Conjugate and uses thereof

Conjugates with specific peptide carriers efficiently deliver therapeutic nucleic acids to treat trinucleotide repeat disorders by enhancing cell penetration and reducing toxicity, addressing the limitations of existing carrier peptides.

HK40134561APending Publication Date: 2026-07-10OXFORD UNIVERSITY INNOVATION LTD +4
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
HK42026122195
Authority / Receiving Office
HK · HK
Patent Type
Applications
Current Assignee / Owner
Priority Date
2019-08-09
Filing Date
2026-04-21
Publication Date
2026-07-10

AI Technical Summary

Technical Problem

Current carrier peptides used for delivering nucleic acid therapeutic agents are ineffective and toxic for treating trinucleotide repeat disorders due to poor cell penetrance and distribution, and their use in diseases with different pathologies has not been investigated.

Method used

Development of conjugates comprising peptide carriers with a specific structure, covalently linked to therapeutic nucleic acids, featuring two or more cationic domains and one hydrophobic domain, without artificial amino acids, for efficient delivery and reduced toxicity.

Benefits of technology

The conjugates effectively penetrate target cells, reduce trinucleotide duplication, and exhibit significantly lower toxicity, providing a safe and effective therapy for trinucleotide repeat disorders like myotonic dystrophy type 1 (DM1).

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

The present invention relates to a conjugate formed from a cell penetrating peptide vector linked to a therapeutic molecule wherein the peptide vector is defined by a specific domain and the therapeutic molecule is a nucleic acid formed from a trinucleotide repeat. The invention further relates to the use of such conjugates in methods of treatment or as a medicament, in particular in the treatment of trinucleotide repeat disorders such as ankylosing muscular dystrophy (DM1).
Need to check novelty before this filing date? Find Prior Art

Description

(19) State Intellectual Property Office (12) Invention Patent Application (10) Application Publication Number (43) Application Publication Date (21) Application Number 202510582562.X (22) Application Date 2020.08.07 (30) Priority Data 1911403.2 2019.08.09 GB (62) Divisional Application Data 202080071067.8 2020.08.07 (71) Applicant Oxford University Technology Innovation Co., Ltd. Address UK Applicant UK Research and Innovation Organization Muscle Research Association National Health and Wellness Institute Sorbonne University (72) Inventors Matthew Wood Miguel Varela Ashley Holland Richard Raz Dennis Flint Klein Michael Gate (74) Patent Agency Beijing Pinyuan Patent Agency Co., Ltd. 11332 Patent Attorney Liu Minghai Hu Bin (51) Int.Cl. A61K 47 / 64 (2017.01) A61K 31 / 7088 (2006.01) A61P 25 / 14 (2006.01) A61P 25 / 00 (2006.01) A61P 21 / 00 (2006.01) A61P 43 / 00 (2006.01) (54) Invention Title: Conjugates and Their Use (57) Abstract: This invention relates to conjugates formed from cell-penetrating peptide carriers linked to therapeutic molecules, wherein the peptide carriers are defined by specific structural domains, and the therapeutic molecules are nucleic acids formed from trinucleotide repeats. The invention further relates to the use of such conjugates in therapeutic treatments or as pharmaceuticals, particularly in the treatment of trinucleotide repeat disorders such as myotonic dystrophy (DM1). Claims (1 page), Description (34 pages), Sequence Listing (electronic publication), Drawings (34 pages), CN 120837670 A, 2025.10.28, CN 1 20 83 76 70 A. 1. A conjugate comprising: a peptide carrier covalently linked to a therapeutic molecule; wherein the total length of the peptide carrier is 40 or fewer amino acids, and comprises: two or more cationic domains, each cationic domain comprising at least 4 amino acid residues, and one or more hydrophobic domains, each hydrophobic domain comprising at least 3 amino acid residues, wherein the peptide carrier does not contain artificial amino acid residues; and wherein the therapeutic molecule comprises a nucleic acid, wherein the nucleic acid comprises a plurality of trinucleotide repeats. 2. The conjugate of claim 1, wherein the nucleic acid comprises a plurality of trinucleotide repeats selected from GTC, CAG, GCC, GGC, CTT, and CCG repeats. 3. The conjugate of claim 1 or 2, wherein the nucleic acid comprises a plurality of CAG repeats.4. The conjugate according to any of the preceding claims, wherein the nucleic acid comprises 5-20 trinucleotide repeats, preferably 5-10 trinucleotide repeats, and more preferably 7 trinucleotide repeats. 5. The conjugate according to any of the preceding claims, wherein the nucleic acid is amplified and bound to the trinucleotide repeats. 6. The conjugate according to any of the preceding claims, wherein the peptide carrier is composed of native amino acid residues. 7. The conjugate according to any of the preceding claims, wherein each cationic domain is 4 to 12 amino acid residues in length, preferably 4 to 7 amino acid residues. 8. The conjugate according to any of the preceding claims, wherein each cationic domain comprises at least 40%, at least 45%, and at least 50% cationic amino acids. 9. The conjugate according to any of the preceding claims, wherein each cationic domain comprises arginine, histidine, β-alanine, hydroxyproline, and / or serine residues, preferably wherein each cationic domain is composed of arginine, histidine, β-alanine, hydroxyproline, and / or serine residues. 10. The conjugate according to any of the preceding claims, wherein the peptide carrier comprises two cationic domains. Claims 1 / 1 Page 2 CN 120837670 A Conjugates and Their Uses

[0001] This application is a divisional application of the invention patent application filed on August 7, 2020, with the international filing date of August 7, 2020, Chinese national application number 202080071067.8, entitled "Conjugates and Their Uses". Technical Field

[0002] The present invention relates to conjugates of peptide carriers and therapeutic molecules, wherein the peptide carrier is defined by a specific structural domain, and the therapeutic molecule is a nucleic acid formed by a trinucleotide repeat. The present invention further relates to the use of such conjugates in therapeutic methods or as a medicine, particularly in the treatment of trinucleotide repeat disorders such as myotonic dystrophy (DM1). Background Art

[0003] Nucleic acid therapy is a genomic medicine capable of transforming human healthcare. Studies have shown that such therapies can be applied in a wide range of disease areas. In particular, the application of antisense oligonucleotide-based methods to regulate mRNA expression has become an ideal therapeutic approach at the forefront of precision medicine.

[0004] However, the development of these promising antisense therapies is hampered by insufficient cell penetrance and poor distribution characteristics.

[0005] Therefore, there is an urgent need to improve the delivery of antisense oligonucleotides in order to provide more effective therapies for genetic diseases such as devastating trinucleotide repeat disorders.

[0006] Trinucleotide repeat disorders are a genetic disease characterized by an abnormally high number of repeats of a specific sequence of three nucleotides in the genomic DNA, also known as trinucleotide repeat amplification. Trinucleotide repeat amplification is a specific type of microsatellite repeat, commonly referred to as microsatellite amplification. Typically, a threshold number of repeats exists in normal healthy subjects, such as...If this number is exceeded, the disease will develop. The threshold number for the disease and the affected gene is different. In these diseases, the number of repeats can usually indicate the severity of the disease. Generally, the more repeats, the more severe the disease. The number of repeats can also be used to predict the age of onset of the disease, with a higher number of repeats indicating an earlier onset.

[0007] Currently, there are 14 known trinucleotide repeat disorders affecting humans. These disorders can be grouped in various ways, such as according to the location of the trinucleotide repeat in the gene, whether it is in a protein-coding ORF; in an exon; or in an untranslated region. Alternatively, they can be grouped according to the triplet repeat sequence. In many trinucleotide disorders, the triplet repeat is “CAG” and encodes glutamine, and this group of disorders is often referred to as polyglutamine disorders. However, trinucleotide repeats with other sequences are known and can be grouped as non-polyglutamine repeat disorders.

[0008] One type of trinucleotide disorder called non-polyglutamine repeat disorder is myotonic dystrophy type 1 (DM1). DM1 is caused by a trinucleotide repeat “CTG” present in the 3'UTR of the DMPK gene. The normal number of repeats in this gene is between 5 and 34. More than 34 repeats may cause some symptoms of the disease, while more than 50 repeats will cause the disease to develop.

[0009] DM1 and other trinucleotide repeat disorders typically affect the neuromuscular system, and there are currently no effective treatments.

[0010] Although the use of antisense oligonucleotides that can bind to repeat regions and disrupt splicing or translation has been theoretically proposed and demonstrated in vitro in the specification 1 / 34 page 3 CN 120837670 A, such antisense oligonucleotides cannot be used as therapeutic agents due to the difficulty in delivering these molecules to affected cells. This is the case for the treatment of many genetic diseases, including trinucleotide repeat disorders.

[0011] The use of viruses as delivery media has been proposed, but its use is limited due to the immunotoxicity and potential carcinogenicity of viral capsid proteins. Alternatively, a variety of non-viral delivery vectors have been developed, among which peptides have shown the most promise due to their small size, target specificity, and ability to deliver large biocargoes across capillaries. The ability of several peptides to penetrate cells alone or carrying biocargo has been reported.

[0012] Over the years, cell-penetrating peptides have been conjugated with antisense oligonucleotides (especially charge-neutral phosphoryl diamine morpholino oligomers (PMO) and peptide nucleic acids (PNA)) to enhance the cellular delivery of such oligonucleotide analogs by efficiently carrying them across the cell membrane to their pre-mRNA target sites in the cell nucleus. It has been shown that conjugation with certain sperm-rich peptides...Peptide conjugations of arginine-containing PMO therapeutic agents (referred to as P-PMO or peptide-PMO) can effectively penetrate into relevant cells.

[0013] In particular, PNA / PMO internalizing peptides (Pips) have been developed, which are arginine-rich CPPs consisting of two arginine-rich sequences separated by a central short hydrophobic sequence. These “Pip” peptides are designed to improve serum stability while maintaining high levels of exon skipping, initially achieved by attaching them to PNA cargoes. Other derivatives of these peptides have been designed as conjugates of PMOs, and after systemic administration in mice, they have been shown to result in systemic skeletal muscle therapy, and importantly, cardiac therapy as well.

[0014] Although these carrier peptides are effective, their associated toxicity hinders their therapeutic application.

[0015] Alternative carrier peptides with a single arginine-rich domain, such as R6Gly, have also been developed. These peptides have been used to produce peptide conjugates with antisense oligonucleotides that have reduced toxicity, but these conjugates have shown lower efficacy compared to Pip peptides.

[0016] Furthermore, almost all carrier peptide development has been conducted in the treatment of DMD. Peptides with hydrophobic core domains have been shown to be particularly active in the case of DMD. The use of such carrier peptides in other neuromuscular diseases with different etiologies and pathologies has not been investigated.

[0017] Therefore, currently available carrier peptides have not been shown to be suitable for use in conjugates containing nucleic acid therapeutic agents for the treatment of genetic conditions, particularly not for diseases caused by different pathologies, such as trinucleotide repeat disorders.

[0018] A challenge in the field of carrier peptide technology is the separation of efficacy and toxicity. The inventors of the present invention have now identified, synthesized, and tested conjugates comprising improved carrier peptides having a specific structure covalently linked to therapeutic nucleic acids for the treatment of trinucleotide disorders, which at least solve this problem.

[0019] According to a first aspect of the invention, a conjugate is provided, comprising: a peptide carrier covalently linked to a therapeutic molecule;

[0020] wherein the total length of the peptide carrier is 40 or fewer amino acids, and comprises: two or more cationic domains, each cationic domain comprising at least 4 amino acid residues and one or more hydrophobic domains, each hydrophobic domain comprising at least 3 amino acid residues, wherein the peptide carrier does not contain artificial amino acid residues;

[0021] and wherein the therapeutic molecule comprises a nucleic acid, wherein the nucleic acid comprises a plurality of trinucleotide repeats.

[0022] According to a second aspect of the invention, the conjugate according to the first aspect is provided for use as a medicament.

[0023] According to a third aspect of the invention, a method of treating a disease in a subject is provided, the method comprising: administering an effective amount of the conjugate according to the first aspect to the subject.

[0024] According to a fourth aspect of the invention, a conjugate according to the first aspect is provided for the prevention or treatment of trinucleotide duplication syndrome.

[0025] According to a fifth aspect of the invention, a method for preventing or treating trinucleotide duplication syndrome in a subject is provided, the method comprising: administering an effective amount of the conjugate according to the first aspect to the subject.

[0026] According to a sixth aspect of the invention, a pharmaceutical composition comprising the conjugate according to the first aspect is provided.

[0027] In one embodiment of the second, third, fourth, or fifth aspect, the conjugate is contained in the pharmaceutical composition.

[0028] Other features and embodiments of the invention will now be described in the following heading sections. Unless otherwise expressly stated, any feature may be combined with the foregoing aspects or other features herein in any compatible combination. Individual features are not limited to any particular embodiment. The headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described.

[0029] The term "peptide carrier" as used throughout the text refers to a peptide suitable for transporting molecules conjugated thereto into cells, i.e., a cell-penetrating peptide. The terms “cell-penetrating peptide” and “peptide carrier” and “peptide” are used interchangeably throughout the text.

[0030] “X” always refers to any form of artificially produced, synthetically prepared aminocaproic acid.

[0031] “B” always refers to the naturally occurring but non-genetically encoded amino acid β-alanine.

[0032] “Ac” always refers to the acetylation of the related peptide.

[0033] “Hyp” always refers to the naturally occurring but non-genetically encoded amino acid hydroxyproline.

[0034] Capital letters always indicate the genetically encoded amino acid residues according to recognized letter amino acid codes.

[0035] The term “artificial” amino acid or residue as used herein refers to any amino acid that is not naturally occurring and includes synthetic amino acids, modified amino acids (e.g., amino acids modified with sugars), non-natural amino acids, artificial amino acids, spacers, and non-peptide-bonded spacers. For the avoidance of ambiguity, in the context of this invention, aminocaproic acid (X) is an artificial amino acid. To avoid ambiguity, β-alanine (B) and hydroxyproline (Hyp) are naturally occurring and therefore, in the context of this invention, are not artificial amino acids but natural amino acids. Artificial amino acids may include, for example, 6-aminohexanoic acid (X), tetrahydroisoquinoline-3-carboxylic acid (TIC), 1-(amino)cyclohexanecarboxylic acid (Cy), and 3-azacyclobutanecarboxylic acid (Az), and 11-aminoundecanoic acid.

[0036] The term "cation" as used herein refers to an amino acid or an amino acid domain that has an overall positive charge at physiological pH.

[0037] "Arginine-rich" or "histidine-rich" means that at least 40% of the cationic domain is formed by said residues.

[0038] The term "hydrophobic" as used herein refers to an amino acid or amino acid domain that has the ability to repel water or is not miscible with water. Detailed Description

[0039] This invention is based on the discovery that binding a specific peptide carrier to a nucleic acid suitable for the prevention and treatment of trinucleotide duplication syndromes allows the nucleic acid to efficiently penetrate target cells and bind to target trinucleotide duplication amplifications present in the genes of the affected subject. This activity reduces the levels of duplication transcripts and / or proteins present in the cells, thereby blocking their pathological interactions with cellular splicing mechanisms, normalizing splicing, and improving the physiological condition of the subject.

[0040] Advantageously, the peptide carriers described herein appear to increase the ability of therapeutic nucleic acids to resist degradation, penetrate target cells, and reach target trinucleotide amplifications to provide treatment. Furthermore, the conjugates of this invention have significantly lower toxicity than conjugates formed with known peptide carriers. Therefore, this conjugate provides an efficient means of delivering nucleic acid therapy for trinucleotide duplication syndromes while remaining non-toxic to the subject.

[0041] The inventors believe that this is the first time that any peptide carrier with a hydrophobic core has been demonstrated to be effective in treating neuromuscular diseases outside the scope of DMD (3 / 34 pages, CN 120837670 A). Previous studies have focused on using peptide carriers to deliver therapeutic agents for DMD. The pathology of DMD is quite different from that of trinucleotide repeat disorders. In particular, DMD involves active muscle degeneration and muscle turnover and repair, including inflammation, while trinucleotide repeat disorders such as ankylosing dystrophy type 1 (DM1) involve muscle dysfunction without significant degeneration. The inventors of the present invention believe that peptide carriers interact with muscle membranes to allow for the efficient delivery of therapeutic molecules, and therefore, the types of membranes with which they interact differ greatly between degenerative and non-degenerative muscles (i.e., between DMD and trinucleotide repeat disorders). In contrast to degenerative diseases such as DMD, in DM1, the muscle membrane is not disrupted, so it is expected that conjugate penetration into muscle tissue will be inhibited and more difficult to achieve. However, based on the data provided herein, the peptide carriers not only showed for the first time effective delivery to non-degenerative muscles for the treatment of DM1, but also unexpectedly showed greater efficacy for DM1 than for DMD.

[0042] In the data provided herein, the conjugates of the present invention maintained good levels of efficacy and were delivered to key target tissues affected by trinucleotide disorders, such as the gastrocnemius and quadriceps skeletal muscles. Furthermore, these conjugates exhibited improved efficacy compared to previously available carrier peptides used in the same conjugates. The conjugates of the present invention target mutant CUG amplification-DMPK transcripts to prevent the formation of nuclear foci, thereby preventing nuclear RNA foci from affectingThe harmful isolation of the MBNL1 splicing factor thus mitigates MBNL1 function loss leading to splicing defects and muscle dysfunction in multiple genes.

[0043] This is demonstrated herein by a reduction in the number of aggregation sites formed by the amplified DMPK transcript after administration of the conjugate of the invention and by splicing correction of genes in DM1 that are typically misjoined due to reduced availability of MBNL1 isolated by the trinucleotide repeat amplified transcript. Specifically, the conjugate shown herein exhibits 50–90% splicing correction in healthy controls excluding clicn1 exon 7a and mblnl1 exon 5 and including serca exon 22, compared to untreated cells / subjects. This is further confirmed by the improvement in the physiological condition of trinucleotide disorders, as shown herein in the DM1 model, where myotonia in mice is restored to normal and corrected to the point of complete recovery, even after a single injection of the conjugate described herein.

[0044] Surprisingly, the inventors found that the peptide carrier used in the conjugates effectively delivers the therapeutic molecule at sufficient concentrations into the nuclear compartment and into the nuclear aggregates of the DMPK transcript to allow for favorable stoichiometric interactions with CUG mutations.

[0045] Simultaneously, the conjugates of the present invention are effective in vivo, exhibiting reduced clinical symptoms after systemic injection and lower toxicity observed by measuring biochemical markers. Crucially, the conjugates of the present invention, after similar systemic injection into mice, have been shown to exhibit remarkably reduced toxicity compared to previous carrier peptides in the same conjugates. As demonstrated herein, the conjugates of the present invention do not cause a significant increase in toxicity markers at treatment-related doses and maintain cell viability compared to saline, while conjugates using existing peptide carriers show significant cell death rates. When the conjugates were administered to mice, the mice had a rapid recovery time, which was much faster than after administration of conjugates formed from previously available peptides.

[0046] Therefore, the conjugates of the present invention offer improved applicability as a safe and effective therapy for human trinucleotide repeat diseases, thus providing a pathway to treat these previously untreatable and devastating diseases.

[0047] Artificial Amino Acids

[0048] This invention relates to conjugates comprising carrier peptides having a specific structure in which no artificial amino acid residues are present.

[0049] Suitably, the peptide does not contain aminocaproic acid residues. Suitably, the peptide does not contain any form of aminocaproic acid residues. Suitably, the peptide does not contain 6-aminocaproic acid residues.

[0050] Suitably, the peptide contains only natural amino acid residues and is therefore composed of natural amino acid residues. Specification 4 / 34 pages 6 CN 120837670 A

[0051] Suitably, artificial amino acids such as 6-aminocaproic acid, which are commonly used in cell-penetrating peptides, are replaced by natural amino acids.Substitution. Suitablely, the artificial amino acid typically used in cell-penetrating peptides, such as 6-aminohexanoic acid, is replaced by an amino acid selected from β-alanine, serine, proline, arginine, and histidine or hydroxyproline.

[0052] In one embodiment, aminohexanoic acid is replaced by β-alanine. Suitablely, 6-aminohexanoic acid is replaced by β-alanine.

[0053] In one embodiment, aminohexanoic acid is replaced by histidine. Suitablely, 6-aminohexanoic acid is replaced by histidine.

[0054] In one embodiment, aminohexanoic acid is replaced by hydroxyproline. Suitablely, 6-aminohexanoic acid is replaced by hydroxyproline.

[0055] Suitablely, the artificial amino acid typically used in cell-penetrating peptides, such as 6-aminohexanoic acid, can be replaced by any combination of β-alanine, serine, proline, arginine, and histidine or hydroxyproline, suitablely, any combination of β-alanine, histidine, and hydroxyproline.

[0056] In one embodiment, the total length of the peptide carrier may be 40 or fewer amino acid residues, the peptide comprising:

[0057] two or more cationic domains, each cationic domain containing at least 4 amino acid residues; and

[0058] one or more hydrophobic domains, each hydrophobic domain containing at least 3 amino acid residues;

[0059] wherein at least one cationic domain contains histidine residues.

[0060] Suitably, at least one cationic domain is histidine-rich.

[0061] Suitably, histidine-rich is defined herein in relation to the cationic domain.

[0062] Cationic Domain

[0063] The present invention relates to conjugates comprising short peptide carriers having a specific structure, wherein at least two cationic domains of a certain length are present.

[0064] Suitably, the peptide comprises at most 4 cationic domains, at most 3 cationic domains.

[0065] Suitably, the peptide comprises 2 cationic domains.

[0066] As defined above, the peptide comprises two or more cationic domains, each cationic domain having a length of at least 4 amino acid residues.

[0067] Suitably, each cationic domain has a length of 4 to 12 amino acid residues, suitably, a length of 4 to 7 amino acid residues.

[0068] Suitably, each cationic domain has a length of 4, 5, 6, or 7 amino acid residues.

[0069] Suitably, each cationic domain has a similar length, suitably, each cationic domain has the same length.

[0070] Suitably, each cationic domain comprises a cationic amino acid, and may also comprise polar and / or nonpolar amino acids.

[0071] The nonpolar amino acid may be selected from: alanine, β-alanine, proline, glycine, cysteine, valine, leucine, etc.Amino acids, isoleucine, methionine, tryptophan, phenylalanine. Suitablely, nonpolar amino acids do not have a charge.

[0072] Polar amino acids may be selected from: serine, asparagine, hydroxyproline, histidine, arginine, threonine, tyrosine, glutamine. Suitablely, the selected polar amino acids do not have a negative charge.

[0073] Cationic amino acids may be selected from: arginine, histidine, lysine. Suitablely, cationic amino acids have a positive charge at physiological pH.

[0074] Suitablely, each cationic domain does not contain anionic or negatively charged amino acid residues. Specification 5 / 34 pages 7 CN 120837670 A

[0075] Suitablely, each cationic domain contains arginine, histidine, β-alanine, hydroxyproline and / or serine residues.

[0076] Suitablely, each cationic domain is composed of arginine, histidine, β-alanine, hydroxyproline and / or serine residues.

[0077] Suitably, each cationic domain comprises at least 40%, at least 45%, or at least 50% cationic amino acids.

[0078] Suitably, each cationic domain comprises a majority of cationic amino acids. Suitably, each cationic domain comprises at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% cationic amino acids.

[0079] Suitably, the isoelectric point (pI) of each cationic domain is at least 7.5, at least 8.0, at least 8.5, at least 9.0, at least 9.5, at least 10.0, at least 10.5, at least 11.0, at least 11.5, or at least 12.0.

[0080] Suitably, the isoelectric point (pI) of each cationic domain is at least 10.0.

[0081] Suitably, the isoelectric point (pI) of each cationic domain is from 10.0 to 13.0.

[0082] In one embodiment, the isoelectric point (pI) of each cationic domain is from 10.4 to 12.5.

[0083] Suitably, the isoelectric point of the cationic domain can be calculated at physiological pH by any suitable method available in the art. Suitably, a network-based algorithm developed by Lukasz Kozlowski, BiolDirect. 2016; 11:55. DOI: 10.1186 / s13062-016-0159-9 is used.

[0084] Suitably, each cationic domain contains at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 60%, at least 65%, at least 70% of arginine and / or histidine residues.

[0085] Suitably, the cationic domain comprises at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 60%, at least 65%, and at least 70% of arginine residues.

[0086] Suitably, the cationic domain comprises at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 60%, at least 65%, and at least 70% of histidine residues.

[0087] Suitably, the cationic domain may comprise a total of 1-5 histidine and 1-5 arginine residues. Suitably, the cationic domain may comprise 1-5 arginine residues. Suitably, the cationic domain may comprise 1-5 histidine residues. Suitably, the cationic domain may comprise a total of 2-5 histidine and 3-5 arginine residues. Suitably, the cationic domain may comprise 3-5 arginine residues. Suitably, the cationic domain may comprise 2-5 histidine residues.

[0088] Suitably, each cationic domain contains one or more β-alanine residues. Suitably, each cationic domain may contain a total of 2-5 β-alanine residues, suitably, a total of 2 or 3 β-alanine residues.

[0089] Suitably, the cationic domain may contain one or more hydroxyproline residues or serine residues.

[0090] Suitably, the cationic domain may contain 1-2 hydroxyproline residues. Suitably, the cationic domain may contain 1-2 serine residues.

[0091] Suitably, all cationic amino acids in a given cationic domain may be histidine, or, suitably, all cationic amino acids in a given cationic domain may be arginine.

[0092] Suitably, the peptide may contain at least one histidine-rich cationic domain. Suitably, the peptide may contain at least one arginine-rich cationic domain.

[0093] Suitably, the peptide may contain at least one arginine-rich cationic domain and at least one histidine-rich cationic domain.

[0094] In one embodiment, the peptide comprises two arginine-rich cationic domains.

[0095] In one embodiment, the peptide comprises two histidine-rich cationic domains. Specification 6 / 34 page 8 CN 120837670 A

[0096] In one embodiment, the peptide comprises two arginine- and histidine-rich cationic domains.

[0097] In one embodiment, the peptide comprises one arginine-rich cationic domain and one histidine-rich cationic domain.

[0098] Suitably, each cationic domain comprises no more than 3 consecutive arginine residues, suitably no more than 2 consecutive arginine residues.

[0099] Suitably, each cationic domain does not contain consecutive histidine residues.

[0100] Suitably, each cationic domain comprises arginine, histidine, and / or β-alanine residues. Suitably, each cationic domain comprises a majority of arginine, histidine, and / or β-alanine residues. Suitably, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, and 100% of the amino acid residues in each cationic domain are arginine, histidine, and / or β-alanine residues. Suitably, each cationic domain is composed of arginine, histidine, and / or β-alanine residues.

[0101] In one embodiment, the peptide comprises a first cationic domain containing arginine and β-alanine residues and a second cationic domain containing arginine and β-alanine residues.

[0102] In one embodiment, the peptide comprises a first cationic domain containing arginine and β-alanine residues and a second cationic domain containing histidine, β-alanine, and optionally arginine residues.

[0103] In one embodiment, the peptide comprises a first cationic domain containing arginine and β-alanine residues and a second cationic domain containing histidine and β-alanine residues.

[0104] In one embodiment, the peptide comprises a first cationic domain composed of arginine and β-alanine residues and a second cationic domain composed of arginine and β-alanine residues.

[0105] In one embodiment, the peptide comprises a first cationic domain composed of arginine and β-alanine residues and a second cationic domain composed of arginine, histidine, and β-alanine residues.

[0106] Suitably, the peptide comprises at least two cationic domains, suitably forming arms of the peptide. Suitably, the cationic domains are located at the N and C ends of the peptide. Suitably, the cationic domains may therefore be referred to as cationic arm domains.

[0107] In one embodiment, the peptide comprises two cationic domains, one located at the N-terminus of the peptide and one located at the C-terminus of the peptide. Suitably, at either end of the peptide. Suitably, no other amino acids or domains are present at the N-terminus and C-terminus of the peptide, except for other groups such as terminal modifications, linkers, and / or therapeutic molecules. For the avoidance of doubt, other groups may be present besides the terminology used herein and claimed as “peptide.” Suitably, each cationic domain thus forms the terminus of the peptide. Suitably, this does not preclude the presence of other linker groups as described herein.

[0108] Suitably, the peptide may contain up to four cationic domains. Suitably, the peptide contains two cationic domains.

[0109] In one embodiment, the peptide contains two cationic domains, both rich in arginine.

[0110] In one embodiment, the peptide contains one cationic domain rich in arginine.

[0111] In one embodiment, the peptide comprises two cationic domains, each rich in both arginine and histidine.

[0112] In one embodiment, the peptide comprises an arginine-rich cationic domain and a histidine-rich cationic domain.

[0113] Suitably, the cationic domain comprises an amino acid unit selected from the group consisting of: R, H, B, RR, HH, BB, RH, HR, RB, BR, HB, BH, RBR, RBB, BRR, BBR, BRB, RBH, RHB, HRB, BRH, HRR, RRH, HRH, HBB, BBH, RHR, BHB, HBH, or any combination thereof.

[0114] Suitably, the cationic domain may also include serine, proline, and / or hydroxyproline residues. Suitable, the cation domain may further comprise an amino acid unit selected from the following: RP, PR, RPR, RRP, PRR, PRP, Hyp; R[Hyp]R, RR[Hyp], [Hyp]RR, [Hyp]R[Hyp], [Hyp][Hyp]R, R[Hyp][Hyp], SB, BS, or any combination thereof, or any combination thereof with the amino acid units listed above.

[0115] Suitably, each cation domain comprises any one of the following sequences: RBRBR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRR (SEQ ID NO:3), RBRRBR (SEQ ID NO:4), RRBRBR (SEQ ID NO:5), RBRRB (SEQ ID NO:6), BRBR (SEQ ID NO:7), RBHBH (SEQ ID NO:8), HBHBR (SEQ ID NO:9), RBRHBHR (SEQ ID NO:10), RBRBBHR (SEQ ID NO:11), RBRBRH (SEQ ID NO:12), HBRRBR (SEQ ID NO:13), HBHBH (SEQ ID NO:14), BHBH (SEQ ID NO:15), BRBSB (SEQ ID NO:16), BRB[Hyp]B (SEQ ID NO:17), R[Hyp]H[Hyp]HB (SEQ ID NO:18), R[Hyp]RR[Hyp]R (SEQ ID NO:19). NO:19) or any combination thereof.

[0116] Suitably, each cation domain consists of any one of the following sequences: RBRBR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRR (SEQ ID NO:3), RBRRBR (SEQ ID NO:4).NO:4), RRBRBR (SEQ ID NO:5), RBRRB (SEQ ID NO:6), BRBR (SEQ ID NO:7), RBHBH (SEQ ID NO:8), HBHBR (SEQ ID NO:9), RBRHBHR (SEQ ID NO:10), RBRBBHR (SEQ ID NO:11), RBRRBH (SEQ ID NO:12), HBRRBR (SEQ ID NO:13), HBHBH (SEQ ID NO:14), BHBH (SEQ ID NO:15), BRBSB (SEQ ID NO:16), BRB[Hyp]B, R[Hyp]H[Hyp]HB, R[Hyp]RR[Hyp]R (SEQ ID NO:19), or any combination thereof.

[0117] Suitably, each cationic domain consists of one of the following sequences: RBRBR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRBR (SEQ ID NO:4), BRBR (SEQ ID NO:7), RBHBH (SEQ ID NO:8), HBHBR (SEQ ID NO:9).

[0118] Suitably, each cationic domain in the peptide may be the same or different. Suitably, each cationic domain in the peptide is different.

[0119] Hydrophobic Domain

[0120] The present invention relates to conjugates comprising short peptide carriers having a specific structure, wherein at least one hydrophobic domain of a certain length is present.

[0121] Suitably, the peptide comprises at most 3 hydrophobic domains, and at most 2 hydrophobic domains.

[0122] Suitably, the peptide comprises 1 hydrophobic domain.

[0123] As defined above, the peptide comprises two or more hydrophobic domains, each hydrophobic domain having a length of at least 3 amino acid residues.

[0124] Suitably, each hydrophobic domain has a length of 3-6 amino acids. Suitably, each hydrophobic domain has a length of 5 amino acids.

[0125] Suitably, each hydrophobic domain may comprise nonpolar, polar, and hydrophobic amino acid residues.

[0126] The hydrophobic amino acid residues may be selected from: alanine, valine, leucine, isoleucine, phenylalanine, tyrosine, methionine, and tryptophan.

[0127] The nonpolar amino acid residues may be selected from: proline, glycine, cysteine, alanine, valine, leucine, isoleucine, tryptophan, phenylalanine, and methionine.

[0128] The polar amino acid residues may be selected from: serine, asparagine, hydroxyproline, histidine, arginine, threonine, specification page 8 / 34, 10 CN 120837670 ATyrosine, glutamine.

[0129] Suitably, the hydrophobic domain does not contain hydrophilic amino acid residues.

[0130] Suitably, each hydrophobic domain contains a majority of hydrophobic amino acid residues. Suitably, each hydrophobic domain contains at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% hydrophobic amino acids. Suitably, each hydrophobic domain is composed of hydrophobic amino acid residues.

[0131] Suitably, the hydrophobicity of each hydrophobic domain is at least 0.3, at least 0.4, at least 0.5, at least 0.6, at least 0.7, at least 0.8, at least 0.8, at least 1.0, at least 1.1, at least 1.2, or at least 1.3.

[0132] Suitably, the hydrophobicity of each hydrophobic domain is at least 0.3, at least 0.35, at least 0.4, or at least 0.45.

[0133] Suitably, the hydrophobicity of each hydrophobic domain is at least 1.2, at least 1.25, at least 1.3, or at least 1.35.

[0134] Suitably, the hydrophobicity of each hydrophobic domain is from 0.4 to 1.4.

[0135] In one embodiment, the hydrophobicity of each hydrophobic domain is from 0.45 to 0.48.

[0136] In one embodiment, the hydrophobicity of each hydrophobic domain is from 1.27 to 1.39.

[0137] Suitably, the hydrophobicity is measured by White and Wimley: W.C. Wimley and S.H. White, "Experimentally determined hydrophobicity scale for proteins at membrane interfaces" Nature Struct Biol 3:842 (1996).

[0138] Suitably, each hydrophobic domain contains at least 3 or at least 4 hydrophobic amino acid residues.

[0139] Suitably, each hydrophobic domain comprises phenylalanine, leucine, isoleucine, tyrosine, tryptophan, proline, and glutamine residues. Suitably, each hydrophobic domain is composed of phenylalanine, leucine, isoleucine, tyrosine, tryptophan, proline, and / or glutamine residues.

[0140] In one embodiment, each hydrophobic domain is composed of phenylalanine, leucine, isoleucine, tyrosine, and / or glutamine residues.

[0141] In one embodiment, each hydrophobic domain is composed of tyrosine and / or proline residues.

[0142] Suitably, the peptide comprises a hydrophobic domain. Suitably, the hydrophobic domain is located at the center of the peptide. Suitably, therefore the hydrophobic domain may be referred to as the core hydrophobic domain. Suitably, theAlternatively, each hydrophobic core domain may be side-attached to an arm domain on either side. Suitably, the arm domain may comprise one or more cationic domains and one or more other hydrophobic domains. Suitably, each arm domain comprises a cationic domain.

[0143] In one embodiment, the peptide comprises two arm domains side-attached to a hydrophobic core domain, wherein each arm domain comprises a cationic domain.

[0144] In one embodiment, the peptide consists of two cationic arm domains side-attached to a hydrophobic core domain.

[0145] Suitably, the or each hydrophobic domain comprises one of the following sequences: YQFLI (SEQ ID NO:20), FQILY (SEQ ID NO:21), ILFQY (SEQ ID NO:22), FQIY (SEQ ID NO:23), WWW, WWPWW (SEQ ID NO:24), WPWW (SEQ ID NO:25), WWPW (SEQ ID NO:26) or any combination thereof.

[0146] Suitably, the or each hydrophobic domain consists of one of the following sequences: YQFLI (SEQ ID NO: 20), FQILY (SEQ ID NO: 21), ILFQY (SEQ ID NO: 22), FQIY (SEQ ID NO: 23), WWW, WWPWW (SEQ ID NO: 24), WPWW (SEQ ID NO: 25), WWPW (SEQ ID NO: 26) or any combination thereof.

[0147] Suitably, the or each hydrophobic domain consists of one of the following sequences: FQILY (SEQ ID NO: 21), WWW, WWPWW (SEQ ID NO: 24). Specification 9 / 34 pages 11 CN 120837670 A

[0148] Suitably, the or each hydrophobic domain consists of FQILY (SEQ ID NO: 21):

[0149] Suitably, each hydrophobic domain in the peptide may have the same sequence or different sequences.

[0150] Peptide Carrier

[0151] This invention relates to conjugates comprising peptide carriers for transporting therapeutic nucleic acids formed by trinucleotide repeats in the treatment of medical conditions.

[0152] The sequence of the peptide is a continuous single molecule, and therefore the domains of the peptide are continuous. Suitably, the peptide comprises several domains arranged linearly between the N-terminus and C-terminus. Suitably, the domains are selected from the above-described cationic and hydrophobic domains. Suitably, the peptide consists of cationic and hydrophobic domains, wherein the domains are as defined above.

[0153] Each domain has the common sequence features described in the relevant sections above, but the exact sequence of each domain is not specified.Each domain can be mutated and modified. Therefore, each domain may have a series of sequences. Combinations of each possible domain sequence produce a series of peptide structures, each peptide structure forming part of the present invention. The characteristics of the peptide structures are described below.

[0154] Suitably, a hydrophobic domain separates any two cationic domains. Suitably, each hydrophobic domain is side-attached to a cationic domain on either side.

[0155] Suitably, no cationic domain is adjacent to another cationic domain.

[0156] In one embodiment, the peptide comprises a hydrophobic domain side-attached to two cationic domains, arranged as follows:

[0157] [Cationic domain]-[Hydrophobic domain]-[Cationic domain]

[0158] Thus, suitably, the hydrophobic domain may be referred to as the core domain, and each cationic domain may be referred to as an arm domain. Suitably, the hydrophobic arm domain is side-attached to a cationic core domain on either side.

[0159] In one embodiment, the peptide consists of two cationic domains and one hydrophobic domain.

[0160] In one embodiment, the peptide consists of a hydrophobic core domain with two cationic arm domains attached to its sides.

[0161] In one embodiment, the peptide comprises a hydrophobic core domain comprising a sequence selected from the following sequences: YQFLI (SEQ ID NO:20), FQILY (SEQ ID NO:21), ILFQY (SEQ ID NO:22), FQIY (SEQ ID NO:23), WWW, WWPWW (SEQ ID NO:24), WPWW (SEQ ID NO:25), and WWPW (SEQ ID NO:26), which is flanked by two cationic arm domains, each cationic arm domain comprising a sequence selected from the following sequences: RBRRBRR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRR (SEQ ID NO:3), RBRRBR (SEQ ID NO:4), RRBRBR (SEQ ID NO:5), RBRRB (SEQ ID NO:6), BRBR (SEQ ID NO:7), RBHBH (SEQ ID NO:8), HBHBR (SEQ ID NO:9), RBRHBHR (SEQ ID NO:10), RBRBBHR (SEQ ID NO:26). NO:11), RBRRBH (SEQ ID NO:12), HBRRBR (SEQ ID NO:13), HBHBH (SEQ ID NO:14), BHBH (SEQ ID NO:15), BRBSB (SEQ ID NO:16), BRB[Hyp]B (SEQ IDNO:17), R[Hyp]H[Hyp]HB (SEQ ID NO:18) and R[Hyp]RR[Hyp]R (SEQ ID NO:19).

[0162] In one embodiment, the peptide comprises a hydrophobic core domain comprising sequences selected from the following: FQILY (SEQ ID NO:21), WWW and WWPWW (SEQ ID NO:24) with two cationic arm domains flanking it, the cationic arm domains comprising sequences selected from the following: RBRRBRR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRRBR (SEQ ID NO:4), RBRRB (SEQ ID NO:6), BRBR (SEQ ID NO:7) and RBHBH (SEQ ID NO:8).

[0163] In one embodiment, the peptide comprises a hydrophobic core domain containing the sequence FQILY (SEQ ID NO:21) flanked by two cationic arm domains containing sequences selected from: RBRRBRR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRRB (SEQ ID NO:4), RBRRB (SEQ ID NO:6), BRBR (SEQ ID NO:7), RBHBH (SEQ ID NO:8).

[0164] In any such embodiment, other groups may be present, such as linkers, terminal modifications, and / or therapeutic molecules.

[0165] Suitably, the peptide is N-terminally modified.

[0166] Suitably, the peptide is N-acetylated, N-methylated, N-trifluoroacetylated, N-trifluoromethylsulfonylated, or N-methylsulfonylated. Suitably, the peptide is N-acetylated.

[0167] Optionally, the N-terminus of the peptide may be unmodified.

[0168] In one embodiment, the peptide is N-acetylated.

[0169] Suitably, the peptide comprises a C-terminal modification selected from: carboxyl-, thioic acid-, aminooxy-, hydrazine-, thioester-, azide-, strained alkyne, strained olefin, aldehyde-, thiol-, or haloacetyl.

[0170] Advantageously, C-terminal or N-terminal modification can provide a means for linking the peptide to a therapeutic molecule.

[0171] Thus, C-terminal or N-terminal modification may comprise a linker, and vice versa. Suitably, C-terminal or N-terminal modification may consist of a linker, and vice versa. Suitable linkers are described elsewhere herein.

[0172] Suitably, the peptide comprises a C-terminal carboxyl group.

[0173] Suitably, the C-terminal carboxyl group is provided by a glycine, β-alanine, glutamic acid, or γ-aminobutyric acid residue.

[0174] In one embodiment, the C-terminal carboxyl group is provided by a β-alanine residue.

[0175] Suitably, the C-terminal residue is a linker. Suitably, the C-terminal β-alanine residue is a linker.

[0176] Suitably, therefore, each cationic domain may further comprise an N- or C-terminal modification. Suitably, the cationic domain comprises a C-terminal modification at the C-terminus. Suitably, the cationic domain comprises an N-terminal modification at the N-terminus. Suitably, the cationic domain comprises a linker group at the C-terminus, and suitably, the cationic domain comprises a C-terminal β-alanine at the C-terminus. Suitably, the cationic domain is N-acetylated at the N-terminus.

[0177] The peptides of the present invention are defined as having a total length of 40 amino acid residues or less. Therefore, the peptides can be considered oligopeptides.

[0178] Suitably, the total length of the peptide is 3-30 amino acid residues, suitably 5-25 amino acid residues, 10-25 amino acid residues, 13-23 amino acid residues, or 15-20 amino acid residues.

[0179] Suitably, the total length of the peptide is at least 12, at least 13, at least 14, at least 15, at least 16, or at least 17 amino acid residues.

[0180] Suitably, the peptide is capable of penetrating cells. Suitably, the peptide can be considered a cell-penetrating peptide.

[0181] Suitably, the peptide is used to attach to a therapeutic molecule. Suitably, the peptide is used to transport a therapeutic molecule to a target cell. Suitably, the peptide is used to deliver a therapeutic molecule to a target cell. Therefore, the peptide is considered a peptide carrier.

[0182] Suitably, the peptide carrier is capable of penetrating into cells and tissues, suitably into the nucleus of the cell. Suitably, into muscle tissue.

[0183] Suitably, the peptide carrier may be selected from any of the following sequences:

[0184] RBRRBRRFQILYRBRBR (SEQ ID NO:27)

[0185] RBRRBRRFQILYRBRR (SEQ ID NO:28)

[0186] RBRRBRFQILYRRBRBR (SEQ ID NO:29)

[0187] RBRBRFQILYRBRRBRR (SEQ ID NO:30)

[0188] RBRRBRRYQFLIRBRBR (SEQ ID NO:31) Specification 11 / 34 pages 13 CN 120837670 A

[0189] RBRRBRRILFQYRBRBR (SEQ ID NO:32)

[0190] RBRRBRFQILYRBRBR (SEQ ID NO:33)RBRRBFQILYRBRRBR (SEQ ID NO:34) RBRRBRRFQILYHBHBR(SEQ ID NO:38)

[0196] RBRRBRRFQILYHBRBH(SEQ ID NO:39)

[0197] RBRRBRRYQFLIRBHBH(SEQ ID NO:40) ID NO:42)

[0200] RBRBBHRFQILYRBHBH (SEQ ID NO:43)

[0201] RBRRBRFQILYRBHBH (SEQ ID NO:44)

[0202] RBRRBRFQILYHBHBH (SEQ ID NO:45)

[0203] RBRRBHFQILYRBHBH (SEQ ID NO:46)

[0204] HBRRBRFQILYRBHBH (SEQ ID NO:47)

[0205] RBRRBFQILYRBHBH (SEQ ID NO:48)

[0206] RBRRBRFQILYBHBH (SEQ ID NO:49)

[0207] RBRRBRYQFLIHBHBH (SEQ ID NO:50)

[0208] RBRRBRILFQYHBHBH (SEQ ID NO:51)

[0209] RBRRBRRFQILYHBHBH (SEQ ID NO:52)

[0210] Suitably, the peptide may be selected from any of the following additional sequences:

[0211] RBRRBRFQILYBRBS(SEQ ID NO:53)

[0212] RBRRBRFQILYBRB[Hyp](SEQ ID NO:54)

[0213] RBRRBRFQILYBR[Hyp]R(SEQ ID NO:55)

[0214] RRBRRBRFQILYBRBR(SEQ ID NO:56)

[0215] BRRBRRFQILYBRBR(SEQ ID NO:57)

[0216] RBRRBRWWWBRBR(SEQ ID NO:58)

[0217] RBRRBRWWPWWBRBR(SEQ ID NO:59)

[0218] RBRRBRWPWWBRBR(SEQ ID NO:60)

[0219] RBRRBRWWPWBRBR(SEQ ID NO:61)

[0220] RBRRBRRWWWRBRBR(SEQ ID NO:62)

[0221] RBRRBRRWWPWWRBRBR(SEQ ID NO:63)

[0222] RBRRBRRWPWWRBRBR(SEQ ID NO:64)

[0223] RBRRBRRWWPWRBRBR(SEQ ID NO:65)

[0224] RBRRBRRFQILYBRBR(SEQ ID NO:66)

[0225] RBRRBRRFQILYRBR(SEQ ID NO:67)

[0226] BRBRBWWPWWRBRRBR(SEQ ID NO:68)

[0227] RBRRBRRFQILYBHBH(SEQ ID NO:69) Specification Page 12 / 34 14 CN 120837670 A

[0228] RBRRBRRFQIYRBHBH(SEQ ID NO:70)

[0229] RBRRBRFQILYBRBH(SEQ ID NO:71)

[0230] RBRRBRFQILYR[Hyp]H[Hyp]H(SEQ ID NO:72)

[0231] R[Hyp]RR[Hyp]RFQILYRBHBH(SEQ ID NO:73)

[0232] R[Hyp]RR[Hyp]RFQILYR[Hyp]H[Hyp]H(SEQ ID NO:74)

[0233] RBRRBRWWWRBHBH(SEQ ID NO:75)

[0234] RBRRBRWWPRBHBH(SEQ ID NO:76)

[0235] RBRRBRPWWRBHBH(SEQ ID NO:77)

[0236] RBRRBRWWPWWRBHBH(SEQ ID NO:78)

[0237] RBRRBRWWPWRBHBH(SEQ ID NO:79)

[0238] RBRRBRWPWWRBHBH(SEQ ID NO:80)

[0239] RBRRBRRWWWRBHBH(SEQ ID NO:81) [02~40] RBRRBRRWWPWWRBHBH(SEQ ID NO:82)

[0241] RBRRBRRWPWWRBHBH(SEQ ID NO:83)

[0242] RBRRBRRWWPWRBHBH (SEQ ID NO:84)

[0243] RRBRRBRFQILYRBHBH (SEQ ID NO:85)

[0244] BRRBRRFQILYRBHBH (SEQ ID NO:86)

[0245] RRBRRBRFQILYBHBH (SEQ ID NO:87)

[0246] BRRBRRFQILYBHBH (SEQ ID NO:87) NO:88)

[0247] RBRRBHRFQILYRBHBH (SEQ ID NO:89)

[0248] RBRRBRFQILY[Hyp]R[Hyp]R (SEQ ID NO:90)

[0249] R[Hyp]RR[Hyp]RFQILYBRBR (SEQ ID NO:91)

[0250] R[Hyp]RR[Hyp]RFQILY[Hyp]R[Hyp]R(SEQ ID NO:92)

[0251] RBRRBRWWWBRBR(SEQ ID NO:93)

[0252] RBRRBRWWPWWBRBR(SEQ ID NO:94)

[0253] Suitably, the peptide consists of one of the following sequences:

[0254] RBRRBRRFQILYRBRBR(SEQ ID NO:27)

[0255] RBRRBRRYQFLIRBRBR(SEQ ID NO:31)

[0256] RBRRBRRILFQYRBRBR(SEQ ID NO:32)

[0257] RBRRBRFQILYBRBR(SEQ ID NO:35)

[0258] RBRRBRRFQILYRBHBH(SEQ ID NO:37)

[0259] RBRRBRRFQILYHBHBR(SEQ ID NO:38)

[0260] RBRRBRFQILYRBHBH(SEQ ID NO:44)

[0261] In one embodiment, the peptide comprises the following sequence: RBRRBRFQILYBRBR (SEQ ID NO: 35).

[0262] In one embodiment, the peptide comprises the following sequence: RBRRBRFQILYRBHBH (SEQ ID NO: 37).

[0263] In one embodiment, the peptide comprises the following sequence: RBRRBRFQILYRBHBH (SEQ ID NO: 44).

[0264] Therapeutic molecule

[0265] The peptide carrier is covalently linked to a therapeutic molecule to provide the conjugate of the present invention, wherein the therapeutic molecule is described on page 13 / 34 of the specification, 15 CN 120837670 A.Nucleic acid comprising multiple trinucleotide repeats.

[0266] Suitably, the nucleic acid may be selected from: antisense oligonucleotides (e.g., PNA, PMO), mRNA, gRNA (e.g., when using CRISPR / Cas9 technology), short interfering RNA, microRNA, and antagomiRNA.

[0267] Suitably, the nucleic acid is an antisense oligonucleotide.

[0268] Suitably, the antisense oligonucleotide is phosphoryldiamine morpholino oligonucleotide (PMO).

[0269] Alternatively, the antisense oligonucleotide may be a modified PMO or any other charge-neutral antisense oligonucleotide, such as peptide nucleic acid (PNA), chemically modified PNA such as γ-PNA (Bahal, Nat. Comm. 2016), oligonucleotide aminophosphates (wherein the non-bridging oxygen of the phosphate group is replaced by an amine or alkylamine) as described in WO2016028187A1, or any other partially or completely charge-neutral oligonucleotide.

[0270] Suitably, the nucleic acid consists of multiple trinucleotide repeats.

[0271] Suitably, the nucleic acid comprises any trinucleotide repeat. Suitably, the nucleic acid comprises trinucleotide repeats selected from the following: GTC, CAG, GCC, GGC, CTT, and CCG repeats. Suitably, the nucleic acid is composed of trinucleotide repeats selected from the following: GTC, CAG, GCC, GGC, CTT, and CCG repeats.

[0272] Suitably, the nucleic acid comprises a CAG repeat. Suitably, the nucleic acid is composed of a CAG repeat.

[0273] In one embodiment, the nucleic acid is an antisense oligonucleotide comprising a CAG repeat. In one embodiment, the nucleic acid is an antisense oligonucleotide composed of a CAG repeat.

[0274] Suitably, the nucleic acid comprises or is composed of a plurality of trinucleotide repeats. Suitably, the nucleic acid comprises or is composed of at least 2 trinucleotide repeats. Suitably, the nucleic acid comprises or is composed of 5-50 trinucleotide repeats. Suitably, the nucleic acid comprises or is composed of 5-40 trinucleotide repeats. Suitably, the nucleic acid comprises or consists of 5-30 trinucleotide repeats. Suitably, the nucleic acid comprises or consists of 5-20 trinucleotide repeats. Suitably, the nucleic acid comprises or consists of 5-10 trinucleotide repeats. Suitably, the nucleic acid comprises or consists of 7 trinucleotide repeats.

[0275] In one embodiment, the nucleic acid is an antisense oligonucleotide comprising 7 CAG repeats. In one embodiment, the nucleic acid is an antisense oligonucleotide composed of 7 CAG repeats. Suitably, in such an embodiment, the nucleic acid is an antisense oligonucleotide composed of [CAG]7.

[0276] Suitably, the nucleic acid is complementary to the microsatellite region, suitably, complementary to the repeat amplification, suitably, complementary to the trinucleotide repeat amplification.

[0277] Suitably, the nucleic acid targets and binds to microsatellite regions. Suitably, the microsatellite regions contain repeat expansions, and suitably, they contain trinucleotide repeat expansions.

[0278] In some embodiments, repeat expansions may include higher repeat expansions, such as four, five, six, seven, eight, nine, or ten repeat expansions, each repeat containing four, five, six, seven, eight, nine, or ten nucleotides, respectively.

[0279] Thus, in some embodiments, the therapeutic molecule is a nucleic acid containing multiple four, five, six, seven, eight, nine, or ten nucleotide repeats. Thus, in some embodiments, the therapeutic molecule is a nucleic acid composed of multiple four, five, six, seven, eight, nine, or ten nucleotide repeats.

[0280] Any statement herein regarding nucleic acids containing trinucleotide repeats also applies to nucleic acids containing higher nucleotide repeats.

[0281] Suitably, the nucleic acid binds to complementary microsatellite regions, suitably, to complementary repeat expansion regions, and suitably, to complementary trinucleotide repeat expansion regions.

[0282] Suitably, the microsatellite region is present in DNA or RNA. Suitably, the microsatellite region is present in RNA. (Page 14 / 34, CN 120837670 A)

[0283] Suitably, the microsatellite region may be present in coding or non-coding sequences. Suitably, the microsatellite region is present in a non-coding sequence, for example, the 3' or 5' UTR. Suitably, the microsatellite region is present in the 3' UTR.

[0284] Suitably, the nucleic acid may be formed by a trinucleotide repeat amplified to a complementary trinucleotide repeat.

[0285] Suitably, the nucleic acid may be formed by a trinucleotide repeat amplified to a complementary trinucleotide repeat in RNA.

[0286] Suitably, the nucleic acid may be formed by a trinucleotide repeat amplified to a complementary trinucleotide repeat in a non-coding sequence of RNA.

[0287] Suitably, the nucleic acid may be formed by a trinucleotide repeat amplified to a complementary trinucleotide repeat in an untranslated region of RNA.

[0288] In one embodiment, the nucleic acid may be formed from a trinucleotide repeat bound to a complementary trinucleotide repeat amplification in the 3'UTR of RNA.

[0289] Optionally, lysine residues may be added to one or both ends of the nucleic acid (e.g., PMO or PNA) before attachment to the peptide carrier to improve water solubility.

[0290] Trinucleotide Repeat Disorders

[0291] The conjugates of the present invention are used as pharmaceuticals, preferably for the prevention or treatment of trinucleotide repeat disorders.

[0292] Suitably, trinucleotide repeat disorders are genetic diseases caused by trinucleotide repeat amplification (also referred to as triplet repeat amplification).

[0293] Suitably, the trinucleotide repeat amplification is present in a gene. Suitably, the trinucleotide repeat amplification is present in genes selected from: ATN1, HTT, AR, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, TBP, FMR1, AFF2, FXN, DMPK, SCA8, JPH3, and PPP2R2B.

[0294] Suitably, the trinucleotide repeat amplification is present in the AR, SCA8, or DMPK gene.

[0295] In one embodiment, the trinucleotide repeat amplification is present in the DMPK gene.

[0296] Suitably, the trinucleotide repeat amplification is composed of repeats selected from: CAG, CTG, CGG, CCG, GAA, TTC, and GGC.

[0297] Suitably, the trinucleotide repeat amplification is composed of CAG or CTG repeats.

[0298] In one embodiment, the trinucleotide repeat amplification is composed of CTG repeats.

[0299] Typically, trinucleotide repeat disorders are caused by the presence of amplified trinucleotide repeats found in a specific gene. Typically, the number of trinucleotide repeats present in the gene is higher than the number of trinucleotide repeats present in the same gene in normal healthy subjects.

[0300] Suitably, the amplified trinucleotide repeat is a CAG repeat selected from the following genes: ATN1, HTT, AR, ATXN1, ATXN, ATXN3, CACNA1A, ATXN7, JPH3, and TBP.

[0301] Suitably, trinucleotide repeat disorders caused by CAG repeats are referred to as “polyglutamine diseases.” Therefore, suitably, the trinucleotide repeat disorder can be a polyglutamine disease. Suitablely, the polyglutamine syndrome may be selected from: DRPLA (Dentate nucleus-rubella-leucocerebellar body atrophy), HD (Huntington's disease), HDL2 (Huntington-like syndrome 2), SBMA (Spinal bulbar muscular atrophy), SCA1 (Spinocerebellar ataxia type 1), SCA2 (Spinocerebellar ataxia type 2), SCA3 (Spinocerebellar ataxia type 3 or Machado-Jospeh disease), SCA6 (Spinocerebellar ataxia type 6), SCA7 (Spinocerebellar ataxia type 7) and SCA17 (Spinocerebellar ataxia type 17).

[0302] Suitablely, the trinucleotide repeat amplification is selected from the CGG repeat of the following gene: FMR1. Instruction manual, pages 15 / 34, 17 CN 120837670 A

[0303] Suitably, the trinucleotide repeat amplification is a CCG repeat selected from the gene AFF2. ​​

[0304] Suitably, the trinucleotide repeat amplification is a GAA repeat selected from the gene FXN.

[0305] Suitablely, the trinucleotide repeat amplification is a CTG repeat selected from the genes of DMPK and ATXN8.

[0306] Suitablely, the trinucleotide repeat amplification is a GTC repeat selected from the gene of JPH3.

[0307] Suitablely, trinucleotide repeat disorders caused by trinucleotide repeats other than CAG repeats are called "non-polyglutamine diseases". Therefore, suitablely, the trinucleotide repeat disorder can be a non-polyglutamine disorder. Suitablely, the non-polyglutamine disorder can be selected from: HDL2 (Huntington's disease-like syndrome 2), FRAXA (fragile X syndrome), FXTAS (fragile X-related tremor / ataxia syndrome), FRAXE (fragile XE intellectual disability), FRDA (Friedrich's ataxia), DM1 (myotonic dystrophy type 1), SCA8 (spinocerebellar ataxia type 8) and SCA12 (spinocerebellar ataxia type 12).

[0308] Suitably, the trinucleotide duplication syndrome is due to an increase in the number of trinucleotide repeats compared to healthy subjects. Suitably, the number of trinucleotide repeats in the gene is increased compared to the same gene in healthy subjects. Suitably, the number of trinucleotide repeats in the trinucleotide repeat amplification is increased compared to the number of trinucleotide repeats in normal healthy subjects.

[0309] Suitably, the number of repeats in the trinucleotide repeat amplification is at least 1.5 times the number of repeats in normal healthy subjects. Suitably, the number of repeats in the trinucleotide repeat amplification is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 times the number of repeats in normal healthy subjects.

[0310] Suitably, the trinucleotide duplication syndrome is due to an increase in the number of repeats in the trinucleotide repeat amplification by at least 1.5 times compared to the number of repeats in normal healthy subjects.

[0311] Suitably, trinucleotide duplication syndrome is caused by an increase in the number of duplications in the trinucleotide duplication amplification by at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 times compared to the number of duplications in normal healthy subjects.

[0312] Suitably, the number of duplications in the trinucleotide duplication amplification is 1.5 to 15 times the number of duplications in normal healthy subjects.

[0313] Suitably, trinucleotide duplication syndrome is caused by an increase in the number of duplications in the trinucleotide duplication amplification by 1.5 to 15 times the number of duplications present in normal healthy subjects.

[0314] Suitably, the number of duplications in the trinucleotide amplification is greater than 50, greater than 75, greater than 100, greater than 125, greater than 150, greater than 175, greater than 200, greater than 225, or greater than 250.

[0315] Suitably, the trinucleotide repeat syndrome is caused by the amplification of trinucleotide repeats containing more than 50, more than 75, more than 100, more than 125, more than 150, more than 175, more than 200, more than 225, or more than 250 repeats.

[0316] Suitably, the number of repeats in the trinucleotide amplification is greater than 50.

[0317] Suitably, the trinucleotide repeat syndrome is caused by the amplification of trinucleotide repeats containing more than 50 repeats.

[0318] Suitably, the number of repeats in the trinucleotide amplification is 50 to 250.

[0319] Suitably, the trinucleotide repeat syndrome is caused by the amplification of trinucleotide repeats containing 50 to 250 repeats.

[0320] Suitably, the trinucleotide repeat syndrome is a non-polyglutamine syndrome.

[0321] Suitably, the trinucleotide repeat syndrome is DM1 or SCA8.

[0322] In one embodiment, the trinucleotide syndrome is DM1.

[0323] In one embodiment, when the trinucleotide duplication syndrome is DM1, the number of repeats in the trinucleotide amplification is greater than 50. In one embodiment, when the trinucleotide duplication syndrome is DM1, the number of CTG repeats in the trinucleotide amplification is greater than 50. In one embodiment, when the trinucleotide duplication syndrome is DM1, the number of CTG repeats in the trinucleotide amplification of the DMPK gene is greater than 50.

[0324] In one embodiment, when the trinucleotide duplication syndrome is SCA8, the number of repeats in the trinucleotide amplification is 110 to 250. In one embodiment, when the trinucleotide duplication syndrome is SCA8, the number of CTG repeats in the trinucleotide amplification is 110 to 250. In one embodiment, when the trinucleotide duplication syndrome is SCA8, the number of CTG repeats in the trinucleotide amplification of the ATXN8 gene is 110 to 250.

[0325] In some embodiments, the conjugates of the present invention are used as pharmaceuticals, preferably for the prevention or treatment of nucleotide duplication syndromes.

[0326] Suitably, nucleotide duplication disorders are genetic diseases caused by nucleotide duplication amplification (also referred to as duplication amplification or microsatellite duplication amplification).

[0327] Suitably, the nucleotide duplication disorder may be caused by duplication amplification of four, five, six, seven, eight, nine, or ten nucleotides.

[0328] Suitably, the nucleotide duplication amplification may be higher duplication amplification as discussed above, such as four, five, six, seven, eight, nine, or ten nucleotide duplication amplification.

[0329] Therefore, suitably, the conjugates of the present invention are used as medicines, preferably for the prevention or treatment of four, five, six, seven, eight, nine, or ten nucleotide duplication disorders.

[0330] Suitably, the nucleotide repeat amplification is a tetranucleotide repeat, and suitably, the tetranucleotide repeat is a CCTG repeat.

[0331] Therefore, suitably, the conjugate of the present invention is used as a medicine, preferably for the prevention or treatment of DM2 (myotonic dystrophy type 2).

[0332] Suitably, the nucleotide repeat amplification is a pentanucleotide repeat, and suitably, the pentanucleotide repeat is an ATTCT repeat.

[0333] Therefore, suitably, the conjugate of the present invention is used as a medicine, preferably for the prevention or treatment of SCA10 (spinocerebellar ataxia type 10).

[0334] Therefore, suitably, the conjugate of the present invention is used as a medicine, preferably for the prevention or treatment of SCA31 (spinocerebellar ataxia type 31).

[0335] Suitably, the nucleotide repeat amplification is a hexanucleotide repeat, and suitably, the hexanucleotide repeat is a GGCCTG repeat or a GGGGCC repeat.

[0336] Therefore, suitably, the conjugates of the present invention are used as medicines, preferably for the prevention or treatment of SCA36 (spinocerebellar ataxia type 36).

[0337] Therefore, suitably, the conjugates of the present invention are used as medicines, preferably for the prevention or treatment of C9ORF72-ALS (amyotrophic lateral sclerosis).

[0338] Any statements herein relating to the treatment of trinucleotide repeat disorders are equally applicable to the treatment of higher nucleotide repeat disorders, such as tetranucleotide, pentanucleotide, hexanucleotide, septnucleotide, octanucleotide, nitrophic, or decanucleotide repeat disorders.

[0339] Covalent Linkage

[0340] The peptide carrier present in the conjugates of the present invention is covalently linked to the therapeutic molecule.

[0341] Suitably, the peptide carrier is covalently linked to the therapeutic molecule at the C-terminus or N-terminus. Suitably, the peptide carrier is covalently linked to the therapeutic molecule at the C-terminus.

[0342] Suitably, if desired, the peptide carrier is covalently linked to the therapeutic molecule via a linker. The connector can act as a spacer to separate the peptide sequence from the therapeutic molecule.

[0343] The connector can be selected from any suitable sequence.

[0344] Suitably, the connector is present between the peptide and the therapeutic molecule. Suitably, the connector is a spacer group between the peptide and the therapeutic molecule. Therefore, the connector can contain artificial amino acids.

[0345] In one embodiment, the conjugate comprises a peptide carrier covalently linked to the therapeutic molecule via a connector.

[0346] In one embodiment, the conjugate comprises the following structure:

[0347] [peptide]-[connector]-[therapeutic molecule]

[0348] In one embodiment, the conjugate consists of the following structure:

[0349] [peptide]-[connector]-[therapeutic molecule]

[0350] Suitablely, any peptide listed herein may be used in the conjugate according to the invention. In one embodiment, the conjugate comprises a peptide carrier selected from one of the following sequences: RBRRBRFQILYBRBR (SEQ ID NO:35), RBRRBRFQILYRBHBH (SEQ ID NO:37), and RBRRBRFQILYRBHBH (SEQ ID NO:44).

[0351] Suitablely, in any case, the peptide carrier may further comprise the N-terminal modification as described above.

[0352] Suitable linkers include, for example, C-terminal cysteine ​​residues that may form a disulfide, thioether, or thiol-maleimide linker; C-terminal aldehydes to form oximes, which may click with a basic amino acid on the peptide or a carboxylic acid moiety on the peptide or form a morpholino linker, wherein the peptide is covalently linked to an amino group to form a carboxamide linker.

[0353] Suitablely, the length of the linker is 1-5 amino acids. Suitablely, the linker may comprise any linker known in the art.

[0354] Suitably, the linker is selected from any of the following sequences: G, BC, XC, C, GGC, BBC, BXC, XBC, X, XX, B, BB, BX, XB, succinic acid, GABA, and E. Suitably, X is 6-aminocaproic acid.

[0355] Suitably, the linker may be a polymer, such as PEG.

[0356] Suitably, the linker is selected from: β-alanine (B), succinic acid (Succ), GABA (Ab), and glutamic acid (E).

[0357] In one embodiment, the linker is β-alanine (B).

[0358] In one embodiment, the peptide carrier is conjugated to a therapeutic molecule via a formamide bond.

[0359] The linker of the conjugate may form part of the therapeutic molecule to which the peptide is attached. Alternatively, the therapeutic molecule may be directly attached to the C-terminus or N-terminus of the peptide carrier. Suitably, in such embodiments, a linker is not required.

[0360] Alternatively, the peptide carrier may be chemically conjugated to a therapeutic molecule. The chemical link may be, for example, a disulfide, alkenyl, alkynyl, aryl, ether, thioether, triazole, amide, carboxamide, urea, thiourea, aminourea, carbazide, hydrazine, oxime, phosphate ester, aminophosphate ester, thiophosphate ester, boron phosphate ester, iminophosphate ester, or thiol-maleimide link.

[0361] Optionally, a cysteine ​​residue may be added to the N-terminus of the therapeutic molecule to allow disulfide bond formation with the peptide carrier, or the N-terminus may be brominated to acetylate the thioether to conjugate it to the peptide carrier.

[0362] In one embodiment, the conjugate comprises a peptide carrier selected from one of the following sequences: RBRRBRFQILYBRBR (SEQ ID NO: ...NO:35), RBRRBRRFQILYRBHBH (SEQ ID NO:37) and RBRRBRFQILYRBHBH (SEQ ID NO:44), which are covalently linked to an antisense oligonucleotide comprising CAG repeats via a linker, wherein the linker is selected from β-alanine (B), GABA (Ab) and glutamate (E).

[0363] In one embodiment, the conjugate comprises a peptide carrier selected from one of the following sequences: RBRRBRFQILYBRBR (SEQ ID NO:35), RBRRBRRFQILYRBHBH (SEQ ID NO:37) and RBRRBRFQILYRBHBH (SEQ ID NO:44), which are covalently linked to an antisense oligonucleotide composed of CAG repeats via a linker, wherein the linker is selected from β-alanine (B), GABA (Ab) and glutamate (E).

[0364] In one embodiment, the conjugate comprises a peptide carrier selected from one of the following sequences: RBRRBRFQILYBRBR (SEQ ID NO:35), RBRRBRFQILYRBHBH (SEQ ID NO:37), and RBRRBRFQILYRBHBH (SEQ ID NO:44), which is covalently linked to an antisense oligonucleotide consisting of seven CAG repeats via a linker, wherein the linker is selected from β-alanine (B), GABA (Ab), and glutamate (E).

[0365] In one embodiment, the conjugate comprises a peptide carrier RBRRBRFQILYBRBR (SEQ ID NO:35), which is covalently linked to an antisense oligonucleotide consisting of seven CAG repeats via β-alanine (B).

[0366] (DPEP1.9)

[0367] In one embodiment, the conjugate comprises a peptide carrier RBRRBRFQILYBRBR (SEQ ID NO:35), which is covalently linked to an antisense oligonucleotide consisting of seven CAG repeats via glutamate (E). (DPEP1.9b) In one embodiment, this conjugate increases penetration into the diaphragmatic tissue. Appropriately, increased penetration into the diaphragm can be used to treat muscle disorders affecting the respiratory system, such as ankylosing dystrophy.

[0368] In one embodiment, the conjugate comprises the peptide carrier RBRRBRRFQILYRBHBH (SEQ ID NO:37), which is covalently linked via β-alanine (B) to an antisense oligonucleotide consisting of seven CAG repeats. (DPEP3.1) In one embodiment...In this formulation, the conjugate increases penetration into muscle tissue. Appropriately, increased penetration into muscle can be used to treat muscle disorders.

[0369] In one embodiment, the conjugate comprises a peptide carrier RBRRBRRFQILYRBHBH (SEQ ID NO:37), which is covalently linked via glutamate (E) to an antisense oligonucleotide consisting of seven CAG repeats. (DPEP3.1b) In one embodiment, the conjugate increases penetration into muscle tissue. Appropriately, increased penetration into muscle can be used to treat muscle disorders.

[0370] In one embodiment, the conjugate comprises a peptide carrier RBRRBRRFQILYRBHBH (SEQ ID NO:37), which is covalently linked via GABA (Ab) to an antisense oligonucleotide consisting of seven CAG repeats. (DPEP3.1a)

[0371] In one embodiment, the conjugate comprises a peptide carrier RBRRBRRFQILYRBHBH (SEQ ID NO:44), which is covalently linked via β-alanine (B) to an antisense oligonucleotide consisting of seven CAG repeats. (DPEP 3.8) In one embodiment, this conjugate increases penetration into muscle tissue. Suitablely, increased penetration into muscle can be used to treat muscle disorders.

[0372] In one embodiment, the conjugate comprises a peptide carrier RBRRBRFQILYRBHBH (SEQ ID NO:44), which is covalently linked via glutamate (E) to an antisense oligonucleotide consisting of seven CAG repeats. (DPEP 3.8b) In one embodiment, this conjugate increases penetration into diaphragmatic tissue. Suitablely, increased penetration into the diaphragm can be used to treat muscle disorders affecting the respiratory system, such as ankylosing dystrophy.

[0373] Any of the above conjugates may be acetylated at the N-terminus.

[0374] Pharmaceutical Composition and Administration

[0375] The conjugates of the present invention can be formulated into pharmaceutical compositions as described above.

[0376] According to a sixth aspect of the invention, the pharmaceutical composition comprises the conjugate of the present invention.

[0377] Suitablely, the pharmaceutical composition may also comprise one or more pharmaceutically acceptable components, such as one or more diluents, adjuvants, or carriers.

[0378] Appropriate pharmaceutically acceptable diluents, adjuvants, and carriers are well known in the art.

[0379] As used herein, the phrase "pharmaceutically acceptable" means those ligands, materials, formulations, and / or dosage forms that, within reasonable medical judgment, are suitable for contact with human and animal tissues without excessive toxicity, irritation, allergic reactions, or other problems or complications, and that meet a reasonable benefit / risk ratio.

[0380] As used herein, the phrase “pharmaceutically acceptable carrier” refers to a pharmaceutically acceptable material, formulation, or medium, such as a liquid or solid filler, diluent, excipient, solvent, or encapsulation material, relating to carrying or transporting the conjugate from one organ or site of the body to another organ or site of the body. Each peptide must be “acceptable” and harmless to an individual in the sense of compatibility with other components of the composition, such as peptides and therapeutic molecules.

[0381] Reconstituteable and administerable lyophilized compositions are also within the scope of the compositions of the present invention.

[0382] Pharmaceutically acceptable carriers can be, for example, excipients, mediums, diluents, and combinations thereof. For example, when the compositions are administered orally, they can be formulated as tablets, capsules, granules, powders, or syrups; or when used for parenteral administration, they can be formulated as injections, infusions, or suppositories. These compositions can be prepared by conventional methods, and if desired, the active compound (i.e., the conjugate) can be mixed with any conventional additives, such as excipients, binders, disintegrants, lubricants, flavoring agents, solubilizers, suspending agents, emulsifiers, coating agents, or combinations thereof.

[0383] It should be understood that the pharmaceutical compositions of this disclosure may further include other known therapeutic agents, pharmaceuticals, compounds modified into prodrugs, etc., for the purpose of alleviating, regulating, preventing, and treating the diseases, symptoms, and conditions described herein for medical use.

[0384] Suitably, the pharmaceutical compositions are used as pharmaceuticals. Suitably, they are used as pharmaceuticals in the same manner as the conjugates described herein. All features described herein relating to medical treatment using the conjugates are applicable to the pharmaceutical compositions.

[0385] Thus, in another aspect of the invention, a pharmaceutical composition according to the sixth aspect is provided for use as a pharmaceutical. In another aspect, a method for preventing or treating a disease condition in a subject is provided, comprising administering an effective amount of the pharmaceutical composition according to the sixth aspect to the subject.

[0386] Suitably, the pharmaceutical composition is used for the prevention or treatment of trinucleotide disorders, and suitably, the prevention or treatment method is directed at a subject with a trinucleotide disorder.

[0387] Prevention or Treatment

[0388] The conjugates of the present invention can be used as medicaments for the prevention or treatment of diseases, preferably trinucleotide repeat disorders.

[0389] The medicament may be in the form of pharmaceutical compositions as defined above.

[0390] A method for the prevention or treatment of a subject with a disease condition requiring treatment is also provided, the method comprising the step of administering a therapeutically effective amount of the conjugate to the subject.

[0391] Suitably, the conjugate is used for the prevention or treatment of trinucleotide repeat disorders.

[0392] Details of suitable genes comprising trinucleotide repeat amplification and the resulting trinucleotide repeat disorders are detailed above.

[0393] Alternatively, the conjugate may be used to prevent or treat other nucleotide duplication disorders. Appropriate details of such higher duplication amplifications and the resulting nucleotide duplication disorders have been described above.

[0394] The specific mechanism by which nucleic acids formed from trinucleotide duplications act to treat trinucleotide duplication disorders will vary depending on the trinucleotide duplication disorder in question. Suitablely, the nucleic acid binds to trinucleotide duplication amplifications in a gene or transcript. Suitablely, the nucleic acid reduces the level of transcripts containing trinucleotide duplication amplifications. Suitablely, the nucleic acid prevents the pathological effects of trinucleotide duplication amplifications, thereby preventing trinucleotide duplication disorders. This also applies to other nucleotide duplication disorders.

[0395] Thus, suitablely, the conjugate improves the physiological condition of the subject.

[0396] For example, the therapeutic nucleic acid of the conjugate may be operable to correct splicing defects caused by trinucleotide duplication disorders. Suitablely, the therapeutic nucleic acid of the conjugate may be operable to normalize splicing in subjects suffering from trinucleotide duplication disorders. Instructions for Use, Page 20 / 34, 22 CN 120837670 A

[0397] Suitably, the therapeutic nucleic acid of the conjugate is operable to bind the transcript of the DMPK gene. Suitably, the therapeutic nucleic acid of the conjugate is operable to bind repeat amplifications present in the DMPK gene transcript. Suitably, the therapeutic nucleic acid of the conjugate is operable to bind CUG repeat amplifications present in the DMPK gene transcript.

[0398] Thus, suitably, the conjugate reduces the level of DMPK transcript. Thus, suitably, the conjugate reduces the level of DMPK transcript with repeat amplifications. Thus, suitably, the conjugate reduces the level of DMPK transcript with CUG repeat amplifications.

[0399] Thus, suitably, the conjugate reduces the number of nuclear aggregation sites. Suitably, the conjugate prevents nuclear aggregation sites from interacting with the cell's splicing mechanisms. Suitably, the conjugate prevents nuclear aggregation sites from interacting with MBNL1. Suitably, the conjugate prevents nuclear aggregation sites from isolating MBNL1.

[0400] Suitablely, these effects are used for the prevention or treatment of DM1.

[0401] Suitablely, compared with healthy subjects, the conjugate can reduce myotonia by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, or 100% in subjects with DM1. Suitablely, the conjugate reduces myotonia by at least 50% in subjects with DM1. Suitablely, the conjugate reduces myotonia by 50%–100% in subjects with DM1.

[0402] Suitablely, the conjugate reduces nuclear aggregation sites in myoblasts of subjects with DM1 by 10%,15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%. Suitably, the conjugate reduces nuclear aggregation points in myoblasts of subjects with DM1 by at least 50%. Suitably, the conjugate reduces nuclear aggregation points in myoblasts of subjects with DM1 by 50%-90%.

[0403] Suitably, the conjugate corrects cardiac conduction in subjects with DM1 by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%. Suitably, the conjugate improves cardiac conduction in subjects with DM1 by at least 10%. Suitably, the conjugate improves cardiac conduction in subjects with DM1 by 10%-50%.

[0404] Suitably, the conjugate improves motor function in subjects with DM1 by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50%. Suitably, the conjugate improves motor function in subjects with DM1 by at least 10%. Suitably, the conjugate improves motor function in subjects with DM1 by 10%–50%.

[0405] Suitably, the conjugate improves muscle strength relative to body weight in subjects with DM1 by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50%. Suitably, the conjugate improves muscle strength relative to body weight in subjects with DM1 by at least 10%. Suitably, the conjugate improves muscle strength relative to body weight in subjects with DM1 by 10%–50%.

[0406] Suitably, the subject to be treated can be any animal or human. Suitablely, the subject may be a non-human mammal. Suitablely, the subject may be male or female.

[0407] Suitablely, the subject to be treated may be of any age. Suitablely, the age of the subject to be treated is 0-40 years, suitablely 0-30 years, suitablely 0-25 years, suitablely 0-20 years.

[0408] Suitablely, the conjugate is administered systemically to the subject, for example, via intramedullary, intrathecal, intravenous, intravitreal, intracortical, enteric, parenteral, intravenous, intraarterial, intramuscular, intratumoral, subcutaneous, oral, or nasal routes.

[0409] In one embodiment, the conjugate is administered intravenously to the subject.

[0410] In one embodiment, the conjugate is administered intravenously by injection to the subject.

[0411] Suitablely, the conjugate is administered to the subject in a “therapeuticly effective amount,” for which this means that the amount is sufficient to demonstrate benefit to the individual. The actual amount administered, as well as the rate and timing of administration, will depend on the nature of the disease being treated andSeverity. The determination of dosage is the responsibility of general practitioners and other physicians. Examples of this technique and protocol can be found on pages 21 / 34 of the instruction manual, 23 CN 120837670 A Remington's Pharmaceutical Sciences, 20th Edition, 2000, pub. Lippincott, Williams & Wilkins.

[0412] Exemplary dosages may be between 0.01 mg / kg and 50 mg / kg, between 0.05 mg / kg and 40 mg / kg, between 0.1 mg / kg and 30 mg / kg, between 0.5 mg / kg and 18 mg / kg, between 1 mg / kg and 16 mg / kg, between 2 mg / kg and 15 mg / kg, between 5 mg / kg and 10 mg / kg, between 10 mg / kg and 20 mg / kg, between 12 mg / kg and 18 mg / kg, and between 13 mg / kg and 17 mg / kg.

[0413] Advantageously, the dosage of the conjugate of the present invention is one level or order of magnitude lower than that required for therapeutic nucleic acid to take effect by application alone.

[0414] Suitably, after application of the conjugate of the present invention, one or more toxicity markers are significantly reduced compared to conjugates using currently available peptide carriers.

[0415] Suitable toxicity markers may be nephrotoxicity markers.

[0416] Suitable toxicity markers include serum KIM-1, NGAL, BUN, creatinine, alkaline phosphatase, alanine transferase, and aspartate transaminase levels.

[0417] Other suitable toxicity markers include urinary sodium, potassium, chloride, urea, creatinine, calcium, phosphorus, glucose, uric acid, magnesium, and protein levels.

[0418] Suitably, the level of at least one of KIM-1, NGAL, and BUN is appropriately reduced after application of the conjugate of the present invention compared to conjugates using currently available peptide carriers.

[0419] Suitably, the levels of each of KIM-1, NGAL, and BUN are appropriately reduced after application of the conjugate of the present invention compared to conjugates using currently available peptide carriers.

[0420] Suitably, the levels of said or each marker are significantly reduced compared to conjugates using currently available peptide carriers.

[0421] Suitably, the levels of said or each marker are reduced by up to 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% after application of the conjugate of the present invention compared to conjugates using currently available peptide carriers.

[0422] Advantageously, the conjugates exhibit significantly reduced toxicity compared to existing peptides and conjugates. In particular, KIM-1 andNGAL-1 is a marker of toxicity, and they are significantly reduced by up to 120-fold compared to conjugates using currently available peptide carriers.

[0423] Suitably, the long-term toxicity of the conjugates is negligible. Suitably, the conjugates have no long-term toxic effects.

[0424] Suitably, apart from the expected effect on the amplification of the target trinucleotide repeat, the conjugates have no significant effect on the gene expression of the subjects. Suitably, the conjugates have no negative effect on the gene expression of the subjects.

[0425] Suitably, after administration of the conjugates of the present invention, cell viability is significantly improved compared to conjugates using currently available peptide carriers.

[0426] Suitably, after administration of the conjugates of the present invention, myoblast and hepatocyte viability is significantly improved compared to conjugates using currently available peptide carriers. Suitablely, after application of the conjugate of the present invention, myoblast and hepatocyte viability increases by up to 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, and 50% compared to conjugates using currently available peptide carriers.

[0427] Suitablely, after application of the conjugate of the present invention, cell survival is significantly improved compared to conjugates using currently available peptide carriers. Specification 22 / 34 pages 24 CN 120837670 A

[0428] Suitablely, after application of the conjugate of the present invention, recovery time is reduced by up to 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, and 50% compared to conjugates using currently available peptide carriers.

[0429] Suitably, after application of the conjugate of the invention, the recovery time is less than 60 minutes, less than 50 minutes, less than 40 minutes, less than 30 minutes, less than 20 minutes, less than 10 minutes, or less than 5 minutes. Suitably, after application of the conjugate of the invention, there is no recovery time.

[0430] Nucleic Acids and Hosts

[0431] The peptide vectors of the invention can be prepared by any standard protein synthesis method (e.g., chemical synthesis, semi-chemical synthesis) or by using an expression system.

[0432] Therefore, the invention also relates to a DNA or nucleotide sequence comprising the conjugate, an expression system (e.g., a vector comprising the sequence and the desired sequence for expression and control of expression), and a host cell and host organism transformed by the expression system.

[0433] Therefore, nucleic acids encoding the conjugates according to the invention are also provided.

[0434] Suitably, the nucleic acids can be provided in isolated or purified form.

[0435] Expression vectors comprising nucleic acids encoding the conjugates according to the invention are also provided.

[0436] Suitably, the associated vector is a plasmid.

[0437] Suitably, the carrier includes a regulation sequence (e.g., a promoter) operatively linked to encoding according to the present invention.The conjugate is a nucleic acid. Suitablely, the expression vector is capable of expressing the conjugate when transfected into a suitable cell (e.g., a mammalian, bacterial, or fungal cell).

[0438] Host cells comprising the expression vector of the present invention are also provided.

[0439] The expression vector can be selected based on the host cell into which the nucleic acid of the present invention can be inserted. Such conversion of the host cell involves conventional techniques, such as those taught in Sambrook et al. [Sambrook, J., Russell, D. (2001) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY, USA]. The selection of a suitable vector is within the capabilities of those skilled in the art. Suitable vectors include plasmids, bacteriophages, granules, and viruses.

[0440] The resulting conjugate can be isolated and purified from the host cell by any suitable method, such as precipitation or chromatographic separation, such as affinity chromatography.

[0441] Suitable vectors, hosts, and recombinant techniques are well known in the art.

[0442] In this specification, the term "operably linked" can include situations where a selected nucleotide sequence and a regulatory nucleotide sequence are covalently linked in such a manner that the expression of the nucleotide-coding sequence is under the control of the regulatory sequence, such that the regulatory sequence can influence the transcription of the nucleotide-coding sequence that forms part or all of the selected nucleotide sequence. The resulting transcript can then be translated into the desired conjugate, where appropriate. Brief Description of the Drawings

[0443] The invention will now be described with reference to the following drawings and examples, in which:

[0444] Figure 1 illustrates a reduction in the number of pathogenic nuclear aggregation sites and MBNL redistribution in myoblasts of DM1 patients with 2600 CTG repeats. The results showed that transfection with different doses of the DPEP1 / 3-[CAG]7PMO conjugate did not reduce cell viability of myoblasts or hepatocytes 48 hours later (shown in 10 μM).

[0445] Figures 2A, B, and C and Figures 3A, B, C, and D show that, at various concentrations, different DPEP1 / 3-[CAG]7PMO conjugates corrected splicing defects of the Mbnl-dependent transcript in myoblasts of DM1 patients at various concentrations, compared to conjugates formed using existing peptide carriers Pip6a and Pip9b2, said myoblasts being derived from DM1 patients with 2600 repeats in the DMPK gene.

[0446] Figure 4 shows the systemic delivery of different DPEP1 / 3-[CAG]7PMO conjugates at 30 mg / kg (intravenous injection, tail vein).The compound corrected splicing defects of the Mbnl-dependent transcript in the gastrocnemius and quadriceps femoris muscles of HSA-LR mice. RT-PCR analysis of splicing of exon 7a of clcn1, exon 22 of serca, and exon 5 of mbnl1 (the most widely used biomarker for DM1) showed that splicing was normalized to wild-type levels for the DPEP1 and 3-based conjugates. Data from six HSA-LR mice for each peptide-PMO were analyzed by ANOVA and Tukey post-hoc tests compared to untreated HSA-LR mice. Data are mean ± SEM (*p<0.05, **p<0.01, ***p<0.001, ns not significant).

[0447] Figure 5 shows the percentage of myoblast cell viability 48 hours after transfection of DM1 patient myoblasts with 2600 CTG replicates with various doses of different DPEP1 / 3-[CAG]7PMO conjugates. Compared to conjugates formed using existing peptide carriers Pip6a and Pip9b2, the concentration of the DPEP1 / 3-[CAG]7PMO conjugate can be increased several times from therapeutic levels without causing cell death in myoblasts.

[0448] Figure 6 shows the percentage of hepatocyte viability 48 hours after transfection of DM1 patient myoblasts with 2600 CTG replicates with different DPEP1 / 3-[CAG]7 conjugates and a comparative conjugate. Compared to conjugates formed using existing peptide carriers Pip6a and Pip9b2, the concentration of the DPEP1 / 3-[CAG]7PMO conjugate can be increased several times from therapeutic levels without causing cell death in hepatocytes.

[0449] Figures 7 and 9 show the electromyographic myotonia measurements of the gastrocnemius muscle in HSA-LR mice 2 weeks after a single dose of different DPEP1 / 3-[CAG]7PMO conjugates (30 mg / kg, n=6, intravenous injection, tail vein). Data were analyzed using ANOVA and Tukey post-hoc tests and compared with untreated HSA-LR mice and a comparative conjugate with DPEP 5.7. Data are mean ± SEM (*p<0.05, **p<0.01, ***p<0.001, ns not significant). Figure 10 shows detailed data for individual tests.

[0450] Figure 8 shows the corresponding myotonia grades in the data in Figures 8 and 10 in HSA-LR mice 2 weeks after a single dose of different DPEP1 / 3-[CAG]7PMO conjugates (30 mg / kg, n=6, intravenous, tail vein). Data were analyzed using unpaired Student's t-tests and compared with untreated HSA-LR mice and a comparative conjugate with DPEP 5.7. Data are mean ± SEM.

[0451] Figures 10A, B, and C show the serum levels of ALP, ALT, and AST assessed in C57BL6 female mice (8–10 weeks old, n = 5 per group) after being injected intravenously (tail vein) with different DPEP1 / 3-[CAG]7PMO conjugates. Serum was collected 7 days post-injection and compared with saline. The fold increases in ALP, ALT, and AST levels were similar to those induced by the saline control compared to existing Pip series peptide carriers.

[0452] Figure 11A shows the serum KIM-1 levels assessed in urine on days 2 and 7 after injection of different DPEP1 / 3-[CAG]7PMO conjugates in C57BL6 female mice, measured by ELISA (R&D cat#MKM100) with samples diluted to fit within the standard curve. Values ​​were normalized to urinary creatinine levels (Harwell) to calculate urinary protein concentrations. KIM-1 levels were similar to the saline control injection compared to the fold increase induced by existing Pip series peptide carriers.

[0453] Figures 11B and C show the serum BUN and creatinine levels assessed on day 7 after injection of different DPEP1 / 3-[CAG]7PMO conjugates into female C57BL6 mice (Harwell) compared to saline injection. BUN and creatinine levels were similar to the saline control injection compared to the fold increase induced by existing Pip series peptide carriers.

[0454] Figures 12 and 13 show the urinary KIM-1 / creatinine ratio assessed on days 2, 7, and 14 after administration of DPEP3.8-[CAG]7PMO conjugates by injection at 30 mg / kg or 6 doses of 5 mg / kg into female C57BL6 mice compared to saline injection. Creatinine and KIM-1 levels were similar to the saline control injection compared to the fold increase induced by existing Pip series peptide carriers.

[0455] Figures 14A, B, C, and D show the urinary sodium, potassium, chloride, urea, creatinine, calcium, phosphorus, glucose, uric acid, magnesium, and protein levels in female C57BL6 mice (8–12 weeks old, n = 5 per group) after injection of different DPEP1 / 3-[CAG]7PMO conjugates at doses of 5, 7.5, and 30 mg / kg (see page 24 / 34 of the instruction manual, CN 120837670 A). Error bars represent SEM.

[0456] Figure 15 shows the body weight of HSA-LR mice treated with the DPEP3.8-[CAG]7PMO conjugate. The long-term body weight of the five HSA-LR mice injected with a single dose of 30 mg / kg did not show any significant decrease compared to the five HSA-LR mice injected with saline.

[0457] Figure 16 shows the administration of 30 mg / kg of the conjugate or 3 x 200 mg / kg of naked PMO to HSA-LR mice (intravenous injection).Biodistribution and delivery analysis of different DPEP1 / 3-[CAG]7PMO conjugates measured by ELISA in the following two weeks. Evaluation of the biodistribution of the DPEP1.9 and DPEP3.8 conjugates revealed optimal delivery to severely affected tissues in DM1. PMO was detected by a custom ELISA assay using probes labeled with digoxin and biotin. Two weeks after treatment, the concentration of PMO in muscle tissue remained >1 nM, while the pM detected after injection of naked PMO was lower (although the molar concentration difference between naked PMO and DPEP-PMO conjugate treatment was >20-fold) (n=4). Data are presented as mean + / - SEM. Statistical analysis: one-way ANOVA with Tukey post-hoc test.

[0458] Figure 17 shows the pharmacokinetic characteristics of different DPEP1 / 3-[CAG]7PMO conjugates measured in serum after a single 5 mg / kg injection. Serum concentrations were quantified using a custom ELISA, reaching 500–800 nM 5 minutes after intravenous injection of 5 mg / kg, decreasing to 100 nM after 1 hour, and to 10 nM after 3 hours. Concentrations were approximately 1 nM 6 hours post-treatment, with most of the compound having been cleared or delivered to the tissue of interest.

[0459] Figures 18A, B, C, and D illustrate in more detail how systemic delivery of different DPEP1 / 3-[CAG]7PMO conjugates corrected splicing defects of the Mbnl-dependent transcript in the gastrocnemius muscle of HSA-LR mice. RT-PCR analysis of splicing of exon 7a of Clcn1, exon 22 of Serca, exon 5 of Mbnl1, and exon 11 of Ldb3 showed that splicing was normalized to wild-type levels using DPEP1.9 and DPEP3.8-based conjugates at 30 and 40 mg / kg. Splice correction persisted for at least 3 months post-treatment and was also significant after a single low dose (5 and 7.5 mg / kg) (boxes indicate data distribution to quartiles, highlighting the mean; error bars indicate variability outside the upper and lower quartiles, n = 5 per group).

[0460] Figures 19A, B, and C show that myotonia grades in HSA-LR mice were corrected to wild-type levels (from 4 to 0) after a single dose of 30 or 40 mg / kg based on conjugates of DPEP1.9 and DPEP3.8. This correction persisted for at least 3 months post-treatment (A). Myotonia was reduced to 50% when the dose was distributed over four injections (4 x 7.5 mg / kg) (B), while reducing the dose to 4 x 5 mg / kg resulted in a 20-25% reduction two weeks after the last injection (C) (error bars indicate SEM); (n = 6, intravenous injection, tail vein).

[0461] Figure 20 shows the intravenous administration of different DPEP 1 / 3- in HSA-LR mice (8-12 weeks old, n=5 per group)Toxicological screening of serum and urine at 2 days and 1 week after treatment with the [CAG]7PMO conjugate showed no significant change in phenotype-normalizing doses in HSA-LR mice. Compared with saline-treated HSA-LR mice, KIM1 levels changed significantly only after treatment with DPEP1.9, DPEP3.8, DPEP3.1, and DPEP3.1b at 30 mg / kg or 40 mg / kg, and only at 2 days post-treatment. Error bars represent SEM.

[0462] Figure 21 shows the correction of the DM1 phenotype (myotonia) in HSA-LR mice several weeks after the first injection of various administration regimens, including: four doses of 5 mg / kg of DPEP3.8-[CAG]7PMO conjugate, four doses of 7.5 mg / kg of DPEP3.8-[CAG]7PMO conjugate, a single dose of 7.5 mg / kg of DPEP3.8-[CAG]7PMO conjugate, a single dose of 30 mg / kg of DPEP3.8-[CAG]7PMO conjugate, or a single dose of 40 mg / kg of DPEP3.8-[CAG]7PMO conjugate. Treatment with low doses of DPEP3.8-[CAG]7PMO conjugate (5–7.5 mg / kg) without any toxicity reduced myotonia.

[0463] Figure 22 shows the correction of the DM1 phenotype (myotonia) in HSA-LR mice several weeks after the first injection of various administration regimens, including: four doses of 5 mg / kg of DPEP1.9-[CAG]7PMO conjugate, four doses of 7.5 mg / kg of DPEP1.9-[CAG]7PMO conjugate (page 25 / 34, CN 120837670 A), a single dose of 7.5 mg / kg of DPEP1.9-[CAG]7PMO conjugate, or a single dose of 40 mg / kg of DPEP1.9-[CAG]7PMO conjugate. Treatment with low doses of DPEP1.9-[CAG]7PMO conjugate (5–7.5 mg / kg) without any toxicity reduced myotonia.

[0464] Figure 23 shows the PMO concentrations (pM) in various tissues 2 weeks after intravenous administration of the following substances to HSA-LR mice: naked PMO (3 doses 200 mg / kg), 30 mg / kg of DPEP3.8-[CAG]7PMO conjugate, 30 mg / kg of DPEP3.8b-[CAG]7PMO conjugate, 7.5 mg / kg of DPEP3.8-[CAG]7PMO conjugate, and 40 mg / kg of DPEP3.8-[CAG]7PMO conjugate. Both peptides (DPEP3.8 and DPEP3.8b) successfully delivered PMO to muscle, achieving concentrations >6 nM in skeletal muscle.

[0465] Figure 24 shows the PMO concentrations (pM) in various tissues after two weeks of IV administration of the following substances to HSA-LR mice: naked PMO (3 doses, 200 mg / kg), 30 mg / kg of DPEP1.9-[CAG]7PMO conjugate, 30 mg / kg of DPEP1.9b-[CAG]7PMO conjugate, 7.5 mg / kg of DPEP1.9-[CAG]7PMO conjugate, and 40 mg / kg of DPEP1.9-[CAG]7PMO conjugate. Both peptides (DPEP1.9 and DPEP1.9b) successfully delivered PMO to muscle. DPEP1.9b-[CAG]7PMO reached the diaphragm particularly well (>15 nM after two weeks of a single intravenous injection of 30 mg / kg).

[0466] Figure 25 shows the PMO concentrations (pM) in various tissues 2 weeks after intravenous administration of the following substances to HSA-LR mice: naked PMO (3 doses 200 mg / kg), 30 mg / kg of DPEP3.1-[CAG]7PMO conjugate, 30 mg / kg of DPEP3.1a-[CAG]7PMO conjugate, and 30 mg / kg of DPEP3.1b-[CAG]7PMO conjugate. These three peptides (DPEP3.1, DPEP3.1a, and DPEP3.1b) are capable of delivering PMO to skeletal muscle and cardiac muscle (>1 nM).

[0467] Figures 26, 27, and 28 show toxicological screening of KIM-1 relative to creatinine levels measured in urine at different time points after systemic intravenous administration of different doses of the different peptide-[CAG]7PMO conjugates of the present invention, compared to injection of saline, injection of naked [CAG]7PMO, and injection of the Pip peptide-[CAG]7PMO conjugate. The DPEP peptide-[CAG]7PMO conjugate of the present invention maintains low toxicity even at higher doses compared to, in particular, the Pip6a-[CAG]7PMO conjugate. Using dosage regimens capable of reversing the DM1 phenotype to healthy levels, the DPEP conjugate does not affect toxicity biomarkers.

[0468] Throughout the description and claims of this specification, the words “comprising” and “including” and variations thereof mean “including but not limited to”, and they are not intended to (and do not) exclude other parts, additives, components, integers, or steps. Throughout the description and claims of this specification, the singular form includes the plural form unless the context requires otherwise. In particular, where indefinite articles are used, the invention should be understood to include both the plural and the singular, unless the context requires otherwise.

[0469] Features, integers, properties, compounds, chemicals described in connection with specific aspects, embodiments, or examples of the inventionParts or groups shall be understood to be applicable to any other aspect, embodiment, or example described herein, unless incompatible therewith. All features disclosed in this specification (including any appended claims, abstract, and drawings) and / or all steps of any method or process so disclosed may be combined in any arbitrary combination, except that at least some of these features and / or steps are mutually exclusive combinations.

[0470] The invention is not limited to the details of any of the foregoing embodiments. The invention extends to any novel one or any novel combination of features disclosed in this specification (including any appended claims, abstract, and drawings), or to any novel one or any novel combination of steps of any method or process so disclosed. Readers should note all papers and documents related to this application that were filed concurrently with or prior to this specification and are publicly available together with this specification, the contents of which are incorporated herein by reference.

[0471] Example Description 26 / 34 pages 28 CN 120837670 A

[0472] 1. Materials and Methods

[0473] Synthesis and Preparation of P-PMO

[0474] 9-fluorenylmethoxycarbonyl (Fmoc) protected L-amino acid, benzotriazol-1-yl-oxy-tripyrrolylphosphine (PyBOP), 2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethylurea hexafluorophosphate (HBTU) and Fmoc-β-Ala-OH pre-filled Wang's resin (0.19 or 0.46 mmol g-1) were obtained from Merck (Hohenbrunn, Germany). 1-Hydroxy-7-azabenzotriazole (HOAt) was obtained from Sigma-Aldrich. HPLC-grade acetonitrile, methanol, and synthetic-grade N-methyl-2-pyrrolidone (NMP) were purchased from Fisher Scientific (Loughborough, UK). Peptide synthetic-grade N,N-dimethylformamide (DMF) and diethyl ether were obtained from VWR (Leicestershire, UK). Piperidine and trifluoroacetic acid (TFA) were obtained from Alfa Aesar (Heysham, UK). PMO was purchased from Gene Tools Inc. (Philomath, USA). Unless otherwise specified, all other reagents were obtained from Sigma-Aldrich (St. Louis, MO, USA). MALDI-TOF mass spectrometry analysis was performed using a Voyager DE Pro BioSpectrometry workstation. A stock solution of 10 mg mL⁻¹ of α-cyano-4-hydroxycinnamic acid or sinapic acid in 50% acetonitrile in water was used as the matrix. Error bars are ±0.1%.

[0475] Synthesis of P-PMO peptides for screening

[0476] a) Preparation of peptide variant libraries

[0477] Peptides were prepared at a scale of 10 μmol using an Intavis parallel peptide synthesizer or at a scale of 100 μmol using an Intavis parallel peptide synthesizer (Buckingham, UK) using Fmoc-β-Ala-OH pre-loaded Wang's resin (0.19 or 0.46 mmol g⁻¹) and following the manufacturer's recommendations, applying standard Fmoc chemistry methods and following the manufacturer's recommendations. When synthesizing using an Intavis parallel peptide synthesizer, the double coupling step was used in conjunction with a PyBOP / NMM coupling mixture, followed by acetic anhydride capping after each step. For syntheses using an Intavis Liberty Blue peptide synthesizer, all amino acids were single-standard coupled except for arginine, which was double-coupled. The coupling was performed at 75°C for 5 minutes at 60 W microwave power, except for arginine residues, each of which was coupled twice. Each deprotection reaction was performed twice at 75°C for 30 seconds each time, followed by 3 minutes at 35 W microwave power. Once synthesis was complete, the resin was washed with DMF (3 x 50 mL) and the N-terminus of the solid-bound peptide was acetylated with acetic anhydride in the presence of DIPEA at room temperature. After N-terminal acetylation, the peptide resin was washed with DMF (3 x 20 mL) and DCM (3 x 20 mL). The peptide was separated from the solid support by treatment with a separation mixture consisting of trifluoroacetic acid (TFA): H2O: triisopropylsilane (TIPS) (95%: 2.5%: 2.5%: 3-10 mL) at room temperature for 3 hours. After peptide release, excess TFA was removed by purging with nitrogen. The crude peptide was precipitated by adding cold diethyl ether (15-40 mL, depending on the synthesis scale) and centrifuged at 3200 rpm for 5 minutes. The crude peptide precipitate was washed three times with cold ether (3 × 15 mL) and purified by RP-HPLC using a Varian 940-LC HPLC system equipped with a 445-LC amplification module and a 440-LC fraction collector. The peptide was purified by semi-preparative HPLC on an RP-C18 column (10 x 250 mm, Phenomenex Jupiter) using a linear gradient of CH3CN in 0.1% TFA / H2O at a flow rate of 15 mL min⁻¹. Detection was performed at 220 nm and 260 nm. Fractions containing the desired peptide were combined and lyophilized to obtain a white solid peptide (yields are shown in Table 1).

[0478]

[0479]

[0480] (Instructions for Use, Pages 27 / 34, CN 120837670 A)Table 1: Synthetic peptides used for testing in the examples, having N-terminal acetylation (Ac), N-terminal succinate linker (Succ), C-terminal β-alanine linker (B), γ-aminobutyric acid linker (Ab), and glutamate linker (E). S* is a glucosylated serine residue. Conjugates formed with DPEP5.7, Pip6a, and Pip9b2 are comparable.

[0481] b) Synthetic peptide-PMO conjugate library

[0482] The 21-mer PMO antisense sequence CAGCAGCAGCAGCAGCAGCAG (SEQ ID NO. 95), also known as [CAG]7, was used for the triplet repeat sequence. The PMO sequence (5′-CAGCAGCAGCAGCAGCAGCAG-3′ (SEQ ID NO: 95)) targeting the repeat sequence of CUG / CTG amplification was purchased from Gene Tools LLC. This is the [CAG]7PMO mentioned elsewhere in this document. The peptide is conjugated to the 3' end of PMO via its C-terminal carboxyl group. This was achieved using 2.5 and 2 equivalents of PyBOP and HOAt in NMP, respectively, in the presence of 2.5 equivalents of DIPEA and using 2.5 times the excess peptide of PMO dissolved in DMSO. Typically, PyBOP (19.2 μL of 0.3 M NMP solution), HOAt (16.7 μL of 0.3 M NMP solution), DIPEA (1.0 mL), and PMO (180 μL of 10 mM DMSO solution) were added to a solution of the peptide (2500 nmol) dissolved in N-methylpyrrolidone (NMP, 80 μL). The mixture was incubated at 40 °C for 2.5 h, and the reaction was quenched by adding 300 μL of 0.1% TFA in H2O solution. The solution was purified by ion-exchange chromatography using a modified Gilson HPLC system. The PMO-peptide conjugate was purified on an ion-exchange column (Resource S 4 mL, GE Healthcare) using a linear gradient of sodium phosphate buffer (25 mM, pH 7.0) containing 20% ​​CH3CN. The conjugate was eluted from the column with sodium chloride solution (1 M) at a flow rate of 4 mL min⁻¹ or 6 mL min⁻¹. Fractions containing the desired compound were immediately combined and desalted. Excess salts were removed from the peptide-PMO conjugate by filtering the fractions collected after ion exchange using an Ultra-15 3K centrifuge. The conjugate was lyophilized and analyzed by MALDI-TOF. Before use, the conjugate was dissolved in sterile water and filtered through a 0.22 μm cellulose acetate membrane. The concentration of peptide-PMO was determined by the conjugate in 0.1 N HCl.The molar absorption at 265 nm in solution was used to determine the yield. (See Table 2 for yield).

[0483] Peptide Yield Specification 28 / 34 Page 30 CN 120837670 AD-Pep 1.1 36% D-Pep 1.7 41% D-Pep 1.8 38% D-Pep 1.9 40% D-Pep 1.9b 34% D-Pep 1.9W3 43% D-Pep 1.9W4P 23% D-Pep 3.1 31% D-Pep 3.1a 17% D-Pep 3.1b 25% D-Pep 3.1d 37% D-Pep 3.8 36% D-Pep 3.8b 35% D-Pep 5.70 31%

[0484] Table 2. Yields of P-PMO conjugates used for cell culture analysis and in vivo experiments (the yields are based on the dry weight of lyophilized purified P-PMO. The purity of P-PMO was greater than 95% as determined by normal-phase HPLC at 220 nm and 260 nm.)

[0485] Animal models and ASO injection. Experiments were conducted at Oxford University or the Centre d'études fonctionnelles (Sorbonne University Medical School) in accordance with the laws of the United Kingdom and France (Ethics Committee Permit #1 7 6 0 - 2015091512001083v6). Intravenous injection in HSA-LR or C57BL / 6 mice was performed by single or multiple administrations via the tail vein. Peptide-PMO-CAG7 at doses of 5, 7.5, 12.5, 30 or 40 mg / kg and PMO at doses of 12.5 or 200 mg / kg were administered at 0.9% Diluted in saline and administered at a volume of 5–6 μL / g body weight. Multiple injections were given at 2-week intervals. Myotonia was assessed and tissue was harvested 2 weeks after the last injection. For long-term experiments, tissue was harvested 3 months after injection. For toxicological measurements, tissue was harvested 1 week later. Urine was tested by ELISA (R&D cat#MKM100), with samples diluted to conform to a standard curve. Values ​​were normalized to urinary creatinine levels (Harwell) to calculate urinary protein concentration

[0486] . In situ myotonia / muscle relaxation measurements. The isometric contraction properties of the gastrocnemius muscle were studied in situ. Mice were anesthetized with ketamine / xylan solutions (80 mg / kg and 15 mg / kg, respectively). Knees and feet were secured with clips and needles. The distal tendon of the gastrocnemius muscle was attached to a lever arm (305B, dual-mode lever) of a servo motor system. Data were recorded and analyzed using a PowerLab system (4SP, ADInstruments) and software (Figure 4, ADInstruments). Ultrasound was used for a duration of 0.1 ms.Large (10-V) square wave pulses were used to stimulate the sciatic nerve (proximal crushing) via bipolar silver electrodes. Absolute maximum isometric tetanic force (P0) was measured during isometric contraction in response to electrical stimulation (frequency from 25 to 150 Hz, stimulation sequence of 500 ms). Tetany was measured as the delay in muscle relaxation after measuring P0.

[0487] Cell culture and peptide-PMO treatment. Immortalized myoblasts from healthy individuals or DM1 patients with 2600 CTG replicates were cultured in a growth medium consisting of an M199:DMEM mixture (1:4 ratio, Life Technologies) supplemented with 20% FBS (Life Technologies), 50 μg / ml gentamicin (Life Technologies), 25 μg / ml fetoglobulin, 0.5 ng / ml bFGF, 5 ng / ml EGF, and 0.2 μg / ml dexamethasone (Sigma-Aldrich). For myoblasts, myoblast differentiation was induced by switching the confluenced cell culture to DMEM medium supplemented with 5 μg / ml insulin (Sigma-Aldrich). For treatment, WT or DM1 cells were differentiated for 4 days. Then, the medium was replaced with fresh differentiation medium containing peptide-PMO conjugates at concentrations of 1, 2, 5, 10, 20, or 40 μM. Cells were harvested for analysis 48 hours after treatment. Cell viability was quantified using a fluorescence-based assay (Promega) 2 days after transfection with peptide-PMO at a concentration of 40 μM in human liver cells or at concentrations of 1, 2, 5, 10, 20, or 40 μM in myoblasts.

[0488] RNA isolation, RT-PCR, and qPCR analysis. For mouse tissue: muscle was disrupted using the Fastprep system and Lysing Matrix D tubes (MP biomedicals) in TriReagent (Sigma-Aldrich) prior to RNA extraction. For human cells: cells were lysed for 45 minutes at 55°C in proteinase K buffer (500 mM NaCl, 10 mM Tris-HCl, pH 7.2, 1.5 mM MgCl2, 10 mM EDTA, 2% SDS, and 0.5 mg / ml proteinase K) prior to RNA extraction. Total RNA was isolated using TriReagent according to the manufacturer's protocol. One microgram of RNA was reverse transcribed using the M-MLV first-strand synthesis system (Life Technologies) according to the manufacturer's instructions, for a total volume of 20 μL. Subsequently, the RNA was processed according to standard protocols (ReddyMix, Thermo).Scientific) used one microliter of cDNA preparation for semi-quantitative PCR analysis. Primers are shown in Table 3 below:

[0489] Table 3

[0490] Specification 30 / 34 pages 32 CN 120837670 A

[0491]

[0492] PCR amplification was performed for 25-35 cycles within the linear amplification range for each gene. PCR products were separated on 1.5-2% agarose gels, stained with ethidium bromide, and quantified using ImageJ software. The exon inclusion ratio was quantified as a percentage of inclusion relative to the total intensity of the isoform signal. To quantify mRNA expression, real-time PCR was performed according to the manufacturer's instructions. PCR cycles consisted of a 15-minute denaturation step followed by 50 cycles of denaturation at 94°C for 15 seconds, annealing at 58°C for 20 seconds, and extension at 72°C for 20 seconds.

[0493] Fluorescence in situ hybridization / immunofluorescence. As previously described, fluorescence in situ hybridization (FISH) experiments were performed using a Cy3-labeled 2'OMe (CAG) 7 probe (Eurogentec). For combined FISH-immunofluorescence assays, immunofluorescence staining was performed after the final FISH wash with rabbit polyclonal anti-MBNL1 antibody, followed by secondary Alexa Fluor 488 conjugated with goat anti-rabbit (1:500, Life Technologies) antibody.

[0494] Measurement of oligonucleotide concentrations in tissues based on ELISA. A custom hybridization-based ELISA was developed to determine the concentration of PMO oligonucleotides using a digoxigenin and biotin-labeled phosphate thioester probe (sequence (5'->3')[DIG] C*T*G*C*T*G*C*TGCTGCT*G*C*T*G*C*T*G[BIO](SEQ ID NO:96)). The assay had a linear detection range of 5–250 pM (R² > 0.99) in mouse serum and tissue lysates. The probe was used to detect peptide-PMO or naked PMO concentrations in eight different tissues (brain, kidney, liver, lung, heart, diaphragm, gastrocnemius, and quadriceps) from treated HSA-LR mice.

[0495] 2. Results

[0496] In this work, we used an arginine-rich cell-penetrating peptide with a specific structure and demonstrated that, compared with unconjugated PMO and other peptide carrier conjugate strategies, this peptide conjugated with [CAG]7 morpholinophosphodiamid oligomer (PMO) significantly enhanced ASO delivery into the striated muscle of DM1 model HSA-LR mice after systemic administration. Therefore, low-dose treatment with the claimed conjugate of peptide-[CAG]7 PMO targeting pathological amplification is sufficient to reverseSplicing defects and myotonia in transgenic DM1 mice (HSA-LR) and normalized the overall disease transcriptome. Furthermore, muscle cells (myoblasts) derived from treated DM1 patients showed that the claimed peptide-[CAG]7PMO conjugate specifically targeted the mutant CUGexp-DMPK transcript, thereby eliminating the detrimental isolation of the nuclear RNA aggregation site to the MBNL1 splicing factor and the resulting loss of MBNL1 function, which caused splicing defects and muscle dysfunction. Our results demonstrate that the claimed peptide-[CAG]7PMO conjugate induces efficient and durable correction of DM1-related phenotypes at both the molecular and functional levels and strongly support the use of these peptide conjugates for systemic corrective therapy of DM1.

[0497] We have generated data on conjugates containing peptide carriers free of artificial amino acids (e.g., X residues), which have a wider therapeutic window and safer toxicological profiles compared to previous cell-penetrating peptides, thus constituting more promising candidates for testing in DM1 patients. When conjugated with the CAG7 repeat antisense oligonucleotide PMO, these new-generation so-called “DPEP1 and DPEP3” peptides showed high efficacy in reducing the number of pathogenic aggregation sites (Fig. 1) and correcting splicing defects in vitro (Figs. 2, 3, 4, and 19). None of the tested concentrations resulted in reduced cell viability in human hepatocytes (1–40 μM), unlike similar comparative conjugates formed from known “Pip” carrier peptides; Pip6a-PMO and Pip9b2-PMO induced significant cell death (>50%) at 40 μM (Fig. 7). Many of the tested concentrations did not result in reduced cell viability in human myoblasts and performed better than similar comparative conjugates formed from known “Pip” carrier peptides Pip6a-PMO and Pip9b2-PMO, which induce cell death at lower doses (Figs. 5 and 6).

[0498] We then tested whether these novel peptides could also effectively correct myotonia and splicing changes in HSA-LR mice. To this end, we tested the main peptide carriers DPEP1.9 and DPEP3.8 of the DPEP 1 and 3 series and compared them with the existing peptide carrier DPEP 5.70. We were able to demonstrate that splicing defects (Fig. 4) and myotonia (Figs. 8, 9, and 10) were corrected to wild-type levels after two weeks of treatment with the conjugate formed from DPEP3.8 and DPEP1.9 at a dose of 30 mg / kg.

[0499] The biodistribution of naked PMO and the biodistribution of the conjugate formed with the carrier peptides DPEP1.9 and DPEP3.8 were assessed by ELISA to quantify the delivery of the peptide-[CAG]7PMO conjugate. Detection of PMO in tissues severely affected by DM1 (e.g., heart and brain) is important for drug delivery development. A single intravenous injection of 30 mg / kg of the peptide-[CAG]7PMO conjugate was administered.HAS-LR mice were administered 200 mg / kg of naked PMO three times (total 600 mg / kg). PMO levels in the gastrocnemius, quadriceps, diaphragm, heart, and brain were analyzed two weeks after administration. Unconjugated naked [CAG]7PMO was present at levels as low as undetectable in all tested tissues; however, [CAG]7PMO conjugated with peptide carriers DPEP1.9 and DPEP3.8 was detected at higher levels (>20-fold molar concentration) despite lower doses. Generally, two weeks after injection at 30 mg / kg, the peptide-[CAG]7PMO conjugates were detected at 1 nM–4 nM in the quadriceps, gastrocnemius, and diaphragm, and at 1 nM in the heart (Figure 17).

[0500] Table 4 Specification 32 / 34 pages 34 CN 120837670 A

[0501]

[0502] We also investigated the pharmacokinetic properties of the peptide-[CAG]7PMO conjugate of the present invention as measured in serum after administration of a low dose of the peptide-[CAG]7PMO conjugate (5 mg / kg). We quantified the concentrations in serum, which reached 500–800 nM 5 minutes after intravenous injection, decreased to 100 nM after 1 hour, and decreased to 10 nM after 3 hours. The concentration was approximately 1 nM 6 hours after treatment, with most of the compound having been cleared or delivered to the tissue of interest (Figure 18).

[0503] Preliminary toxicological evaluation of the conjugates formed from the DPEP3.8 and DPEP1.9 carrier peptides in wild-type mice showed that ALP, ALT, AST, KIM-1, creatinine, BUN, and NGAL levels were similar to those of the saline control injection, contrary to the multiple increases typically caused by currently available peptide carriers from the Pip series. Using these preliminary data, we demonstrated that the conjugate formed from the DPEP peptide and [CAG]7PMO in vivo is as active as Pip6a, but with a wider therapeutic window (Figures 11, 12, and 21).

[0504] Furthermore, compared with five HSA-LR mice injected with saline, five HSA-LR mice injected with a single dose of 30 mg / kg of the conjugate formed from DPEP3.8-[CAG]7 showed no significant trend in body weight (Figure 16).

[0505] In addition, the recovery time of HSA-LR mice after injection of the DPEP-based [CAG]7PMO conjugate was shorter than that after injection of conjugates formed from existing peptide carriers (such as Pip6a) (Table 5).

[0506] Table 5

[0507]

[0508] To evaluate the efficacy of the conjugates of the present invention in more detail, we also found that splicing defects and myotonia were corrected to wild-type levels at least 3 months after administration of the DPEP peptide-[CAG]7PMO conjugate (Figures 19 and 20, respectively). We also measuredAfter administration of a dose of 7.5 mg / kg, missplicing and myotonia were reduced by 50%. (Instructions for Use, pages 33 / 34, CN 120837670 A)

[0509] Notably, conjugates formed with existing peptide carriers (such as Pip6a-[CAG]7PMO) cannot be tested at >20 mg / kg without causing high mortality in mice, unlike the conjugates of the present invention, whose concentrations can be increased by more than 5-fold without causing any mortality. Furthermore, in toxicity screening, we only detected changes in Kim1 levels compared to saline levels at doses exceeding 30 mg / kg 2 days post-treatment (Figure 21).

[0510] Efficacy and toxicology data indicate that the claimed conjugates formed with the DPEP1 and DPEP3 series carrier peptides are particularly effective in blocking the chelation of amplified CTG repeats to MBNL1 in individuals affected by DM1 and induce low toxicity. These conjugates are able to completely correct the DM1 phenotype at the molecular level by normalizing splicing and at the muscle level by correcting myotonia to wild-type levels. These new conjugates also have a wider therapeutic window than existing peptide carrier-formed conjugates, and are therefore closer to clinical realization.

[0511] In summary, we present strong evidence to support (1) that peptide-[CAG]7PMO blocks the pathological interaction of MBNL1 with nuclear mutant CUGexp-RNA and rescues downstream effects on RNA splicing; (2) the antisense oligonucleotide approach of peptide conjugates allows for the delivery of treatment to hard-to-reach tissues, such as the heart in the diaphragm; and (3) the powerful effect of [CAG]7PMO in directly targeting disease mutations, combined with the ability of peptide carrier technology to provide highly effective treatment in vivo, together strongly reversed the DM1 phenotype in skeletal muscle DM1 mice (HSA-LR) to wild-type levels, even months after treatment cessation. This evidence strongly suggests that peptide-[CAG]7 conjugates may have a potent disease-modifying effect in DM1.

[0512] In fact, our experiments show that the effects we observed in HSA-LR mice not only prevented the deterioration of DM1 pathology but also actually led to a reversal of the disease phenotype. The amplified CUG transcript was expressed in pups, and HSA-LR mice showed significant myotonia at 1 month of age. The animals we used to produce results supporting this application were treated at least 2 months to 7 months of age, well beyond the time point of molecular and functional phenotype development of DM1.

[0513] 3. Conclusion

[0514] *The conjugate containing the DPEP carrier peptide and [CAG]7PMO (10 μM) was able to reduce the number of nuclear lesions in myoblasts of DM1 patients and >50% in controls (at doses that do not reduce cell viability). Compared with the effect induced by concentrations of 20 μM or higher,Unlike other carrier peptides that resulted in cell death (>50%), the conjugates tested at concentrations that did not reduce cell viability (1–40 μM).

[0515] *The conjugates containing the DPEP carrier peptide and [CAG]7PMO showed positive pharmacokinetics, and biodistribution assessments revealed optimal delivery to severely affected tissues in DM1.

[0516] *The conjugates containing the DPEP carrier peptide and [CAG]7PMO induced 50%–90% splicing correction in HSA-LR mice at doses (30 mg / kg, intravenously) in exon 7a of Clcn1, exon 22 of Serca, exon 5 of Mbnl1, and exon 11 of Ldb3, with lower toxicity than the conjugates containing other carrier peptides at 12.5 mg / kg. RT-PCR analysis also showed that splicing normalization to wild-type levels was achieved using conjugates containing DPEP1.9 and DPEP3.8 at 30 and 40 mg / kg. Splice correction persisted for at least 3 months after treatment and was also significant after a single low dose (5 and 7.5 mg / kg).

[0517] *Based on qualitative observation of myotonia and electromyographic myotonia measurements, conjugates containing DPEP carrier peptides and [CAG]7PMO reduced myotonia to wild-type levels after a single injection at 40 mg / kg or 30 mg / kg (IV). Moderate correction of myotonia was also observed after four injections of conjugates containing DPEP3.8 or DPEP1.9 at 7.5 mg / kg.

[0518] *The duration of lethargy induced in wild-type mice by a conjugate containing DPEP carrier peptides and [CAG]7PMO injected at 30 mg / kg (IV) was shorter (>1 hour) than that induced by a single injection at 12.5 mg / kg with other carrier peptides. Kidney function and blood analysis, including urinary biochemistry tests, showed no changes compared to saline in wild-type mice. In HSA-LR, Kim1 levels and urinary protein showed slight changes after reaching 30 mg / kg. [Instruction manual page 34 / 34, page 36, CN 120837670 A, Figure 1; Instruction manual figure 1 / 34, page 37, CN 120837670 A, Figure 2A; Instruction manual figure 2 / 34, page 38, CN 120837670 A, Figure 2B; Instruction manual figure 3 / 34, page 39, CN 120837670 A, Figure 2C; Instruction manual figure 4 / 34, page 40, CN 120837670 A, Figure 3A; Instruction manual figure 5 / 34, page 41, CN 120837670 A, Figure 3B; Instruction manual figure 6 / 34, page 42, CN 120837670 A, Figure 3C; Instruction manual figure 7 / 34, page 43, CN]120837670 A Figure 3D, Instruction Manual Appendix 8 / 34, Page 44 CN 120837670 A Figure 4, Instruction Manual Appendix 9 / 34, Page 45 CN 120837670 A Figure 5, Instruction Manual Appendix 10 / 34, Page 46 CN 120837670 A Figure 6, Instruction Manual Appendix 11 / 34, Page 47 CN 120837670 A Figure 7, Instruction Manual Appendix 12 / 34, Page 48 CN 120837670 A Figure 8 Figure 9, Instruction Manual Appendix 13 / 34, Page 49 CN 120837670 A Figure 10A Figure 10B, Instruction Manual Appendix 14 / 34, Page 50 CN 120837670 A Figure 10C, Instruction Manual Appendix 15 / 34, Page 51 CN 120837670 A Figure 11, Instruction Manual Appendix 16 / 34, Page 52 CN 120837670 A Figure 12 Figure 13 Appendix to the Instruction Manual, Page 17 / 34, 53 CN 120837670 A Figure 14A Figure 14B Appendix to the Instruction Manual, Page 18 / 34, 54 CN 120837670 A Figure 14C Figure 14D Appendix to the Instruction Manual, Page 19 / 34, 55 CN 120837670 A Figure 15 Figure 16 Appendix to the Instruction Manual, Page 20 / 34, 56 CN 120837670 A Figure 17 Figure 18A Appendix to the Instruction Manual, Page 21 / 34, 57 CN 120837670 A Figure 18B Appendix to the Instruction Manual, Page 22 / 34, 58 CN 120837670 A Figure 18C Appendix to the Instruction Manual, Page 23 / 34, 59 CN 120837670 A Figure 18D Appendix to the Instruction Manual, Page 24 / 34, 60 CN 120837670 A Figure 19 Appendix to the Instruction Manual, Page 25 / 34, 61 CN 120837670 A Figure 20 Instruction Manual Appendix 26 / 34 Page 62 CN 120837670 A Figure 21 Instruction Manual Appendix 27 / 34 Page 63 CN 120837670 A Figure 22 Instruction Manual Appendix 28 / 34 Page 64 CN 120837670 A Figure 23 Instruction Manual Appendix 29 / 34 Page 65 CN 120837670 A Figure 24 Instruction Manual Appendix 30 / 34 Page 66 CN 120837670 A Figure 25 Instruction Manual Appendix 31 / 34 Page 67 CN 120837670Figure 26, page 32 / 34 of the specification, CN 120837670 A Figure 27, page 33 / 34 of the specification, CN 120837670 A Figure 28, page 34 / 34 of the specification, CN 120837670 A Abstract Abdominal ultrasound examination method, system and device CONJUGATE AND USES THEREOF The present invention relates to conjugates formed from a cell-penetrating peptide carrier linked to a therapeutic molecule, wherein the peptide carrier is defined by specific domains and the therapeutic molecule is a nucleic acid formed of trinucleotide repeats. The present invention further relates to the use of such a conjugate in methods of treatment or as a medicament, especially in the treatment of trinucleotide repeat disorders such as myotonic dystrophy (DM1).

Claims

1. A conjugate comprising: a peptide carrier covalently linked to a therapeutic molecule; The total length of the peptide carrier is 40 or fewer amino acids, and includes: two or more cationic domains, each containing at least 4 amino acid residues, and one or more hydrophobic domains, each containing at least 3 amino acid residues, wherein the peptide carrier does not contain artificial amino acid residues. Furthermore, the therapeutic molecule comprises a nucleic acid, wherein the nucleic acid comprises multiple trinucleotide repeats.

2. The conjugate according to claim 1, wherein the nucleic acid comprises a plurality of trinucleotide repeats selected from GTC, CAG, GCC, GGC, CTT and CCG repeats.

3. The conjugate according to claim 1 or 2, wherein the nucleic acid comprises a plurality of CAG repeats.

4. The conjugate according to any of the preceding claims, wherein the nucleic acid comprises 5-20 trinucleotide repeats, preferably 5-10 trinucleotide repeats, and more preferably 7 trinucleotide repeats.

5. The conjugate according to any of the preceding claims, wherein the nucleic acid is bound to a trinucleotide repeat amplification.

6. The conjugate according to any of the preceding claims, wherein the peptide carrier is composed of natural amino acid residues.

7. The conjugate according to any of the preceding claims, wherein each cationic domain has a length of 4 to 12 amino acid residues, preferably 4 to 7 amino acid residues.

8. The conjugate according to any of the preceding claims, wherein each cationic domain comprises at least 40%, at least 45%, or at least 50% cationic amino acids.

9. The conjugate according to any of the preceding claims, wherein each cationic domain comprises arginine, histidine, β-alanine, hydroxyproline and / or serine residues, preferably wherein each cationic domain is composed of arginine, histidine, β-alanine, hydroxyproline and / or serine residues.

10. The conjugate according to any of the preceding claims, wherein the peptide carrier comprises two cationic domains.