212 CUUGACAUGUUGAUAA AGA 13458 UCUUUAUCAACAUGUCA AG 13159 APOB_213 GCUAUACCAAAGAUGA UAA 13459 UUAUCAUCUUUGGUAUA GC 13160 APOB_214 GUCCUUUAUGAUUAUG UCA 13460 UGACAUAAUCAUAAAGG AC 13161 APOB_215 GCAAUGUGGCAACAGA AAU 13461 AUUUCUGUUGCCACAUU GC 13162 APOB_216 GCCUAUAUUGAUAAAA CCA 13462 UGGUUUUAUCAAUAUAG GC 13163 APOB_217 GAUUGUCAAGAUAAAC AAU 13463 AUUGUUUAUCUUGACAA UC 13164 APOB_218 GAACACAUGAAUCACA AAU 13464 AUUUGUGAUUCAUGUGU UC 13165 APOB_219 GAAAUGUGUCCAAAGU ACA 13465 UGUACUUUGGACACAUU UC 13166 APOB_220 GAUAGCAACACUAAAU ACU 13466 AGUAUUUAGUGUUGCUA UC 13167 APOB_221 CAAAAUCAACUUUAAU GAA 13467 UUCAUUAAAGUUGAUUU UG 13168 APOB_222 CAUG GAAU U UAAG UAU GAU 13468 AUCAUACUUAAAUUCCA UG 13169 APOB_223 CAAAGAAGUCAAGAUU GAU 13469 AUCAAUCUUGACUUCUU UG 13170 APOB_224 CUCAAACAGACAUGAC UUU 13470 AAAGUCAUGUCUGUUUG AG 13171 APOB_225 GGAUUACAGUUGCAAA UAU 13471 AUAUUUGCAACUGUAAU CC 13172 APOB_226 CUCAAAAGGUUUACUA AUA 13472 UAUUAGUAAACCUUUUG AG 13173 APOB_227 GAAACAAUGCAUUAGA UUU 13473 AAAUCUAAUGCAUUGUU UC 13174 APOB_228 GAUAACAG GAAGAUAU GAA 13474 UUCAUAUCUUCCUGUUA UC 13175 APOB_229 GAGUGAUUGUCAAGAU AAA 13475 UUUAUCUUGACAAUCAC UC 13176 APOB_230 CAAUUUAACAACAAUG AAU 13476 AUUCAUUGUUGUUAAAU UG 13177 APOB_231 GAAGCAUUAAAACUGU UUU 13477 AAAACAGUUUUAAUGCU UC 13178 APOB_232 CAGAGUUAAUGAUGAA UCU 13478 AGAUUCAUCAUUAACUC UG 13179 APOB_233 CCUUAUCAGCAAGCUA UAA 13479 UUAUAGCUUGCUGAUAA GG 13180 APOB_234 GACUCAAUGGUGAAAU UCA 13480 UGAAUUUCACCAUUGAG UC 13181 APOB_235 GAAGUUGAUGUGUUAA CAA 13481 UUGUUAACACAUCAACU UC 13182 APOB_236 GCCUUAUCAGCAAGCU AUA 13482 UAUAGCUUGCUGAUAAG GC 13183 APOB_237 CAACAACUAUCAUAAG ACA 13483 UGUCUUAUGAUAGUUGU UG 13184 APOB_238 GGCAAUAUUACCUAUG AUU 13484 AAU CAUAG G UAAUAU UG CC 13185 APOB_239 CUAUAUUGAUAAAACC AUA 13485 UAUGGUUUUAUCAAUAU AG 13186 APOB_240 CCUAUAUUGAUAAAAC CAU 13486 AUGGUUUUAUCAAUAUA GG 13187 APOB_241 CACCAAAUCCUAUAAU GAA 13487 UUCAUUAUAGGAUUUGG UG 13188 APOB_242 CAUCAGUUCAGAUAAA CUU 13488 AAGUUUAUCUGAACUGA UG 13189 APOB_243 GAUAACCGUGCCUGAA UCU 13489 AGAUUCAGGCACGGUUA UC 13190 APOB_244 CUACAACAAGUUAAGA UAA 13490 UUAUCUUAACUUGUUGU AG 13191 APOB_245 CAUGAAUCACAAAUUA GUU 13491 AACUAAUUUGUGAUUCA UG 13192 APOB_246 CAAAUUUCUAGAUUCG AAU 13492 AUUCGAAUCUAGAAAUU UG 13193 APOB_247 GCACAAACUAUAAUUC AGA 13493 UCUGAAUUAUAGUUUGU GC 13194 APOB_248 GAUUUCAAGGAAUUGU GUA 13494 UACACAAUUCCUUGAAA UC 13195 APOB_249 GAACAAUCCUCAGAGU UAA 13495 UUAACUCUGAGGAUUGU UC 13196 APOB_250 CCUACAACAAGUUAAG AUA 13496 UAUCUUAACUUGUUGUA GG 13197 APOB_251 CACAAACAGUCUGAAC AUU 13497 AAUGUUCAGACUGUUUG UG 13198 APOB_252 GGAAAAUGGAGCCUAA AGA 13498 UCUUUAGGCUCCAUUUU CC 13199 APOB_253 CCAUGUAGGAAUAAAU GGA 13499 UCCAUUUAUUCCUACAU GG 13200 APOB_254 CUAUCAUAUCCGUGUA AAU 13500 AUUUACACGGAUAUGAU AG 13201 APOB_255 CCAAAAUAACCUUAAU CAU 13501 AUGAUUAAGGUUAUUUU GG 13202 APOB_256 CUUACAACACUAAAGA 13502 UUAUCUUUAGUGUUGUA UAA AG 13203 APOB_257 GAAUUUGAAAGUUCGU UUU 13503 AAAACGAACUUUCAAAU UC 13204 APOB_258 CUUUCUCUCAUGAUUA CAA 13504 UUGUAAUCAUGAGAGAA AG 13205 APOB_259 GUAGAUGAAACCAAUG ACA 13505 UGUCAUUGGUUUCAUCU AC 13206 APOB_260 GUUAACAAAAUAUUCU CAA 13506 UUGAGAAUAUUUUGUUA AC 13207 APOB_261 CAAGUUGAAGGAGACU AUU 13507 AAUAGUCUCCUUCAACU UG 13208 APOB_262 CUACCUUACACAAUAA UCA 13508 UGAUUAUUGUGUAAGGU AG 13209 APOB_263 GUACUCUACCGCUAAA GGA 13509 UCCUUUAGCGGUAGAGU AC 13210 APOB_264 CACUCAUUGAUUUUCU GAA 13510 UUCAGAAAAUCAAUGAG UG 13211 APOB_265 CCACAUUCCUUCCUUU ACA 13511 UGUAAAGGAAGGAAUGU GG 13212 APOB_266 G UACCAUAAG CCAUAU UUU 13512 AAAAUAUGGCUUAUGGU AC 13213 APOB_267 C AAAAG G U U U AC U AAU AUU 13513 AAUAUUAGUAAACCUUU UG 13214 APOB_268 GAACUACGAGCUGACU UUA 13514 UAAAGUCAGCUCGUAGU UC 13215 APOB_269 GACAUGUUGAUAAAGA AAU 13515 AUUUCUUUAUCAACAUG UC 13216 APOB_270 CUUCCUUUACAAUUGA CUU 13516 AAGUCAAUUGUAAAGGA AG 13217 APOB_271 GAAAGAGAUGAAAUUU ACU 13517 AGUAAAUUUCAUCUCUU UC 13218 APOB_272 CUCAAGAAUUCCAUAU GAA 13518 UUCAUAUGGAAUUCUUG AG 13219 APOB_273 CUUACAUCCUGAACAU CAA 13519 UUGAUGUUCAGGAUGUA AG 13220 APOB_274 GCAUCUUCGUGUUUCA ACU 13520 AGUUGAAACACGAAGAU GC 13221 APOB_275 CCAAUAAGAUCAAUAG CAA 13521 UUGCUAUUGAUCUUAUU GG 13222 APOB_276 CAUUCCAUCACAAAUC CUU 13522 AAGGAUUUGUGAUGGAA UG 13223 APOB_277 CCAAAGUCCAUGAGUU AAU 13523 AUUAACUCAUGGACUUU GG 13224 APOB_278 GAUCAAGAACCUGUUA GUU 13524 AACUAACAGGUUCUUGA UC 13225 APOB_279 CAGAUAUUAACAAAAU UGU 13525 ACAAUUUUGUUAAUAUC UG 13226 APOB_280 GAUGUGUUAACAAAAU AUU 13526 AAU AU U U U G U U AAC AC A UC 13227 APOB_281 GAUUCCUUUGCCUUUU GGU 13527 ACCAAAAG G CAAAG GAA UC 13228 APOB_282 CAUUUGUUUAUUGAAA AUA 13528 UAU U U UCAAUAAACAAA UG 13229 APOB_283 GUAUAUUAAAGAUAGU UAU 13529 AUAACUAUCUUUAAUAU AC 13230 APOB_284 GGUUCAAUCAGUAUAA GUA 13530 UACUUAUACUGAUUGAA CC 13231 APOB_285 GCAAUGUCCUACAACA AGU 13531 ACUUGUUGUAGGACAUU GC 13232 APOB_286 GACAUAUAUGAUACAA UUU 13532 AAAUUGUAUCAUAUAUG UC 13233 APOB_287 CUAGAUUCGAAUAUCA AAU 13533 AUUUGAUAUUCGAAUCU AG 13049 APOB_288 CUAUGUGUUCCCAAAA GCA 13534 UGCUUUUGGGAACACAU AG 13235 APOB_289 CAACCUUAAUGAUUUU CAA 13535 UUGAAAAUCAUUAAGGU UG 13236 APOB_290 GAUCAAUUUGUAAGAA AAU 13536 AUUUUCUUACAAAUUGA UC 13237 APOB_291 GAUCAGUAUAUUAAAG AUA 13537 UAUCUUUAAUAUACUGA UC 13238 APOB_292 GUUAUGAUUUACAUGA UUU 13538 AAAUCAUGUAAAUCAUA AC 13239 APOB_293 CCACUUUGGCUAUACC AAA 13539 UUUGGUAUAGCCAAAGU GG 13240 APOB_294 CACAAGAUUGACAAGA AAA 13540 UUUUCUUGUCAAUCUUG UG 13241 APOB_295 GAUGAAAU U UAC U UAU CUU 13541 AAGAUAAGUAAAUUUCA UC 13242 APOB_296 GAUAAAGAAAUUAAAG UCA 13542 UGACUUUAAUUUCUUUA UC 13243 APOB_297 GAAU U UAAG UAUGAU U UCA 13543 UGAAAUCAUACUUAAAU UC 13244 APOB_298 CAUAUAUGAUACAAUU UGA 13544 UCAAAUUGUAUCAUAUA UG 13245 APOB_299 CAACUAAUAGAAGAUA ACA 13545 UGUUAUCUUCUAUUAGU UG 13246 APGB_300 GGAAUCUUAUAUUUGA UCC 13546 GGAUCAAAUAUAAGAUU CC Table 19 fA, fll, fC, fG = 2’-F ribonucleotides and mA, mil, mC, mG = 2’ OMe ribonucleotides. SEQ ID NO ID modified_sense modified_antisense 17826 18129 ctrl_ApoB mCmCmUmGmGmAfCfAfUmU mCmAmGmAmAmCmAmAmG mAmA mUfUmCfUmUfGmUfUmCfUmG fAm AfU mG fU mCfC m AfG mG mG mU 17827 18130 ctrl_DGA T mGmUmCmAmUmGfGfGfUmG mUmCmUmGmUmGmGmGmU mUmA mUfAmAfCmCfCmAfCmAfG mAf CmAfCmCfCmAfUmGfAmCmU mU 17828 18131 ctrl_mTT R mAmAmCmAmGmUfGfUfUmC mUmUmGmCmUmCmUmAmU mAmA mUfU mAfU mAfG mAfG mCfAmAf GmAfAmCfAmCfUmGfUmUmU mU 17829 18132 ctrl_ANG PTL3 mGmCmUmCmAmAfCfAfUmA mUmUmUmGmAmUmCmAmG mUmA mUfAmCfUmGfAmUfCmAfAmAf UmAfUmGfUmUfGmAfGmCmU mU 17256 17541 ctrl_DGAT -1473 mUmGmGmGmUmUfAfUfUmU mAmAmAmAmG mAmAmA mUfUmUfCmUfUmUfUmAfAmAf UmAfAmCfCmCfAmCmA 17830 18133 APOB_1 mCmCmCmUmGmAfAfGfUmU mGmAmUmGmUmGmUmUmA mUfAmAfCmAfCmAfU mCfAmAf CmUfUmCfAmGfGmGmUmU 17831 18134 APOB_2 mCmUmCmUmCmAfAfAfCmC mCmUmAmAmGmAmUmUmA mUfAmAfUmCfUmUfAmGfGmG fUmUfUmGfAmGfAmGmUmU 17832 18135 APOB_3 mCmCmCmUmAmAfAfGfUmA mUmGmAmGmAmAmCmUmA mUfAmGfUmUfCmUfCmAfUmAf CmUfUmUfAmGfGmGmUmU 17833 18136 APOB_4 mGmCmAmCmUmGfGfGfGmA mUfAmAfUmCfUmUfCmAfUmCf mUmGmAmAmGmAmUmUmA CmCfCmAfGmUfGmCmUmU 17834 18137 APOB_5 mGmGmGmAmAmCfUfGfUmU mGmAmAmAmGmAmUmUmU mAfAmAfUmCfUmUfUmCfAmAf CmAfGmUfUmCfCmCmUmU 17835 18138 APOB_6 mGmAmCmAmAmGfAfGfCmU mUmAmUmGmGmGmAmUmU mAfAmUfCmCfCmAfUmAfAmGf CmUfCmUfUmGfUmCmUmU 17836 18139 APOB_7 mGmAmUmCmAmAfAfGfUmU mAmAmUmUmGmGmGmAmA mUfUmCfCmCfAmAfUmUfAmAf CmUfUmUfGmAfUmCmUmU 17837 18140 APOB_8 mCmGmAmGmAmGfAfCfCmC mUmAmGmAmAmGmAmUmA mUfAmUfCmUfUmCfUmAfGmG fGmUfCmUfCmUfCmGmUmU 17838 18141 APOB_9 mGmGmAmAmAmAfGfGfGmU mCmAmUmGmGmAmAmAmU mAfUmUfUmCfCmAfUmGfAmCf CmCfUmUfUmUfCmCmUmU 17839 18142 APOB_10 mCmG mG mG mAmAfUfAfU mU mCmAmGmGmAmAmCmUmA mUfAmGfUmUfCmCfUmGfAmA fUmAfUmUfCmCfCmGmUmU 17840 18143 APOB_11 mCmCmCmAmUmGfGfUfCmU mUmGmAmGmUmUmAmAmA mUfUmUfAmAfCmUfCmAfAmGf AmCfCmAfU mGfG mG mU mU 17841 18144 APOB_12 mCmGmUmGmGmGfUfUfCmC mAmAmAmUmUmAmAmUmA mUfAmUfUmAfAmUfUmUfGmG fAm AfC mCfC m AfC mG m U m U 17842 18145 APOB_13 mGmUmAmCmUmGfGfGfUmU mAmAmUmGmGmUmCmAmA mUfUmGfAmCfCmAfUmUfAmAf CmCfCmAfGmUfAmCmUmU 17843 18146 APOB_14 mCmCmCmUmGmGfAfCfAmU mUmCmAmGmAmAmCmAmA mUfUmGfUmUfCmUfGmAfAmU fGmUfCmCfAmGfGmGmUmU 17844 18147 APOB_15 mCmAmAmUmGmAfAfGfGmG mAmAmUmUmUmGmAmAmA mUfUmUfCmAfAmAfUmUfCmCf CmUfUmCfAmUfUmGmUmU 17845 18148 APOB_16 mGmGmAmAmGmGfGfCfUmC mAmAmAmG mAmAmU mG mA mUfCmAfUmUfCmUfUmUfGmA fGmCfCmCfUmUfCmCmUmU 17846 18149 APOB_17 mGmAmAmAmUmGfCfUfAmU mUmGmAmGmGmGmAmAmA mUfUmUfCmCfCmUfCmAfAmUf AmGfCmAfUmUfUmCmUmU 17847 18150 APOB_18 mGmGmGmAmGmGfAfGfGmA mAmCmAmAmAmUmAmAmA mUfUmUfAmUfUmUfGmUfUmC fCmUfCmCfUmCfCmCmUmU 17848 18151 APOB_19 mGmUmAmUmAmGfGfGfAmA mCmUmGmUmUmGmAmAmA mUfUmUfCmAfAmCfAmGfUmUf CmCfCmUfAmUfAmCmUmU 17849 18152 APOB_20 mCmAmCmGmUmGfGfGfUmU mCmCmAmAmAmUmUmAmA mUfUmAfAmUfUmUfGmGfAmAf CmCfCmAfCmGfUmGmUmU 17850 18153 APOB_21 mGmCmAmCmGmUfGfGfGmU m U mC mC mAmAmAm U m U mA mUfAmAfUmUfUmGfGmAfAmCf CmCfAmCfGmUfGmCmUmU 17851 18154 APOB_22 mGmUmCmCmCmAfGfGfUmA mUmAmUmUmCmGmAmAmA mUfUmUfCmGfAmAfUmAfUmAf CmCfUmGfGmGfAmCmUmU 17852 18155 APOB_23 mGmUmUmCmCmAfUfGfUmC mCmCmAmUmUmUmAmCmA mUfGmUfAmAfAmUfGmGfGmA fCmAfUmGfGmAfAmCmUmU 17853 18156 APOB_24 mGmUmAmCmUmGfUfCfCmC mAmGmGmUmAmUmAmUmU mAfAmUfAmUfAmCfCmUfGmGf GmAfCmAfGmUfAmCmUmU 17854 17253 APOB_25 mCmCmAmAmUmUfUfCfCmC mUmGmUmGmGmAmUmCmU m AfG m AfU mCfC m AfC m AfG mG fGmAfAmAfUmUfGmGmUmU 17855 18157 APOB_26 mCmCmAmUmGmGfGfCfAmA mUmAmUmUmAmCmCmUmA mUfAmGfGmUfAmAfUmAfUmUf GmCfCmCfAmUfGmGmUmU 17856 18158 APOB_27 mGmGmGmUmCmCfUfUfUmA mUmGmAmUmUmAmUmGmU m AfC m AfU m AfAm UfC mAfU m Af AmAfGmGfAmCfCmCmUmU 17857 18159 APOB_28 mGmUmUmCmAmGfGfGfUmG mUmGmGmAmGmUmUmUmA mUfAmAfAmCfUmCfCmAfCmAf CmCfCmUfGmAfAmCmUmU 17858 18160 APOB_29 mCmCmCmUmGmAfAfUfGmC mUmAmAmCmAmCmUmAmA mUfUmAfGmUfGmUfUmAfGmC fAmUfUmCfAmGfGmGmUmU 17859 18161 APOB_30 mCmGmG mG mAmAfUfCfU mG mAmU mG mAmG mG mAmAmA mUfUmUfCmCfUmCfAmUfCmAf GmAfUmUfCmCfCmGmUmU 17860 18162 APOB_31 mCmCmCmUmAmUfUfCfUmC mUmGmGmUmAmAmCmUmA mUfAmGfUmUfAmCfCmAfGmAf G mAfAmUfAmGfG mG mU mU 17861 18163 APOB_32 mCmAmGmGmAmAfGfGfGmC mUmCmAmAmAmGmAmAmU mAfUmUfCmUfUmUfGmAfGmC fCmCfUmUfCmCfUmGmUmU 17862 18164 APOB_33 mCmAmAmAmCmAfAfUfGmAm AmGmGmGmAmAmUmUmU mAfAmAfUmUfCmCfCmUfUmCf AmUfUmGfUmUfUmGmUmU 17863 18165 APOB_34 mGmCmCmCmUmGfAfAfUmG mCmUmAmAmCmAmCmUmA mUfAmGfUmGfUmUfAmGfCmA fUmUfCmAfGmGfGmCmUmU 17864 18166 APOB_35 mGmGmUmAmAmAfAfUfUmC mCmCmUmGmAmAmGmUmU mAfAmCfUmUfCmAfGmGfGmA fAmUfUmUfUmAfCmCmUmU 17865 18167 APOB_36 mCmCmAmUmGmAfUfUfUmC mCmCmUmGmAmCmCmUmU mAfAmGfG mUfCmAfG mGfGmA fAmAfU mCfAmUfG mG mU mU 17866 18168 APOB_37 mGmGmAmAmAmUfGfCfUmA mU mU mG mAmG mG mG mAmA mUfUmCfCmCfUmCfAmAfUmAf GmCfAmUfUmUfCmCmUmU 17867 18169 APOB_38 mCmAmCmAmAmAfCfAfAmUm GmAmAmGmGmGmAmAmU mAfUmUfCmCfCmUfUmCfAmUf UmGfUmUfUmGfUmGmUmU 17868 18170 APOB_39 mGmGmAmUmAmUfAfCfAmC mUmAmGmGmGmAmGmGmA mUfCmCfUmCfCmCfUmAfGmU fGmUfAmUfAmUfCmCmUmU 17869 18171 APOB_40 mCmAmAmGmGmGfUfGfUmU mAmUmUmUmCmCmAmUmA mUfAmUfGmGfAmAfAmUfAmAf CmAfCmCfCmUfUmGmUmU 17870 18172 APOB_41 mCmCmCmUmAmGfAfAfAmU mCmUmCmAmAmGmCmUmU mAfAmGfCmUfUmGfAmGfAmU fUmUfCmUfAmGfGmGmUmU 17871 18173 APOB_42 mCmAmUmUmCmAfAfUfUmG mGmGmAmGmAmGmAmCmA mUfGmUfCmUfCmUfCmCfCmA fAmUfUmGfAmAfUmGmUmU 17872 18174 APOB_43 mGmGmGmAmAmCfAfCfAmU mGmAmAmUmCmAmCmAmA mUfUmGfUmGfAmUfUmCfAmU fGmUfGmUfUmCfCmCmUmU 17873 18175 APOB_44 mGmUmCmAmAmGfGfGfUmU mCmGmGmUmUmCmUmUmU mAfAmAfG mAfAmCfC mGfAmAf CmCfCmUfUmGfAmCmUmU 17874 18176 APOB_45 mCmUmCmAmAmAfCfCfCmU mAmAmG mAmU mUmAmAmU mAfUmUfAmAfUmCfUmUfAmGf GmGfUmUfUmGfAmGmUmU 17875 18177 APOB_46 mCmAmCmUmAmAfAfUfUmCm CmCmAmUmGmGmUmCmU mAfG mAfC mCfAmUfG mGfG mA fAmUfUmUfAmGfUmGmUmU 17876 18178 APOB_47 mGmAmAmAmCmAfAfCfCmCm AmGmUmCmUmCmAmAmA mUfUmUfGmAfGmAfCmUfGmG fGmUfUmGfUmUfUmCmUmU 17877 18179 APOB_48 mGmCmCmCmUmAfUfUfCmU mCmUmGmGmUmAmAmCmU mAfGmUfUmAfCmCfAmGfAmG fAmAfU mAfGmGfGmCmUmU 17878 18180 APOB_49 mGmUmGmAmCmAfAfAfUmA mUmGmGmGmCmAmUmCmA mUfGmAfUmGfCmCfCmAfUmA fUmUfUmGfUmCfAmCmUmU 17879 18181 APOB_50 mGmGmAmUmUmCfAfUfUmC mUmGmGmGmUmCmUmUmU mAfAmAfG m AfC mCfC mAfG mAf AmUfGmAfAmUfCmCmUmU 17880 18182 APOB_51 mGmGmAmGmGmGfUfAfGmU mCmAmUmAmAmCmAmGmU mAfCmUfGmUfUmAfUmGfAmC fUmAfCmCfCmUfCmCmUmU 17881 18183 APOB_52 mCmAmAmUmGmGfGfAfAmA mCmUmAmCmGmGmCmUmA mUfAmGfCmCfGmUfAmGfUmU fUmCfCmCfAmUfUmGmUmU 17882 18184 APOB_53 mCmUmCmAmAmGfAfCfCmC mAmAmUmUmUmAmAmCmA mUfGmUfUmAfAmAfUmUfGmG fGmUfCmUfUmGfAmGmUmU 17883 18185 APOB_54 mCmAmUmUmGmGfUfAfGmA mGmCmAmAmGmGmGmUmU mAfAmCfCmCfUmUfGmCfUmC fUmAfCmCfAmAfUmGmUmU 17884 18186 APOB_55 mGmGmGmAmUmGfAfAfGmA mUmUmAmCmAmCmCmUmA mUfAmGfGmUfGmUfAmAfUmC fUmUfCmAfUmCfCmCmUmU 17885 18187 APOB_56 mGmAmGmGmGmUfAfGfUmC mAmUmAmAmCmAmGmUmA mUfAmCfUmGfUmUfAmUfGmA fCmUfAmCfCmCfUmCmUmU 17886 18188 APOB_57 mCmCmCmUmCmAfAfCfUmU mUmUmCmUmAmAmAmCmU mAfGmUfUmUfAmGfAmAfAmAf GmUfUmGfAmGfGmGmUmU 17887 18189 APOB_58 mCmAmAmAmGmUfUfAfAmUm UmGmGmGmAmAmGmAmA mUfUmCfUmUfCmCfCmAfAmUf UmAfAmCfUmUfUmGmUmU 17888 18190 APOB_59 mGmGmGmUmUmCfCfAfAmA mUmUmAmAmUmAmGmUmU mAfAmCfUmAfUmUfAmAfUmUf UmGfG mAfAmCfC mCmUmU 17889 18191 APOB_60 mCmCmCmUmCmAfAfAfCmAm GmAmCmAmUmGmAmCmU mAfGmUfCmAfUmGfUmCfUmG fUmUfUmGfAmGfGmGmUmU 17890 18192 APOB_61 mGmGmGmAmAmCfUfAfCmA mAmUmUmUmCmAmUmUmU mAfAmAfUmGfAmAfAmUfUmGf UmAfGmUfUmCfCmCmUmU 17891 18193 APOB_62 mGmGmUmUmAmAfCfAfGmG mGmAmAmGmAmUmAmGmA mUfCmUfAmUfCmUfUmCfCmC fUmGfUmUfAmAfCmCmUmU 17892 18194 APOB_63 mGmAmAmGmGmGfAfAfGmG mUfAmAfAmCfUmCfUmGfCmCf mCmAmGmAmGmUmUmUmA UmUfCmCfCmUfUmCmUmU 17893 18195 APOB_64 mCmCmCmAmCmUfUfGfCmU mCmUmCmAmUmCmAmAmA mUfUmUfGmAfUmGfAmGfAmG fCmAfAmGfUmGfGmGmUmU 17894 18196 APOB_65 mGmGmGmAmGmGfAfAfCmU mUmUmGmCmAmCmUmAmU mAfUmAfGmUfGmCfAmAfAmGf UmUfCmCfUmCfCmCmUmU 17895 18197 APOB_66 mGmAmGmAmUmUfCfCfCmU mCmCmAmUmUmAmAmGmU mAfCmUfUmAfAmUfGmGfAmG fGmGfAmAfUmCfUmCmUmU 17896 18198 APOB_67 mCmCmCmAmGmUfCfUfCmA mAmAmAmGmGmUmUmUmA mUfAmAfAmCfCmUfUmUfUmGf AmGfAmCfUmGfG mGmUmU 17897 18199 APOB_68 mGmAmUmAmUmAfCfAfCmU mAmG mG mG mAmG mG mAmA mUfUmCfCmUfCmCfCmUfAmG fU mGfU mAfU mAfU mC mU mU 17898 18200 APOB_69 mGmCmAmGmGmGfCfAfCmU mUmCmCmAmAmAmAmUmU mAfAmUfUmUfUmGfGmAfAmG fUmGfCmCfCmUfGmCmUmU 17899 18201 APOB_70 mCmCmCmAmAmUfUfUfAmAm CmAmAmCmAmAmUmGmA mUfCmAfUmUfGmUfUmGfUmU fAmAfAmUfUmGfGmGmUmU 17900 18202 APOB_71 mCmUmCmCmAmUfCfCfCmU mGmUmAmAmAmAmGmUmU mAfAmCfUmUfUmUfAmCfAmGf GmGfAmUfGmGfAmGmUmU 17901 18203 APOB_72 mCmCmCmUmUmCfUfGfAmU mAmGmAmUmGmUmGmGmU mAfCmCfAmCfAmUfCmUfAmUf CmAfG mAfAmGfG mGmUmU 17902 18204 APOB_73 mGmGmGmUmAmGfUfCfAmU mAmAmCmAmGmUmAmCmU mAfGmUfAmCfUmGfUmUfAmU fGmAfCmUfAmCfCmCmUmU 17903 18205 APOB_74 mGmGmUmAmCmUfGfUfCmC mCmAmGmGmUmAmUmAmU mAfU mAfU mAfCmCfU mGfG mG fAmCfAmGfUmAfCmCmUmU 17904 18206 APOB_75 mCmUmUmUmGmUfGfGfCmU mUmCmCmCmAmUmAmUmU mAfAmUfAmUfGmGfGmAfAmG fCmCfAmCfAmAfAmGmUmU 17905 18207 APOB_76 mGmGmGmAmGmAfGfAfCmA mAmGmUmUmUmCmAmCmA mUfGmUfGmAfAmAfCmUfUmG fUmCfUmCfUmCfCmCmUmU 17906 18208 APOB_77 mCmGmAmUmGmUfAfUfAmG mGmGmAmAmCmUmGmUmU mAfAmCfAmGfUmUfCmCfCmUf AmUfAmCfAmUfC mGmUmU 17907 18209 APOB_78 mGmAmCmAmCmCfAfAfUmG mGmGmAmAmGmUmAmUmA mUfAmUfAmCfUmUfCmCfCmAf UmUfGmGfUmGfUmCmUmU 17908 18210 APOB_79 mGmCmCmAmUmGfGfGfCmA mAmUmAmUmUmAmCmCmU mAfGmGfUmAfAmUfAmUfUmG fCmCfCmAfUmGfGmCmUmU 17909 18211 APOB_80 mCmCmCmUmAmAfCfAfGmA mUmUmUmGmAmGmGmAmU mAfUmCfCmUfCmAfAmAfUmCf UmGfUmUfAmGfGmGmUmU 17910 18212 APOB_81 mCmUmGmAmCmAfCfCfAmA mUmGmGmGmAmAmGmUmA mUfAmCfUmUfCmCfCmAfUmUf GmGfUmGfUmCfAmGmUmU 17911 18213 APOB_82 mCmCmAmUmGmUfCfCfCmA mUmUmUmAmCmAmGmAmU mAfUmCfUmGfUmAfAmAfUmGf GmGfAmCfAmUfG mGmUmU 17912 18214 APOB_83 mGmCmAmAmAmUfGfCfUmG mAmCmAmUmAmGmGmGmA mUfCmCfCmUfAmUfGmUfCmA fGmCfAmUfUmUfGmCmUmU 17913 18215 APOB_84 mCmAmGmGmGmAfAfCfAmC mAmAmUmGmCmAmAmAmA mUfUmUfUmGfCmAfUmUfGmU fGmUfUmCfCmCfUmGmUmU 17914 18216 APOB_85 mCmUmGmGmGmUfUfAfAmU mGmGmUmCmAmAmGmUmU mAfAmCfUmUfGmAfCmCfAmUf UmAfAmCfCmCfAmGmUmU 17915 18217 APOB_86 mGmGmGmCmAmGfCfUfGmU mAmUmAmGmCmAmAmAmU mAfUmUfUmGfCmUfAmUfAmCf AmGfCmUfGmCfCmCmUmU 17916 18218 APOB_87 mCmAmAmUmUmGfGfGfAmG mAmGmAmCmAmAmGmUmU mAfAmCfUmUfGmUfCmUfCmU fCmCfCmAfAmUfUmGmUmU 17917 18219 APOB_88 mGmGmGmAmAmUfAfUfUmC mAmGmGmAmAmCmUmAmU mAfUmAfGmUfUmCfCmUfGmA fAmUfAmUfUmCfCmCmUmU 17918 18220 APOB_89 mCmAmAmGmAmUfUfGfGmG mCmUmAmAmAmCmGmUmA mUfAmCfGmUfUmUfAmGfCmC fCmAfAmUfCmUfUmGmUmU 17919 18221 APOB_90 mCmCmCmCmAmGfGfAfCmC mUmUmUmCmAmAmAmUmU mAfAmUfUmUfG mAfAmAfG mGf UmCfCmUfG mGfG mGmUmU 17920 18222 APOB_91 mGmAmCmCmCmAfAfUfUmU mAmAmCmAmAmCmAmAmU mAfUmUfGmUfUmGfUmUfAmA fAmUfUmGfGmGfUmCmUmU 17921 18223 APOB_92 mCmCmCmAmCmAfUfCfUmC mAmCmAmCmAmCmAmAmU mAfUmUfGmUfGmUfGmUfGmA fGmAfUmGfUmGfGmGmUmU 17922 18224 APOB_93 mCmCmCmUmGmGfAfUfAmG mCmAmAmCmAmCmUmAmA mUfUmAfGmUfGmUfUmGfCmU fAmUfCmCfAmGfGmGmUmU 17923 18225 APOB_94 mCmCmAmUmUmGfAfGfAmU mUmCmCmCmUmCmCmAmU mAfU mGfG mAfG mGfG mAfAmU fCmUfCmAfAmUfGmGmUmU 17924 18226 APOB_95 mGmCmUmGmAmCfAfUfAmG mG mG mAm AmU mG mG mAmA mUfUmCfCmAfUmUfCmCfCmU fAmUfGmUfCmAfGmCmUmU 17925 18227 APOB_96 mCmGmGmAmUmUfCfAfUmU mCmUmGmGmGmUmCmUmU mAfAmGfAmCfCmCfAmGfAmAf UmGfAmAfUmCfCmGmUmU 17926 18228 APOB_97 mCmAmGmCmCmCfUfAfUmU mCmU mCmU mG mG mU mAmA mUfUmAfCmCfAmGfAmGfAmAf U mAfG mGfG mCfUmGmUmU 17927 18229 APOB_98 mCmAmCmCmAmAfCfAfAmUm GmGmGmAmAmAmCmUmA mUfAmGfUmUfUmCfCmCfAmU fUmGfUmUfGmGfUmGmUmU 17928 18230 APOB_99 mGmAmUmUmGmGfGfCfUmA mAmAmCmGmUmAmUmGmA mUfCmAfUmAfCmGfUmUfUmAf GmCfCmCfAmAfUmCmUmU 17929 18231 APOB_10 0 mGmGmGmCmAmCfUfUfCmC mAmAmAmAmUmUmGmAmU mAfU mCfAmAfU mUfU mUfG mG fAmAfGmUfGmCfCmCmUmU 17930 18232 APOB_10 1 mCmCmCmUmAmGfAfAfGmA mUmAmCmAmCmGmAmGmA mUfCmUfCmGfUmGfUmAfUmC fUmUfCmUfAmGfGmGmUmU 17931 18233 APOB_10 2 mCmCmCmUmUmGfUfCfAmA mCmUmCmUmGmAmUmCmA mUfGmAfUmCfAmGfAmGfUmU fGmAfCmAfAmGfGmGmUmU 17932 18234 APOB_10 3 mCmUmAmUmGmUfGfUfUmC mCmCmAmAmAmAmGmCmA mUfGmCfUmUfUmUfGmGfGmA fAmCfAmCfAmUfAmGmUmU 17933 18235 APOB_10 4 mCmUmGmGmAmAfAfCfUmC mAmAmGmAmCmCmCmAmA mUfUmGfGmGfUmCfUmUfGmA fGmUfUmUfCmCfAmGmUmU 17934 18236 APOB_10 5 mCmUmUmCmCmCfAfAfCmU mCmUmCmAmAmGmUmCmA mUfGmAfCmUfUmGfAmGfAmG fUmUfGmGfGmAfAmGmUmU 17935 18237 APOB_10 6 mCmGmCmCmGmAfGfGfCmC mCmGmCmGmCmUmGmCmU mAfGmCfAmGfCmGfCmGfGm GfCmCfUmCfGmGfCmGmUmU 17936 18238 APOB_10 7 mGmGmCmCmCmGfCfGfCmU mGmCmUmGmGmCmGmCmU mAfG mCfG mCfCmAfG mCfAmG fCmGfCmGfGmGfCmCmUmU 17937 18239 APOB_10 8 mCmAmCmCmCmUfGfAfAmA mGmAmGmGmUmGmUmAmU mAfUmAfCmAfCmCfUmCfUmUf UmCfAmGfGmGfUmGmUmU 17938 18240 APOB_10 9 mCmCmUmUmUmAfCfCfCmG mG mAmGmAmAmAmGmAmU mAfUmCfUmUfUmCfUmCfCmG fGmGfUmAfAmAfGmGmUmU 17939 18241 APOB_11 0 mGmUmAmUmGmGfGfAfUmG mGmUmAmGmCmAmCmAmA mUfUmGfUmGfCmUfAmCfCmA fUmCfCmCfAmUfAmCmUmU 17940 18242 APOB_11 1 mCmAmAmCmCmCfCfCfUmU mCmUmGmAmUmAmGmAmU mAfU mCfU mAfU mCfAmGfAmAf GmGfGmGfGmUfUmGmUmU 17941 18243 APOB_11 2 mGmGmCmUmUmCfCfCfAmU mAmUmUmGmCmCmAmAmU mAfUmUfGmGfCmAfAmUfAmUf GmGfGmAfAmGfCmCmUmU 17942 18244 APOB_11 3 mGmCmUmUmCmCfCfAfUmA mUmUmGmCmCmAmAmUmA mUfAmUfU mGfG mCfAmAfU mAf UmGfGmGfAmAfGmCmUmU 17943 18245 APOB_11 4 mCmUmUmCmCmCfAfUfAmU mUmGmCmCmAmAmUmAmU mAfUmAfUmUfGmGfCmAfAmUf AmUfG mGfG mAfAmG mU mU 17944 18246 APOB_11 5 mCmUmUmUmUmUfGfGfGmA mAmG mCmAmAmG mG mAmU mAfUmCfCmUfUmGfCmUfUmC fCmCfAmAfAmAfAmG mU mU 17945 18247 APOB_11 6 mG mAmAmG mCmAfAfGfG mA mUmUmUmUmUmCmCmCmA mUfG mGfG mAfAmAfAmAfUmCf CmUfUmGfCmUfUmCmUmU 17946 18248 APOB_11 7 mCmAmAmGmGmAfUfUfUmU mUmCmCmCmAmGmAmCmA mUfGmUfCmUfGmGfGmAfAmA fAmAfUmCfCmUfUmGmUmU 17947 18249 APOB_11 8 mGmAmUmUmUmUfUfCfCmC mAmGmAmCmAmGmUmGmU mAfCmAfCmUfGmUfCmUfGmG fG mAfAmAfAmAfU mC mU mU 17948 18250 APOB_11 9 mCmCmCmAmGmAfCfAfGmU mGmUmCmAmAmCmAmAmA mUfUmUfGmUfUmGfAmCfAmC fUmGfUmCfUmGfGmGmUmU 17949 18251 APOB_12 0 mCmAmAmAmG mCfUfUfU mG mUmAmCmUmGmGmGmUmU mAfAmCfCmCfAmGfUmAfCmAf AmAfGmCfUmUfUmGmUmU 17950 18252 APOB_12 1 mCmUmAmAmAmAfGfCfUmG mGmGmAmAmGmCmUmGmA mUfCmAfGmCfUmUfCmCfCmA fGmCfUmUfUmUfAmGmUmU 17951 18253 APOB_12 mCmCmCmUmGmAfAfGfUmU mUfGmAfGmUfUmAfCmAfAmAf 2 mUmGmUmAmAmCmUmCmA CmUfUmCfAmGfG mGmUmU 17952 18254 APOB_12 3 mCmUmUmCmCmAfAfUfUmU mCmCmCmUmGmUmGmGmA mUfCmCfAmCfAmGfGmGfAmA fAmUfUmGfGmAfAmGmUmU 17953 18255 APOB_12 4 mCmAmCmAmUmCfCfCfAmG mAmAmAmAmCmCmUmCmU mAfGmAfGmGfUmUfUmUfCmU fGmGfGmAfUmGfUmGmUmU 17954 18256 APOB_12 5 mCmCmCmAmGmAfAfAfAmCm CmUmCmUmUmCmUmUmA mUfAmAfGmAfAmGfAmGfGmU fUmUfUmCfUmGfGmGmUmU 17955 18257 APOB_12 6 mGmAmUmGmGmCfCfGfGmG mUmCmAmAmAmUmAmUmA mUfAmUfAmUfUmUfGmAfCmCf CmGfGmCfCmAfUmCmUmU 17956 18258 APOB_12 7 mCmGmGmGmUmCfAfAfAmU mAmUmAmCmCmUmUmGmA mUfCmAfAmGfGmUfAmUfAmUf UmUfGmAfCmCfCmGmUmU 17957 18259 APOB_12 8 mGmGmGmUmCmAfAfAfUmA mUmAmCmCmUmUmGmAmA mUfU mCfAmAfG mGfU mAfU mAf UmUfUmGfAmCfCmCmUmU 17958 18260 APOB_12 9 mGmAmGmUmUmCfCfAfAmG mUmCmCmCmUmAmCmUmU mAfAmGfUmAfGmGfGmAfCmU fUmGfGmAfAmCfUmCmUmU 17959 18261 APOB_13 0 mGmUmUmCmCmAfAfGfUmC mCmCmUmAmCmUmUmUmU mAfAmAfAmGfU mAfG mGfG mAf CmUfUmGfGmAfAmCmUmU 17960 18262 APOB_13 1 mCmAmAmGmUmCfCfCfUmA mCmUmUmUmUmAmCmCmA mUfG mGfU mAfAmAfAmGfU mAf GmGfGmAfCmUfUmGmUmU 17961 18263 APOB_13 2 mGmUmCmAmAmGfAfUfUmG mAmUmGmGmGmCmAmGmU mAfCmUfGmCfCmCfAmUfCmAf AmUfCmUfUmGfAmCmUmU 17962 18264 APOB_13 3 mGmAmUmAmUmGfAfAfGmA mUmGmGmAmAmCmCmCmU mAfG mGfG mUfUmCfCmAfUmC fUmUfCmAfUmAfUmCmUmU 17963 18265 APOB_13 4 mCmUmAmUmCmAfCfUfGmG mGmAmAmGmUmGmCmUmU mAfAmGfCmAfCmUfUmCfCmCf AmGfUmGfAmUfAmGmUmU 17964 18266 APOB_13 5 mCmAmCmUmGmGfGfAfAmG mUmGmCmUmUmAmUmCmA mUfGmAfUmAfAmGfCmAfCmUf UmCfCmCfAmGfUmGmUmU 17965 18267 APOB_13 6 mCmAmUmGmAmUfGfGfGmC mUmCmAmUmAmUmGmCmU mAfG mCfAmUfAmUfG mAfG mC fCmCfAmUfCmAfUmGmUmU 17966 18268 APOB_13 7 mCmAmUmAmCmUfGfGfGmC mAmGmCmUmGmUmAmUmA mUfAmUfAmCfAmGfCmUfGmC fCmCfAmGfUmAfUmGmUmU 17967 18269 APOB_13 8 mCmUmUmUmUmAfCfUfCmA mGmUmGmAmGmCmCmCmA mUfGmGfGmCfUmCfAmCfUmG fAmGfUmAfAmAfAmGmUmU 17968 18270 APOB_13 9 mGmAmGmAmAmGfCfCfCmC mAmAmGmAmAmUmUmUmA mUfAmAfAmUfUmCfUmUfGmG fGmGfCmUfUmCfUmCmUmU 17969 18271 APOB_14 0 mGmCmCmCmCmAfAfGfAmA mUmUmUmAmCmAmAmUmU mAfAmUfUmGfUmAfAmAfUmUf CmUfU mGfG mGfG mCmUmU 17970 18272 APOB_14 1 mCmCmCmAmAmGfAfAfUmU mUmAmCmAmAmUmUmGmU mAfCmAfAmUfUmGfUmAfAmAf UmUfCmUfUmGfGmGmUmU 17971 18273 APOB_14 2 mCmAmCmUmCmCfAfUfUmA mAmCmCmUmCmCmCmAmU mAfUmGfGmGfAmGfGmUfUmA fAmUfGmGfAmGfUmGmUmU 17972 18274 APOB_14 3 mCmCmAmUmUmAfAfCfCmU mCmCmCmAmUmUmUmUmU mAfAmAfAmAfUmGfGmGfAmGf G mUfU mAfAmUfG mGmUmU 17973 18275 APOB_14 4 mCmAmUmUmAmAfCfCfUmC mCmCmAmUmUmUmUmUmU mAfAmAfAmAfAmUfG mGfG mAf G mGfUmUfAmAfU mG mU mU 17974 18276 APOB_14 5 mCmUmCmCmCmAfUfUfUmU mUmUmGmAmGmAmCmCmU mAfG mGfU mCfUmCfAmAfAmAf AmAfU mGfG mGfAmG mU mU 17975 18277 APOB_14 6 mCmAmAmUmUmGfGfGfAmA mCmUmAmCmAmAmUmUmU mAfAmAfUmUfGmUfAmGfUmUf CmCfCmAfAmUfU mGmUmU 17976 18278 APOB_14 7 mCmUmAmUmCmCfAfAfGmA mUmUmGmGmGmCmUmAmA mUfUmAfGmCfCmCfAmAfUmCf UmUfGmGfAmUfAmGmUmU 17977 18279 APOB_14 8 mCmCmAmAmGmAfUfUfGmG mGmCmUmAmAmAmCmGmU mAfCmGfUmUfUmAfGmCfCmC fAmAfU mCfU mUfG mGmUmU 17978 18280 APOB_14 9 mGmGmGmUmUmCfAfCfUmG mUmUmCmCmUmGmAmAmA mUfUmUfCmAfGmGfAmAfCmAf GmUfGmAfAmCfC mCmUmU 17979 18281 APOB_15 0 mGmUmCmCmCmCfCfUfAmA mCmAmGmAmUmUmUmGmA mUfCmAfAmAfUmCfUmGfUmUf AmGfGmGfGmGfAmCmUmU 17980 18282 APOB_15 1 mCmAmGmAmUmAfUfAfUmAm UmCmUmCmAmGmGmGmA mUfCmCfCmUfGmAfGmAfUmA fUmAfUmAfUmCfU mGmUmU 17981 18283 APOB_15 2 mGmCmAmCmAmAfCfUfCmU mCmAmAmAmCmCmCmUmA mUfAmGfGmGfUmUfUmGfAmG fAmGfUmUfGmUfGmCmUmU 17982 18284 APOB_15 3 mGmCmUmAmUmUfGfAfGmG mGmAmAmAmAmUmCmAmA mUfUmGfAmUfUmUfUmCfCmC fUmCfAmAfUmAfGmCmUmU 17983 18285 APOB_15 4 mCmUmAmUmUmGfAfGfGmG mAmAmAmAmUmCmAmAmA mUfUmUfGmAfUmUfUmUfCmC fCmUfCmAfAmUfAmGmUmU 17984 18286 APOB_15 5 mCmAmGmAmUmUfCfUfCmA mGmAmUmGmAmGmGmGmA mUfCmCfCmUfCmAfUmCfUmG fAmGfAmAfUmCfUmGmUmU 17985 18287 APOB_15 6 mCmUmCmAmGmAfUfGfAmG mGmGmAmAmCmAmCmAmU mAfUmGfUmGfUmUfCmCfCmU fCmAfUmCfUmGfAmGmUmU 17986 18288 APOB_15 7 mCmCmAmCmAmAfAfCfAmAm UmGmAmAmGmGmGmAmA mUfUmCfCmCfUmUfCmAfUmU fGmUfUmUfGmUfGmGmUmU 17987 18289 APOB_15 8 mCmCmAmUmUmAfAfGfGmU mUmAmAmCmAmGmGmGmA mUfCmCfCmUfGmUfUmAfAmC fCmUfUmAfAmUfGmGmUmU 17988 18290 APOB_15 9 mCmAmUmUmAmAfGfGfUmU mAmAmCmAmGmGmGmAmA mUfUmCfCmCfUmGfUmUfAmA fCmCfUmUfAmAfUmGmUmU 17989 18291 APOB_16 0 mCmAmGmGmGmAfAfGfAmU mAmGmAmCmUmUmCmCmU mAfGmGfAmAfGmUfCmUfAmU fCmUfUmCfCmCfUmGmUmU 17990 18292 APOB_16 1 mGmGmGmAmAmGfAfUfAmG mAmCmUmUmCmCmUmGmA mUfCmAfGmGfAmAfGmUfCmU fAmUfCmUfUmCfCmCmUmU 17991 18293 APOB_16 2 mGmAmAmCmAmUfUfAfUmG mGmAmGmGmCmCmCmAmU mAfUmGfGmGfCmCfUmCfCmA fUmAfAmUfGmUfUmCmUmU 17992 18294 APOB_16 3 mCmAmUmUmAmUfGfGfAmG mGmCmCmCmAmUmGmUmA mUfAmCfAmUfGmGfGmCfCmU fCmCfAmUfAmAfUmGmUmU 17993 18295 APOB_16 4 mGmAmUmUmUmCfUfCfUmC mUmAmUmGmGmGmAmAmA mUfUmUfCmCfCmAfUmAfGmAf G mAfG mAfAmAfUmCmU mU 17994 18296 APOB_16 5 mCmUmCmUmCmUfAfUfGmG mGmAmAmAmAmAmAmCmA mUfGmUfUmUfUmUfUmCfCmC fAmUfAmGfAmGfAmGmUmU 17995 18297 APOB_16 6 mCmUmAmUmGmGfGfAfAmA mAmAmAmCmAmGmGmCmU mAfGmCfCmUfGmUfUmUfUmU fUmCfCmCfAmUfAmGmUmU 17996 18298 APOB_16 7 mGmGmGmAmAmAfAfAfAmC mAmGmGmCmUmUmGmAmA mUfUmCfAmAfGmCfCmUfGmU fUmUfUmUfUmCfCmCmUmU 17997 18299 APOB_16 8 mCmCmUmGmCmCfAfUfGmG mGmCmAmAmUmAmUmUmA mUfAmAfUmAfUmUfGmCfCmCf AmUfGmGfCmAfGmGmUmU 17998 18300 APOB_16 9 mCmAmAmGmAmAfAfAfAmGm GmGmGmAmUmUmGmAmA mUfUmCfAmAfUmCfCmCfCmUf UmUfUmUfCmUfUmGmUmU 17999 18301 APOB_17 0 mGmAmAmAmAmAfGfGfGmG mAmUmUmGmAmAmGmUmU mAfAmCfUmUfCmAfAmUfCmCf CmCfUmUfUmUfUmCmUmU 18000 18302 APOB_17 1 mCmAmAmCmAmAfAfUfUmUm GmUmGmGmAmGmGmGmU mAfCmCfCmUfCmCfAmCfAmAf AmUfUmUfGmUfUmGmUmU 18001 18303 APOB_17 2 mCmAmAmCmAmAfCfCfAmCm AmAmAmAmGmCmCmCmA mUfGmGfGmCfUmUfUmUfGm UfGmGfUmUfGmUfUmGmUmU 18002 18304 APOB_17 3 mGmCmCmCmAmAfAfUfUmC mCmAmAmUmUmUmUmGmA mUfCmAfAmAfAmUfUmGfGmAf AmUfUmUfGmGfGmCmUmU 18003 18305 APOB_17 4 mGmCmAmUmAmUfAfUfUmC mCmCmUmCmUmGmGmGmA mUfCmCfCmAfGmAfGmGfGmA fAmUfAmUfAmUfGmCmUmU 18004 18306 APOB_17 5 mCmUmAmGmAmGfGfGfCmC mUmCmUmUmUmUmUmCmA mUfG mAfAmAfAmAfG mAfG mGf CmCfCmUfCmUfAmGmUmU 18005 18307 APOB_17 6 mCmAmUmUmCmUfGfGfGmU mCmUmUmUmCmCmAmGmA mUfCmUfGmGfAmAfAmGfAmC fCmCfAmGfAmAfUmGmUmU 18006 18308 APOB_17 7 mGmUmGmUmAmCfAfCfCmA mAmAmAmAmCmCmCmCmA mUfGmGfGmGfUmUfUmUfUm GfGmUfGmUfAmCfAmCmUmU 18007 18309 APOB_17 8 mGmUmAmCmAmCfCfAfAmAm AmAmCmCmCmCmAmAmU mAfUmUfGmGfGmGfUmUfUmU fUmGfGmUfGmUfAmCmUmU 18008 18310 APOB_17 9 mCmCmAmAmAmAfAfCfCmCm CmAmAmUmGmGmCmUmA mUfAmGfCmCfAmUfUmGfGmG fGmUfUmUfUmUfGmGmUmU 18009 18311 APOB_18 0 mCmAmAmAmAmAfCfCfCmCm AmAmUmGmGmCmUmAmU mAfUmAfGmCfCmAfUmUfGmG fGmGfUmUfUmUfUmGmUmU 18010 18312 APOB_18 mCmCmCmAmAmUfGfGfCmU mAfGmAfAmUfGmAfAmUfAmGf 1 mAmUmUmCmAmUmUmCmU CmCfAmUfUmGfGmGmUmU 18011 18313 APOB_18 2 mCmCmAmUmCmCfCfUfGmU mAmAmAmAmGmUmUmUmU mAfAmAfAmCfUmUfUmUfAmCf AmGfGmGfAmUfGmGmUmU 18012 18314 APOB_18 3 mCmCmCmUmGmUfAfAfAmA mGmUmUmUmUmGmGmCmU mAfGmCfCmAfAmAfAmCfUmUf U mUfAmCfAmGfG mG mU mU 18013 18315 APOB_18 4 mCmUmCmCmUmUfGfAfUmU mCmCmCmUmUmUmUmUmU mAfAmAfAmAfAmGfG mGfAmAf UmCfAmAfGmGfAmGmUmU 18014 18316 APOB_18 5 mCmCmUmUmGmAfUfUfCmC mCmUmUmUmUmUmUmGmA mUfCmAfAmAfAmAfAmGfGmGf AmAfU mCfAmAfG mG mU mU 18015 18317 APOB_18 6 mGmAmUmUmCmCfCfUfUmU mUmUmUmGmAmGmAmUmA mUfAmUfCmUfCmAfAmAfAmAf AmGfGmGfAmAfUmCmUmU 18016 18318 APOB_18 7 mGmUmUmUmUmGfGfGfAmA mCmAmCmAmCmAmAmAmA mUfUmUfUmGfUmGfUmGfUmU fCmCfCmAfAmAfAmCmUmU 18017 18319 APOB_18 8 mCmUmUmCmAmGfGfAfAmU mGmGmGmAmAmGmGmAmA mUfUmCfCmUfUmCfCmCfAmU fUmCfCmUfGmAfAmGmUmU 18018 18320 APOB_18 9 mGmCmAmCmUmAfUfGfUmU mCmAmUmAmAmGmGmGmA mUfCmCfCmUfU mAfU mGfAmAf CmAfUmAfGmUfGmCmUmU 18019 18321 APOB_19 0 mCmUmAmUmGmUfUfCfAmU mAmAmGmGmGmAmGmGmU mAfCmCfUmCfCmCfUmUfAmUf GmAfAmCfAmUfAmGmUmU 18020 18322 APOB_19 1 mCmAmGmUmGmAfUfUfAmU mAmUmCmCmCmAmUmAmU mAfUmAfUmGfGmGfAmUfAmU fAmAfUmCfAmCfUmGmUmU 18021 18323 APOB_19 2 mGmUmGmAmUmUfAfUfAmU mCmCmCmAmUmAmUmGmU mAfCmAfUmAfUmGfGmGfAmU fAmUfAmAfU mCfAmC mU mU 18022 18324 APOB_19 3 mGmAmUmUmAmUfAfUfCmC mCmAmUmAmUmGmUmUmU mAfAmAfCmAfUmAfUmGfGmGf AmUfAmUfAmAfUmCmUmU 18023 18325 APOB_19 4 mGmGmCmCmCmUfUfCfGmU mG mAmAmGmAmAmU mAmU mAfUmAfUmUfCmUfUmCfAmCf GmAfAmGfGmGfCmCmUmU 18024 18326 APOB_19 5 mGmCmCmCmUmUfCfGfUmG mAmAmG mAmAmU mAmUmU mAfAmUfAmUfUmCfUmUfCmAf CmGfAmAfGmGfGmCmUmU 18025 18327 APOB_19 6 mCmCmCmUmUmCfGfUfGmA mAmGmAmAmUmAmUmUmU mAfAmAfUmAfUmUfCmUfUmCf AmCfG mAfAmGfG mG mU mU 18026 18328 APOB_19 7 mGmAmUmCmCmAfGfAfUmG mGmAmAmAmAmGmGmGmA mUfCmCfCmUfUmUfUmCfCmA fUmCfUmGfGmAfUmCmUmU 18027 18329 APOB_19 8 mCmAmGmUmCmAfUfGfAmA mCmCmCmCmUmAmCmAmU mAfUmGfUmAfGmGfGmGfUmU fCmAfUmGfAmCfUmGmUmU 18028 18330 APOB_19 9 mGmUmCmAmUmGfAfAfCmC mCmCmUmAmCmAmUmGmA mUfCmAfUmGfUmAfGmGfGmG fUmUfCmAfUmGfAmCmUmU 18029 18331 APOB_20 0 mGmUmAmAmAmAfGfCfUmC mAmGmUmAmUmAmAmGmA mUfCmUfUmAfUmAfCmUfGmAf GmCfUmUfUmUfAmCmUmU 18030 18332 APOB_20 1 mCmUmGmAmAmAfCfUfAmAm AmUmGmAmUmCmUmAmA mUfUmAfGmAfUmCfAmUfUmUf AmGfUmUfUmCfAmGmUmU 18031 18333 APOB_20 2 mCmAmCmAmAmAfUfUfUmCm UmAmGmAmUmUmCmGmA mUfCmGfAmAfUmCfUmAfGmAf AmAfUmUfUmGfUmGmUmU 18032 18334 APOB_20 3 mGmUmGmAmUmUfGfUfCmA mAmG mAmU mAmAmAmC mA mUfGmUfUmUfAmUfCmUfUmG fAmCfAmAfU mCfAmC mU mU 18033 18335 APOB_20 4 mGmAmGmAmAmAfUfUfGmG mUmUmGmGmAmUmUmUmA mUfAmAfAmUfCmCfAmAfCmCf AmAfUmUfUmCfUmCmUmU 18034 18336 APOB_20 5 mGmAmAmCmUmGfUfUfGmA mAmAmGmAmUmUmUmAmU mAfUmAfAmAfUmCfUmUfUmCf AmAfCmAfGmUfUmCmUmU 18035 18337 APOB_20 6 mGmAmUmAmAmAfCfUfUmC mAmAmAmGmAmCmUmUmA mUfAmAfGmUfCmUfUmUfGmA fAmGfUmUfUmAfUmCmUmU 18036 18338 APOB_20 7 mGmUmCmAmAmGfAfAfGmC mUmUmAmAmUmGmAmAmU mAfU mUfC mAfU mUfAmAfG mCf UmUfCmUfUmGfAmCmUmU 18037 18339 APOB_20 8 mCmUmUmAmAmGfCfUfCmU mCmAmAmAmUmGmAmCmA mUfGmUfCmAfUmUfUmGfAmG fAmGfCmUfUmAfAmGmUmU 18038 18340 APOB_20 9 mGmGmAmAmUmAfUfUfCmA mGmGmAmAmCmUmAmUmU mAfAmUfAmGfUmUfCmCfUmG fAmAfUmAfUmUfCmCmUmU 18039 18341 APOB_21 0 mCmUmUmAmUmCfAfGfCmA mAmGmCmUmAmUmAmAmA mUfUmUfAmUfAmGfCmUfUmG fCmUfG mAfU mAfAmG mU mU 18040 18342 APOB_21 1 mCmUmCmUmGmAfUfUfAmC mUmAmUmGmAmAmAmAmA mUfUmUfUmUfCmAfUmAfGmU fAmAfUmCfAmGfAmGmUmU 18041 18343 APOB_21 2 mCmU mU mG mAmCfAfUfG mU mU mGmAmU mAmAmAmG mA mUfCmUfUmUfAmUfCmAfAmCf AmUfGmUfCmAfAmGmUmU 18042 18344 APOB_21 3 mGmCmUmAmUmAfCfCfAmA mAmG mAmU mG mAmU mAmA mUfUmAfUmCfAmUfCmUfUmUf G mGfU mAfU mAfG mC mU mU 18043 18345 APOB_21 4 mGmUmCmCmUmUfUfAfUmG mAmUmUmAmUmGmUmCmA mUfGmAfCmAfUmAfAmUfCmAf UmAfAmAfGmGfAmCmUmU 18044 18346 APOB_21 5 mGmCmAmAmUmGfUfGfGmC mAmAmCmAmGmAmAmAmU mAfUmUfUmCfUmGfUmUfGmC fCmAfCmAfUmUfGmCmUmU 18045 18347 APOB_21 6 mGmCmCmUmAmUfAfUfUmG mAmU mAmAmAmAmCmCmA mUfGmGfUmUfUmUfAmUfCmA fAmUfAmUfAmGfGmCmUmU 18046 18348 APOB_21 7 mGmAmUmUmGmUfCfAfAmG mAmUmAmAmAmCmAmAmU mAfUmUfGmUfUmUfAmUfCmU fUmGfAmCfAmAfUmCmUmU 18047 18349 APOB_21 8 mGmAmAmC mAmCfAfUfG mA mAmUmCmAmCmAmAmAmU mAfUmUfUmGfUmGfAmUfUmC fAmUfGmUfGmUfUmCmUmU 18048 18350 APOB_21 9 mGmAmAmAmUmGfUfGfUmC mCmAmAmAmGmUmAmCmA mUfGmUfAmCfUmUfUmGfGmA fCmAfCmAfUmUfUmCmUmU 18049 18351 APOB_22 0 mGmAmUmAmGmCfAfAfCmA mCmUmAmAmAmUmAmCmU mAfGmUfAmUfUmUfAmGfUmG fUmUfGmCfUmAfUmCmUmU 18050 18352 APOB_22 1 mCmAmAmAmAmUfCfAfAmCm UmUmUmAmAmUmGmAmA mUfUmCfAmUfUmAfAmAfGmUf UmGfAmUfUmUfUmGmUmU 18051 18353 APOB_22 2 mCmAmUmGmGmAfAfUfUmU mAmAmG mU mAmU mG mAmU mAfUmCfAmUfAmCfUmUfAmAf AmUfUmCfCmAfUmGmUmU 18052 18354 APOB_22 3 mCmAmAmAmGmAfAfGfUmC mAmAmG mAmUmUmG mAmU mAfU mCfAmAfU mCfU mUfG mAf CmUfUmCfUmUfUmGmUmU 18053 18355 APOB_22 4 mCmU mCmAmAmAfCfAfG mAm CmAmUmGmAmCmUmUmU mAfAmAfGmUfCmAfUmGfUmCf UmGfUmUfUmGfAmGmUmU 18054 18356 APOB_22 5 mGmGmAmUmUmAfCfAfGmU mUmGmCmAmAmAmUmAmU mAfU mAfU m UfU mG fC mAfAmCf UmGfUmAfAmUfCmCmUmU 18055 18357 APOB_22 6 mCmUmCmAmAmAfAfGfGmU mUmUmAmCmUmAmAmUmA mUfAmUfUmAfGmUfAmAfAmCf CmUfUmUfUmGfAmGmUmU 18056 18358 APOB_22 7 mGmAmAmAmCmAfAfUfGmC mAmUmUmAmGmAmUmUmU mAfAmAfU mCfU mAfAmUfG mCf AmUfUmGfUmUfUmCmUmU 18057 18359 APOB_22 8 mGmAmUmAmAmCfAfGfGmA mAmG mAmU mAmU mG mAmA mUfUmCfAmUfAmUfCmUfUmCf CmUfGmUfUmAfUmCmUmU 18058 18360 APOB_22 9 mGmAmGmUmGmAfUfUfGmU mCmAmAmGmAmUmAmAmA mUfUmUfAmUfCmUfUmGfAmC fAmAfUmCfAmCfUmCmUmU 18059 18361 APOB_23 0 mCmAmAmUmUmUfAfAfCmAm AmCmAmAmUmGmAmAmU mAfUmUfCmAfUmUfGmUfUmG fUmUfAmAfAmUfUmGmUmU 18060 18362 APOB_23 1 mGmAmAmGmCmAfUfUfAmA mAmAmCmUmGmUmUmUmU mAfAmAfAmCfAmGfUmUfUmUf AmAfUmGfCmUfUmCmUmU 18061 18363 APOB_23 2 mCmAmGmAmGmUfUfAfAmU mGmAmUmGmAmAmUmCmU mAfGmAfUmUfCmAfUmCfAmUf UmAfAmCfUmCfUmGmUmU 18062 18364 APOB_23 3 mCmCmUmUmAmUfCfAfGmC mAmAmG mC mU mAmU mAmA mUfU mAfU mAfG mCfU mUfG mC fUmGfAmUfAmAfGmGmUmU 18063 18365 APOB_23 4 mG mAmCmU mCmAfAfUfG mG mUmGmAmAmAmUmUmCmA mUfGmAfAmUfUmUfCmAfCmCf AmUfUmGfAmGfUmCmUmU 18064 18366 APOB_23 5 mGmAmAmGmUmUfGfAfUmG mUmGmUmUmAmAmCmAmA mUfUmGfUmUfAmAfCmAfCmAf UmCfAmAfCmUfUmCmUmU 18065 18367 APOB_23 6 mGmCmCmUmUmAfUfCfAmG mCmAmAmGmCmUmAmUmA mUfAmUfAmGfCmUfUmGfCmU fGmAfUmAfAmGfGmCmUmU 18066 18368 APOB_23 7 mCmAmAmCmAmAfCfUfAmUm CmAmUmAmAmGmAmCmA mUfGmUfCmUfUmAfUmGfAmU fAmGfUmUfGmUfUmGmUmU 18067 18369 APOB_23 8 mGmGmCmAmAmUfAfUfUmA mCmCmUmAmUmGmAmUmU mAfAmUfCmAfU mAfG mGfU mAf AmUfAmUfUmGfCmCmUmU 18068 18370 APOB_23 9 mCmUmAmUmAmUfUfGfAmU mAmAmAmAmCmCmAmUmA mUfAmUfGmGfUmUfUmUfAmU fCmAfAmUfAmUfAmGmUmU 18069 18371 APOB_24 mCmCmUmAmUmAfUfUfGmA mAfUmGfGmUfUmUfUmAfUmC 0 mUmAmAmAmAmCmCmAmU fAmAfUmAfUmAfGmGmUmU 18070 18372 APOB_24 1 mCmAmCmCmAmAfAfUfCmCm UmAmUmAmAmUmGmAmA mUfUmCfAmUfUmAfUmAfGmG fAmUfUmUfGmGfUmGmUmU 18071 18373 APOB_24 2 mCmAmUmCmAmGfUfUfCmA mGmAmUmAmAmAmCmUmU mAfAmGfUmUfUmAfUmCfUmG fAmAfCmUfGmAfUmGmUmU 18072 18374 APOB_24 3 mGmAmUmAmAmCfCfGfUmG mCmCmUmGmAmAmUmCmU mAfGmAfU mUfCmAfG mGfCmA fCmGfGmUfUmAfUmCmUmU 18073 18375 APOB_24 4 mCmUmAmCmAmAfCfAfAmGm UmUmAmAmGmAmUmAmA mUfUmAfUmCfUmUfAmAfCmUf UmGfUmUfGmUfAmGmUmU 18074 18376 APOB_24 5 mCmAmUmGmAmAfUfCfAmC mAmAmAmUmUmAmGmUmU mAfAmCfU mAfAmUfU mUfG mUf GmAfUmUfCmAfUmGmUmU 18075 18377 APOB_24 6 mCmAmAmAmU mUfUfCfU mAm GmAmUmUmCmGmAmAmU mAfU mUfC mGfAmAfU mCfU mAf GmAfAmAfUmUfUmGmUmU 18076 18378 APOB_24 7 mGmCmAmCmAmAfAfCfUmAm UmAmAmUmUmCmAmGmA mUfCmUfG mAfAmUfU mAfU mAf GmUfUmUfGmUfGmCmUmU 18077 18379 APOB_24 8 mGmAmUmUmUmCfAfAfGmG mAmAmUmUmGmUmGmUmA mUfAmCfAmCfAmAfUmUfCmCf UmUfGmAfAmAfUmCmUmU 18078 18380 APOB_24 9 mGmAmAmCmAmAfUfCfCmU mCmAmGmAmGmUmUmAmA mUfU mAfAmCfU mCfUmGfAmG fGmAfUmUfGmUfUmCmUmU 18079 18381 APOB_25 0 mCmCmUmAmCmAfAfCfAmAm GmUmUmAmAmGmAmUmA mUfAmUfCmUfUmAfAmCfUmUf GmUfUmGfUmAfGmGmUmU 18080 18382 APOB_25 1 mCmAmCmAmAmAfCfAfGmUm CmUmGmAmAmCmAmUmU mAfAmUfGmUfUmCfAmGfAmCf UmGfUmUfUmGfUmGmUmU 18081 18383 APOB_25 2 mGmGmAmAmAmAfUfGfGmA mGmCmCmUmAmAmAmGmA mUfCmUfUmUfAmGfGmCfUmC fCmAfUmUfUmUfCmCmUmU 18082 18384 APOB_25 3 mCmCmAmUmGmUfAfGfGmA mAmUmAmAmAmUmGmGmA mUfCmCfAmUfUmUfAmUfUmCf CmUfAmCfAmUfGmGmUmU 18083 18385 APOB_25 4 mCmUmAmUmCmAfUfAfUmC mCmGmUmGmUmAmAmAmU mAfUmUfUmAfCmAfCmGfGmAf UmAfUmGfAmUfAmGmUmU 18084 18386 APOB_25 5 mCmCmAmAmAmAfUfAfAmCm CmUmUmAmAmUmCmAmU mAfUmGfAmUfUmAfAmGfGmU fUmAfUmUfUmUfGmGmUmU 18085 18387 APOB_25 6 mCmUmUmAmCmAfAfCfAmCm UmAmAmAmGmAmUmAmA mUfUmAfUmCfUmUfUmAfGmU fGmUfUmGfUmAfAmGmUmU 18086 18388 APOB_25 7 mGmAmAmUmUmUfGfAfAmA mGmUmUmCmGmUmUmUmU mAfAmAfAmCfG mAfAmCfU mUf UmCfAmAfAmUfUmCmUmU 18087 18389 APOB_25 8 mCmUmUmUmCmUfCfUfCmA mUmGmAmUmUmAmCmAmA mUfUmGfUmAfAmUfCmAfUmG fAmGfAmGfAmAfAmGmUmU 18088 18390 APOB_25 9 mGmUmAmGmAmUfGfAfAmA mCmCmAmAmUmGmAmCmA mUfGmUfCmAfUmUfGmGfUmU fUmCfAmUfCmUfAmCmUmU 18089 18391 APOB_26 0 mGmUmUmAmAmCfAfAfAmAm UmAmUmUmCmUmCmAmA mUfUmGfAmGfAmAfUmAfUmUf UmUfGmUfUmAfAmCmUmU 18090 18392 APOB_26 1 mCmAmAmGmUmUfGfAfAmG mGmAmGmAmCmUmAmUmU mAfAmUfAmGfUmCfUmCfCmUf UmCfAmAfCmUfUmGmUmU 18091 18393 APOB_26 2 mCmUmAmCmCmUfUfAfCmA mCmAmAmUmAmAmUmCmA mUfGmAfUmUfAmUfUmGfUmG fUmAfAmGfGmUfAmGmUmU 18092 18394 APOB_26 3 mGmUmAmCmUmCfUfAfCmC mGmCmUmAmAmAmGmGmA mUfCmCfUmUfUmAfGmCfGmG fUmAfGmAfGmUfAmCmUmU 18093 18395 APOB_26 4 mCmAmCmUmCmAfUfUfGmA mUmUmUmUmCmUmGmAmA mUfUmCfAmGfAmAfAmAfUmCf AmAfUmGfAmGfUmGmUmU 18094 18396 APOB_26 5 mCmCmAmCmAmUfUfCfCmU mUmCmCmUmUmUmAmCmA mUfGmUfAmAfAmGfGmAfAmG fGmAfAmUfGmUfGmGmUmU 18095 18397 APOB_26 6 mGmUmAmCmCmAfUfAfAmG mCmCmAmUmAmUmUmUmU mAfAmAfAmUfAmUfGmGfCmUf UmAfUmGfGmUfAmCmUmU 18096 18398 APOB_26 7 mCmAmAmAmAmGfGfUfUmU mAmCmUmAmAmUmAmUmU mAfAmUfAmUfUmAfGmUfAmAf AmCfCmUfUmUfUmGmUmU 18097 18399 APOB_26 8 mGmAmAmCmUmAfCfGfAmG mCmUmGmAmCmUmUmUmA mUfAmAfAmGfUmCfAmGfCmUf CmGfUmAfGmUfUmCmUmU 18098 18400 APOB_26 9 mGmAmCmAmUmGfUfUfGmA mU mAmAmAmGmAmAmAmU mAfUmUfUmCfUmUfUmAfUmCf AmAfCmAfUmGfUmCmUmU 18099 18401 APOB_27 0 mCmUmUmCmCmUfUfUfAmC mAmAmUmUmGmAmCmUmU mAfAmGfUmCfAmAfUmUfGmUf AmAfAmGfGmAfAmGmUmU 18100 18402 APOB_27 1 mGmAmAmAmGmAfGfAfUmG mAmAmAmUmUmUmAmCmU mAfGmUfAmAfAmUfUmUfCmAf UmCfUmCfUmUfUmCmUmU 18101 18403 APOB_27 2 mCmUmCmAmAmGfAfAfUmU mCmCmAmUmAmUmGmAmA mUfUmCfAmUfAmUfGmGfAmAf UmUfCmUfUmGfAmGmUmU 18102 18404 APOB_27 3 mCmUmUmAmCmAfUfCfCmU mGmAmAmCmAmUmCmAmA mUfUmGfAmUfGmUfUmCfAmG fGmAfUmGfUmAfAmGmUmU 18103 18405 APOB_27 4 mGmCmAmUmCmUfUfCfGmU mGmUmUmUmCmAmAmCmU mAfGmUfUmGfAmAfAmCfAmCf GmAfAmGfAmUfGmCmUmU 18104 18406 APOB_27 5 mCmCmAmAmUmAfAfGfAmUm CmAmAmUmAmGmCmAmA mUfUmGfCmUfAmUfUmGfAmU fCmUfUmAfUmUfGmGmUmU 18105 18407 APOB_27 6 mCmAmUmUmCmCfAfUfCmA mCmAmAmAmUmCmCmUmU mAfAmGfGmAfUmUfUmGfUmG fAmUfGmGfAmAfUmGmUmU 18106 18408 APOB_27 7 mCmCmAmAmAmGfUfCfCmA mUmGmAmGmUmUmAmAmU mAfUmUfAmAfCmUfCmAfUmGf GmAfCmUfUmUfGmGmUmU 18107 18409 APOB_27 8 mGmAmUmCmAmAfGfAfAmC mCmUmGmUmUmAmGmUmU mAfAmCfUmAfAmCfAmGfGmUf UmCfUmUfGmAfUmCmUmU 18108 18410 APOB_27 9 mCmAmGmAmUmAfUfUfAmAm CmAmAmAmAmUmUmGmU mAfCmAfAmUfUmUfUmGfUmUf AmAfUmAfUmCfUmGmUmU 18109 18411 APOB_28 0 mGmAmUmGmUmGfUfUfAmA mCmAmAmAmAmUmAmUmU mAfAmUfAmUfUmUfUmGfUmUf AmAfCmAfCmAfUmCmUmU 18110 18412 APOB_28 1 mGmAmUmUmCmCfUfUfUmG mCmCmUmUmUmUmGmGmU mAfCmCfAmAfAmAfG mGfCmAf AmAfGmGfAmAfUmCmUmU 18111 18413 APOB_28 2 mCmAmUmUmUmGfUfUfUmA mUmUmGmAmAmAmAmUmA mUfAmUfUmUfUmCfAmAfUmAf AmAfCmAfAmAfUmGmUmU 18112 18414 APOB_28 3 mGmUmAmUmAmUfUfAfAmAm GmAmUmAmGmUmUmAmU mAfU mAfAmCfU mAfU mCfU mUf UmAfAmUfAmUfAmCmUmU 18113 18415 APOB_28 4 mGmGmUmUmCmAfAfUfCmA mGmUmAmUmAmAmGmUmA mUfAmCfUmUfAmUfAmCfUmGf AmUfUmGfAmAfCmCmUmU 18114 18416 APOB_28 5 mGmCmAmAmUmGfUfCfCmU mAmCmAmAmCmAmAmGmU mAfCmUfUmGfUmUfGmUfAmG fGmAfCmAfUmUfGmCmUmU 18115 18417 APOB_28 6 mG mAmCmAmU mAfUfAfU mG mAmUmAmCmAmAmUmUmU mAfAmAfUmUfGmUfAmUfCmAf UmAfUmAfUmGfUmCmUmU 18116 18418 APOB_28 7 mCmUmAmGmAmUfUfCfGmA mAmUmAmUmCmAmAmAmU mAfUmUfUmGfAmUfAmUfUmCf GmAfAmUfCmUfAmGmUmU 18117 18419 APOB_28 8 mCmUmAmUmGmUfGfUfUmC mCmCmAmAmAmAmGmCmA mUfGmCfUmUfUmUfGmGfGmA fAmCfAmCfAmUfAmGmUmU 17933 18420 APOB_28 9 mCmAmAmCmCmUfUfAfAmUm GmAmUmUmUmUmCmAmA mUfUmGfAmAfAmAfUmCfAmUf UmAfAmGfGmUfUmGmUmU 18118 18236 APOB_29 0 mGmAmUmCmAmAfUfUfUmG mUmAmAmGmAmAmAmAmU mAfUmUfUmUfCmUfUmAfCmAf AmAfUmUfGmAfUmCmUmU 18119 18421 APOB_29 1 mGmAmUmCmAmGfUfAfUmA mUmUmAmAmAmGmAmUmA mUfAmUfCmUfUmUfAmAfUmAf UmAfCmUfGmAfUmCmUmU 18120 18422 APOB_29 2 mGmUmUmAmUmGfAfUfUmU mAmCmAmUmGmAmUmUmU mAfAmAfUmCfAmUfGmUfAmAf AmUfCmAfUmAfAmCmUmU 18121 18423 APOB_29 3 mCmCmAmCmUmUfUfGfGmC mUmAmUmAmCmCmAmAmA mUfUmUfGmGfUmAfUmAfGmC fCmAfAmAfGmUfGmGmUmU 18122 18424 APOB_29 4 mCmAmCmAmAmGfAfUfUmG mAmCmAmAmGmAmAmAmA mUfUmUfUmCfUmUfGmUfCmA fAmUfCmUfUmGfUmGmUmU 18123 18425 APOB_29 5 mGmAmUmGmAmAfAfUfUmU mAmCmUmUmAmUmCmUmU mAfAmGfAmUfAmAfGmUfAmAf AmUfUmUfCmAfUmCmUmU 18124 18426 APOB_29 6 mGmAmUmAmAmAfGfAfAmAm UmUmAmAmAmGmUmCmA mUfGmAfCmUfUmUfAmAfUmUf UmCfUmUfUmAfUmCmUmU 18125 18427 APOB_29 7 mGmAmAmUmUmUfAfAfGmU mAmUmGmAmUmUmUmCmA mUfGmAfAmAfUmCfAmUfAmCf UmUfAmAfAmUfUmCmUmU 18126 18428 APOB_29 8 mCmAmUmAmUmAfUfGfAmU mAmCmAmAmUmUmUmGmA mUfCmAfAmAfUmUfGmUfAmUf CmAfU mAfU mAfU mGmUmU 18127 18429 APOB_29 mCmAmAmCmUmAfAfUfAmGm mUfGmUfUmAfUmCfUmUfCmU 9 AmAmGmAmUmAmAmCmA fAmUfUmAfGmUfUmGmUmU 18128 18430 APOB_30 0 mGmGmAmAmUmCfUfUfAmU mAmUmUmUmGmAmUmCmC mGfGmAfUmCfAmAfAmUfAmUf AmAfGmAfUmUfCmCmUmU Example 8 Performance of bispecific APOB-DGAT2 in vitro and in vivo mouse study Table 20: In vitro knockdown performance of APOB(25)-DGAT2 bispecific and mono siRNAs. Primary C57BI6 hepatocytes were plated with RNase-free water (Vehicle) or the indicated concentration of mono siRNAs or APOB(25)-DGAT2 bispecific. 24 hours after plating cells media was changed and cells incubated for a further 24 hours. Cells were lysed in Cells-to-Ct lysis buffer and Apob and Dgat2 relative expression measured by Taqman qPCR, normalised to Gapdh levels within samples and to the average of vehicle treated cells. All data presented as mean ± standard deviation, n=3 per condition. Apob (relative expression) Dgat2 (relative expression) Compound 0.1 nM 1 nM 10 nM 0.1 nM 1 nM 10 nM Vehicle 1.00 ±0.05 1.00 ±0.06 APOB mono 0.66 ± 0.04 0.36 ±0.06 0.14 ± 0.01 NA DGAT2 mono NA 0.63 ±0.03 0.27 ±0.01 0.08 ± 0.01 APOB-DGAT2 bispecific 0.63 ± 0.09 0.40 ±0.02 0.14 ± 0.01 0.64 ±0.08 0.37 ±0.03 0.12 ± 0.02 Mouse study testing Bispecific ApoB-DGAT2 siRNA in vivo Methodology 144 Male C57BL / 6J mice (20-25 g on arrival) were group-housed at the Transpharmation animal facility at the University of Reading. Animals were maintained under a 12 h light / dark cycle, where temperature and humidity are controlled according to Home Office regulations. Mice were given access to standard rodent chow for the duration of the study. Bispecifics were formulated in RNAase free PBS to a concentration of 4 mg / mL to provide a dose of 20 mg / kg when given subcutaneously in 5 mL / kg dosing volumes. Monospecifics were formulated in RNAase free PBS to a concentration of 2 mg / mL to provide a dose of 10 mg / kg when given subcutaneously in 5 mL / kg dosing volumes. Mice were weighed prior to compound administration (Day 0) and allocated to groups of 4, 12, 24 or 32. Groups of mice were then injected subcutaneously with either vehicle (RNase free PBS), monospecific siRNA, bispecific siRNAs or control bispecific siRNA. Mice were then returned to their home cages. On Day 1 and twice weekly thereafter mice were weighed and assessed for any overt signs of tolerability issues. On day 21, a subgroup of the mice for certain treatments was re-injected with a second dose of the compound. Liver processing for RT-qPCR On Day 7, 21, 42 or 64 some or all mice from each treatment group were food deprived for 4 h and then terminally sampled by cardiac puncture under isoflurane. Immediately, after blood sample collection, whole liver tissue was excised and weighed. The snap-frozen liver portion was used for qPCR analysis. Total RNA was extracted from homogenates of snap-frozen liver using QIAGEN RNeasy Mini Kit (74104). Duplex RT-qPCR was performed using the ThermoFisher TaqMan Fast 1-Step Master Mix with TaqMan probes for GAPDH (VIC_PL, Assay Id Mm99999915_g1), ApoB (FAM, Assay Id Mm01545150_m1 FAM) or DGAT2 (FAM, Assay Id Mm00499536_m1). Relative quantification (RQ) of target mRNA was determined using the AACT method, where GAPDH was used as internal control and the expression changes of the target gene were normalized to the vehicle control. Liver histology: one lobe was removed for possible histology and placed in 5 x volume of neutral-buffered formalin (NBF). Blood assays Measuring plasma biomarkers; blood samples were taken from the mice from each treatment group 7, 21, 42 or 64 days later by cardiac puncture under isoflurane. Blood (>300 pL) was placed into Eppendorf tubes on ice containing 6.5 pL EDTA (93 mg / mL). Following gentle mixing, samples were centrifuged at 10,000 rpm x 3 min and plasma (1 x 30 pL for LDL and HDL, 1 x 20 pL for ApoB, 1 x 20 pL for AST and 1 x 20 pL for triglycerides and rest of sample, collected into separate Eppendorf tubes on dry ice before storing at -20C (until measured by ELISA). Plasma LDL and HDL levels were measured using a CrystalChem mouse LDL assay kit (Cat no # 79980) and CrystalChem mouse HDL assay kit (Cat no # 79990), respectively. Verification of LDL calibration curves were ensured by use of a #79983 mouse LDL control. Plasma Triglyceride levels were measured using a Cayman 10010303 kit (Cambridge Bioscience). Plasma ApoB levels were measured using an Abeam mouse Apo B ELISA Kit (ab230932). AST was measured using an AbCam mouse AST (ab263882) ELISA kit. Plasma Angptl3 levels were measured using an R&D systems, cat. no. MANL30 ELISA kit. Table 21 In vivo knockdown performance of APOB_25-DGAT2 bispecific and mono siRNAs. Healthy C57BI6 mice were injected subcutaneously with RNase-free PBS (Vehicle), 10 mg / kg of the indicated mono siRNA or 20 mg / kg of APOB_25-DGAT2 bispecific at day 0. A subgroup of mice received an additional dose of compounds at day 21. Mice were sacrificed and livers collected on the indicated days for RNA isolation. Apob and Dgat2 relative expression was measured by TaqMan qPCR, normalised to Gapdh levels within samples and to the average of vehicle treated mice. All data presented as mean ± standard deviation. Apob (relative expression) Dgat2 (relative expression) Compound Day 7 (n=8) Day 21 (n=8) Day 42 (n=4) Day 42 2nd dose (n=4) Day 7 (n=8) Day 21 (n=8) Day 42 (n=4) Day 42 2nd dose (n=4) Vehicle 1.00 ±0.09 1.00 ±0.09 1.00 ± 0.15 1.00 ±0.13 1.00 ±0.8 1.00 ± 0.05 APOB mono 0.10 ±0.03 0.07 ±0.01 0.17 ± 0.09 0.09 ± 0.07 NA NA NA NA DGAT2 mono NA NA NA NA 0.25 ±0.3 0.30 ± 0.05 0.72 ± 0.07 0.33 ± 0.02 APOB- DGAT2 bispecific 0.07 ±0.01 0.07 ±0.01 0.22 ± 0.02 0.07 ± 0.01 0.15 ±0.03 0.26 ± 0.03 0.67 ± 0.03 0.27 ± 0.03 Table 22: DGAT2 sequence screening in HepG2 cells. HepG2 cells were transfected with the indicated concentration of DGAT2 siRNAs, using RNAiMAX lipofectamine, in triplicate. 48-hours after transfection cells were lysed and RT-qPCR performed to measure the relative expression level of DGAT2, normalised to GAPDH gene expression 5 levels. Relative knockdown of DGAT2 was calculated against cells treated with RNAiMAX and no siRNA. Overall rank SEQID 0.1 nM KD (%) 1 nM KD (%) 10 nM KD (%) Sense Antisense 1 13 92 94 94 GUCUGUGG GUUAUUUAA AA UUUUAAAUA ACCCACAGA CUU 2 24 89 94 96 GCUCUGUAA AUUUGGAAG U ACUUCCAAA UUUACAGAG CUU 3 26 91 93 94 UGGAGAGAA UGAAGUGUA C GUACACUUC AUUCUCUCC AUU 4 79 90 93 94 UGGGUGUCU GUGGGUUAU U AAUAACCCA CAGACACCC AUU 5 31 89 93 93 CUGUGGGUU AUUUAAAAG A UCUUUUAAA UAACCCACA GUU 6 65 91 94 92 UUGCUCUGU AAAUUUGGA A UUCCAAAUU UACAGAGCA AUU 8 1 87 93 93 CUGUAAAUU UGGAAGUGU C GACACUUCC AAAUUUACA GUU 7 45 83 93 95 CCAGGAACU AUAUCUUUG G CCAAAGAUA UAGUUCCUG GUU 9 50 88 92 94 GGGUGUCU GUGGGUUAU UU AAAUAACCC ACAGACACC CUU 10 55 89 92 93 GUGUCUGUG GGUUAUUUA A UUAAAUAAC CCACAGACA CUU 11 47 87 92 93 UCCUCAUGU ACAUAUUCU G CAGAAUAUG UACAUGAGG AUU 12 15 85 92 92 CCUUUGGAG AGAAUGAAG U ACUUCAUUC UCUCCAAAG GUU 13 80 79 93 94 UCUGUGGGU UAUUUAAAA G CUUUUAAAU AACCCACAG AUU 14 11 77 92 96 CGAUGGGUC CAGAAGAAG ACUUCUUCU GGACCCAUC U GUU 16 57 81 90 96 UCGCUGUGC UCUACUUCA C GUGAAGUAG AGCACAGCG AUU 15 61 83 91 93 UCAUGGGUG UCUGUGGGU U AACCCACAG ACACCCAUG AUU 17 14 83 92 93 UCACUUGGC UGGUGUUUG A UCAAACACC AGCCAAGUG AUU 18 3 90 92 88 CCACCAGGA ACUAUAUCU U AAGAUAUAG UUCCUGGUG GUU 19 8 90 91 88 UCUGUAAAU UUGGAAGUG U ACACUUCCA AAUUUACAG AUU 20 39 88 89 91 GGUGUCUGU GGGUUAUUU A UAAAUAACC CACAGACAC GUU Sense modification pattern - mmmmmmfffmmmmmmmmmm Antisense modification pattern - mfmfmfmfmfmfmfmfmfm + mUrnll m - 2'-O-methyl; f - 2'-fluoro; KD - knockdown Table 23 Effect of APOB-DGAT2 bispecific and mono siRNAs in vivo on plasma markers. Healthy C57BI6 mice were injected subcutaneously with RNase-free PBS (Vehicle), 10 mg / kg of the indicated mono siRNA or 20 mg / kg of APOB-DGAT2 bispecific at day 0. A subgroup of mice received an additional dose of compounds at day 21. Mice were sacrificed and blood collected into EDTA. Anti-coagulated blood was centrifuged at 10,000 rpm for 3 minutes, plasma aliquoted and stored at -70°C. ELISAs / colorimetric assays were used to measure the indicated plasma markers. APOB (Apolipoprotein B, mg / dL), LDL-C (Low-density lipoprotein-cholesterol, mg / dL), TGs (triglycerides, mg / dL), HDL-C (High-density lipoprotein-cholesterol, mg / dL), AST (Aspartate aminotransferase, p.g / dL). All data presented as mean ± standard deviation. Data analysed by one-way ANOVA with Dunnett’s multiple comparison test vs. Vehicle for each time point: n.s. (no significant difference), * (p-value <0.05), ** (p-value <0.005), *** (p-value <0.0005). Vehicle APOB mono DGAT2 mono APOB-DGAT2 bispecific Da y 7 (n= 8) Da y 21 (n= 8) Da y 42 (n= 4) Da y 7 (n= 8) Da y 21 (n= 8) Da y 42 (n= 4) Da y 42 2nd do Da y 7 (n= 8) Da y 21 (n= 8) Da y 42 (n= 4) Da y 42 2nd do Da y 7 (n= 8) Da y 21 (n= 8) Da y 42 (n= 4) Da y 42 2nd do se (n= 4) se (n= 4) se (n= 4) AP 30. 19. 23. 0.3 0.4 0.9 0.1 34. 34. 25. 29. 0.6 0.7 2.5 0.1 OB 4 6 4 + + 3 6 7 1 3 0 + + + + + + + 0.2 0.2 + + + + + + 0.3 0.5 0.9 0.1 13. 0 2.9 3.0 *** *** 1.0 *** 0.3 1 *** 12. 8 n.s. 6.6 *** 5.0 n.s. 2.6 * *** *** *** *** LD 84. 84. 108 12. 12. 37. 20. 48. 51. 93. 75. 11. 14. 36. 15. L-C 8 3 + 7 4 7 4 4 6 0 3 9 5 5 6 + 7.1 + 10. 4 6.6 + 2.1 *** + 3.1 *** + 7.5 *** + 2.5 *** + 11. 6 *** J (0 1 1+ + 13. 3 n.s. + 3.1 *** + 2.7 *** + 2.0 *** + 6.0 *** + 8.1 *** TG 58. 65. 76. 24. 35. 27. 19. 63. 54. 69. 67. 22. 27. 32. 18. s 3 1 1 1 8 3 4 2 7 7 6 4 3 4 1 + + + + + + + + + + + + + + + 14. 15. 18. 4.5 14. 3.9 1.7 13. 12. 13. 10. 2.6 8.2 8.3 5.0 0 8 8 *** 0 ** *** *** 9 n.s. 3 n.s. 0 n.s. 4 n.s. *** *** *** *** HD 41. 31. 34. 11. 12. 22. 16. 27. 25. 34. 38. 12. 11. 24. 9.2 L-C 1 9 7 3 6 7 0 4 4 7 7 7 8 2 + + + + + + + + + + + + + + + 3.1 21. 1 14. 9 5.8 5.3 *** 5.4 ** 0.8 n.s. 5.2 n.s. 13. 5 n.s. 8.1 n.s. 14. 0 n.s. 21. 4 n.s. 9.6 ** 3.7 *** 6.8 n.s. n.s. AS 48. 45. 42. 72. 77. 22. 32. 75. 59. 31. 31. 44. 45. 57. 41. T 6 5 1 4 8 8 9 5 5 3 9 1 9 8 0 + + + + + + + + + + + + + + + 25. 36. 34. 53. 78. 7.4 23. 58. 60. 12. 17. 28. 39. 60. 29. 4 8 9 0 n.s. 6 n.s. n.s. 2 n.s. 1 n.s. 8 n.s. 2 n.s. 2 n.s. 4 n.s. 8 n.s. 8 n.s. 6 n.s. 5 Table 24 Effect of AP0B-DGAT2 bispecific and mono siRNAs on liver triglycerides. Healthy C57BI6 mice were injected subcutaneously with RNase-free PBS (Vehicle), 10 mg / kg of the indicated mono siRNA or 20 mg / kg of APOB-DGAT2 bispecific at day 0. A 10 subgroup of mice received an additional dose of compounds at day 21. Mice were sacrificed and livers collected on the indicated days. Lipids from liver tissue were solubilised in NP-40, triglycerides measured using a colorimetric assay and normalised to the mass of tissue lysed. All data presented as mean ± standard deviation. Data analysed by one-way ANOVA with Dunnett’s multiple comparison test vs. APOB mono 15 for each time point: n.s. (no significant difference), ** (p-value <0.005), *** (p-value <0.0005). Liver triglycerides (mg / g) Compound (dose) Day 7 (n=8) Day 21 (n=8) Day 42 (n=4) Day 42 2nd dose (n=4) Vehicle 8.4 ±0.7 *** 6.5 ±0.4 *** 4.7 ±0.4 *** APOB mono 13.9 ± 1.0 13.5 ± 1.2 12.4 ± 1.9 12.2 ± 1.2 DGAT2 mono 6.0 ±0.4 *** 5.8 ± 1.2 *** 5.0 ±0.3 *** 5.2 ± 0.5 *** APOB-DGAT2 9.7 ± 1.5 8.6 ± 1.0 10.0 ±2.2 8.5 ± 1.2 bispecific *** *** n.s. **
Claims
1. A nucleic acid molecule comprising:i) a first nucleic acid comprising a double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense and an antisense strand designed with reference to a nucleotide sequence comprising a cardiovascular disease associated gene to be silenced wherein said cardiovascular disease gene is angiopoietin-like protein 3 (ANGPTL3) and wherein there is provided a first single stranded deoxyribonucleic acid (DNA) molecule conjugated to either the 5’ or 3’ end of said sense or antisense strand, wherein the sense strand comprises the modification pattern mmmmmmfffmmmmmmmmmm wherein m -2'-O-methyl and f - 2-deoxy-2-fluoro and said sense strand is 19-23 nucleotides in length; andii) a second nucleic acid comprising a double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense and an antisense strand designed with reference to a nucleotide sequence to be silenced comprising a cardiovascular disease associated gene to be silenced wherein said cardiovascular gene is diacylglycerol O acyltransferase 2 (DGAT2) and wherein there is provided a second single stranded deoxyribonucleic acid (DNA) molecule conjugated to either the 5’ or 3’ end of said sense or antisense strand wherein the second single stranded deoxyribonucleic acid (DNA) molecule is substantially complementary to the first single stranded deoxyribonucleic acid (DNA) molecule set forth in i) above and anneals by complementary base pairing to form a double stranded DNA linker that links the first and second double stranded inhibitory ribonucleic acid (RNA),wherein the DNA linker molecule comprises a nucleotide sequence having a melting temperature (TM) that is 73°C +1- 5%.
2. A nucleic acid molecule comprising:i) a first nucleic acid comprising a double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense and an antisense strand designed with reference to a nucleotide sequence comprising a cardiovascular disease associated gene to be silenced wherein said cardiovascular disease gene is angiopoietin-like protein 3 (ANGPTL3) and wherein there is provided a first single stranded deoxyribonucleic acid (DNA) molecule conjugated to either the 5’ or 3’ end of said sense or antisense strand; andii) a second nucleic acid comprising a double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense and an antisense strand designed with reference to a nucleotide sequence to be silenced comprising a cardiovascular disease associated gene to be silencedwherein said cardiovascular gene is diacylglycerol O acyltransferase 2 (DGAT2) wherein the sense strand comprises the modification pattern mmmmmmfffmmmmmmmmmm wherein m - 2'-O-methyl and f - 2-deoxy-2'-fluoro and said sense strand is 19-23 nucleotides in length and there is provided a second single stranded deoxyribonucleic acid (DNA) molecule conjugated to either the 5’ or 3’ end of said sense or antisense strand wherein the second single stranded deoxyribonucleic acid (DNA) molecule is substantially complementary to the first single stranded deoxyribonucleic acid (DNA) molecule set forth in i) above and anneals by complementary base pairing to form a double stranded DNA linker that links the first and second double stranded inhibitory ribonucleic acid (RNA),wherein the DNA linker molecule comprises a nucleotide sequence having a melting temperature (TM) that is 73°C +1- 5%.
3. The nucleic acid molecule according to claim 1 or 2 wherein said DNA linker molecule comprises a nucleotide sequence wherein the TM is 69°C to 76°C.
4. The nucleic acid molecule according to any one of claims 1 to 3 wherein said DNA linker molecule comprises a nucleotide sequence wherein the TM is 73°C.
5. The nucleic acid molecule according to any one of claims 1 to 4 wherein said first single stranded deoxyribonucleic acid (DNA) molecule comprises the nucleotide sequence: 5’ CGAAGCG 3’.
6. The nucleic acid molecule according to any one of claims 1 to 5 wherein said single stranded DNA comprises the nucleotide sequence 5’ CGAAGCGCCCTACTCCACT 3’ (SEQ ID NO: 17155).
7. The nucleic acid molecule according to any one of claims 1 to 5 wherein said complementary single stranded DNA comprises the nucleotide sequence 5’ AGTGGAGTAGGGCGCTTCG 3’ (SEQ ID NO: 17156).
8. The nucleic acid molecule according to any one of claims 1 to 5 wherein said single stranded DNA comprises the nucleotide sequence 5’ CGAAGCGCCCTACTCCACT 3’ (SEQ ID NO: 17155) and is attached to the 5’ end of the sense nucleotide sequence.
9. The nucleic acid molecule according to any one of claims 1 to 5 wherein said single stranded DNA comprises the nucleotide sequence 5’ CGAAGCGCCCTACTCCACT 3’ (SEQ ID NO: 17155) and is attached to the 5’ end of the antisense nucleotide sequence.
10. The nucleic acid molecule according to any one of claims 1 to 5 wherein said complementary single stranded DNA comprises the nucleotide sequence 5’ AGTGGAGTAGGGCGCTTCG 3’ (SEQ ID NO: 17156) and is attached to the 5’ end of the sense nucleotide sequence.
11. The nucleic acid molecule according to any one of claims 1 to 5 wherein said complementary single stranded DNA comprises the nucleotide sequence 5’ AGTGGAGTAGGGCGCTTCG 3’ (SEQ ID NO: 17156) and is attached to the 5’ end of the antisense nucleotide sequence.
12. The nucleic acid molecule according to any one of claims 1 to 5 wherein said first single stranded DNA molecule comprises a nucleotide sequence selected from the group: SEQ ID NO: 1 to SEQ ID NO: 6170.
13. The nucleic acid molecule according to claim 12 wherein said second single stranded complementary DNA molecule is selected from the group: SEQ ID NO: 6171 to SEQ ID NO: 12340 and is fully complementary to said first single stranded DNA molecule as set forth in SEQ ID NO: 1 to SEQ ID NO: 6170 and is a stable double stranded DNA linker molecule.
14. The nucleic acid molecule according to any one of claims 1 to 13 wherein said ANGPTL3 gene comprises a nucleotide sequence set forth in SEQ ID NO: 17159 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length.
15. The nucleic acid molecule according to any one of claims 1 to 13 wherein said DGAT2 gene comprises a nucleotide sequence set forth in SEQ ID NO: 12346 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length.
16. The nucleic acid molecule according to any one of claims 1 to 15 wherein said first and / or said second double stranded inhibitory RNA molecule comprises modified nucleotides and / or modified sugar(s).
17. The nucleic acid molecule according to any one of claims 1 to 16 wherein said antisense nucleotide sequence is modified wherein said modification pattern comprises the following:mfmfmfmfmfmfmfmfmfm + mil milwherein m - 2'-O-methyl and f - 2-deoxy-2'-fluoro.
18. The nucleic acid molecule according to any one of claims 1 to 17 wherein said nucleic acid molecule is covalently linked to A / -acetylgalactosamine.
19. The nucleic acid molecule according to claim 18 wherein / V-acetylgalactosamine is covalently linked to the 3’ end of said sense strand.
20. A pharmaceutical composition comprising a nucleic acid molecule according to any one of claims 1 to 19.
21. A nucleic acid molecule according to any one of claims 1 to 19 for use in the treatment or prevention of a subject that has or is predisposed to hypercholesterolemia22. The nucleic acid molecule according to the use of claim 21 wherein said use is the treatment or prevention of diseases associated with hypercholesterolemia.
23. The nucleic acid molecule according to the use of claim 22 wherein said disease associated with hypercholesterolemia is selected from the group consisting of: stroke prevention, hyperlipidaemia, cardiovascular disease, atherosclerosis, coronary heart disease, aortic stenosis, cerebrovascular disease, peripheral arterial disease, hypertension, metabolic syndrome, type II diabetes, non-alcoholic fatty acid liver disease, non-alcoholic steatohepatitis, Buerger’s disease, renal artery stenosis, hyper-apobetalipoproteinemia, cerebrovascular atherosclerosis, cerebrovascular disease and venous thrombosis.
24. The nucleic acid molecule according to the use of claim 23 wherein said disease associated with hypercholesterolemia is non-alcoholic fatty acid liver disease or non-alcoholic steatohepatitis.A
Citation Information
Patent Citations
Sirna of angptl3 and use thereof
US20230257750A1
Multi-targeted single entity conjugates
WO2017015109A1
Treatment of cardiovascular disease
WO2022136466A1