Preeclampsia biomarker and use thereof

The fusion genes PSPC1-MRPS31P2 and LINC00630-AL035494 serve as a non-invasive biomarker for preeclampsia, enhancing diagnostic accuracy through real-time PCR, addressing the need for early and effective preeclampsia detection.

HK40134622APending Publication Date: 2026-07-10SHENZHEN BAY LAB
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
HK42026123773
Authority / Receiving Office
HK · HK
Patent Type
Applications
Current Assignee / Owner
Filing Date
2026-05-21
Publication Date
2026-07-10

AI Technical Summary

Technical Problem

Current diagnostic methods for preeclampsia lack accurate and early detection techniques, relying heavily on clinical symptoms and lacking effective non-invasive approaches, which are crucial for timely intervention and reducing maternal and fetal complications.

Method used

A preeclampsia biomarker comprising fusion genes PSPC1-MRPS31P2 and LINC00630-AL035494, detected through real-time quantitative PCR in peripheral blood, providing a non-invasive diagnostic method with high accuracy and low cost.

Benefits of technology

Enables early prediction and diagnosis of preeclampsia with improved accuracy, suitable for large-scale clinical use, using a reagent kit that includes nucleic acid molecules and PCR reagents for detecting these fusion genes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

The invention discloses a preeclampsia biomarker and an application of the preeclampsia biomarker. The preeclampsia biomarker comprises at least one of a fusion gene PSPC1-MRPS31P2 and a fusion gene LINC00630-AL035494. The preeclampsia biomarker can be used for detecting preeclampsia. The preeclampsia biomarker provided by the invention can provide a non-invasive diagnosis scheme for clinical prenatal preeclampsia, and preeclampsia specific high-expression fusion genes (PSPC1-MRPS31P2 and LINC00630-AL035494) in peripheral blood of a pregnant woman are detected through real-time quantitative PCR (Polymerase Chain Reaction), so that preeclampsia early prediction, disease diagnosis and monitoring of the state of a patient in the illness period are realized; and in combination with the existing clinical diagnosis scheme, the accuracy of pre-eclampsia diagnosis is improved.
Need to check novelty before this filing date? Find Prior Art

Description

(19) State Intellectual Property Office (12) Invention Patent Application (10) Application Publication Number (43) Application Publication Date (21) Application Number 202411335494.9 (22) Application Date 2024.09.24 (71) Applicant Shenzhen Bay Laboratory Address 518132, Guangdong Province, China, Guangqiao Road, Tianliao Community, Yutang Street, Guangming District, Shenzhen, 1st Floor 102, 2nd Floor 202, 3rd Floor 304 (72) Inventors Sun Kun, Yang Mengqi, Wang Qi (74) Patent Agency Guangzhou Jiaquan Patent & Trademark Agency Co., Ltd. 44205 Patent Attorney Xiao Yun (51) Int.Cl. C12Q 1 / 6883 (2018.01) C12N 15 / 11 (2006.01) (54) Invention Title: A Preeclampsia Biomarker and Its Application (57) Abstract: This invention discloses a preeclampsia biomarker and its application, wherein the preeclampsia biomarker includes at least one of the fusion genes PSPC1-MRPS31P2 and LINC00630-AL035494. The preeclampsia biomarker provided by this invention can provide a non-invasive diagnostic approach for prenatal preeclampsia in clinical practice. By detecting the preeclampsia-specifically highly expressed fusion genes (PSPC1-MRPS31P2 and LINC00630-AL035494) in the peripheral blood of pregnant women through real-time quantitative PCR, early prediction of preeclampsia, disease diagnosis, and monitoring of the patient's condition during the course of the disease can be achieved; combined with existing clinical diagnostic protocols, the accuracy of preeclampsia diagnosis can be improved. Claims (1 page), Description (6 pages), Sequence Listing (electronic publication), Drawings (2 pages) CN 121718625 A 2026.03.24 CN 1 21 71 86 25 A 1. A preeclampsia biomarker, characterized in that the preeclampsia biomarker comprises at least one of the fusion gene PSPC1-MRPS31P2 and the fusion gene LINC00630-AL035494. 2. The preeclampsia biomarker according to claim 1, characterized in that the sequence information of the fusion gene PSPC1-MRPS31P2 and the fusion gene LINC00630-AL035494 is as follows: 3. A nucleic acid molecule, characterized in that the nucleic acid molecule comprises specific primers for detecting the preeclampsia biomarker as described in claim 1 or 2. 4. The nucleic acid molecule according to claim 3, characterized in that the nucleic acid molecule comprises specific primers for detecting the fusion gene PSPC1-MRPS31P2; preferably, the specific primers for detecting the fusion gene PSPC1-MRPS31P2 comprise: primer pairs as shown in SEQ ID NO. 3 and SEQ ID NO. 4; or, as shown in SEQ ID NO.5. The nucleic acid molecule according to claim 3, characterized in that the nucleic acid molecule comprises specific primers for detecting the fusion gene LINC00630-AL035494; preferably, the specific primers for detecting the fusion gene LINC00630-AL035494 comprise: primer pairs as shown in SEQ ID NO.7 and SEQ ID NO.8; or, primer pairs as shown in SEQ ID NO.9 and SEQ ID NO.10. 6. A kit, characterized in that the kit comprises the nucleic acid molecule according to any one of claims 3 to 5. 7. The kit according to claim 6, characterized in that the kit further comprises nucleic acid extraction reagents, a primer set for an internal reference gene, and PCR reaction reagents. 8. The kit according to claim 7, characterized in that the PCR reaction reagents comprise DNA polymerase, dNTPs, and a fluorescent dye. 9. The kit according to claim 6, characterized in that the sample types applicable to the kit include blood samples and placental tissue samples; preferably, the blood samples include serum samples and / or plasma samples. 10. The application of the preeclampsia biomarker as described in claim 1 or 2 in (1) to (3): (1) preparing a product for detecting preeclampsia; (2) preparing a product for evaluating the prognostic analysis of preeclampsia; (3) screening drugs for the treatment and / or prevention of preeclampsia. Claims 1 / 1 page 2 CN 121718625 A Preeclampsia Biomarker and Its Application Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a preeclampsia biomarker and its application. Background Art

[0002] Preeclampsia (PE) is a serious pregnancy complication related to hypertension. The main symptoms are the first appearance of hypertension, proteinuria, edema, liver or kidney damage, etc. after 20 weeks of pregnancy, and the symptoms become more severe in the later stages. Statistics show that about 2-8% of pregnant women suffer from preeclampsia each year, which is one of the main causes of maternal and fetal death. Preeclampsia has a complex pathogenesis, involving multiple factors, mechanisms, and pathways. Clinically, low-dose aspirin or oral calcium supplementation can improve the condition to some extent, but safe and effective treatments are still lacking, and termination of pregnancy is currently the only effective method. Furthermore, the diagnosis of preeclampsia mainly relies on clinical symptoms, such as maternal blood pressure, proteinuria, central nervous system symptoms, liver and kidney function, and blood biochemical indicators, lacking early diagnostic techniques. Therefore, improving the ability to diagnose preeclampsia early and providing timely clinical intervention and treatment are crucial for preventing and reducing preeclampsia and its associated complications.The risk of death is of great significance. Because the pathogenesis of preeclampsia is not yet clear, an accurate and effective prediction and diagnosis method has not yet been established.

[0003] A large number of studies have confirmed that angiogenic factors (such as sFlt-1, PlGF, sEng) can play a certain predictive role in preeclampsia in mid-pregnancy. When the sFlt-1 / PlGF ratio is ≤38, the negative predictive value is 99.3%, and when the ratio is >38, the positive predictive value is 36.7%. However, prospective, large-sample, multicenter clinical studies are still needed for such indicators. Maternal risk factors are still important clinical indicators for early screening of high-risk groups. Several recent studies have compared the cell-free RNA (cfRNA) transcriptome and DNA (cfDNA) methylation profiles in the plasma of pregnant women with preeclampsia symptoms and normal pregnant women. The sensitivity for diagnosing preeclampsia reached about 70%, but the experimental technique threshold is high and large-scale validation is lacking.

[0004] Abnormal placental formation and development is one of the key pathological mechanisms of preeclampsia. Studies have shown that the placenta and tumors are very similar in some aspects, such as high cell proliferation and division capacity, invasiveness, and high expression of angiogenic factors (such as VEGF). Therefore, the placenta may contain some biological phenomena common in tumors, such as fusion genes; fusion genes are new genes formed by the fusion of all or part of the sequences of two or more genes, belonging to a type of mutation, and are closely related to the pathogenesis of certain diseases. At present, most of the research on fusion genes is in the field of oncology, and some fusion genes have become biomarkers for tumor diagnosis and therapeutic targets. Summary of the Invention

[0005] The present invention aims to at least solve one of the technical problems existing in the prior art. To this end, the present invention proposes a preeclampsia biomarker, which can be used as a prenatal non-invasive diagnosis biomarker for preeclampsia, with the advantages of high accuracy, low technical threshold and low cost, and is suitable for large-scale promotion and use.

[0006] The present invention also proposes a nucleic acid molecule.

[0007] The present invention also proposes a reagent kit.

[0008] The present invention also proposes the application of the above-mentioned preeclampsia biomarker.

[0009] According to a first aspect of the present invention, a preeclampsia biomarker is provided, wherein the preeclampsia biomarker comprises at least one of the fusion gene PSPC1-MRPS31P2 and the fusion gene LINC00630-AL035494.

[0010] In some embodiments of the present invention, the nucleotide sequence of the fusion gene PSPC1-MRPS31P2 near the fusion site is shown in SEQ ID NO.1.

[0011] In some embodiments of the present invention, the nucleotide sequence of the fusion gene LINC00630-AL035494 near the fusion site is shown in SEQ ID NO.2.

[0012] In some embodiments of the present invention, the sequence information of the fusion gene PSPC1-MRPS31P2 and the fusion gene LINC00630-AL035494 is as follows:

[0013]

[0014] According to a second aspect of the present invention, a nucleic acid molecule is provided, the nucleic acid molecule comprising specific primers for detecting preeclampsia biomarkers as described in the first aspect of the present invention.

[0015] In some embodiments of the present invention, the nucleic acid molecule comprises specific primers for detecting the fusion gene PSPC1-MRPS31P2.

[0016] In some preferred embodiments of the present invention, the specific primers for detecting the fusion gene PSPC1-MRPS31P2 comprise: primer pairs as shown in SEQ ID NO.3 and SEQ ID NO.4; or, primer pairs as shown in SEQ ID NO.5 and SEQ ID NO.6.

[0017] In some embodiments of the present invention, the nucleic acid molecule includes specific primers for detecting the fusion gene LINC00630-AL035494.

[0018] In some preferred embodiments of the present invention, the specific primers for detecting the fusion gene LINC00630-AL035494 include: primer pairs as shown in SEQ ID NO.7 and SEQ ID NO.8; or, primer pairs as shown in SEQ ID NO.9 and SEQ ID NO.10.

[0019] In some embodiments of the present invention, the nucleic acid molecule is suitable for detection by RT-qPCR or digital PCR.

[0020] According to a third aspect of the present invention, a kit is provided, the kit comprising the nucleic acid molecule as described in the second aspect of the present invention.

[0021] In some embodiments of the present invention, the kit further includes nucleic acid extraction reagents, a primer set for an internal reference gene, and PCR reaction reagents.

[0022] In some preferred embodiments of the present invention, the PCR reaction reagents include DNA polymerase, dNTPs, and fluorescent dyes.

[0023] In some embodiments of the present invention, the sample types for which the kit is applicable include blood samples and placental tissue samples.

[0024] In some preferred embodiments of the present invention, the blood sample includes serum samples and / or plasma samples.

[0025] According to a fourth aspect of the present invention, the application of the preeclampsia biomarker as described in the first aspect of the present invention in (1) to (3) is proposed:

[0026] (1) Preparation of a product for detecting preeclampsia;

[0027] (2) Preparation of a product for evaluating the prognostic analysis of preeclampsia; SpecificationPage 2 / 6 4 CN 121718625 A

[0028] (3) Screening for drugs used to treat and / or prevent preeclampsia.

[0029] The present invention has at least the following beneficial effects:

[0030] The preeclampsia biomarkers provided by the present invention can provide a non-invasive diagnostic scheme for prenatal preeclampsia in clinical practice. By detecting the preeclampsia-specific high-expression fusion genes (PSPC1-MRPS31P2 and LINC00630-AL035494) in the peripheral blood of pregnant women through real-time quantitative PCR, the early prediction of preeclampsia, disease diagnosis and monitoring of the patient's condition during the disease can be achieved; combined with the existing clinical diagnostic schemes, the accuracy of preeclampsia diagnosis can be improved. The kits provided by the present invention can be used for early diagnosis of the disease, and the reagent cost and experimental operation difficulty are low, making them suitable for large-scale clinical promotion.

[0031] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:

[0032] Figure 1 is a graph showing the detection results of the expression levels of the fusion genes PSPC1-MRPS31P2 (left) and LINC00630-AL035494 (right) in clinical placental samples in Embodiment 2 of the present invention; wherein, “Control” represents healthy human samples, “PE” represents preeclampsia patient samples, “***” represents a p-value less than 0.001, and “*” represents a p-value less than 0.05;

[0033] Figure 2 is a graph showing the detection results of the expression levels of the fusion genes PSPC1-MRPS31P2 (left) and LINC00630-AL035494 (right) in clinical plasma samples in Embodiment 2 of the present invention; wherein, “Control” represents healthy human samples, “PE” represents preeclampsia patient samples, “**” represents a p-value less than 0.01, and “*” represents a p-value less than 0.05;

[0034] Figure 3 is a ROC analysis curve of the combined expression level of the fusion gene PSPC1-MRPS31P2 and the fusion gene LINC00630-AL035494 in clinical plasma samples in Examples 2 and 3 of the present invention;

[0035] Figure 4 is a schematic diagram of the experimental process for verification in Examples 2 to 4 of the present invention. Detailed Embodiments

[0036] The concept and technical effects of the present invention will be clearly and completely described below in conjunction with the embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, not all of the embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.

[0037] When a numerical range is disclosed herein, the above range is considered to be continuous and includes the minimum and maximum values ​​of the range, as well as every value between such minimum and maximum values. Further, when the range refers to an integer, it includes the rangeEvery integer between the minimum and maximum values ​​of the range. Furthermore, when multiple ranges are provided to describe a feature or characteristic, the ranges may be merged. In other words, unless otherwise specified, all ranges disclosed herein should be understood to include any and all subranges to which they are included.

[0038] Unless otherwise specified, the reagents, methods, and equipment used in this invention are conventional reagents, methods, and equipment in this technical field.

[0039] Example 1 Screening of biomarkers associated with preeclampsia

[0040] This example is based on placental samples from 10 patients with preeclampsia (all of whom were late-onset preeclampsia, LOP type, which is the main subtype of preeclampsia, accounting for more than 80%) and placental samples from 9 healthy pregnant women with similar age and gestational age to the above patients. Transcriptome maps of these placental samples were drawn using whole transcriptome sequencing technology (RNA-seq). Then, multiple fusion genes were identified using STAR-Fusion software, including the fusion gene PSPC1-MRPS31P2 and the fusion gene LINC00630-AL035494. Specific qPCR primers were further designed for these fusion genes, and the expression levels of these fusion genes in the above 19 placental samples were accurately quantified using the specific primers. The specific experimental steps are as follows: Instruction manual 3 / 6 pages 5 CN 121718625 A

[0041] 1) Sample collection:

[0042] After delivery, fresh placental chorionic villus tissue from the fetal side was collected into a 2mL cryovial and immediately placed in a -80°C freezer for long-term storage until use. Before use, approximately 100mg of the tissue was ground with liquid nitrogen without thawing for downstream experiments such as RNA extraction and reverse transcription.

[0043] 2) Specific primer design:

[0044] Based on the sequences of the fusion gene PSPC1-MRPS31P2 and the fusion gene LINC00630-AL035494 near the fusion site, specific primers were designed accordingly;

[0045] The sequence of the fusion gene PSPC1-MRPS31P2 near the fusion site is as follows: 5'-TGAGGCAAGATCTA ATG AGGCGTCAAGAAGAACTCAGACGCTTGGAAGAACTCAGAAACCAAGAGTTGCAAAAACGGAAGCAAATACAACTAA GACATGAAGAGGAGCATCGGCGGCGTGAGGAAGAAATGATCCGACACAGAGAACAGGAGGAACTGAGGCGACAGCA AGAGGGCTTTAAGCCAAACTACATGGAAAATGGTGATAAAAGAAAATGTGGCTGAAGTTACCCGAAGTTCAGCTTGCAGTGTAATTCAGAAGAGTTAAGACCAGAAGTACTGGAATCATACTTCCTTTCAGAATTGAGTCCCTAAGTCCTGA GTTGGTGGCAGCTGCATCTGCTGTGGCAGATTCTCTCCCTTTTGACAAGCAAATAACCAAGTCAGAGCTGTTGAGG CAGCTCCAGCAGCATGAGGAAGAGTCAAGGGCACAGAGAGATGCAGAGAGAACTAAAATTAGTTTCAGTAACGTAA TATCAGATATGAATGTTGCCAGATCTGCTACAGCTAGAGTTTGTTCAAGACCAGAGCATCAGATTCAGTTTGACAA GGGCTATGACAATTATCCTGGCCAGGAGAAGACTGCTGATCTTACAAAAAG‑3' (SEQ ID NO.1);

[0046] The sequence of the fusion gene LINC00630‑AL035494 near the fusion site is as follows: 5'‑CTTGAACATCG AG ATGAAAATATACTGTCTACGTTGTTCAACACAATAGCTAATGGCAACTGTGGCAGTTGAACACCCGAAACGTGATG AATGTGACTGAGGAACTGAACTTTTAGTTTCATTGTGACATGATGAATGAATTTATTGAGCCCCAGGAAGAAGGAA AATTAAAGAAGAGCAAAGAATAATAGCTGGACAGAAGATGGGGGTCATTGAACCTATATCCTAGTTGCCAGACCAG TAAACTGACATGGGACCTGGGGGAGGCAGCAGATGACCGAAAACCTGGAGTGATGGTGGCTGAATACCGCATGATC TGAAGACTGCACTGGTGGCTGCGATTGATATTGGAAAAGCAGTTTCCCATTGAGTCTCAAATGAAGAGAGTGCAGA TGAAGAGGAGAAGACTCTGTATTGAACCAAGGTGCTCTACACAGTAGCCCCTACTAAGCTCCCAGCAGATGCCAGC ATCAGTCATCCATCTCTTCATGTGGATGTCTG-3' (SEQ ID NO.2);

[0047] The primer design principles mainly include: primer length of 17-25 bp; GC content percentage of each primer of 40%-60%; the primer annealing temperature is close to 60℃, and the difference between the annealing temperatures of the upstream and downstream primers is within 5℃; avoid 3 or more complementary bases within or between primers; two pairs of usable primers were designed, and the specific sequences are as follows:

[0048] PSPC1-MRPS31P2-upstream primer 1: 5'-CAGAATTGAGTCCCTAAGTCCTGA-3' (SEQ ID NO.3);

[0049] PSPC1-MRPS31P2-downstream primer 1: 5'-CTGCCTCAACAGCTCTGACT-3' (SEQ ID NO.4);

[0050] PSPC1-MRPS31P2-upstream primer 2: 5'-TCAGAATTGAGTCCCTAAGTCCTG-3' (SEQ ID NO.5);

[0051] PSPC1-MRPS31P2-downstream primer 2: 5'-TGCCTCAACAGCTCTGACTT-3' (SEQ ID NO.4);

[0052] LINC00630-AL035494-Upstream primer 1: 5'-AGCAGATGACCGAAAACCTG-3' (SEQ ID NO. 7);

[0053] LINC00630-AL035494-Downstream primer 1: 5'-ATATCAATCGCAGCCACCAG-3' (SEQ ID NO. 8);

[0054] LINC00630-AL035494-Upstream primer 2: 5'-GCAGATGACCGAAAACCTGG-3' (SEQ ID NO. 9);

[0055] LINC00630-AL035494-Downstream primer 2: 5'-TATCAATCGCAGCCACCAGT-3' (SEQ ID NO. 10);

[0056] This embodiment uses PSPC1-MRPS31P2-upstream primer 1, PSPC1-MRPS31P2-downstream primer 1, LINC00630-AL035494-downstream primer 1 and LINC00630-AL035494-downstream primer 1 for testing.

[0057] 3) Extraction of placental tissue RNA and quantitative detection of the target gene: Instruction manual 4 / 6 pages 6 CN 121718625 A

[0058] RNA was extracted from the placental sample obtained in step 1) using TRIzol Reagent (Invitrogen, #15596018) reagent and Direct-zol RNAMiniprep Kits (Zymo, #R2052), and HiScript III All-in-one RT SuperMix Perfect forReverse transcription was performed using a qPCR (Vayzme, #R333-01) kit. The cDNA obtained from the reverse transcription was diluted 2-fold for downstream quantitative detection.

[0059] The cDNA obtained after diluting the placental tissue RNA by the corresponding fold was used to quantitatively detect the expression levels of the fusion genes PSPC1-MRPS31P2 and LINC00630-AL035494 in placental samples using a Taq Pro Universal SYBR qPCR Master Mix (Vayzme, #Q712-02) kit. The results are shown in Figure 1.

[0060] As shown in Figure 1, the expression levels of PSPC1-MRPS31P2 and LINC00630-AL035494 were significantly upregulated in preeclampsia placental samples.

[0061] The sequence information of the fusion genes PSPC1-MRPS31P2 and LINC00630-AL035494 is shown in Table 1.

[0062] Table 1 Sequence information of the two fusion genes

[0063]

[0064] Example 2 Application of fusion gene PSPC1-MRPS31P2 as a biomarker in the preparation of products for detecting preeclampsia

[0065] This example provides specific detection primers for the fusion gene PSPC1-MRPS31P2 and uses peripheral blood samples from a total of 22 pregnant women, including 12 patients with LOP type preeclampsia and 10 healthy controls of similar age and gestational age. Blood samples were collected between 30 and 34 weeks of gestation to verify the feasibility of the fusion gene PSPC1-MRPS31P2 as a biomarker for preeclampsia. The specific verification process is as follows:

[0066] 1) Sample collection:

[0067] Peripheral blood (6 mL) was collected from the vein using a blood collection tube containing an anticoagulant (EDTA). The blood was centrifuged at low temperature (4 °C) and medium speed (1600 rpm) for 15 min. The supernatant was then aspirated and transferred to a new centrifuge tube. The blood was then centrifuged again at low temperature (4 °C) and high speed (16000 rpm) for 15 min. The supernatant (i.e., plasma) was then aspirated and transferred to a new centrifuge tube or cryopreservation tube. The plasma can be used immediately for subsequent experiments or stored in an ultra-low temperature (-80 °C) freezer until use.

[0068] 2) Specific primer design:

[0069] In this embodiment, the PSPC1-MRPS31P2- upstream primer 1 and PSPC1-MRPS31P2- downstream primer 1 provided in Example 1 were used for testing.

[0070] 3) Extraction of plasma cfRNA and quantitative detection of the target gene:

[0071] The plasma cfRNA was extracted from the target gene using the Quick-cfDNA / cfRNA Serum & Plasma Kit (Zymo, #R1072) from step 1).cfRNA was extracted from the obtained plasma samples, and the cfRNA was subjected to gene primer-specific reverse transcription and cDNA amplification using the Single Cell Sequence Specific Amplification Kit (Vayzme, #P621-01). The amplified cDNA was diluted 25-fold for downstream quantitative detection.

[0072] The cDNA obtained after diluting the plasma cfRNA by the corresponding factor was used to quantitatively detect the expression level of the fusion gene PSPC1-MRPS31P2 in the plasma samples by qPCR using the Taq Pro Universal SYBR instruction manual page 5 / 6 7 CN 121718625 A qPCR Master Mix (Vayzme, #Q712-02). The results are shown in Figure 2. Further ROC curve analysis was performed based on the detection of plasma samples, and the results are shown in Figure 3.

[0073] As shown in Figure 2, compared with the control group, the expression of the fusion gene PSPC1-MRPS31P2 in the plasma cfRNA of the disease group (PE group) was significantly upregulated, and the result was statistically significant.

[0074] As shown in Figure 3, the AUC is 0.79, indicating that the fusion genes PSPC1-MRPS31P2 can effectively distinguish patients with preeclampsia and can be used as specific biomarkers for plasma diagnosis of preeclampsia.

[0075] Example 3 Application of fusion gene LINC00630-AL035494 as a biomarker in the preparation of products for detecting preeclampsia

[0076] This example provides specific detection primers for the fusion gene LINC00630-AL035494, and uses peripheral blood samples from 22 pregnant women (the same as in Example 2) to verify the feasibility of the fusion gene LINC00630-AL035494 as a biomarker for preeclampsia. The specific verification process is as follows:

[0077] 1) Sample collection: See step 1 of Example 2).

[0078] 2) Specific primer design:

[0079] In this embodiment, the upstream primer 1 of LINC00630-AL035494 and the downstream primer 1 of LINC00630-AL035494 provided in Example 1 were used for testing.

[0080] 3) Extraction of cfRNA and quantitative detection of the target gene:

[0081] For specific steps, please refer to step 3) of Example 2. The results are shown in Figure 2. Further ROC curve analysis was performed based on the detection of plasma samples. The results are shown in Figure 3.

[0082] As shown in Figure 2, compared with the control group, the expression of the fusion gene LINC00630-AL035494 in the plasma cfRNA of the disease group (PE group) was significantly upregulated and statistically significant.

[0083] As shown in Figure 3, the AUC is 0.82, indicating that the fusion gene LINC00630-AL035494 can effectively distinguish patients with preeclampsia and can be used as a specific biomarker for plasma diagnosis of preeclampsia.

[0084] Example 4 Application of the combination of fusion gene PSPC1-MRPS31P2 and fusion gene LINC00630-AL035494 as a biomarker in the preparation of a product for detecting preeclampsia

[0085] In this example, the combination of fusion gene PSPC1-MRPS31P2 and fusion gene LINC00630-AL035494 was used as a biomarker for preeclampsia. The feasibility of the combination of fusion gene PSPC1-MRPS31P2 and fusion gene LINC00630-AL035494 as a biomarker for preeclampsia was verified using clinical plasma samples. The specific experimental verification process is described in Examples 2 and 3. The results are shown in Figures 2 and 3. That is, after detecting the expression of the two fusion genes separately, the maximum value of each fusion gene in the control group was used as the cutoff value, that is, there were no false positives and the specificity was 100%. If the expression level of either of the two fusion genes in a preeclampsia sample is higher than the cutoff value, it is considered positive. The detection sensitivity reaches 75% (i.e., 9 samples were detected), indicating that the combined analysis of the two fusion genes can effectively identify patients with preeclampsia and can be used as a specific biomarker for diagnosing preeclampsia in plasma.

[0086] The experimental process diagram for verification in Examples 2 to 4 of the present invention is shown in Figure 4.

[0087] In addition to RT-qPCR used in the embodiments of the present invention, quantitative methods that can be used for the biomarkers provided by the present invention include sequencing, digital PCR, etc.

[0088] The embodiments of the present invention have been described in detail above with reference to the accompanying drawings. However, the present invention is not limited to the above embodiments. Within the scope of knowledge possessed by those skilled in the art, various changes can be made without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict. Instruction manual 6 / 6 pages 8 CN 121718625 A Figure 1 Figure 2 Instruction manual drawings 1 / 2 pages 9 CN 121718625 A Figure 3 Figure 4 Instruction manual drawings 2 / 2 pages 10 CN 121718625 A Abstract The present disclosure discloses a preeclampsia biomarker and use thereof, wherein the preeclampsia biomarker comprises at least one of PSPC1-MRPS31P2 andLINC00630-AL035494 fusion genes. The preeclampsia biomarker provided by the present disclosure can provide a non-invasive diagnostic scheme for clinical prenatal preeclampsia by detecting the fusion genes (PSPC1-MRPS31P2 and LINC00630-AL035494) that are specifically and highly expressed in preeclampsia in peripheral blood of pregnant women through real-time quantitative PCR, thereby achieving early prediction of preeclampsia, disease diagnosis, and monitoring of a patient’s status during the course of the disease. By combining existing clinical diagnostic protocols, the accuracy of preeclampsia diagnosis can be improved.

Claims

1. A biomarker for preeclampsia, characterized in that, The preeclampsia biomarkers include at least one of the fusion genes PSPC1-MRPS31P2 and LINC00630-AL035494.

2. The preeclampsia biomarker according to claim 1, characterized in that, The sequence information of the fusion gene PSPC1-MRPS31P2 and the fusion gene LINC00630-AL035494 is as follows:

3. A nucleic acid molecule, characterized in that, The nucleic acid molecule includes specific primers for detecting the preeclampsia biomarkers as described in claim 1 or 2.

4. The nucleic acid molecule according to claim 3, characterized in that, The nucleic acid molecule includes specific primers for detecting the fusion gene PSPC1-MRPS31P2; Preferably, the specific primers for detecting the fusion gene PSPC1-MRPS31P2 include: Primer pairs as shown in SEQ ID NO.3 and SEQ ID NO.4; or, Primer pairs as shown in SEQ ID NO.5 and SEQ ID NO.

6.

5. The nucleic acid molecule according to claim 3, characterized in that, The nucleic acid molecule includes specific primers for detecting the fusion gene LINC00630-AL035494; Preferably, the specific primers for detecting the fusion gene LINC00630-AL035494 include: Primer pairs as shown in SEQ ID NO.7 and SEQ ID NO.8; or, Primer pairs as shown in SEQ ID NO.9 and SEQ ID NO.

10.

6. A reagent kit, characterized in that, The kit comprises the nucleic acid molecules as described in any one of claims 3 to 5.

7. The reagent kit according to claim 6, characterized in that, The kit also includes nucleic acid extraction reagents, primer sets for internal reference genes, and PCR reaction reagents.

8. The reagent kit according to claim 7, characterized in that, The PCR reaction reagents include DNA polymerase, dNTPs, and fluorescent dyes.

9. The reagent kit according to claim 6, characterized in that, The kit is applicable to blood samples and placental tissue samples; Preferably, the blood sample includes a serum sample and / or a plasma sample.

10. The application of the preeclampsia biomarker as described in claim 1 or 2 in (1) to (3): (1) Prepare products for detecting preeclampsia; (2) Prepare products for evaluating the prognostic analysis of preeclampsia; (3) Screening for drugs used to treat and / or prevent preeclampsia.