Cellular reprogramming
Reprogramming adult fibroblasts into hiLGEPs using chemically modified mRNA and specific activators addresses the risks of current stem cell therapies, enabling effective cell replacement therapy for Huntington's disease by generating functional neurons that alleviate motor dysfunction.
Patent Information
- Application Number
- HK62026124295
- Authority / Receiving Office
- HK · HK
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-06-29
- Filing Date
- 2026-06-03
- Publication Date
- 2026-07-10
AI Technical Summary
Current cell transplantation therapies for Huntington's disease face challenges such as tumorigenesis, gene mutation, and insertional mutagenesis risks associated with the use of human embryonic stem cells or induced pluripotent stem cells, necessitating the development of alternative cell sources that avoid these defects.
Reprogramming adult somatic cells, particularly adult fibroblasts, into human neural progenitor cells using chemically modified mRNA and specific activators, such as SOX2 and PAX6 mRNA, along with basal brain culture medium and activators like activin A, protein kinase C inhibitors, and p160ROCK inhibitors, to generate inducible lateral ganglion progenitor cells (hiLGEP) capable of differentiating into intermediate-sized polyspinous striatal neurons.
The directly reprogrammed hiLGEPs survive and generate functional neurons after transplantation, effectively alleviating motor dysfunction in Huntington's disease models, providing a clinically viable cell source for neurodegenerative disease treatment.
Smart Images

Figure 00000044_0000 
Figure 00000045_0000 
Figure 00000045_0001
Abstract
Description
(19) State Intellectual Property Office (12) Invention Patent Application (10) Application Publication Number (43) Application Publication Date (21) Application Number 202480040966.X (22) Application Date 2024.06.28 (30) Priority Data 2023902064 2023.06.29 AU (85) PCT International Application Entering National Phase Date 2025.12.18 (86) PCT International Application Application Data PCT / IB2024 / 056302 2024.06.28 (87) PCT International Application Publication Data WO2025 / 003972 EN 2025.01.02 (71) Applicant Bronwyn Jane Connor Address Auckland, New Zealand Applicant Amy Jane Samuel (72) Inventors Bronwyn Jane Connor Amy Jane Samuel (74) Patent Agency Beijing Ying Sai Jia Hua Intellectual Property Agency Co., Ltd. 11204 Patent Attorney Zu Luxia Hong Xin (51) Int.Cl. C12N 5 / 0793 (2010.01) A61K 35 / 30 (2015.01) A61P 25 / 28 (2006.01) A61P 25 / 14 (2006.01) (54) Invention Title Cell Reprogramming (57) Abstract This invention generally relates to compositions for reprogramming human cells into inducible neural progenitor cells, methods for preparing inducible human neural progenitor cells by cell reprogramming, and methods for treating diseases using reprogrammed inducible human neural progenitor cells. Claims (2 pages), Description (30 pages), Sequence List (electronic publication), Drawings (16 pages) CN 121368632 A 2026.01.20 CN 1 21 36 86 32 A 1. A composition comprising: basal brain culture medium, and at least two active agents selected from the group consisting of activator A (ActA), protein kinase C (PKC) inhibitor, p160ROCK inhibitor, and N-2 supplement. 2. The composition according to claim 1, comprising: basal brain culture medium, and at least three active agents selected from the group consisting of activator A (ActA), protein kinase C (PKC) inhibitor, p160ROCK inhibitor, and N-2 supplement. 3. The composition according to claim 1 or claim 2, comprising: basal brain culture medium, and all four active agents: activator A (ActA), protein kinase C (PKC) inhibitor, p160ROCK inhibitor, and N-2 supplement. 4. The composition according to any one of claims 1 to 3, wherein the PKC inhibitor is selected from Gö6983, enzatogen, asteroidin, GF 109203X, Gö6976, Ro 31-8220 mesylate, Ro32-0432 hydrochloride, sotrataline, and K252a, preferably with Gö6983 as the PKC inhibitor. 5. The composition according to any one of claims 1 to 4, wherein the p160ROCK inhibitor is selected from the group consisting of Y27632, thiazolinone, HA 1100 hydrochloride, and GSK429286A, preferably with Y27632 as the p160ROCK inhibitor. 6. A method for preparing human induced lateral ganglion progenitor cells (hiLGEP), comprising: a) reprogramming human fibroblasts (HF) into hiLGEP, comprising: a. transfecting HF with SOX2 cmRNA and PAX6 cmRNA; b. culturing the transfected HF in a composition comprising: basal brain culture medium, and at least two activators selected from the group consisting of a protein kinase C (PKC) inhibitor, a p160ROCK inhibitor, and an N-2 supplement; c. The HF in b. is passaged in a composition comprising: basal brain culture medium, and at least three activators selected from the group consisting of a protein kinase C (PKC) inhibitor, a p160ROCK inhibitor, an N-2 supplement, and activator A (ActA); and d. the passaged HF is cultured. 7. The method of claim 6, wherein the SOX2 cmRNA comprises SEQ ID NO: 1. 8. The method of claim 6 or claim 7, wherein the PAX6 cmRNA comprises SEQ ID NO: 2. 9. The method of any one of claims 6 to 8, wherein the composition in b. comprises basal brain culture medium and all three activators, wherein the three activators are a protein kinase (PKC) inhibitor, a p160ROCK inhibitor, and an N-2 supplement. 10. The method of any one of claims 6 to 9, wherein the composition in c. comprises basal brain culture medium and all four activators, wherein the four activators are a protein kinase (PKC) inhibitor, a p160ROCK inhibitor, an N-2 supplement, and activator A (ActA). 11. The method according to any one of claims 6 to 10, wherein the PKC inhibitor in b. and / or c. is selected from the group consisting of Gö6983, enzatoidin, asteroidin, GF 109203X, Go6976, Ro 31-8220 mesylate, Ro 32-0432 hydrochloride, sotratalline, and K252a, preferably wherein the PKC inhibitor is Gö6983. 12. The method according to any one of claims 6 to 11, wherein the p160ROCK inhibitor in b. and / or c. is selected from the group consisting of Y27632, thiazolinone, HA 1100 hydrochloride, and GSK429286A, preferably wherein the p160ROCK inhibitor is Y27632.13. The method according to any one of claims 6 to 12, wherein the HF is human dermal fibroblasts (HDF). 14. The method according to any one of claims 6 to 12, wherein the HF is adult fibroblasts (aHF), preferably adult dermal fibroblasts (aHDF). Claims 1 / 2 page 2 CN 121368632 A 15. A kit comprising: i. a composition comprising: basal brain culture medium, and at least two active agents selected from the group consisting of a protein kinase C (PKC) inhibitor, a p160ROCK inhibitor, and an N-2 supplement; and ii. a composition comprising: basal brain culture medium, and at least three active agents selected from the group consisting of a protein kinase C (PKC) inhibitor, a p160ROCK inhibitor, an N-2 supplement, and activator A (ActA). 16. The kit according to claim 15, wherein the composition in i. comprises all three active agents, said three active agents being a protein kinase (PKC) inhibitor, a p160ROCK inhibitor, and an N-2 supplement. 17. The kit according to claim 15 or claim 16, wherein the composition in ii. comprises all four active agents, said four active agents being a protein kinase (PKC) inhibitor, a p160ROCK inhibitor, an N-2 supplement, and activator A (ActA). 18. The kit according to any one of claims 15 to 17, wherein the PKC inhibitor in i. and / or ii. is selected from the group consisting of Gö6983, enzatoidin, asteroidin, GF 109203X, Gö6976, Ro 31-8220 mesylate, Ro 32-0432 hydrochloride, sotratalline, and K252a, preferably wherein said PKC inhibitor is Gö6983. 19. The kit according to any one of claims 15 to 18, wherein the p160ROCK inhibitor in i. and / or ii. is selected from the group consisting of Y27632, thiazolinone, HA 1100 hydrochloride, and GSK429286A, preferably wherein the p160ROCK inhibitor is Y27632. 20. A human inducible lateral ganglion eminence precursor cell (hiLGEP). 21. The hiLGEP according to claim 20, prepared by the method according to any one of claims 6 to 14. 22. A pharmaceutical composition comprising at least one hiLGEP according to claim 20 or claim 21. 23. The use of the composition as defined in any one of claims 1 to 5 in promoting the induction of fibroblasts into lateral ganglion eminence (LGE) precursor fate, preferably wherein the fibroblasts are human fibroblasts, human dermal fibroblasts, adult fibroblasts, or adult dermal fibroblasts.24. The use of a composition comprising human induced lateral ganglion progenitor cells (hiLGEP) and a carrier in the treatment of Huntington's disease. 25. The use of human induced lateral ganglion progenitor cells (hiLGEP) in the preparation of a medicament for the treatment of Huntington's disease. 26. A method of treating Huntington's disease, the method comprising transplanting human induced lateral ganglion progenitor cells (hiLGEP) into the striatum of a subject who has or is suspected of having Huntington's disease. 27. The use according to any one of claims 23 to 25 or the method according to claim 24, wherein the hiLGEP is derived from reprogrammed fibroblasts, preferably adult fibroblasts, human dermal fibroblasts, or adult dermal fibroblasts. 28. The use according to any one of claims 23 to 25 or the method according to claim 24, wherein the hiLGEP is as defined in claim 21. 29. The use of the composition according to any one of claims 1 to 5 or the kit according to any one of claims 15 to 19 in the reprogramming of fibroblasts to hiLGEP, preferably wherein the fibroblasts are human fibroblasts, human dermal fibroblasts, adult fibroblasts or adult dermal fibroblasts. Claims 2 / 2 Page 3 CN 121368632 A Cell Reprogramming
[0001] 1. Technical Field
[0002] The present invention generally relates to compositions for converting human cells into inducible neural progenitor cells through cell reprogramming, methods for preparing inducible human neural progenitor cells through cell reprogramming, and methods for treating diseases using reprogrammed inducible human neural progenitor cells.
[0003] 2. Background Art
[0004] Huntington's disease (HD) is a hereditary neurological disorder caused by a mutation in the trinucleotide (CAG) repeat amplification in exon 1 of the HTT (IT15) gene, which encodes a 350 kDa protein called huntingtin protein (HTT). The disease is inherited in an autosomal dominant manner, with a prevalence of approximately 1 in 15,000 people. HD is characterized primarily by the loss of neurons in the caudate nucleus, putamen, and cerebral cortex. In later stages, areas such as the hippocampus and hypothalamus are also affected (Vonsattel et al., 1985). Major degeneration of the intermediate-sized polyspinous striatal projection neurons (MSN) leads to motor dysfunction, accompanied by cognitive and psychiatric impairments.
[0005] Currently, treatment options for Huntington's disease are extremely limited. Although some behavioral symptoms of HD respond to psychiatric treatment, and several medications are available to alleviate the effects of chorea, other motor and cognitive symptoms of HD are currently untreatable (Caron et al., 1998). Cell transplantation is a viable treatment option for HD, aiming to replace neurons lost due to the disease process.Cell transplantation aims to reconstruct damaged neural circuits using donor cells, hoping that the donor cells can reconnect to the remaining host neural networks to restore connectivity. Early intervention through genetic testing allows for the transplantation of alternative MSNs before widespread degeneration to maintain corticostriatal circuits. Studies in rodents and primates with HD have shown that reconstruction of corticostriatal circuits after cell transplantation can alleviate motor and cognitive deficits observed in HD (Dunnett et al., 2000; Kendall et al., 1998; Palfi et al., 1998). Small, open-label clinical trials have explored transplanting human fetal striatal tissue into HD patients, providing preliminary validation of the benefits of neural transplantation for HD patients (Rosser and Bachoud-Levi, 2012). However, one of the major challenges to making cell transplantation a viable treatment option for HD patients is identifying ethically and technically feasible donor cell sources other than human fetal striatal tissue.
[0006] In the search for alternative donor cell sources, attention has turned to the potential applications of human stem cells, including human embryonic stem cells (hESCs) or human induced pluripotent stem cells (iPSCs) (Connor, 2018). However, initial studies have shown that while hESC-derived neural stem cells (NSCs) transplanted into a Huntington's disease quinolinic acid (QA) lesion model can survive and generate new neurons, the transplanted human NSCs do not differentiate into region-specific neurons expressing MSN markers (Joannides et al., 2007; Reidling et al., 2018; Song et al., 2007; Vazey et al., 2010). To improve lineage specificity and promote MSN differentiation, several research teams have differentiated hESCs into striatal progenitor cells (Arber et al., 2015; Aubry et al., 2008; Delli Carri et al., 2013; Faedo et al., 2017; 2013). These studies report that striatal progenitor cells can generate MSNs after transplantation into the QA-damaged striatum, indicating the need to guide hESCs to lineage-specific progenitor cell fates before transplantation. Several studies have also confirmed the potential of iPSC-derived NSCs as a cell source for HD transplantation therapy (An et al., 2012; Jeon et al., 2012), with An et al. (An et al., 2012) demonstrating the ability to transplant genetically corrected HD patient-derived cells. However, cell transplantation using hESC or hiPSC-derived NSCs carries the potential risks of tumorigenesis and gene mutations, which are associated with the accumulation of chromosomal abnormalities over long passages. Furthermore, hiPSCs, due to the oncogenic properties of reprogramming factors and the gene delivery integration methods used during reprogramming, pose a risk of generating genetic abnormalities and insertional mutagenesis (González et al., 2011).
[0007] In view of the above, there is a need in the art to develop alternative forms of cell transplantation therapy to avoid the problems found when using hESC or hiPSC-derived NSCs, especially the risks associated with tumorigenesis, gene mutation, the generation of genetic abnormalities, and insertional mutagenesis.
[0008] The object of the present invention is to provide compositions and methods to support at least one such alternative form of cell transplantation therapy while avoiding at least some of the defects found in prior therapies, and / or at least providing a useful option for the public.
[0009] In this specification, references are made to patent specifications, other external documents, or other sources of information, which are generally used to provide background for discussing the features of the invention. Unless otherwise expressly stated, references to such external documents should not be construed as an admission that such documents or such sources are part of the prior art or common general knowledge in the art within any scope of the claims.
[0010] 3. Summary of the Invention
[0011] The compositions and methods disclosed herein employ chemically modified mRNA to reprogram somatic cells into neural progenitor cells. This disclosure provides for the first time compositions and methods for reprogramming adult somatic cells (aHS) (particularly adult fibroblasts (aHF), and more particularly adult dermal fibroblasts (aHDF)) into human nerve cells (particularly human lateral ganglion progenitor cells (hiLGEP)).
[0012] The inventors also disclose for the first time that directly reprogrammed somatic cells generated using the compositions and methods described herein can survive and generate intermediate-sized polyspinous striatal neurons (MSNs) after transplantation into quinolinic acid (QA)-damaged rat striatum (a recognized model of HD in the art). Following transplantation, these directly reprogrammed hiLGEPs recovered motor dysfunction within 14 weeks, demonstrating that directly reprogrammed hiLGEPs provide an effective and clinically viable cell source for cell replacement therapy in the treatment of neurodegenerative diseases, particularly Huntington's disease (HD).
[0013] In one aspect, this application relates to a composition comprising: basal brain culture medium, and at least two activators selected from the group consisting of activin A (ActA), protein kinase C (PKC) inhibitors, p160ROCK inhibitors, and N-2 supplements.
[0014] In another aspect, the present invention relates to a method for preparing human inducible lateral ganglion progenitor cells (hiLGEP), comprising:
[0015] a) reprogramming human fibroblasts (HF) into hiLGEP, comprising:
[0016] a. transfecting HF with SOX2 cmRNA and PAX6 cmRNA;
[0017] b. culturing the transfected HF in a composition comprising: basal brain culture medium, and at least two activators selected from the group consisting of activin A (ActA), protein kinase C (PKC) inhibitors, p160ROCK inhibitors, and N-2 supplements.
[0018] c. Passaging the HF from b. in a composition comprising: basal brain culture medium and at least three active agents selected from the group consisting of protein kinase C (PKC) inhibitor, p160ROCK inhibitor, N-2 supplement, and activator A (ActA); and
[0019] d. Culturing the passaged HF.
[0020] In another aspect, the present invention relates to a kit comprising:
[0021] i. a composition comprising: basal brain culture medium and at least two active agents selected from the group consisting of protein kinase C (PKC) inhibitor, p160ROCK inhibitor, and N-2 supplement; and
[0022] ii. A composition comprising: basal brain culture medium, and at least three activators selected from the group consisting of a protein kinase C (PKC) inhibitor, a p160ROCK inhibitor, an N-2 supplement, and activator A (ActA).
[0023] In another aspect, the present invention relates to a human induced lateral ganglion progenitor cell (hiLGEP).
[0024] In another aspect, the present invention relates to a composition comprising human induced lateral ganglion progenitor cells (hiLGEP) and a carrier. Specification 2 / 30 pages 5 CN 121368632 A
[0025] In another aspect, the present invention relates to a composition comprising basal brain culture medium, B27-RA, an N2 supplement, a cyclic adenosine 3',5'-monophosphate (cAMP) activator, a p160ROCK inhibitor, brain-derived neurotrophic factor (BDNF), and activator A (ActA).
[0026] In another aspect, the present invention relates to a composition comprising basal brain culture medium, B27-RA, N2 supplement, cAMP activator, p160ROCK inhibitor, brain-derived neurotrophic factor (BDNF), and dorsomorphin.
[0027] In another aspect, the present invention relates to the use of a composition for inducing the expression of at least one lateral ganglion eminence (LGE) transcription factor in reprogramming HF, the composition comprising basal brain culture medium and at least two activators selected from the group consisting of activin A (ActA), protein kinase C (PKC) inhibitor, p160ROCK inhibitor, and N-2 supplement.
[0028] In another aspect, the present invention relates to the use of a composition for promoting the induction of lateral ganglion eminence (LGE) precursor cell fate in fibroblasts (preferably human fibroblasts (HF)), the composition comprising basal brain culture medium and at least two activators selected from the group consisting of activin A (ActA), protein kinase C (PKC) inhibitor, p160ROCK inhibitor, and N-2 supplement.At least two activators in the group.
[0029] In another aspect, the present invention relates to the use of a composition for inducing the expression of at least one biomarker associated with neuronal differentiation in reprogrammed HF LGE precursor cells, the composition comprising basal brain culture medium, B27-RA, N2 supplement, cAMP activator, p160ROCK inhibitor, brain-derived neurotrophic factor (BDNF) and activin A.
[0030] In another aspect, the present invention relates to the use of a composition for inducing the expression of at least one biomarker associated with neuronal differentiation in reprogrammed HF LGE precursor cells, the composition comprising basal brain culture medium, B27-RA, N2 supplement, cAMP activator, p160ROCK inhibitor, brain-derived neurotrophic factor (BDNF) and dorsomorphin.
[0031] In another aspect, the present invention relates to the use of a composition for preparing intermediate-sized polyspinous striatum projection neurons (MSN), the composition comprising human inducible lateral ganglion eminence precursor cells (hiLGEP) or reprogrammed HF expressing at least one lateral ganglion eminence (LGE) transcription factor and a vector.
[0032] In another aspect, the present invention relates to the use of a composition for treating Huntington's disease, the composition comprising human induced lateral ganglion progenitor cells (hiLGEP) and a carrier.
[0033] In another aspect, the present invention relates to the use of a composition for reducing the severity of Huntington's disease, the composition comprising human induced lateral ganglion progenitor cells (hiLGEP) and a carrier.
[0034] In another aspect, the present invention relates to the use of a composition for delaying the onset of Huntington's disease, the composition comprising human induced lateral ganglion progenitor cells (hiLGEP) and a carrier.
[0035] In another aspect, the present invention relates to a method of treating Huntington's disease, the method comprising transplanting human induced lateral ganglion progenitor cells (hiLGEP) into the striatum of a subject who has or is suspected of having Huntington's disease.
[0036] In another aspect, the present invention relates to a method for delaying the onset of Huntington's disease, the method comprising transplanting human induced lateral ganglion progenitor cells (hiLGEP) into the striatum of a subject suspected of having Huntington's disease or having at least one symptom of Huntington's disease.
[0037] In another aspect, the present invention relates to a method for reducing the severity of Huntington's disease, the method comprising transplanting human induced lateral ganglion progenitor cells (hiLGEP) into the striatum of a subject suspected of having Huntington's disease or having at least one symptom of Huntington's disease.
[0038] 4. Brief Description of the Drawings
[0039] The invention will now be described by way of example only and with reference to the accompanying drawings, in which:
[0040] Figure 1 shows the direct reprogramming and differentiation scheme disclosed herein. DescriptionPage 3 / 30 6 CN 121368632 A
[0041] Figure 2 shows the expression of lateral ganglion eminence precursor cell biomarkers by reprogrammed HDF. (A) and (B) show the combined positive effects of additives ActA, Gö6983, Y-27632, and N-2 (GYN) in Neurobasal A (NBA) or BrainPhys-based reprogramming medium on LGE fate assessed by CTIP2 expression. (C) shows representative images of hiLGEP expressing key biomarkers at the gene level (D) and protein level (E-H), respectively.
[0042] Figure 3 shows the ability of hiLGEP to differentiate into medium-sized multispinous striatal neurons. hiLGEP reprogrammed in BrainPhys-based medium supplemented with ActA and GYN yielded high yields of striatal neurons expressing (A) TUJ1 and (B) DARPP32. (C) Adding dorsomorphin to the striatal differentiation medium resulted in a more stable and consistent number of DARPP32-positive striatal neurons generated by hiLGEP. Reprogramming with GYN alone or in combination with ActA (whether or not all three GYN compounds were included) produced hiLGEP that could differentiate into striatal neurons expressing (D) TUJ1 and (E) DARPP32, with the highest yield of striatal neurons generated during reprogramming using GYN+ActA. p≤0.05; p≤0.01; p≤0.001.
[0043] Figure 4 shows the biomarkers of medium-sized multispinous striatal neurons expressed by differentiated hiLGEP. (A) shows representative images of striatal neurons differentiated from hiLGEP that express the key biomarkers (B) TUJ1, (C) DARPP32, (D) GABA, and (E) GAD65 / 67. striatal neurons derived from hiLGEP possess calcium flow capacity (G; brighter staining indicates more intracellular calcium), a measure of cellular function in response to increasing glutamate concentrations (F).
[0044] Figure 5 (A) shows the cell transplantation protocol and timeline in the QA rat model disclosed herein. (B) shows that hiLGEP transplanted into the Huntington's disease QA rat model significantly reduced forelimb motor dysfunction, manifested as reduced ipsilateral forelimb use over time. # p≤0.05; ## p≤0.01 (compared to baseline); p≤0.05 (compared to post-QA).
[0045] Figure 6 shows the key biomarkers expressed by striatal neurons derived from transplanted hiLGEP 14 weeks after transplantation. hiLGEP generated human medium-sized polyspinous neurons expressing the human biomarker STEM121 (A), and (B2) MAP2, (C2)DARPP32, (D2)GAD65 / 67 and (E2)GABA co-express STEM121 (B1, C1, D1 and E1). A' is a high-magnification image of A.
[0046] Figure 7 shows that hiLGEP and its derived medium-sized polyspinous striatal neurons can be generated regardless of the cmRNA transfection method used. (A) HDF was transfected with SOX2 and PAX6 cmRNA SNIM for 5 hours per day for 4 consecutive days (4×5 hours SNIM), or with SOX2 and PAX6 lipid nanoparticles for a single transfection for 24 hours (1×24 hours LNP), showing the same morphological changes during reprogramming. HDF was reprogrammed with 4×5 hours SNIM or 1×24 hours LNP, showing upregulation of (B) SOX2 and (C) PAX6, and (D) the striatal lineage marker CTIP2 after 7 days of reprogramming. After differentiating for 14 days, hiLGEP neurons become medium-sized polyspinous striatal neurons, exhibiting a similar morphology (E) and expressing the neuronal markers TUJ1 (F1 and F3) and DARPP32 (F2 and F4), a marker of medium-sized polyspinous striatal neurons.
[0047] 5. Detailed Description
[0048] 5.1 Definitions and Abbreviations
[0049] As used herein, the term “cmRNA” is an abbreviation for chemically modified mRNA, which contains a combination of modified and unmodified nucleotides, and refers to stable, non-immunogenic mRNA (known commercially available SNIM RNA), as disclosed in WO 2011 / 012316, the entire contents of which are incorporated herein by reference. Chemical modification of cmRNA structural elements enables these molecules to circumvent the inherent immune recognition and instability of native mRNA. cmRNA can be reused, i.e., in single and / or consecutive transfection events, thereby enabling cells to continuously produce a certain level of the target protein product. Known uses of cmRNA include enhancing or replacing missing / nonfunctional proteins, and / or introducing new proteins. In some embodiments, lipid nanoparticle technology (LNP) can be used to transfect cmRNA into cells, as described in the examples.
[0050] As used herein, the term “Gö6983” refers to Gö6983 with CAS number 133053-19-7.
[0051] As used herein, the term “Y27632” refers to Y-27632 dihydrochloride with CAS number 129830-38-2. Specification 4 / 30 pages 7 CN 121368632 A
[0052] As used herein, the term “N-2 supplement” refers to Bottenstein’s N-2 formulation (1), a chemically defined supplement consisting of human transferrin (all iron-bound), recombinant insulin full chain, progesterone, putrescine and sodium selenite (Bottenstein, J.E.).(1985) Cell Culture in the Neurosciences, edited by Bottenstein, JE and Harvey, AL, p. 3, Plenum Press: New York and London.
[0053] In this document, the combination of Gö6983, Y27632 and N-2 is abbreviated as “GYN”.
[0054] As used herein, the term “cyclic adenosine 3',5'-monophosphate (cAMP) activator” or “cAMP activator” refers to a molecule that activates the cAMP pathway. In one embodiment, the cAMP activator is dcAMP, fibrinogen (FSK), 8-bromo-cAMP, cAMPS-Sp.
[0055] As used herein, the term “activator” means that the reagent is a key component in the compositions, kits, methods or applications described herein for driving the reprogramming of human fibroblasts (particularly adult fibroblasts, and more particularly adult dermal fibroblasts) into human lateral ganglion eminence precursor cells (hiLGEP). The compositions, kits, methods, and / or applications described herein may also include other reagents that facilitate and / or allow cell culture and passage during cell reprogramming. Other reagents may include valproic acid, penicillin-streptomycin-glutamine, retinoic acid-free B-27, epidermal growth factor (EGF), fibroblast growth factor 2 (FGF2), heparin, and retinoic acid, including any combination thereof.
[0056] The active agents considered herein are selected from the group consisting of activin A (ActA), protein kinase C (PKC) inhibitors, p160ROCK inhibitors, and N-2 supplements. In a preferred embodiment, the active agents are activin A, Gö6983, Y27632, and N-2 supplements.
[0057] In some embodiments, fibroblasts to be reprogrammed to hiLGEP are cultured using at least two active agents (preferably three active agents, namely protein kinase C (PKC) inhibitors, p160ROCK inhibitors, and N-2 supplements) according to the compositions, kits, methods, and / or applications described herein. In a preferred embodiment, the three active agents are Gö6983, Y27632, and an N-2 supplement.
[0058] In some embodiments, fibroblasts to be reprogrammed into hiLGEP are passaged using at least three active agents (preferably four active agents, namely a protein kinase C (PKC) inhibitor, a p160ROCK inhibitor, an N-2 supplement, and activin A (ActA)) according to the compositions, kits, methods, and / or applications described herein. In a preferred embodiment, the four active agents are Gö6983, Y27632, an N-2 supplement, and ActA.
[0059] As used herein, “basal brain culture medium” refers to a universal culture medium suitable for the in vitro culture of neural cells.
[0060] In one embodiment, the basal brain culture medium is Neurobasal A or Brain Phys, supplemented with at least one active agent, preferably at least two, three, or all four active agents selected from the group consisting of: activin A (ActA), protein kinase C (PKC) inhibitors, p160ROCK inhibitors, and N-2 supplements. In some embodiments, the basal brain culture medium is supplemented with at least one of activin A, Gö6983, Y27632, and N-2 supplements, preferably at least two, three, or all four.
[0061] The basal brain culture medium may also be supplemented with other reagents that are not “active agents” and are known to those skilled in the art for human cell culture and passage.
[0062] In some embodiments, the other reagents are any combination and / or all of the following components: valproic acid, penicillin-streptomycin-glutamine, B-27 without retinoic acid, epidermal growth factor (EGF), fibroblast growth factor 2 (FGF2), heparin and retinoic acid. As used herein, the term "SOX2" refers to SRY-box transcription factor 2 [(Homo sapiens (human)], Gene ID: 6657. The gene encoding SOX2 is an intronless gene and belongs to the SRY-associated HMG-box (SOX) family of transcription factors, involved in regulating embryonic development and cell fate determination. The gene product is crucial for the maintenance of stem cells in the central nervous system (see page 5 / 30 of CN 121368632 A) and regulates gene expression in the stomach. Mutations in this gene are closely associated with optic nerve dysplasia and syndromic microphthalmia (a severe structural eye malformation). Furthermore, this gene is located within an intron region of another gene, the SOX2 overlapping transcript (SOX2OT) (https: / / www.ncbi.nlm.nih.gov / gene / 6657).
[0063] The specific sequence of the SOX2 cmRNA used herein is shown in SEQ ID NO: 1.
[0064] GGGAGACCCAAGCTGGCTAGCGTTTAAACTTAAGCTTGGTACCGAGCTCGGATCCCAGTGTGGTGGTAC GGGAAATCACAAGTTTGTACAAAAAAGCAGGCTCCGCGGCCGCCCCCTTCACCATGTACAACATGATGGAGACGGAG CTGAAGCCGCCGGGCCCGCAGCAAACTTCGGGGGGCGGCGGCGGCAACTCCACCGCGGCGGCGGCCGGCGGCAACCAGAAAAACAGCCCGGACCGCGTCAAGCGGCCCATGAATGCCTTCATGGTGTGGTCCCGCGGGCAGCGGCGCAAGATGG CCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAGCGCCTGGGCGCCGAGTGGAAACTTTTGTCGGAGACG GAGAAGCGGCCGTTCATCGACGAGGCTAAGCGGCTGCGAGCGCTGCACATGAAGGAGCACCCGGATTATAAATACCG GCCCCGGCGGAAAACCAAGACGCTCATGAAGAAGGATAAGTACACGCTGCCCGGCGGGCTGCTGGCCCCCGGCGGCA ATAGCATGGCGAGCGGGGTCGGGGTGGGCGCCGGCCTGGGCGCGGGCGTGAACCAGCGCATGGACAGTTACGCGCAA TGAACGGCTGGAGCAACGGCAGCTACAGCATGATGCAGGACCAGCTGGGCTACCCGCAGCACCCGGGCCTCAATGCG CACGGCGCAGCGCAGATGCAGCCCATGCACCGCTACGACGTGAGCGCCCTGCAGTACAACTCCATGACCAGCTCGCA GACCTACATGAACGGCTCGCCCACCTACAGCATGTCCTACTCGCAGCAGGGCACCCCTGGCATGGCTCTTGGCTCCA TGGGTTCGGTGGTCAAGTCCGAGGCCAGCTCCAGCCCCCCTGTGGTTACCTCTTCCTCCCACTCCAGGGCGCCCTGC CAGGCGGGGACCTCCGGGACATGATCAGCATGTATCTCCCCGGCGCCGAGGTGCCGGAACCCGCCGCCCCCAGCAGA CTTCACATGTCCCAGCACTACCAGAGCGGCCCGGTGCCCGGCACGGCCATTAACGGCACACTGCCCCTCTCACACAT GTGAAAGGGTGGGCGCGCCGACCCAGCTTTCTTGTACAAAGTGGTGATATTCCAGCTGAGCGCCGGTCGCTACCATTACCAGTTGGTCTGGTGTCAAAAATAATAATAACCGGGCAGGCCATGTCTGCCCGTATTTCGCGTAAGGAAATCCATT ATGTACTATTTAAACTCGAAATTCTGCAGAAA ... This gene is regulated by multiple enhancers located hundreds of kilobases away from the gene locus. Mutations in this gene or enhancer regions can lead to eye developmental abnormalities such as aniridia and Peter's anomaly. Using alternative promoters and alternative splicing, a variety of transcriptomorphs can be generated, encoding different protein isoforms. Notably, it has been shown that the introduction of specific alternative coding exons can lengthen the pairing cassette domain and alter its DNA-binding specificity. Therefore, isoforms carrying shorter pairing cassette domains regulate different gene profiles than isoforms carrying longer pairing cassette domains (https: / / www.ncbi.nlm.nih.gov / gene / 5080).
[0066] The specific sequence of the PAX6 cmRNA used in this paper is shown in SEQ ID NO: 2. GGGAGACCCAAGCTGGCTAGCGTTTAAACTTAAGCTTGGTACGTTTTGCTGGAGGATGATGACAGAGGA ATCTGAGAATTGCTCTCACACACCACCCAGCAACATCCGTGGAGAAAACTCTCACCAGCAACTCCTTTAAAACACCGTCATTTCAAACCATTGTGGTCTTCAAGCAACAACAGCAGCACAAAAAACCCCAACCAAACAAAACTCTTGACAGAA GCTGTGACAACCAGAAAGGATGCCTCATAAAGGGGGAAGACTTTAACTAGGGGCGCGCAGATGTGTGAGGCCTTTTA TTGTGAGAGTGGACAGACATCCGAGATTTCAGAGCCCCATATTCGAGCCCCGTGGAATCCCGCGGCCCCCAGCCAGA Specification Page 6 / 30 9 CN 121368632 A GCCAGCATGCAGAACAGTCACAGCGGAGTGAATCAGCTCGGTGGTGTCTTTGTCAACGGGCGGCCACTGCCGGACTC CACCCGGCAGAAGATTGTAGAGCTAGCTCACAGCGGGGCCCGGCCGTGCGACATTTCCCGAATTCTGCAGGTGTCCA ACGGATGTGTGAGTAAAATTCTGGGCAGGTATTACGAGACTGGCTCCATCAGACCCAGGGCAATCGGTGGTAGTAAA CCGAGAGTAGCGACTCCAGAAGTTGTAAGCAAAATAGCCCAGTATAAGCGGGAGTGCCCGTCCATCTTTGCTTGGGA AATCCGAGACAGATTACTGTCCGAGGGGGTCTGTACCAACGATAACATACCAAGCGTGTCATCAATAAACAGAGTTC TTCGCAACCTGGCTAGCGAAAAGCAACAGATGGGCGCAGACGGCATGTATGATAAACTAAGGATGTTGAACGGGCAG ACCGGAAGCTGGGGCACCCGCCCTGGTTGGTATCCGGGGACTTCGGTGCCAGGGCAACCTACGCAAGATGGCTGCCA GCAACAGGAAGGAGGGGGAGAGAATACCAACTCCATCAGTTCCAACGGAGAAGATTCAGATGAGGCTCAAATGCGAC TTCAGCTGAAGCGGAAGCTGCAAAGAAATAGAACATCCTTTACCCAAGAGCAAATTGAGGCCCTGGAGAAAGAGTTTGAGAGAACCCATTATCCAGATGTGTTTGCCCGAGAAAGACTAGCAGCCAAAATAGATCTACCTGAAGCAAGAATACA GGTATGGTTTTCTAATCGAAGGGCCAAATGGAGAAGAGAAGAAAAACTGAGGAATCAGAGAAGACAGGCCAGCAACA CACCTAGTCATATTCCTATCAGCAGTAGTTTCAGCACCAGTGTCTACCAACCAATTCCACAACCCACCACACCGGTT TCCTCCTTCACATCTGGCTCCATGTTGGGCCGAACAGACACAGCCCTCACAAACACCTACAGCGCTCTGCCGCCTAT GCCCAGCTTCACCATGGCAAATAACCTGCCTATGCAACCCCCAGTCCCCAGCCAGACCTCCTCATACTCCTGCATGC TGCCCACCAGCCCTTCGGTGAATGGGCGGAGTTATGATACCTACACCCCCCCACATATGCAGACACACATGAACAGT CAGCCAATGGGCACCTCGGGCACCACTTCAACAGGACTCATTTCCCCTGGTGTGTCAGTTCCAGTTCAAGTTCCCGG AAGTGAACCTGATATGTCTCAATACTGGCCAAGATTACAGTAAAAAAAAAAAAAAAAAAAAAAAAATTCTGCAGAAA AAA ... As is known in the art, B27 supplements contain biotin, DL-α-tocopherol acetate, DL-α-tocopherol, vitamin A, biotin, fatty acid-free bovine serum albumin V fraction, catalase, recombinant human insulin, human transferrin, superoxide dismutase, corticosterone, D-galactose, ethanolamine HCl, glutathione (reduced), L-carnitine HCl, linoleic acid, linolenic acid, progesterone, putrescine dihydrochloride, sodium selenite, and T3 (triiodothyronine).
[0069] As used herein, the term “adult” refers to somatic cells, particularly fibroblasts, and is derived from an adult organism.Cells obtained (preferably from adults).
[0070] In one embodiment, adult fibroblasts are fibroblasts obtained from any person outside the embryonic or fetal stage.
[0071] As used herein, the term “mature” refers to somatic cells, particularly fibroblasts, and means cells that have completed differentiation and have acquired specific, rather than generalized, functions. This contrasts with immature or stem cell formation, which still retains pluripotency and can differentiate into any cell type in the body.
[0072] In one embodiment, the term “mature human cell” refers to human cells that have reached their final state of differentiation. Such cells no longer have the potential for further differentiation. Such cells can be found at various developmental stages, including the embryonic period, postnatal, or adulthood, but are typically obtained from adults.
[0073] As used herein, the term “therapeutic effective dose” is a suitable dose determined by a person skilled in the art based on known factors. Such doses may be administered as part of a dosing regimen developed by an attending physician based on a variety of known clinical factors. Such factors will include subject body size, weight, age, body surface area, sex, time and route of administration, other medications administered to the subject, and the subject's overall health condition (but not limited thereto). A therapeutically effective amount will be an amount sufficient to produce a therapeutic effect on the disease or condition to be treated. In some embodiments, the disease or condition to be treated is Huntington's disease, as described in page 7 / 30 of the product manual, 10 CN 121368632 A.
[0074] As used herein, the term "treatment" means achieving an expected or desired outcome in general, typically an expected or desired pharmacological and / or physiological response or effect. In this document, the term "treatment" means a beneficial therapeutic outcome, in the form of partial or complete cure of the disease and / or adverse reactions and / or symptoms caused by the disease.
[0075] For example, treating a subject with Huntington's disease can be any stage of treatment for Huntington's disease, including the acute phase of the disease. Within this disclosure, "treatment" also includes taking measures to reduce the severity of the disease and / or delay its onset, for example, encompassing partial or complete treatment of the disease (or its symptoms). As used herein, the term “delayed onset” (and its grammatical variations) in a therapeutic context refers to shortening the time interval between the appearance of initial signs of having or suspected having Huntington’s disease in a subject and the onset of an “acute” symptom. As described herein, a subject is considered to be in an “acute” phase of Huntington’s disease if they exhibit some and / or all of the symptoms of the disease. Such subjects require treatment after the onset of the disease, for example, to alleviate some and / or all of the symptoms.
[0076] The term “delayed onset” (including its grammatical variations) refers to delaying the onset of at least one clinical symptom of Huntington’s disease in a subject. These will be determined by assessing baseline changes measured by UHDRS-TMS. UHDRS (Uniform Huntington’s Disease Rating System)The table (UHDRS) is a research tool known to those skilled in the art, used to provide a uniform assessment of the clinical characteristics and course of Huntington's disease. The components of the complete UHDRS assess motor function, cognition, behavior, functional capacity, degree of independence scales, and total functional capacity. Motor function assessment includes the Total Motor Score (TMS) and Total Functional Capacity (TFC) score. The UHDRS TMS assesses all motor characteristics of HD, including maximal choreiform movements, maximal dystonia, eye tracking, saccade initiation and speed, dysarthria, tongue protrusion, finger tapping, hand pronation and supination, Luria test, rigidity, bradykinesia, gait, tandem walking, and pull-back test. Each item is scored on a scale from 0 (normal motor function) to 4 (severe motor dysfunction). The TMS score is the sum of all scores, ranging from 0 (normal motor function) to 124 (severe motor dysfunction). A lower TMS score indicates better motor function.
[0077] As used herein, the term "comprising" means "consisting of at least part of". When interpreting each statement in this specification that includes the term "comprise", features other than those that are the term or begin with that term may also exist. Related terms, such as "comprise" (comprises), are interpreted in the same manner.
[0078] As used herein, the term "about" means a reasonable amount of deviation of the modified term such that the final result is not significantly altered. For example, when applied to a value, the term should be interpreted as including a deviation of + / - 5% of that value.
[0079] References to the numerical ranges disclosed herein (e.g., 1 to 10) are intended to also include references to all rational numbers within that range (e.g., 1, 1.1, 2, 3, 3.9, 4, 5, 6, 6.5, 7, 8, 9, and 10) and any range of rational numbers within that range (e.g., 2 to 8, 1.5 to 5.5, and 3.1 to 4.7), and thus all subranges of the entire ranges explicitly disclosed herein are explicitly disclosed herein. These are merely examples of specific intentions, and all possible combinations of values between the listed minimum and maximum values are considered to be expressly stated in this application in a similar manner.
[0080] Whenever ranges are given in this specification, such as temperature ranges, time ranges, or composition ranges, all intermediate ranges and sub-ranges, as well as all individual values included in the given ranges, are intended to be included in this disclosure. In this disclosure and claims, “and / or” means additionally or alternatively. Furthermore, terms used in the singular also include the plural form.
[0081] 5.1 Detailed Description
[0082] This document discloses the inventors’ research work, which for the first time demonstrated that human fibroblasts (HF) (particularly human dermal fibroblasts (HDF)) can be directly reprogrammed into human induced lateral ganglion eminence precursor cells via SOX2 and PAX6 cmRNA.The hiLGEP phenotype, when transplanted into the striatum of QA-damaged rats, produces DARPP32 and GABA-positive neurons and restores motor function. This work uses adult dermal fibroblasts as an example, but is not limited thereto. Based on this disclosure, on page 8 / 30 of CN 121368632 A, the inventors believe that the cell reprogramming compositions and methods described herein can be successfully applied to the reprogramming of different types of human fibroblasts and have reasonable expectations of success.
[0083] In one example, the compositions and methods described herein utilize cmRNA to generate hiLGEPs for transplantation. In terms of safety and efficiency, cmRNA provides an ideal non-viral, non-integrative delivery system for cell reprogramming. The cmRNA system described herein allows mRNA transfection without inhibiting the immune response, reduces the activation of the innate immune response and improves mRNA stability by replacing uridine and cytidine residues with chemically modified uridine and cytidine analogs, respectively. Therefore, using cmRNA to generate reprogrammed donor cells for cell replacement therapy is highly attractive because it provides a highly efficient and stable gene delivery system without the risks of genome integration and insertional mutations inherent in all-DNA-based methods, and allows for cell reprogramming without any trace of transgene residue. These features make cmRNA an excellent choice for the clinical translation of reprogramming-based cell replacement therapy.
[0084] As disclosed herein, the inventors have demonstrated that HF (especially HDF) can be directly reprogrammed to the lateral ganglion eminence precursor (LGEP) fate. In this regard, the cell reprogramming compositions and methods described herein are not limited to lineage-specific neural progenitor cell reprogramming for transplantation. Rather, as described herein, various types of HF (especially HDF) are reprogrammed in multiple ways to ensure complete differentiation into the striatal phenotype. In some embodiments, HF (especially HDF) is lineage-specific.
[0085] By culturing HF (especially HDF) in a combination of activin A with Gö 6983, Y27632, and N-2 (GYN) after transfection with SOX2 / PAX6 cmRNA as described herein, the inventors demonstrated that direct reprogramming could generate neural progenitor cells expressing striatal factors GSX2, DLX2, FOXP1, FOXP2, CTIP2, and MEIS2. Based on this expression profile, particularly the significant upregulation of CTIP2 expression, the inventors determined that the use of activin A could induce LGE fate (i.e., they could generate hiLGEP), and the addition of Gö 6983, Y27632, and N-2 could further promote this process. It is further described herein that DARPP32 was generated by in vitro differentiation of hiLGEP in a BrainPhys™-based striatal differentiation medium supplemented with activin A and dorsomorphin.Positive neurons further confirm the generation of hiLGEP through direct reprogramming.
[0086] Furthermore, the ability of hiLGEP to survive, differentiate into intermediate-sized multispinous striatal neurons (MSNs) and improve motor function in a rat model of QA injury in the neurodegenerative disease Huntington's disease is described herein. Importantly, the inventors' work disclosed herein demonstrates that transplanting directly reprogrammed hiLGEP into the striatum of QA-injured animals restores motor dysfunction by spontaneous exploration of forelimb use assays, compared to saline-treated animals.
[0087] Therefore, in one aspect, the present invention relates to a composition comprising: a basal brain culture medium, and at least two activators selected from the group consisting of activin A (ActA), protein kinase C (PKC) inhibitors, p160ROCK inhibitors, and N-2 supplements.
[0088] In one embodiment, the composition comprises: a basal brain culture medium, and at least three active agents selected from the group consisting of activator A (ActA), protein kinase C (PKC) inhibitors, p160ROCK inhibitors, and N-2 supplements.
[0089] In one embodiment, the composition comprises: a basal brain culture medium and four active agents, the four active agents being activator A (ActA), protein kinase C (PKC) inhibitors, p160ROCK inhibitors, and N-2 supplements.
[0090] In one embodiment, the composition is a culture medium.
[0091] In one embodiment, the PKC inhibitor is selected from the group consisting of: Gö6983, enzastaurin, staurosporine, GF 109203X, Gö6976, Ro 31-8220 mesylate, Ro 32-0432 hydrochloride, sotrastaurin, and K252a. In one embodiment, the PKC inhibitor is Gö 6983.
[0092] In one embodiment, the p160ROCK inhibitor is selected from the group consisting of: Y27632, Thiazovivin, HA 1100 hydrochloride and GSK429286A. In one embodiment, the p160ROCK inhibitor is Y27632, specified on page 9 / 30 of the specification, CN 121368632 A.
[0093] In one embodiment, the “N-2 supplement” is Bottenstein’s N-2 formulation (1).
[0094] In one embodiment, the basal brain culture medium is Neurobasal-A (NBA) or BrainPhys, preferably BrainPhys.
[0095] In one embodiment, the basal brain culture medium further comprises selected from valganciclovir, penicillin-streptomycin, etc.The composition comprises at least one, at least two, three, four, at least five, six, or all seven adjuvants from the group consisting of glutamine, B27-RA, FGF2, EGF, retinoic acid, and heparin.
[0096] In one embodiment, the composition is used to reprogram fibroblasts (preferably human fibroblasts (HF)) to hiLGEP.
[0097] In one embodiment, the composition is used to reprogram fibroblasts (preferably human fibroblasts (HF)) to hiLGEP.
[0098] In one embodiment, the composition, when used, is used to reprogram fibroblasts (preferably human fibroblasts (HF)) to hiLGEP.
[0099] In one embodiment, HF is a lineage-specific cell. In one embodiment, HF is a non-lineage-specific cell. In one embodiment, HF is a human dermal fibroblast (HDF). In one embodiment, HF is an adult fibroblast (aHF). In one embodiment, HF is an adult dermal fibroblast (aHDF).
[0100] In another aspect, the present invention relates to a method for preparing human inducible lateral ganglion progenitor cells (hiLGEP), comprising:
[0101] a) reprogramming human fibroblasts (HF) into hiLGEP, comprising:
[0102] a. transfecting HF with SOX2 cmRNA and PAX6 cmRNA;
[0103] b. culturing the transfected HF in a composition comprising: basal brain culture medium, and at least two activators selected from the group consisting of a protein kinase C (PKC) inhibitor, a p160ROCK inhibitor, and an N-2 supplement;
[0104] c. passage the fibroblasts in b. in a composition comprising: basal brain culture medium, and at least three activators selected from the group consisting of a protein kinase C (PKC) inhibitor, a p160ROCK inhibitor, an N-2 supplement, and an activator A (ActA); and
[0105] d. culturing the passaged HF.
[0106] In one embodiment, the transfection in a. comprises transfection with 0.5 to 5 µg, preferably 1.5 to 4 µg, preferably 2 to 3 µg, preferably 2.5 µg of SOX2 cmRNA and PAX6 cmRNA, respectively.
[0107] In one embodiment, the transfection in a. comprises at least one, preferably at least two, at least three, at least four, preferably five separate transfection events.
[0108] In one embodiment, at least two separate transfection events are performed over two to six consecutive days, preferably three to five consecutive days, preferably four consecutive days.
[0109] In one embodiment, the transfection event lasts for about 10 minutes, preferably about 20, 30, 40, 50, 60, 70, 80 minutes, or longer.90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 400, 420, 480 minutes or about 500 minutes, preferably lasting about 300 minutes.
[0110] In one embodiment, the transfection event lasts about 100 to about 500 minutes, preferably about 150 to 450 minutes, 200 to 400 minutes, 250 to 350 minutes, preferably lasting about 300 minutes.
[0111] In one embodiment, the SOX2 cmRNA comprises SEQ ID NO:1. In one embodiment, the SOX2 cmRNA consists essentially of SEQ ID NO:1 or consists of SEQ ID NO:1. In one embodiment, the PAX6 cmRNA package specification page 10 / 30 13 CN 121368632 A contains SEQ ID NO:2. In one embodiment, the PAX6 cmRNA is substantially composed of SEQ ID NO: 1 or SEQ ID NO: 2.
[0112] In one embodiment, the basal brain culture medium is Neurobasal A or BrainPhys, preferably BrainPhys. In one embodiment, the basal brain culture medium further comprises at least one, at least two, three, four, at least five, six, or all seven adjuvants selected from the group consisting of valganciclovir, penicillin-streptomycin-glutamine, B27 without retinoic acid, FGF2, EGF, retinoic acid, and heparin.
[0113] In one embodiment, the culture in b. lasts for about four to about ten days, preferably about five to about nine days, preferably about six to about eight days. In one embodiment, the culture in b. lasts for about seven days.
[0114] In one embodiment, the PKC inhibitor in b. is selected from the group consisting of: GÖ6983, enzatolin, asteroidin, GF 109203X, GÖ6976, Ro 31-8220 mesylate, Ro 32-0432 hydrochloride, sotratalline, and K252a. In one embodiment, the PKC inhibitor in b. is GÖ6983.
[0115] In one embodiment, the concentration of the PKC inhibitor in b. is from about 0.5 nM to 50 µM, preferably from about 1 nM to about 40 µM, from about 10 nM to about 30 µM, from about 100 nM to about 20 µM, from about 500 nM to about 15 µM, from about 1 µM to about 10 µM, from about 3 µM to about 8 µM, from about 5 µM to about 6 µM, preferably about 5 µM.
[0116] In one embodiment, the p160ROCK inhibitor in b. is selected from the group consisting of: Y27632, thiazolinone, HA1100 hydrochloride and GSK429286A. In one embodiment, the p160ROCK inhibitor in b. is Y27632.
[0117] In one embodiment, the concentration of the p160ROCK inhibitor in b. is from about 0.1 nM to about 100 µM, preferably from about 1 nM to about 75 µM, from about 500 nM to about 50 µM, from about 1 µM to about 25 µM, from about 5 µM to about 15 µM, from about 7 µM to about 13 µM, preferably about 10 µM.
[0118] In one embodiment, the passaging in c. is carried out over about four to about ten days, preferably from about five to nine days, and preferably from about six to eight days. In one embodiment, the passaging in c. is completed over about seven days.
[0119] In one embodiment, the composition in c. comprises: basal brain culture medium, and at least three active agents selected from the group consisting of protein kinase C (PKC) inhibitors, p160ROCK inhibitors, N-2 supplements, and activator A (ActA).
[0120] In one embodiment, the composition in c. comprises: basal brain culture medium, and all four active agents, wherein the four active agents are protein kinase C (PKC) inhibitors, p160ROCK inhibitors, N-2 supplements, and activator A (ActA).
[0121] In one embodiment, the concentration of the N-2 supplement in c. is from about 0.1% to about 10%, preferably from about 0.3% to about 8%, from about 0.5% to about 5%, from about 0.7% to about 3%, from about 0.9% to about 2%, preferably about 1%.
[0122] In one embodiment, the concentration of ActA in c is about 25 pg / mL to about 25 µg / mL, preferably about 50 pg / mL to about 1 µg / mL, about 250 pg / mL to about 750 ng / mL, about 500 pg / mL to about 500 ng / mL, about 750 pg / mL to about 250 ng / mL, about 1 ng / mL to about 100 ng / mL, about 5 ng / mL to about 75 ng / mL, about 10 ng / mL to about 65 ng / mL, about 15 ng / mL to about 50 ng / mL, about 20 ng / mL to about 30 ng / mL, about 22 ng / mL to about 28 ng / mL, preferably about 25 ng / mL.
[0123] In one embodiment, the PKC inhibitor in c. is selected from the group consisting of: GÖ6983, enzatolin, asteroidin, GF 109203X, GÖ6976, Ro 31-8220 mesylate, Ro 32-0432 hydrochloride, sotrataline, and K252a. In one embodiment, the PKC inhibitor in b. is GÖ6983.
[0124] In one embodiment, the concentration of the PKC inhibitor in c. is from about 0.5 nM to 50 µM, preferably from about 1 nM to about 40 µM.M, about 10 nM to about 30 µM, about 100 nM to about 20 µM, about 500 nM to about 15 µM, about 1 µM to about 10 µM, about 3 µM to about 8 µM, about 5 µM to about 6 µM, preferably about 5 µM.
[0125] In one embodiment, the p160ROCK inhibitor in c. is selected from the group consisting of: Y27632, thiazolidinediones (see CN 121368632 A, page 11 / 30 of the specification), HA 1100 hydrochloride, and GSK429286A. In one embodiment, the p160ROCK inhibitor in c. is Y27632.
[0126] In one embodiment, the concentration of the p160ROCK inhibitor in c. is about 0.1 nM to about 100 µM, preferably about 1 nM to about 75 µM, about 500 nM to about 50 µM, about 1 µM to about 25 µM, about 5 µM to about 15 µM, about 7 µM to about 13 µM, preferably about 10 µM.
[0127] In one embodiment, the culture in d. lasts about four to about ten days, preferably about five to about nine days, preferably about six to about eight days. In one embodiment, the culture in d. lasts about seven days.
[0128] In one embodiment, HF is a lineage-specific cell. In one embodiment, HF is a non-lineage-specific cell.
[0129] In one embodiment, HF is human dermal fibroblast (HDF). In one embodiment, HF is adult fibroblast (aHF). In one embodiment, HF is adult dermal fibroblast (aHDF).
[0130] In one embodiment, hiLGEP expresses at least one lateral ganglion elevation (LGE) transcription factor. In one embodiment, at least one LGE transcription factor is selected from the group consisting of GSX2, FOXP1, FOXP2, MEIS, and CTIP2.
[0131] In one embodiment, hiLGEP expression is selected from at least two, at least three, at least four, and preferably five LGE transcription factors selected from the group consisting of GSX2, FOXP1, FOXP2, MEIS, and CTIP2.
[0132] In one embodiment, the method further comprises differentiating hiLGEP in striatal differentiation medium (STDM).
[0133] In one embodiment, differentiation lasts for about four to about ten days, preferably about five to about nine days, preferably about six to about eight days. In one embodiment, differentiation lasts for about seven days.
[0134] In one embodiment, STDM contains B27-RA, N-2 supplement, cAMP activator, p160ROCK inhibitor, and brain-derived neurotrophic factor (BDNF), wherein STDM is supplemented with dorsomorphin for about the first four to six days of the initial differentiation period and with ActA for about the first six to eight days of the initial differentiation period.
[0135] In one embodiment, the cAMP activator is dcAMP or fibrinogen (FSK).
[0136] In one embodiment, the concentration of the cAMP activator is from about 0.1 nM to about 10 mM, preferably from about 1 nM to about 1 mM, from about 10 nM to about 0.1 mM, from about 100 nM to about 100 µM, from about 1 µM to about 50 µM, from about 5 µM to about 25 µM, from about 7 µM to about 15 µM, preferably from about 10 µM.
[0137] In one embodiment, the concentration of B27-RA is from about 0.2% to about 20%, preferably from about 0.5% to about 15%, from about 0.7% to about 10%, from about 0.9% to about 5%, from about 1% to about 3%, preferably from about 2%.
[0138] In one embodiment, the concentration of the N2 supplement is from about 0.1% to about 10%, preferably from about 0.3% to about 8%, from about 0.5% to about 5%, from about 0.7% to about 3%, from about 0.9% to about 2%, preferably from about 1%.
[0139] In one embodiment, the concentration of BDNF is from about 0.3 ng / mL to 3 μg / mL, preferably from about 3 ng / mL to about 300 ng / mL, from about 5 ng / mL to about 150 ng / mL, from about 10 ng / mL to about 75 ng / mL, from about 15 ng / mL to about 50 ng / mL, from about 20 ng / mL to about 40 ng / mL, preferably from about 30 ng / mL.
[0140] In one embodiment, STDM is supplemented with dorsomorphin for about the first five days of differentiation. In one embodiment, the concentration of dorsomorphin is from about 1 nM to about 1 mM, preferably from about 100 nM to about 100 µM, from about 500 nM to about 50 µM, from about 750 nM to about 25 µM, from about 800 nM to about 15 µM, from about 900 nM to about 5 µM, from about 950 nM to about 2.5 µM, preferably about 1 µM.
[0141] In one embodiment, STDM is supplemented with ActA for about the first seven days of the initial differentiation phase.
[0142] In one embodiment, the concentration of ActA is from about 25 pg / mL to about 25 µg / mL, preferably from about 50 pg / mL to about 1 µg / mL, from about 250 pg / mL to about 750 ng / mL, from about 500 pg / mL to about 500 ng / mL, from about 750 pg / mL to about 250 ng / mL, from about 1 ng / mL to about 100 ng / mL, from about 5 ng / mL to about 75 ng / mL, from about 10 ng / mL to about 65 ng / mL, from about 15 ng / mL to about 50 ng / mL, from about 20 ng / mL to about 30 ng / mL, from about 22 ng / mL to about 28 ng / mL, preferably about 25 ng / mL.
[0143] In one embodiment, the p160ROCK inhibitor is selected from the group consisting of Y27632, thiazolyl ivermectin, HA 1100 hydrochloride, and GSK429286A. In one embodiment, the p160ROCK inhibitor is Y27632.
[0144] In one embodiment, the concentration of the p160ROCK inhibitor is from about 0.1 nM to about 100 µM, preferably from about 1 nM to about 75 µM, from about 500 nM to about 50 µM, from about 1 µM to about 25 µM, from about 5 µM to about 15 µM, from about 7 µM to about 13 µM, preferably from about 10 µM.
[0145] In one embodiment, differentiation includes differentiating hiLGEP into cells expressing at least one biomarker associated with neuronal differentiation. In one embodiment, differentiation includes differentiating hiLGEP into intermediate-sized multispinous striatum neurons (MSNs).
[0146] In one embodiment, hiLGEP, after differentiation in STDM, expresses at least one of TUJ1, MAP2, DARPP32, GABA, and GAD65 / 67, preferably at least three of TUJ1, MAP2, DARPP32, GABA, and GAD65 / 67, preferably at least four, and preferably all five.
[0147] In another aspect, the present invention relates to a kit comprising:
[0148] i. a composition comprising: basal brain culture medium, and at least two active agents selected from the group consisting of a protein kinase C (PKC) inhibitor, a p160ROCK inhibitor, and an N-2 supplement; and
[0149] ii. a composition comprising: basal brain culture medium, and at least three active agents selected from the group consisting of a protein kinase C (PKC) inhibitor, a p160ROCK inhibitor, an N-2 supplement, and an activator A (ActA).
[0150] In one embodiment, the composition in i. comprises basal brain culture medium and all three active agents, namely a protein kinase (PKC) inhibitor, a p160ROCK inhibitor, and an N-2 supplement.
[0151] In one embodiment, the composition in ii. comprises basal brain culture medium and all four active agents, namely a protein kinase (PKC) inhibitor, a p160ROCK inhibitor, an N-2 supplement, and activator A (ActA).
[0152] In one embodiment, the composition in i. or the composition in ii. or both are dry, substantially dry, lyophilized, liquid, or frozen compositions.
[0153] In one embodiment, i. and ii. are packaged separately in the kit and are used in the order i. first, ii. last.
[0154] In one embodiment, the kit contains iii., namely at least one selected from SOX2 cmRNA and PAX6 cmRNA.A cmRNA. In one embodiment, the kit comprises SOX2 cmRNA and PAX6 cmRNA. In one embodiment, SOX2 cmRNA comprises SEQ ID NO:1. In one embodiment, SOX2 cmRNA consists essentially of SEQ ID NO:1 or consists of SEQ ID NO:1. In one embodiment, PAX6 cmRNA comprises SEQ ID NO:2. In one embodiment, PAX6 cmRNA consists essentially of SEQ ID NO:2 or consists of SEQ ID NO:2.
[0155] In one embodiment, iii. is provided as a composition comprising a vector. In one embodiment, the composition is a dry, substantially dry, lyophilized, liquid, or frozen composition.
[0156] In one embodiment, when the kit comprises iii., i., ii., and iii. are packaged separately in the kit and used in the order of iii., then i., then ii.
[0157] In one embodiment, fibroblasts (preferably human fibroblasts (HF)) are reprogrammed to hiLGEP using the kit.
[0158] In one embodiment, the kit is used to reprogram fibroblasts (preferably human fibroblasts (HF)) to hiLGEP.
[0159] In one embodiment, the kit, when used, is used to reprogram fibroblasts (preferably human fibroblasts (HF)) to hiLGEP. Specification 13 / 30 pages 16 CN 121368632 A
[0160] In one embodiment, HF is a lineage-specific cell. In one embodiment, HF is a non-lineage-specific cell. In one embodiment, HF is human dermal fibroblasts (HDF). In one embodiment, HF is adult fibroblasts (aHF). In one embodiment, HF is adult dermal fibroblasts (aHDF).
[0161] As a specific embodiment of this aspect of the invention, particularly contemplated are all embodiments of the following as set forth in any other aspect disclosed herein: basal brain culture medium, protein kinase (PKC) inhibitor, p160ROCK inhibitor, N-2 supplement, and ActA.
[0162] In another aspect, the present invention relates to a human induced lateral ganglion elevation precursor cell (hiLGEP).
[0163] In one embodiment, the hiLGEP does not express ZNF503.
[0164] In one embodiment, the hiLGEP is prepared according to the methods described herein.
[0165] In another aspect, the present invention relates to a composition comprising human induced lateral ganglion elevation precursor cells (hiLGEP) and a carrier.
[0166] In one embodiment, hiLGEP does not express ZNF503.
[0167] In one embodiment, the carrier is a buffer, culture medium, or a pharmaceutically acceptable carrier. In one embodiment, the carrier is a pharmaceutically acceptable carrier.
[0168] In one embodiment, the composition comprises at least about 1,000,000 live hiLGEP, preferably at least about 2,000,000, at least about 3,000,000, at least about 4,000,000, preferably at least about 5,000,000 live hiLGEP.
[0169] In one embodiment, hiLGEP is prepared according to the methods described herein.
[0170] In another aspect, the present invention relates to a composition comprising basal brain culture medium, B27-RA, N-2 supplement, cyclic adenosine 3',5'-monophosphate (cAMP) activator, p160ROCK inhibitor, brain-derived neurotrophic factor (BDNF), and activin A (ActA).
[0171] In one embodiment, the composition comprises dorsomorphin.
[0172] In another aspect, the present invention relates to a composition comprising basal brain culture medium, B27-RA, N-2 supplement, cyclic adenosine 3',5'-monophosphate (cAMP) activator, p160ROCK inhibitor, brain-derived neurotrophic factor (BDNF), and dorsomorphin.
[0173] In one embodiment, the composition comprises activin A.
[0174] In one embodiment, the composition comprises hiLGEP.
[0175] In one embodiment, hiLGEP is reprogrammed human fibroblasts (HF), human dermal fibroblasts (HDF), adult fibroblasts (aHF), or adult dermal fibroblasts (aHDF).
[0176] In one embodiment, hiLGEP is prepared according to the methods described herein.
[0177] As a specific embodiment of this aspect of the invention, particular consideration is given to all embodiments of the following as set forth in any other aspect disclosed herein: basal brain culture medium, B27-RA, N-2 supplement, cAMP activator, protein kinase (PKC) inhibitor, p160ROCK inhibitor, BDNF, dorsomorphin, and ActA.
[0178] In another aspect, the present invention relates to the use of a composition for inducing the expression of at least one lateral ganglion elevation (LGE) transcription factor in reprogrammed HF, the composition comprising basal brain culture medium, activin A (ActA), protein kinase C (PKC) inhibitor, p160ROCK inhibitor, and N-2 supplement.
[0179] In one embodiment, the reprogrammed HF is reprogrammed adult fibroblasts, human dermal fibroblasts, or adult dermal fibroblasts.
[0180] In one embodiment, the induced LGE transcription factor is at least one of GSX2, FOXP1, FOXP2, MEIS, and CTIP2, preferably at least two, at least three, or at least four of GSX2, FOXP1, FOXP2, MEIS, and CTIP2, and preferably all five as described on page 14 / 30 of the specification, CN 121368632 A.
[0181] As a specific embodiment of this aspect of the invention, particularly contemplated are all embodiments of the following as set forth in any other aspect disclosed herein: basal brain culture medium, activin A (ActA), protein kinase C (PKC) inhibitor, p160ROCK inhibitor, and N-2 supplement.
[0182] In another aspect, the present invention relates to the use of a composition for promoting the induction of lateral ganglion elevation (LGE) precursor fate in fibroblasts (preferably human fibroblasts (HF)), the composition comprising: basal brain culture medium, and at least three active agents selected from the group consisting of activin A (ActA), protein kinase C (PKC) inhibitors, p160ROCK inhibitors, and N-2 supplements. In one embodiment, the composition comprises four active agents, namely activin A (ActA), protein kinase C (PKC) inhibitors, p160ROCK inhibitors, and N-2 supplements.
[0183] In one embodiment, the HF is adult fibroblasts, human dermal fibroblasts, or adult dermal fibroblasts.
[0184] In one embodiment, the application is a method for reprogramming HF according to the methods described herein.
[0185] In one embodiment, the application provides a reprogrammed HF LGE precursor or hiLGEP.
[0186] As a specific embodiment of this aspect of the invention, particular consideration is given to all embodiments of the following as set forth in any other aspect disclosed herein: basal brain culture medium, ActA, protein kinase (PKC) inhibitor, p160ROCK inhibitor, and N-2 supplement.
[0187] In another aspect, the present invention relates to the use of a composition for inducing the expression of at least one neuronal differentiation-related biomarker in reprogrammed HF LGE precursor cells, the composition comprising basal brain culture medium, B27-RA, N2 supplement, cAMP activator, p160ROCK inhibitor, brain-derived neurotrophic factor (BDNF), and activin A.
[0188] In one embodiment, the reprogrammed HF LGE precursor cells are reprogrammed adult fibroblasts, human dermal fibroblasts, or adult dermal fibroblasts.
[0189] In one embodiment, the reprogrammed HF is hiLGEP as described herein.
[0190] In one embodiment, the application is as a cell culture medium.
[0191] In one embodiment, the application lasts for about 13 to about 15 days, preferably about 14 days.
[0192] In one embodiment, the application includes the use of activator A in the composition for about five to about nine days, preferably about six to about eight days, preferably about seven days.
[0193] In one embodiment, the composition includes dorsomorphin.
[0194] In one embodiment, the application includes the use of dorsomorphin in the composition for about three to about seven days, preferably about four to about six days, preferably about five days.
[0195] In one embodiment, the biomarker is at least one of TUJ1, MAP2, DARPP32, GABA, and GAD65 / 67, preferably at least three, at least four, and preferably all five of TUJ1, MAP2, DARPP32, GABA, and GAD65 / 67.
[0196] As a specific embodiment of this aspect of the invention, particular consideration is given to all embodiments of the following as set forth in any other aspect disclosed herein: basal brain culture medium, B27-RA, N-2 supplement, cAMP activator, protein kinase (PKC) inhibitor, p160ROCK inhibitor, BDNF, dorsomorphin, and ActA.
[0197] In another aspect, the present invention relates to the use of a composition for inducing the expression of at least one neuronal differentiation-related biomarker in reprogrammed HF LGE precursor cells, the composition comprising basal brain culture medium, B27-RA, N2 supplement, cAMP activator, p160ROCK inhibitor, brain-derived neurotrophic factor (BDNF), and dorsomorphin.
[0198] In one embodiment, the reprogrammed HF LGE precursor cells are reprogrammed adult fibroblasts, human dermal fibroblasts, or adult dermal fibroblasts. Specification 15 / 30 pages 18 CN 121368632 A
[0199] In one embodiment, the reprogrammed HF is hiLGEP as described herein.
[0200] In one embodiment, the application is as a cell culture medium.
[0201] In one embodiment, the application lasts for about 13 to about 15 days, preferably about 14 days.
[0202] In one embodiment, the application includes the use of dorsomorphin in the composition for about three to about seven days, preferably about four to about six days, preferably about five days.
[0203] In one embodiment, the composition includes activator A.
[0204] In one embodiment, the application includes the use of activator A in the composition for about five to about nine days, preferably about six to about eight days, preferably about seven days.
[0205] In one embodiment, the biomarker is at least one of TUJ1, MAP2, DARPP32, GABA, and GAD65 / 67.The preferred species are at least three, at least four, and preferably all five of TUJ1, MAP2, DARPP32, GABA, and GAD65 / 67.
[0206] As a specific embodiment of this aspect of the invention, particularly contemplated are all embodiments of the following as set forth in any other aspect disclosed herein: basal brain culture medium, B27-RA, N-2 supplement, cAMP activator, protein kinase (PKC) inhibitor, p160ROCK inhibitor, BDNF, dorsomorphin, and ActA.
[0207] In another aspect, the present invention relates to the use of a composition for the preparation of intermediate-sized polyspinous striatum neurons (MSNs), the composition comprising at least one induced human lateral ganglion eminence precursor cell (hiLGEP) and a carrier.
[0208] In one embodiment, the carrier is a buffer, culture medium, or a pharmaceutically acceptable carrier. In one embodiment, the carrier is a pharmaceutically acceptable carrier.
[0209] In one embodiment, the hiLGEP is a reprogrammed adult fibroblast, a human dermal fibroblast, or an adult dermal fibroblast. In one embodiment, hiLGEP is prepared according to the method described herein.
[0210] In one embodiment, the induced LGE transcription factor is at least one of GSX2, FOXP1, FOXP2, MEIS, and CTIP2, preferably at least two, at least three, at least four, and preferably all five of GSX2, FOXP1, FOXP2, MEIS, and CTIP2.
[0211] In one embodiment, MSN is prepared in vitro or in vivo.
[0212] In one embodiment, MSN is prepared in vitro by culturing hiLGEP in STDM (supplemented with dorsomorphin and ActA) as described herein.
[0213] In one embodiment, MSN is prepared in vivo by transplanting hiLGEP into a subject (preferably a human subject).
[0214] In one embodiment, transplantation comprises inserting or implanting hiLGEP into the subject. In one embodiment, insertion is performed by injection.
[0215] In another aspect, the present invention relates to the use of a composition for the treatment of Huntington's disease, the composition comprising human induced lateral ganglion elongation precursor cells (hiLGEP) and a carrier.
[0216] In another aspect, the present invention relates to the use of a composition for reducing the severity of Huntington's disease, the composition comprising human induced lateral ganglion elongation precursor cells (hiLGEP) and a carrier.
[0217] In another aspect, the present invention relates to the use of a composition for delaying the onset of Huntington's disease, the composition comprising human induced lateral ganglion elongation precursor cells (hiLGEP) and a carrier.
[0218] In another aspect, the present invention relates to the use of human induced lateral ganglion progenitor cells (hiLGEP) in the preparation of a medicament for treating Huntington's disease.
[0219] In another aspect, the present invention relates to the use of human induced lateral ganglion progenitor cells (hiLGEP) in the preparation of a medicament for reducing the severity of Huntington's disease. Specification 16 / 30 pages 19 CN 121368632 A
[0220] In another aspect, the present invention relates to the use of human induced lateral ganglion progenitor cells (hiLGEP) in the preparation of a medicament for delaying the onset of Huntington's disease.
[0221] In another aspect, the present invention relates to the use of human induced lateral ganglion progenitor cells (hiLGEP) for treating Huntington's disease.
[0222] In another aspect, the present invention relates to the use of human induced lateral ganglion progenitor cells (hiLGEP) for reducing the severity of Huntington's disease.
[0223] In another aspect, the present invention relates to the use of human induced lateral ganglion progenitor cells (hiLGEP) for delaying the onset of Huntington's disease.
[0224] The following embodiments particularly cover any and / or all embodiments described herein that relate to the following: the use of compositions comprising human induced lateral ganglion progenitor cells (hiLGEP), the use of hiLGEP in the preparation of pharmaceuticals, and / or the use of hiLGEP as described herein.
[0225] In one embodiment, the carrier is a pharmaceutically acceptable carrier. In one embodiment, the composition is a pharmaceutical composition.
[0226] In one embodiment, hiLGEP expresses at least one LGE transcription factor selected from the group consisting of: GSX2, DLX2, FOXP1, FOXP2, CTIP2, and MEIS2. In one embodiment, hiLGEP expresses at least two, preferably at least three, at least four, and preferably all five of GSX2, DLX2, FOXP1, FOXP2, CTIP2, and MEIS2.
[0227] In one embodiment, hiLGEP expresses at least one neurotrophic factor, preferably NESTIN.
[0228] In one embodiment, hiLGEP is a lineage-specific cell. In one embodiment, hiLGEP is a non-lineage-specific cell.
[0229] In one embodiment, hiLGEP is a reprogrammed adult fibroblast, human dermal fibroblast, or adult dermal fibroblast.
[0230] In one embodiment, the application comprises implanting hiLGEP or a pharmaceutical composition into the striatum of a human subject. In one embodiment, the insertion is performed by injection.
[0231] In one embodiment, the injection is an injection into the striatum of a human subject suspected of having Huntington's disease or having at least one symptom of Huntington's disease.
[0232] In one embodiment, the injection comprises a therapeutically effective amount of hiLGEP or a pharmaceutical composition.
[0233] In one embodiment, the therapeutically effective amount of composition comprises at least about 1,000,000 live hiLGEPs per injection, preferably at least 2,000,000, at least 3,000,000, at least 4,000,000, and preferably at least about 5,000,000 live hiLGEPs.
[0234] In one embodiment, the therapeutically effective amount of hiLGEP is at least about 1,000,000 live hiLGEPs per injection, preferably at least 2,000,000, at least 3,000,000, at least 4,000,000, and preferably at least about 5,000,000 live hiLGEPs.
[0235] In another aspect, the present invention relates to a method for treating Huntington's disease, the method comprising transplanting human induced lateral ganglion protrusion (hiLGEP) cells into the striatum of a subject who has or is suspected of having Huntington's disease.
[0236] In another aspect, the present invention relates to a method for improving Huntington's disease, the method comprising transplanting human induced lateral ganglion protrusion (hiLGEP) cells into the striatum of a subject who is suspected of having Huntington's disease or has at least one symptom of Huntington's disease.
[0237] In another aspect, the present invention relates to a method for delaying the onset of Huntington's disease, the method comprising transplanting human induced lateral ganglion protrusion (hiLGEP) cells into the striatum of a subject who is suspected of having Huntington's disease or has at least one symptom of Huntington's disease.
[0238] In another aspect, the present invention relates to a method for reducing the severity of Huntington's disease, the method comprising transplanting human induced lateral ganglion protrusion (hiLGEP) cells into the striatum of a subject suspected of having Huntington's disease or having at least one symptom of Huntington's disease.
[0239] The following embodiments particularly cover any and / or all embodiments of the method aspect of the above invention.
[0240] In one embodiment, the transplantation comprises transplanting a therapeutically effective amount of hiLGEP.
[0241] In one embodiment, the therapeutically effective amount of hiLGEP comprises at least about 1,000,000 live hiLGEP cells per injection, preferably at least 2,000,000, at least 3,000,000, at least 4,000,000, preferably at least about 5,000,000 live hiLGEP cells.
[0242] In one embodiment, the transplantation comprises inserting hiLGEP cells into the striatum of the subject. In one embodiment, the insertion is performed by injection.
[0243] In one embodiment, hiLGEP expresses at least one LGE transcription factor selected from the group consisting of:GSX2, DLX2, FOXP1, FOXP2, CTIP2, and MEIS2. In one embodiment, hiLGEP expresses at least two, preferably at least three, at least four, and preferably all five of GSX2, DLX2, FOXP1, FOXP2, CTIP2, and MEIS2.
[0244] In one embodiment, hiLGEP expresses at least one neurotrophic factor, preferably NESTIN.
[0245] In one embodiment, hiLGEP is a lineage-specific cell. In one embodiment, hiLGEP is a non-lineage-specific cell.
[0246] In one embodiment, hiLGEP is obtained by reprogramming adult fibroblasts, human dermal fibroblasts, or adult dermal fibroblasts.
[0247] In one embodiment, hiLGEP is contained in a pharmaceutical composition comprising a physiologically acceptable carrier.
[0248] In one embodiment, transplantation comprises inserting the pharmaceutical composition into the striatum of a human subject. In one embodiment, insertion is performed by injection.
[0249] In one embodiment, the pharmaceutical composition comprises a therapeutically effective amount of hiLGEP. In one embodiment, the therapeutically effective amount of hiLGEP is at least about 1,000,000 live hiLGEPs per injection, preferably at least 2,000,000, at least 3,000,000, at least 4,000,000, and preferably at least 5,000,000 live hiLGEPs.
[0250] In one embodiment, improving Huntington's disease includes improving at least one Huntington's disease symptom. In one embodiment, delaying the onset of Huntington's disease includes prolonging the time before the subject is observed to have at least one Huntington's disease symptom. In one embodiment, reducing severity includes reducing the severity of at least one Huntington's disease symptom.
[0251] In one embodiment, at least one symptom is selected from the group consisting of: motor dysfunction, including involuntary twitching or twisting (chorea); muscle problems, including rigidity or muscle contractures (dystonia); slow or irregular eye movements; gait, posture, and balance disorders; and speech or swallowing difficulties.
[0252] The compositions and methods disclosed herein enable the cell reprogramming of human fibroblasts (HF) into neural progenitor cells. In one specific embodiment, compositions and methods for reprogramming HF into human-inducible lateral ganglion eminence progenitor cells are disclosed. As described herein, cell reprogramming using SOX2 and PAX6 cmRNA results in HF-derived cell progeny possessing at least one novel cell phenotype compared to unreprogrammed contemporaneous HF cells. This novel phenotype can be observed in culture or in reprogrammed cells in vivo. The cell reprogramming described herein confers pluripotent potential to cmRNA-transfected HF. In this context...In this context, "pluripotency" refers to the measurable proportion of reprogrammed cell progeny that has the potential to differentiate into cells displaying the phenotypic characteristics of a new cell type, compared to the proportion of unreprogrammed cells that do not possess this potential. In some embodiments, the proportion of progeny displaying the phenotypic characteristics of a new cell type will be significantly higher than before reprogramming. In some embodiments, the proportion of progeny displaying the phenotypic characteristics of a new cell type will be at least 0.05%, 0.1%, 0.5%, 1%, 5%, 10%, 15%, 25%, 30%, 40%, 50%, or higher than the proportion observed in appropriate controls as understood by those skilled in the art.
[0253] In some embodiments, the reprogrammed cells are cells displaying the phenotypic characteristics of nervous system cells and / or lineage-specific neural cells. The term "lineage-specific" is derived from the cell lineage of a tissue type, which is the relevant product of cell division.
[0254] As described herein, neural progenitor cells (particularly human induced lateral ganglion eminence progenitor cells) are cells capable of differentiating into lateral ganglion eminence neural lineage cells and / or tissue types. In this regard, the lineage-specific neural progenitor cells described herein (particularly lineage-specific induced human lateral ganglion eminence progenitor cells) are artificially created pluripotent progenitor cells derived from a non-pluripotent and non-multipotent source. This document uses reprogrammed human dermal fibroblasts (HDF) expressing lineage-specific neural cell characteristic genes as an example to illustrate this source.
[0255] In some embodiments, reprogramming HF with cmRNA as described herein involves transfecting HDF with cmRNA encoding SOX2 and PAX6. Transfection involves introducing or delivering cmRNA encoding SOX2 or PAX6 into HDF using standard transfection techniques known and used by those skilled in the art. Transfection protocols are illustrated in the examples in this specification and can be implemented as described. Those skilled in the art are also familiar with standard transfection techniques, such as the method described in WO2011 / 012316, which discloses a method for transfecting lung cells with mRNA using Lipofectamine 2000 (Invitrogen). Kim and Eberwine (Anal Bioanal Chem. 397(8):3173-8(2010)) also describe other transfection protocols, reviewing biological, chemical, and physical transfection methods in the art for delivering nucleic acids to cells.
[0256] As described herein, transfection of HDF involves transfection with cmRNA. In some embodiments, transfection involves transfection with separate cmRNAs encoding SOX2 and PAX6, respectively. In some embodiments, approximately 5% to 50% of the cytidine nucleotides and 5% to 50% of the uridine nucleotides in the cmRNA are modified. In some embodiments, approximately 10% to 35% of the cytidine and uridine nucleotides are modified.Modification. In some embodiments, the cmRNA may contain about 7.5% to 25% modified cytidine nucleotides and about 7.5% to 25% modified uridine nucleotides. In a preferred embodiment, about 25% of the cytidine nucleotides and about 25% of the uridine nucleotides are modified. In some embodiments, the modified uridine nucleotide is 2-thiouridine. In some embodiments, the modified cytidine nucleotide is a 5-methylcytidine residue. In some embodiments, the nucleotides containing adenosine and guanosine are unmodified or partially modified.
[0257] The cmRNAs encoding SOX2 and PAX6 as described herein can be prepared by recombinant methods in vivo or in vitro systems, or by synthetic methods (e.g., conventional chemical synthesis on an automated nucleotide sequencer using solid-phase support and standard techniques). Those skilled in the art can recombinantly produce cmRNA in vivo or in vitro systems, or by synthetic methods. Regardless of the method used to produce the cmRNA, it can be purified and recovered using methods known to skilled workers.
[0258] In some embodiments, HF is adult fibroblast (aHF), human dermal fibroblast (HDF), or adult dermal fibroblast (aHDF). Preferably, HF is adult HDF. Fibroblasts are commonly found in connective tissue and are associated with collagen fiber formation and connective tissue matrix production. Cell reprogramming described herein considers mammalian fibroblasts from any source of tissue, including but not limited to fibroblasts from kidney, heart, lung, interstitial, and dermal tissues. In some embodiments, the fibroblasts reprogrammed using the compositions and methods described herein are adult mammalian dermal fibroblasts, preferably adult dermal fibroblasts (aHDF). aHDF is available from commercial sources or isolated from various tissues using known laboratory equipment and techniques according to methods known in the art.
[0259] After transfection with cmRNA, fibroblasts are cultured to allow transfected RNA expression and subsequent reprogramming. As described herein, HDF is cultured under permissible conditions in a brain-based reprogramming medium that supports neural progenitor cell growth. The preferred brain-based reprogramming culture media are Neurobasal-A and BrainPhys media, but are not necessarily limited to these.
[0260] In some embodiments, the culture medium is supplemented with a variety of components that promote the reprogramming process. As described herein, certain components are particularly preferred as they are essential for reprogramming HF (including HDF) into neural progenitor cells (especially hiLGEP). These components are referred to herein as “activators”.
[0261] Additional components of the culture medium may contain chromatin modifying agents that promote reprogramming. Chromatin modifying agents may be inhibitors of…Agents for chromatin deacetylation, altering the methylation status of histones in chromatin, inducing DNA demethylation in chromatin, or promoting chromatin acetylation. In one embodiment, valproic acid at an appropriate concentration (typically 1 μM) can be used as a chromatin modifier.
[0262] Brain-based reprogramming media may also contain multiple combinations of some and / or all of the following components: amino acids (including non-essential amino acids), fatty acids, lipids, growth factors, vitamins, antioxidants, cytokines, inorganic salts, pyruvate, and reducing agents (such as 2-mercaptoethanol). In some embodiments, the listed components are selected and added to the culture medium according to concentrations known in the art and used for neural cell culture.
[0263] In some embodiments, the permissible conditions for neural cell culture are those described in the examples of this disclosure, but are not limited thereto. Cell culture may also be performed under permissible conditions for neural cell culture known in the art and used. Cultures may be grown in containers including, but are not limited to, culture bags, test tubes, flasks, bottles, culture dishes (including culture dishes and culture trays), well plates (microwells and porous plates), trays, and slide chambers. Those skilled in the art can select appropriate containers for cell culture.
[0264] HF (especially HDF), which is being reprogrammed as disclosed herein, can be cultured in any suitable volume of culture medium. For example, a volume of about 0.2 ml to about 2000 ml can be selected, depending on the equipment and protocols available to those skilled in the art and the desired permissible conditions. In some embodiments, bioreactors known and used in the art can be employed.
[0265] The culture container can be selected according to the purpose and can be adhesive or non-adhesive, as known in the art. Adhesive culture containers may contain a coating that promotes and / or improves cell adhesion to the container. Containers with inner walls coated to promote and / or improve cell adhesion can be coated with a variety of ingredients known in the art, including but not limited to fibronectin, gelatin, laminin, collagen, fibronectin, poly-L-lysine, or poly-D-lysine or mixtures thereof.
[0266] Those skilled in the art can define further culture conditions based on this disclosure in conjunction with knowledge known and used in the art. Such conditions include the selection of temperature, oxygen tension, and CO2 concentration. As a non-limiting example, the culture temperature may be in the range of about 30 to 40°C, including all temperature points therein, but is not necessarily limited to this; the oxygen tension may be in the range of about 1 to 20%, including all percentages therein, but is not necessarily limited to this; the CO2 concentration may be in the range of about 1 to 10%, also including any percentage therein, but is not necessarily limited to this.
[0267] Composition of Culture Medium / Composition
[0268] In addition to the general considerations provided regarding cell culture, the inventors have determined that certain culture conditions are required for the effective reprogramming of HF to hiLGEP. These required conditions are set forth herein as embodiments.
[0269] In one example, reprogramming HF (particularly HDF, particularly aHDF) involves: transfecting cells with cmRNA encoding transcription factors SOX2 and PAX6, followed by culturing the transfected cells in a brain-based reprogramming medium containing 1 mM valproic acid, 1% penicillin-streptomycin-glutamine, 2% retinoic acid-free B-27, 20 ng / ml EGF, 20 ng / ml FGF2, and 2 µg / ml heparin, with the broad-spectrum protein kinase C inhibitor Gö6983 (5 µM), the p160ROCK inhibitor Y27632 (10 µM), 1% N-2 supplement (combination abbreviation GYN), and 10 µM retinoic acid. The preferred brain-based reprogramming medium is BrainPhys. Cells are cultured for approximately 6 to 8 days, preferably approximately 7 days, followed by passage of the culture and the addition of activin A (25 ng / ml) to the medium. The passaged cells were cultured for approximately 6 to 8 days, preferably approximately 7 days, for a total culture period of approximately 12 to approximately 16 days. A preferred total culture period was approximately 14 days.
[0270] The reprogrammed cells were tested using molecular and cellular techniques known in the art and described in the appendix examples to confirm that they had obtained the lateral ganglion eminence precursor fate as described on pages 20 / 30 of the specification, CN 121368632 A.
[0271] A portion of the reprogrammed cells with the LGEP fate, as described in the appendix examples, were further differentiated in vitro into functional DARPP32-positive neurons.
[0272] The pharmaceutical compositions described herein are compositions suitable for administration to a subject (preferably a human subject).
[0273] Pharmaceutical compositions containing hiLGEP as described herein can be formulated into methods suitable for cell transplantation therapy. In some embodiments, such pharmaceutical compositions are used to treat Huntington's disease, or at least reduce its severity and / or delay its onset.
[0274] In addition to containing hiLGEP as described herein, the pharmaceutical compositions described herein also contain pharmaceutically acceptable carriers, diluents, and / or excipients. As used herein, “pharmaceutically acceptable carrier” means a physiologically acceptable carrier.
[0275] Pharmaceutically acceptable carriers, diluents, and / or excipients include inactive substances contained in hiLGEP formulations as described herein. Such substances serve a variety of purposes in formulations. In one instance, such substances are used to increase the volume of the formulation to improve convenience and / or accuracy in manufacturing the dosage form. Such substances may be referred to as diluents, fillers, or expanders. Pharmaceutically acceptable carriers, diluents, and / or excipients may also provide therapeutically enhancing properties to the formulation, including, but not limited to, promoting the dissolution or absorption of the active ingredient. Various excipients are also used to reduce the difficulty of handling the active ingredient during manufacturing, for example by providing flowability or anti-sticking properties. In addition, different carriers, diluents, and / or excipients can provide stabilizing properties, includingTo prevent oxidation, crystallization, or denaturation, thereby extending the shelf life of the formulation. For any given formulation, the selection of appropriate pharmaceutically acceptable carriers, diluents, and / or excipients is considered to be within the capabilities of those skilled in the art. A variety of factors need to be considered when designing such formulations, including dosage form, nature of the active ingredient, route of administration, and other factors.
[0276] Several well-known pharmaceutically acceptable carriers, excipients, and / or diluents suitable for a variety of formulations include water, physiological saline, phosphate-buffered saline (PBS), wetting agents, and emulsifiers. Pharmaceutical compositions comprising various pharmaceutically acceptable carriers can be formulated using well-known conventional methods.
[0277] Pharmaceutical compositions comprising hiLGEP as described herein are formulated to contain an effective amount of hiLGEP, together with appropriate pharmaceutically acceptable carriers, diluents, and / or excipients. Such formulations can be readily determined by those skilled in the art based on the disclosure provided herein and methods known in the art. It should be understood that a “therapeuticly effective amount” means an amount sufficient to elicit a detectable therapeutic response in a subject administering the pharmaceutical combination.
[0278] In some embodiments, the therapeutically effective amount is at least about 1,000,000 hiLGEPs per injection dose, preferably 2,000,000, preferably 3,000,000, preferably 4,000,000, preferably at least about 5,000,000 hiLGEPs per dose. In one embodiment, the dose is an injection dose.
[0279] Administration of the therapeutically effective amount of hiLGEP as described herein, comprising administration of hiLGEP itself or a pharmaceutical composition comprising hiLGEP as described herein, can be performed by various cell transplantation techniques known to those skilled in the art and appropriately selected for cell therapy. Cell transplantation methods for transplantation therapy are believed to be well known to those skilled in the art. As a non-limiting example, the cells to be transplanted can be administered by intracerebral injection, stereotactic injection, local injection or direct injection into the spinal canal.
[0280] The pharmaceutical compositions described herein may also comprise a suitable carrier comprising a pharmaceutically acceptable salt or other pharmaceutically acceptable substance. The presence of a pharmaceutically acceptable salt and / or other substance is to make the pharmaceutical composition isotonic. As a non-limiting example, the carrier may include physiological saline, Ringer's solution, and glucose solution. Pharmaceutically acceptable carriers, diluents, and / or carriers (including stabilizers) are non-toxic at the doses and concentrations used. Suitable carriers and their formulations are described in more detail in Remington's Pharmaceutical Sciences, 17th edition (1985, Mack Publishing Co.).
[0281] Pharmaceutically acceptable carriers, diluents, and / or excipients may include, but are not limited to: buffers, including citric acid. (See page 24 of the instruction manual, 21 / 30)CN 121368632 A Salt, phosphate and other organic acid buffers; proteins, including serum albumin, gelatin and / or low molecular weight (>10 amino acid residues) peptides; chelating agents, including EDTA; nonionic surfactants, such as Tween, Prönkel or polyethylene glycol; salt-forming counterions, including sodium and potassium; hydrophilic polymers, such as polyvinylpyrrolidone (PVP); amino acids, including histidine, glutamine, lysine, asparagine, arginine or glycine; antioxidants, including methionine, Ascorbic acid and tocopherol; carbohydrates, such as glucose, mannose, dextrose or dextrin; various monosaccharides and disaccharides; various sugars, including sucrose, mannitol, trehalose or sorbitol; and / or various preservatives, such as octadecyl dimethyl benzyl ammonium chloride; hexamethyl diammonium chloride; benzalkonium chloride, benzyl chloride; phenol, butanol or benzyl alcohol; alkyl p-hydroxybenzoate, such as methyl or p-hydroxybenzoate; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol.
[0282] 6. Examples
[0283] Materials and Methods
[0284] Adult fibroblasts were directly reprogrammed into induced lateral ganglion eminence precursor cells and differentiated.
[0285] Human inducible lateral ganglion elevation precursor (hiLGEP) cells were generated from adult dermal fibroblast (aHDF) cell lines (1507: male Caucasian, 50 years old, facial tissue; 1838: male Caucasian, 50 years old, facial tissue; 2116: female Caucasian, 35 years old, abdominal tissue; 2298: female Caucasian, 33 years old, abdominal tissue; Cell Applications Inc). aHDF cells were cultured in DMEM (Thermo Fisher Scientific) containing 10% fetal bovine serum (FBS; Thermo Fisher Scientific).
[0286] aHDF cells were induced to the lateral ganglion elevation precursor (LGEP) fate by using chemically modified mRNA (cmRNA; Ethris GmbH, Munich, Germany) (Connor et al., 2018), utilizing transient overexpression of the neurotropic genes SOX2 and PAX6.
[0287] Several transfection protocols were used in this study. Both protocols achieved successful transfection, and the transfected cells exhibited the same morphological changes during the reprogramming process (Figure 7).
[0288] In the first protocol, Lipofectamine RNAiMAX (Thermo Fisher Scientific) transfection reagent was used to transfect aHDF cells with 2.5 µg each of SOX2 and PAX6 cmRNA. Transfection was performed for 5 hours over four consecutive days.
[0289] In the second protocol, lipid nanoparticle technology (LNP; Ethris GmbH, Munich, Germany) was used to transfect neurotrophic cells...Transient overexpression of the SOX2 and PAX6 genes combined with reprogramming aHDF to induce hiLGEP. A single 24-hour transfection was performed using 2.5 µg of SOX2-PAX6-LNP. In short, SOX2-PAX6-LNP was added to 500 µL of Opti-MEM™ serum-depleted medium (Gibco) and gently mixed. The transfection mixture was then added dropwise to wells containing the reprogramming medium.
[0290] Cells transfected using both methods were cultured and reprogrammed under normoxic conditions in Neurobasal-A (NBA; Thermo Fisher Scientific) or BrainPhys™-based (Stem Cell Technologies) reprogramming medium containing 1 mM valproic acid (Sigma Aldrich), 1% penicillin-streptomycin-glutamine (Thermo Fisher Scientific), 2% retinoic acid-free B-27 (Thermo Fisher Scientific), 20 ng / ml epidermal growth factor (EGF) (Prospec Bio), 20 ng / ml fibroblast growth factor 2 (FGF2) (Prospec Bio), 2 µg / ml heparin (Sigma Aldrich), 1% N-2 supplement (Thermo Fisher Scientific), 5 µM Gö6983 (Abcam), 10 µM Y27632 (Abcam), and 10 µM retinoic acid (Sigma Aldrich). Cells were passaged on day 7 of reprogramming, and activin A (25 ng / mL; Prospec Bio) was added to the reprogramming medium from day 7 to day 14 of reprogramming (Figure 1).
[0291] After day 14 of reprogramming, hiLGEP cells were collected for transplantation into the striatum of rats with quinolinic acid (QA) damage, a well-established model of Huntington's disease in the art.
[0292] On day 14 of reprogramming, hiLGEP cells were collected for transplantation, or subjected to RT-qPCR and immunocytochemistry to confirm their LGEP cell fate. Another group of cells was seeded at a density of 60,000 cells / well on GelTrex-coated glass coverslips (page 22 / 30, CN 121368632 A) for differentiation. The cells were prepared on an NBA- or BrainPhysic-based formulation containing 1% penicillin-streptomycin-glutamine, 2% B-27 supplement (without retinoic acid), 1% N-2 supplement, 10µM Y-27632, 10µM leucovorin (Sigma Aldrich), and 30ng / mL BDNF (PeproTech).Cells were cultured in striatal differentiation medium containing 1 µM dorsomorphin (Sigma Aldrich) for the first 5 days (with or without 5 µM Gö6983) and 25 ng / mL activin A for the first 7 days. After 14 days of differentiation, cells were fixed with 4% paraformaldehyde at 4°C and subjected to immunocytochemical treatment.
[0293] Quantitative RT-PCR
[0294] Total RNA was extracted from hiLGEP and original aHDF cell lines reprogrammed for 14 days using the Nucleospin RNA kit (Macherey Nagel). cDNA was synthesized from total RNA using Superscript IV reverse transcriptase (Thermo Fisher Scientific). Duplex qPCR was performed using the TaqMan system (Applied Biosystems), with internal control ribosomal 18S rRNA as the standard. Each reaction was equivalent to 4-10 ng of RNA, with three replicates. Gene expression was normalized to the internal control ribosomal 18S rRNA standard. Gene expression was expressed as a fold change relative to aHDF using the ΔΔCt method.
[0295] Immunocytochemistry
[0296] Cells were first permeabilized in phosphate-buffered saline containing 0.5% Triton X-100 for 5 min. The following human-specific primary antibodies were used: GSX2 (1:500, Abcam), FOXP1 (1:100, R&D), FOXP2 (1:500, Abcam), MEIS2 (1:500, Abcam), TUJ1 (1:500, Abcam), DARPP32 (1:500, Invitrogen), GABA (1:500, Invitrogen), and GAD65 / 67 (1:500, AbCam). The primary antibodies were visualized using a species-matched Alexa Fluor™ labeled secondary antibody (1:500; Invitrogen). Single cell nuclei were confirmed using DAPI included in Prolong Diamond anti-quenching mounting media (Thermo Fisher Scientific). Images were acquired using an inverted Nikon TE2000E fluorescence microscope equipped with a DS-Ri2 camera. The number of hiLGEP-derived neurons of TUJ1+ or DARPP32+ was manually quantified in ImageJ software, expressed as the proportion of DAPI+ cells in at least 500 DAPI+ cells.
[0297] Live-cell calcium imaging
[0298] hiLGEP cells were seeded at a density of 80,000 cells / well on GelTrex-coated Greiner black-walled glass plates for differentiation and cultured for 14 days in the above-mentioned BrainPhys™-based striatal differentiation medium. Cells were loaded with 5 mM Cal-520.Cal-520 AM (Abcam) was incubated with 0.04% Pluronic F-127 (Thermo Fisher Scientific) at 37°C for 1 hour, followed by incubation at room temperature for 30 minutes. The Cal-520 AM working solution was replaced with a phenol red-free Hank's balanced salt buffer (Thermo Fisher Scientific) containing 1 mM probenecid and 20 mM 4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid (HEPES; Thermo Fisher Scientific). Cells were imaged at Ex / Em = 420 / 525 nm, and Cal-520 AM fluorescence intensity was recorded for a total of 180 seconds, with or without 12.5, 25, and 50 µM glutamate treatment. Time-lapse recordings were acquired using a Nikon TE2000E inverted microscope equipped with a color DS-Ri2 camera and NIS Elements BR software. Live-cell calcium imaging analysis was performed using the time-series analysis plugin in FIJI software. The average fluorescence intensity values of 100 regions of interest were recorded from two replicate experiments. Fluorescence was measured as the percentage increase in mean fluorescence intensity relative to baseline fluorescence at time 0 (DF / F0).
[0299] Animals
[0300] Adult male Sprague-Dawley rats (Vernon Jansen Unit, University of Auckland), weighing 250 to 350 g (8 weeks old), were used in cases of quinolinic acid (QA) injury. All procedures were strictly in accordance with the University of Auckland Animal Ethics Guidelines, the New Zealand Animal Welfare Act 1999, and international ethical guidelines. Every effort was made to minimize the number of animals used and their suffering. Rats were randomly assigned to the following treatment groups: hiLGEP transplant group, n=15; sham transplant group (0.9% sterile saline), n=15. Rats were housed in groups in a temperature and humidity controlled room with a 12-hour light-dark cycle. Food and water were available freely throughout the study. Forty-eight hours prior to transplantation, all rats received an intraperitoneal injection of Sandimmun (20 mg / kg cyclosporine; provided by Vernon Jansen Unit, University of Auckland). Following the transplant surgery, the rats were injected with 26 CN 121368632 A via injection three times a week for the entire experimental period.
[0301] Surgical Procedure
[0302] All surgeries were performed under isoflurane anesthesia (induction: 5% isoflurane, O2 flow rate 2 L / min; maintenance: 1.5% isoflurane, O2 flow rate 1.5 L / min). All rats received unilateral striatal infusion of QA (50 nmol, 400 nmol; flow rate 100 nmol / min, using a 32G device controlled by WPI UltraMicroPump II).Hamilton syringe), stereotactic coordinates are as follows: relative to the anterior fontanelle, anterior-posterior (AP) +0.5 mm, middle-lateral (ML) -2.7 mm, and dorsal-ventral (DV) distance from the dura mater surface -5.0 mm (Vazey and Connor, 2010; Vazey et al., 2006; Vazey et al., 2010). Twenty-one days after QA injury, hiLGEP (approximately 250,000 live cells per animal) or 0.9% sterile saline was injected into two adjacent sites of the injured striatum (approximately 62,500 live cells / µl: 2µl per injection site; flow rate 400 nl / min, using a 26G Hamilton syringe), with stereotactic coordinates as follows: +0.3 mm AP, -2.5 mm ML, at -5.0 and -4.0 mm DV (Vazey and Connor, 2010; Vazey et al., 2006; Vazey et al., 2010).
[0303] Spontaneous exploration of forelimb use
[0304] Rats were placed in an plexiglass cylinder (20 cm in diameter) and their behavior was video-recorded for 5 minutes. Baseline test data of motor function were obtained before QA injury. Motor function was also assessed 2 weeks after QA injury. After transplantation, rats were assessed at 2, 4, 12, and 14 weeks post-transplantation. Spontaneous exploratory forelimb use was scored using the forelimb asymmetric analysis method (Schallert et al., 2000) in slow-motion playback of video sessions by experimenters unaware of the animals' condition. Forelimb use was assessed with an asymmetric score representing the overall use of the ipsilateral forelimb for standing, wall-mounting, and landing during exploratory standing within a 5-minute test period (Vazey and Connor, 2010; Vazey et al., 2006). Rats that did not respond to QA impairment by predominantly using the contralateral forelimb were excluded from all analyses.
[0305] Immunohistochemical analysis
[0306] At 14 weeks post-transplantation, rats were euthanized with sodium pentobarbital (120 mg / kg, intraperitoneal injection) and then cardiac perfusion with 0.9% saline and 4% paraformaldehyde. Brain tissue was cryoprotected in 30% sucrose and then coronally sectioned to a thickness of 40 µm using an HM450 sliding microtome (Microm International GmbH, Walddorf, Germany). Eight sets of sections were collected from each brain (with a 320 µm spacing between consecutive sections in each set) and stored at -20°C.
[0307] Free coronal sections from each animal were subjected to fluorescence immunohistochemical analysis using spectrophotometers targeting STEM121 (1:500, Takara), TUJ1 (1:500, Biolegend), and MAP2 (1:500, Sigma).Antibodies were prepared using Aldrich, DARPP32 (1:500, Invitrogen), GAD65 / 67 (1:500, AbCam), and GABA (1:500, Invitrogen). Primary antibodies were visualized using species-matched Alexa Fluor™-labeled secondary antibodies (1:500; Invitrogen). Individual cell nuclei were confirmed using DAPI (1:1000, Thermo Fisher Scientific). Imaging was performed on a Nikon TE2000E inverted microscope equipped with a Nikon DS-Ri2 camera (Nikon) or a Zeiss LSM 710 inverted confocal scanning laser microscope (Biomedical Imaging Resources, University of Auckland).
[0308] Statistical Analysis
[0309] Statistical analysis was performed using IBM SPSS Statistics v28 (IBM). Levene's test was performed on all data. One-way or two-way ANOVA was used to compare culture medium components and / or cell lines. Post-hoc analysis was performed using the Bonferroni test. A two-way mixed ANOVA (followed by simple main effects analysis with Bonferroni correction) was used to compare spontaneous exploration of forelimb use in hiLGEP transplanted animals and sham-operated animals over time. All data are expressed as mean ± SEM. A p-value < 0.05 was considered statistically significant.
[0310] Results Description 24 / 30 pages 27 CN 121368632 A
[0311] Adult dermal fibroblasts can be directly reprogrammed into the lateral ganglion elevation phenotype.
[0312] Figure 1 shows the direct reprogramming and differentiation scheme disclosed herein, which promotes the generation of neural progenitor cells with the hiLGEP phenotype and enhances their differentiation into medium-sized multispinous striatum neurons (MSN).
[0313] In the examples provided herein, the inventors investigated the effects of adding the following components to a standard NBA-based reprogramming medium: a broad-spectrum protein kinase C inhibitor Gö6983 (5 µM), a p160ROCK inhibitor Y27632 (10 µM), 1% N-2 supplement (combination abbreviation GYN), and 10 µM retinoic acid. This standard NBA-based reprogramming medium contained 1 mM valproic acid, 1% penicillin-streptomycin-glutamine, 2% retinoic acid-free B-27, 20 ng / ml EGF, 20 ng / ml FGF2, and 2 µg / ml heparin. Most importantly, the inventors added activator A (25 ng / ml) to the medium 7 days after reprogramming. 14 days after reprogramming, [the following was observed].The inventors observed that, compared with NBA medium alone, the addition of activin A (with or without GYN) had little effect on the expression of striatal transcription factors GSX2 or DLX2 (Fig. 2A). In contrast, NBA medium with activin A added upregulated the expression of the lateral ganglion eminence (LGE) selective gene CTIP2, and further addition of GYN further upregulated CTIP2 expression (Fig. 2A).
[0314] The inventors then compared the effects of the basal medium BrainPhys™ and NBA on hiLGEP gene expression 14 days after reprogramming (Fig. 2B). 14 days after reprogramming, no upregulation of CTIP2 was observed in cells reprogrammed in BrainPhys™ with only activin A added. However, when BrainPhys™ was supplemented with both GYN and activin A, a significant upregulation of CTIP2 was observed (Fig. 2B). In summary, these results indicate that activin A, in combination with Gö6983, Y27632, and N-2, can promote the expression of the key LGEP gene CTIP2.
[0315] To confirm the ability of BrainPhys™ supplemented with GYN and activin A to induce LGE transcription factor expression, the inventors collected cells 14 days after reprogramming with SOX2 / PAX6 cmRNA and assessed their gene and protein expression. 14 days after reprogramming, the inventors observed extensive colony formation (Fig. 2C), and the expression of the pro-neurotropic factor NESTIN and LGE transcription factors DLX2, FOXP2, and CTIP2 was upregulated compared to the original aHDF (Fig. 2D). The inventors did not observe any change in the expression of the glutamatergic neurotrophic factor NGN2 (Colasante et al., 2019). At the protein level, the reprogrammed cells expressed GSX2, FOXP1, FOXP2, and MEIS2 (Fig. 2E-H). Not wanting to be bound by theory, the inventors believe that the above findings support the following claim: BrainPhys™ medium supplemented with GYN and activin A can promote the induction of LGE precursor fate.
[0316] Directly reprogrammed human lateral ganglion eminence precursors differentiated into functional DARPP32 positive neurons in vitro.
[0317] To ensure optimal differentiation of hiLGEP into MSN fate, the inventors compared the effects of NBA and BrainPhys™ mediums on neuronal differentiation. The addition of activin A 7 days before differentiation was also investigated to enhance striatal differentiation (Figure 1). hiLGEP reprogrammed in NBA medium subsequently differentiated in NBA, while hiLGEP reprogrammed in BrainPhys™ medium differentiated in BrainPhys™. It was observed that when differentiating hiLGEP in NBA-based striatal differentiation medium containing activin A, regardless of the reprogramming scheme, the percentage of TUJ1 / DAPI positive cells ranged from 1.2% ± 0.33% to 14.33% ± 3.0.4% (Figure 3A). In contrast, hiLGEP cells reprogrammed in BrainPhys™ supplemented with GYN and activin A and differentiated in BrainPhys™-based striatal differentiation medium containing activin A showed a significantly higher proportion of TUJ1-positive cells to the total DAPI+ cell population, reaching 63.8% ± 4.59%, while hiLGEP cells reprogrammed only in BrainPhys™ and activin A showed only 9.4% ± 1.74% TUJ1 / DAPI-positive cells (Figure 3A). Similarly, after differentiation in standard striatal differentiation medium based on NBA, the number of DARPP32-positive cells was extremely low (0.15% ± 1.15% to 10.76% ± 2.2%; Figure 3B). However, hiLGEP cells reprogrammed in BrainPhys™ supplemented with GYN and activin A, and differentiated in BrainPhys™-based striatal differentiation medium containing activin A, showed a DARPP32 expression rate of 42.45% ± 2.72% in the total DAPI+ cell population, while hiLGEP cells reprogrammed solely in BrainPhys™ and activin A showed a DARPP32 / DAPI positive rate of only 3.77% ± 0.95% (Fig. 3B, Fig. 4A, B, C). Further validation of the effect of using GYN alone or in combination with activin A on reprogramming is shown in Fig. 3D and E. These findings confirm that reprogramming aHDF cells transfected with SOX2 / PAX6 cmRNA in BrainPhys™ supplemented with GYN and activin A promotes the induction of hiLGEP, and differentiation of hiLGEP in BrainPhys™ culture medium supplemented with activin A enhances the generation of DARPP32 positive neurons.
[0318] Finally, the inventors investigated whether supplementing with the AMP-activated kinase inhibitor dorsomorphin for 5 days before differentiation, or supplementing with the broad-spectrum protein kinase C inhibitor Gö6983 for 5 days before differentiation and then supplementing with dorsomorphin for the next 5 days, could further enhance the generation of DARPP32 positive neurons. The effects of dorsomorphin alone or in combination with Gö6983 in two independent cell lines (2116 and 1507) were compared to evaluate the stability and consistency of DARPP32 positive neuron production. Interestingly, compared to standard BrainPhys™-based striatal differentiation medium, the addition of dorsomorphin (with or without Gö6983) did not significantly alter the proportion of DARPP32-positive neurons (Figure 3C). A significant interaction existed between differentiation conditions and cell lines (two-way mixed ANOVA; p=0.001), indicating that the effect of different culture medium conditions on DARPP32 yield varied depending on the cell line.Although for the 2116 cell line, supplementing the striatal differentiation medium with Gö6983 and dorsomorphin significantly increased the number of DARPP32-positive cells compared to dorsomorphin supplementation alone (p=0.007; Figure 3C), further post-hoc analysis determined that the BrainPhys™-based striatal differentiation medium supplemented with dorsomorphin alone produced the most consistent yield of DARPP32-positive cells across cell lines (striatal differentiation + dorsomorphin, 2116 vs. 1507, p=0.088; striatal differentiation only, 2116 vs. 1507, p=0.0008; striatal differentiation + Gö6983 + dorsomorphin, 2116 vs. 1507, p=0.0003). Based on these findings, the inventors selected a BrainPhys™-based striatal differentiation medium supplemented with dorsomorphin for 5 days before differentiation and activin A for 7 days before differentiation.
[0319] Using these culture conditions, the inventors successfully generated TUJ1+ neurons co-expressing DARPP32, as well as GABA-positive and GAD65 / 67-positive neurons, which exhibited extensive neurite growth and network formation (Figs. 4A-E). The function of hiLGEP-derived neurons was confirmed by live-cell calcium imaging (video data not shown; representative data are shown in snapshots 4F and G). Cultures were loaded with the fluorescence-based calcium indicator Cal-520 and exposed to 0, 12.5, 25, or 50 µM glutamate. Cal-520 fluorescence was measured as a percentage increase in mean fluorescence intensity relative to baseline at time 0. hiLGEP-derived neurons showed enhanced Cal-520 fluorescence with increasing glutamate concentration, with the highest mean intensity at 25 µM glutamate, peaking 90 seconds after glutamate administration, followed by a decrease in mean intensity of -300% to -750% from baseline over 95–100 seconds (Fig. 4F).
[0320] Transplantation of directly reprogrammed human lateral ganglion eminence anterior body can reduce spontaneous exploration forelimb use disorder.
[0321] The spontaneous exploration forelimb use test is a non-pharmacologically induced forelimb motor function test that relies on the integrity of intrinsic striatal neurons, the substantia nigra-striatal dopamine system, and the sensorimotor cortex. Following unilateral striatal injury, rats preferentially use the ipsilateral forelimb to initiate and terminate weight transfer movements when standing and exploring vertical surfaces (Vazey and Connor, 2010; Vazey et al., 2006). Using the spontaneous exploration forelimb use test, the inventors investigated the effects of hiLGEP transplantation into the QA-damaged striatum on forelimb motor function at 2, 4, 12, and 14 weeks post-transplantation (Figure 5A).
[0322] Two-way mixed ANOVA and subsequent simple main effects analysis showed a significant interaction between time and treatment.Interactions (F=2.83, degrees of freedom=5, p=0.043). Following QA injury, both treatments showed a significant preference for ipsilateral forelimb use compared to baseline (saline treatment, p=0.017; hiLGEP treatment, p=0.027, Fig. 5B). Animals receiving saline treatment continued to show a preference for ipsilateral forelimb use over time (2 weeks post-transplantation, p=0.008; 12 weeks post-transplantation, p=0.036; 14 weeks post-transplantation, p=0.026; Fig. 5B). In contrast, hiLGEP-transplanted animals only showed a significant preference for ipsilateral forelimb use compared to baseline at 2 weeks post-transplantation (p=0.04; Fig. 5B). Extending this observation, compared to QA injury, hiLGEP-transplanted animals showed a significant reduction in ipsilateral forelimb use at 14 weeks post-transplantation (p=0.027; Fig. 5B). These results indicate that striatal transplantation of hiLGEP can alleviate spontaneous forelimb exploration impairment caused by striatal QA injury.
[0323] Human induced lateral ganglion protuberances survived and differentiated into medium-sized polyspinous striatal neurons after transplantation into the QA-injured striatum.
[0324] The inventors also investigated the ability of hiLGEP, which was directly reprogrammed with SOX2 / PAX6 cmRNA, to survive and differentiate into medium-sized polyspinous striatal neurons (MSNs) in a HD rat QA injury model after transplantation. HiLGEP-derived neurons were identified in the striatum of QA-injured rats by expressing the human cytoplasmic marker STEM121 (14 weeks post-transplantation; Fig. 6A). STEM121-positive cells were detected within the defined boundaries of the anterior striatum of hiLGEP-transplanted animals at 14 weeks post-transplantation (Fig. 6A). STEM121-positive cells were not detected in animals that received sterile saline injections. STEM121-positive cells exhibited a unique neuronal morphology, with extensive neurite growth observed 14 weeks post-transplantation (Fig. 6A and A'). The inventors did not observe STEM121-positive cells exhibiting astrocyte morphology, and STEM121 was not co-expressed with GFAP (data not shown).
[0325] To determine the final phenotype of hiLGEP-derived neurons 14 weeks post-transplantation into the QA-damaged striatum, a dual-label immunofluorescence analysis targeting STEM121 and cell type-specific markers was performed.
[0326] At 14 weeks post-transplantation, STEM121-positive cells co-expressed MAP2 (Fig. 6B1 and Fig. 6B2), and most STEM121-positive cells co-expressed DARPP32 (Fig. 6C1 and Fig. 6C2). Some STEM121-positive cells also expressed GABA (Fig. 6E1 and Fig. 6E2), and a small number of STEM121-positive cells co-expressed the enzymes GAD65 / 67 (Fig. 6D1 and Fig. 6D2). We also observed astrocytes.GABA-positive / STEM121-negative cells with cytomorphic morphology (Fig. 6E1 and Fig. 6E2). Astrocytes have been shown to synthesize and take up GABA through multiple pathways (Ishibashi et al., 2019; Jo et al., 2014). The lack of STEM121 co-expression suggests that these astrocytes are generated in response to QA injury in the host rat brain. Furthermore, this observation, combined with the lack of co-expression of STEM121 and GFAP, demonstrates that transplanted hiLGEP does not generate astrocytes after transplantation.
[0327] These results indicate that hiLGEP generated by direct reprogramming of SOX2 / PAX6 cmRNA survives and differentiates into medium-sized polyspinous striatal neurons (MSNs) after transplantation into the striatum of QA-injured rats.
[0328] Discussion – Conclusion
[0329] The results of this study demonstrate that aHDF can be directly reprogrammed into hiLGEP in BrainPhys™-based reprogramming medium via transient cmRNA-mediated overexpression of SOX2 and PAX6, and exposure to activin A, Gö6983, Y27632, and N-2. This study also demonstrates for the first time that transplanting directly reprogrammed hiLGEP into the striatum of rats with QA-damaged brains (a recognized animal model of neurodegenerative diseases in the art, specifically Huntington's disease) generates high yields of medium-sized multispinous striatal neurons (MSNs). Furthermore, compared to saline-treated animals, transplanting hiLGEP into the striatum of QA-damaged brains significantly reduced motor dysfunction as measured by spontaneous exploration of forelimb use. Not wanting to be bound by theory, the inventors believe that these findings provide an effective and clinically feasible strategy for cell replacement therapy in the treatment of neurodegenerative diseases, particularly Huntington's disease, using directly reprogrammed hiLGEP via cmRNA.
[0330] 7. Industrial Applicability
[0331] This invention can be used to reprogram HDF into neural progenitor cells, with applications in research and medicine. Those skilled in the art should understand that the above description is merely illustrative and the invention is not limited thereto.
[0332] 8. References
[0333] An, M. C., Zhang, N., Scott, G., Montoro, D., Wittkop, T., Mooney, S., Melov, S. and Ellerby, LM (2012). Genetic correction of Huntington's disease phenotype in induced pluripotent stem cells. Cell Stem Cell, 11(2), 253-263.
[0334] Arber, C., Precious, S. V., Cambray, S., Risner-Janiczek, J. R., Kelly,C., Noakes, Z., Fjodorova, M., Heuer, A., Ungless, MA, Rodriguez, TA, Rosser, AE, Dunnett, SB and Li, M. (2015). Activin A guides the differentiation of striatal projection neurons from human pluripotent stem cells. Development, 142(7), 1375-1386. Instructions 27 / 30 pages 30 CN 121368632 A
[0335] Aubry, L., Bugi, A., Lefort, N., Rousseau, F., Peschanski, M. and Perrier, AL (2008). Striatal progenitor cells derived from human embryonic stem cells mature into DARPP32 neurons in vitro and in quinolinate-induced rats. Proceedings of the National Academy of Sciences, 105, 16707–16712.
[0336] Caron, N., Wright, G. and Hayden, M. (1998). Huntington's disease. M. Adam, D. Everman and G. Mirzaa et al. (eds.), GeneReviews® [Internet]. https: / / www.ncbi.nlm.nih.gov / books / NBK1305 /
[0337] Colasante, G., Rubio, A., Massimino, L. and Broccoli, V. (2019). Direct neuronal reprogramming reveals unknown functions of known transcription factors [Review]. Frontiers in Neuroscience, 13. doi.org / 10.3389 / fnins.2019.00283
[0338] Connor, B. (2018). Brief review: Stem cells for understanding and treating Huntington's disease. STEM CELLS, 36 (2), 146-160. doi.org / 10.1002 / stem.2747
[0339] Connor, B., Firmin, E., McCaughey-Chapman, A., Monk, R., Lee, K., Liot, S., Geiger, J., Rudolph, C. and Jones, K.(2018). Transformation of adult fibroblasts into neural progenitor cells using chemically modified mRNA. Heliyon, 4 (11), e00918. doi.org / 10.1016 / j.heliyon.2018.e00918
[0340] Delli Carri, A., Onorati, M., Castiglioni, V., Faedo, A., Camnasio, S., Toselli, M., Biella, G. and Cattaneo, E. (2013). Differentiation of human pluripotent stem cells into true striatal projection neurons. Stem Cell Rev, 9(4), 461-474. doi.org / 10.1007 / s12015-013-9441-8
[0341] Dunnett, SB, Nathwani, F. and Björklund, A. (2000). Chapter 16 Integration and function of striatal grafts. Prog Brain Res (Vol. 127, pp. 345–380). Elsevier. doi.org / 10.1016 / S0079-6123(00)27017-9
[0342] Faedo, A., Laporta, A., Segnali, A., Galimberti, M., Besusso, D., Cesana, E., Belloli, S., Moresco, R. M., Tropiano, M., Fuca, E., Wild, S., Bosio, A., Vercelli, AE, Biella, G. and Cattaneo, E. (2017). Induction of Gsx2 expression Ebf1 induces differentiation of human telogen progenitor cells into MSNs. Proc Natl Acad Sci USA, 114 (7), E1234–E1242. doi.org / 10.1073 / pnas.1611473114
[0343] González, F., Boué, S. and Belmonte, JCI (2011). Preparation of induced pluripotent stem cells: reprogramming [10.1038 / nrg2937]. Nat Rev Genet, 12 (4), 231–242. doi.org / http: / / www.nature.com / nrg / journal / v12 / n4 / suppinfo / nrg2937_S1.html
[0344] Ishibashi, M., Egawa, K. and Fukuda, A. (2019). Multiple roles of astrocytes in GABAergic signal transduction. International Journal of Molecular Sciences, 20(12), 2964. doi.org / 10.3390 / ijms20122964
[0345] Jeon, I., Lee, N., Li, J.-Y., Park, I.-H., Park, K. S., Moon, J., Shim, SH, Choi, C., Chang, D.-J., Kwon, J., Oh, S.-H., Shin, DA, Kim, HS, Do, JT, Lee, DR, Kim, M., Kang, K.-S., Daley, GQ, Brundin, P. and Song, J. (2012). Neuronal characteristics, in vivo effects and pathology of induced pluripotent stem cells derived from patients with Huntington's disease. STEM CELLS, 30(9), 2054-2062. doi.org / 10.1002 / stem.1135 (Instructions 28 / 30 pages 31 CN 121368632 A
[0346] Jo, S., Yarishkin, O., Hwang, Y. J., Chun, YE, Park, M., Woo, DH, Bae, J. Y., Kim, T., Lee, J., Chun, H., Park, H. J., Lee, DY, Hong, J., Kim, HY, Oh, S.-J., Park, SJ, Lee, H., Yoon, B.-E., Kim, Y., . . . Lee , C . J . (2014). GABA-damaged memory in a mouse model of Alzheimer's disease in reactive astrocytes. Nature Medicine, 20(8), 886-896. doi.org / 10.1038 / nm.3639
[0347] Joannides , A. J .,Webber, D. J., Raineteau, O., Kelly, C., Irvine, K.-A., Watts, C., Rosser, AE, Kemp, PJ, Blakemore, WF, Compston, A., Caldwell, MA, Allen, ND and Chandran, S. (2007). Environmental signals regulate lineage selection and temporal maturation of neural stem cells derived from human embryonic stem cells. Brain, 130(5), 1263-1275. http: / / brain.oxfordjournals.org / cgi / content / abstract / 130 / 5 / 1263.
[0348] Kendall, AL, Rayment, FD, Torres, EM, Baker, HF, Ridley, RM and Dunnett, SB (1998). Functional integration of striatal allogeneic transplantation in a primate model of Huntington's disease. Nature Medicine, 4, 727-729.
[0349] Nicoleau, C., Varela, C., Bonnefond, C., Maury, Y., Bugi, A., Aubry, L., Viegas, P., Bourgois-Rocha, F., Peschanski, M. and Perrier, AL (2013). Embryonic stem cell neural differentiation enables Wnt / β-catenin signaling to play a role in the canonicalization and regionalization of the human distal brain. STEM CELLS, 31(9), 1763-1774. doi.org / 10.1002 / stem.1462
[0350] Palfi, S., Conde, F., Riche, D., Brouillet, E., Dautry, C., Mittoux, V., Chibois, A., Peschanski, M. and Hantraye, P. (1998). Reversal of cognitive deficits in a primate model of Huntington's disease by fetal striatal allogeneic transplantation. Nature Medicine, 4, 963-966.
[0351] Reidling, JC, Relaño-Ginés, A., Holley, SM, Ochaba, J., Moore,C., Fury, B., Lau, A., Tran, AH, Yeung, S., Salamati, D., Zhu, C., Hatami, A., Cepeda, C., Barry, J. A., Kamdjou, T., King, A., Coleal-Bergum, D., Franich, NR, Laferla, FM, ... Thompson, LM (2018). Human neural stem cell transplantation repairs functional defects in R6 / 2 and Q140 Huntington's disease mice. Stem Cell Reports, 10 (1), 58-72. doi.org / 10.1016 / j.stemcr.2017.11.005
[0352] Rosser, AE and Bachoud-Levi, AC (2012). Clinical trials of neural transplantation for Huntington's disease. Prog Brain Res, 200, 345-371. doi.org / 10.1016 / b978-0-444-59575-1.00016-8
[0353] Schallert, T., Fleming, S. M., Leasure, J. L., Tillerson, J. L. and Bland, ST (2000). Assessment of CNS plasticity and forelimb sensorimotor outcomes in rat models of unilateral stroke, cortical ablation, Parkinson's disease and spinal cord injury. Neuropharmacology, 39, 777-787.
[0354] Song, J., Lee, S.-T., Kang, W., Park, J.-E., Chu, K., Lee, S.-e., Hwang, T., Chung, H. and Kim, M. (2007). Transplantation of human embryonic stem cell-derived neural progenitors attenuates rotational behavior in rats with amorphine-induced unilateral quinolinate injury. Neuroscience Letters, 423(1), 58-61.
[0355] Vazey, E. and Connor, B. (2010). Differential fate and functional outcomes of lithium chloride-induced adult neural progenitor cell transplantation in a rat model of Huntington's disease. Stem Cell Res Ther, 1(5), 41.
[0356] Vazey, EM, Chen,K., Hughes, SM and Connor, B. (2006). Survival, differentiation and reduced motor function impairment of transplanted adult neural progenitor cells in a rodent model of Huntington's disease. Experimental Neurology, 199(2), 384-396. Instructions 29 / 30 pages 32 CN 121368632 A
[0357] Vazey, E. M., Dottori, M., Jamshidi, P., Tomas, D., Pera, M. F., Horne, M. and Connor, B. (2010). Comparison of transplantation efficiency of spontaneously derived and Noggin-preinduced human embryonic stem cell neural progenitor cells in a rat model of quinolinic acid Huntington's disease. Cell Transplant, 19, 1055-1062.
[0358] Vonsattel, J. P., Myers, R. H., Stevens, T. J., Ferrante, R. J., Bird, ED, and Richardson, EP J. (1985). Neuropathological classification of Huntington's disease. Journal of Neuropathology and Experimental Neurology, 44, 559-577. (The remaining text appears to be a list of product labels and related information, which are not translated as they are not part of the main text.) Instruction manual, Figure 5 (continued), page 6 / 16, page 39, CN 121368632 A; Figure 5 (continued), page 7 / 16, page 40, CN 121368632 A; Figure 5 (continued), page 8 / 16, page 41, CN 121368632 A; Figure 6 (continued), page 9 / 16, page 42, CN 121368632 A; Figure 6 (continued), page 10 / 16, page 43, CN 121368632 A; DescriptionIllustrations: Page 11 / 16, Figure 7A (CN 121368632 A); Page 12 / 16, Figure 7B (CN 121368632 A); Page 13 / 16, Figure 7C (CN 121368632 A); Page 14 / 16, Figure 7D (CN 121368632 A); Page 15 / 16, Figure 7F (CN 121368632 A); Page 16 / 16, Figure 49 (CN 121368632 A).
Claims
1. A composition comprising: a basal brain medium, and at least two active agents selected from the group consisting of Activin A (ActA), a protein kinase C (PKC) inhibitor, a pi 60 ROCK inhibitor, and an N-2 supplement.
2. The composition of claim 1, comprising: a basal brain medium, and at least three active agents selected from the group consisting of Activin A (ActA), a protein kinase C (PKC) inhibitor, a pi 60 ROCK inhibitor, and an N-2 supplement.
3. The composition of claim 1 or claim 2, comprising: a basal brain medium, and all four active agents of Activin A (ActA), a protein kinase C (PKC) inhibitor, a pi 60 ROCK inhibitor, and an N-2 supplement.
4. The composition according to any one of claims 1 to 3, wherein, the PKC inhibitor is selected from the group consisting of Gö6983, enzalutamide, staurosporine, GF 109203X, Go6976, Ro 31-8220 methanesulfonate, Ro 32-0432 hydrochloride, sorbitol, and K252a, preferably the PKC inhibitor is Gö6983.
5. The composition according to any one of claims 1 to 4, wherein, the pi 60 ROCK inhibitor is selected from the group consisting of Y27632, thiazovivin, HA 1100 hydrochloride, and GSK429286A, preferably the pi 60 ROCK inhibitor is Y27632.
6. A method of making human induced lateral ganglionic eminence precursor cells (hiLGEPs), comprising: a) reprogramming human fibroblasts (HFs) to hiLGEPs, comprising: a. with SOX2 cmRNA and PAX6 cmRNA transfection of HFs; b. culturing the transfected HFs in a composition comprising: a basal brain medium, and at least two active agents selected from the group consisting of a protein kinase C (PKC) inhibitor, a pi 60 ROCK inhibitor, and an N-2 supplement; c. passaging the HFs in b. in a composition comprising: a basal brain medium, and at least three active agents selected from the group consisting of a protein kinase C (PKC) inhibitor, a pi 60 ROCK inhibitor, an N-2 supplement, and Activin A (ActA); and d. culturing the passaged HFs.
7. The method of claim 6, wherein, The SOX2 The cmRNA comprises SEQ ID NO:
1.
8. The method of claim 6 or claim 7, wherein, The PAX6 The cmRNA comprises SEQ ID NO:
2.
9. The method of any one of claims 6 to 8, wherein the composition in b. comprises a basal brain medium and all three active agents of a protein kinase (PKC) inhibitor, a pi 60 ROCK inhibitor, and an N-2 supplement.
10. The method of any one of claims 6-9, wherein, the composition in c. comprises a basal brain medium and all four active agents of a protein kinase (PKC) inhibitor, a pi 60 ROCK inhibitor, an N-2 supplement, and Activin A (ActA).
11. The method of any one of claims 6 to 10, wherein, the PKC inhibitor in b. and / or c. is selected from the group consisting of Gö6983, enzalutamide, staurosporine, GF 109203X, Go6976, Ro 31-8220 methanesulfonate, Ro 32-0432 hydrochloride, sorbitol, and K252a, preferably wherein the PKC inhibitor is Gö6983.
12. The method of any one of claims 6-11, wherein, The p160ROCK inhibitor in b. and / or c. is selected from the group consisting of Y27632, thiazovivin, HA 1100 hydrochloride and GSK429286A, preferably wherein the p160ROCK inhibitor is Y27632.
13. The method of any one of claims 6 to 12, wherein, The HF is a human dermal fibroblast (HDF).
14. The method of any one of claims 6-12, wherein, The HF is an adult human fibroblast (aHF), preferably an adult human dermal fibroblast (aHDF).
15. A kit comprising: i. a composition comprising: basal brain medium, and at least two active agents selected from the group consisting of a protein kinase C (PKC) inhibitor, a pl60ROCK inhibitor and an N-2 supplement; and ii. a composition comprising: basal brain medium, and at least three active agents selected from the group consisting of a protein kinase C (PKC) inhibitor, a pl60ROCK inhibitor, an N-2 supplement and an Activin A (ActA).
16. The kit of claim 15, wherein, The composition in i. comprises all three active agents, which are a protein kinase (PKC) inhibitor, a pl60ROCK inhibitor and an N-2 supplement.
17. The kit of claim 15 or claim 16, wherein, The composition in ii. comprises all four active agents, which are a protein kinase (PKC) inhibitor, a pl60ROCK inhibitor, an N-2 supplement and an Activin A (ActA).
18. The kit of any one of claims 15 to 17, wherein, The PKC inhibitor in i. and / or ii. is selected from the group consisting of Gö6983, enzalutamide, staurosporine, GF 109203X, Go6976, Ro 31-8220 methanesulfonate, Ro 32-0432 hydrochloride, sorbitol and K252a, preferably wherein the PKC inhibitor is Gö6983.
19. The kit of any one of claims 15 to 18, wherein, The pl60ROCK inhibitor in i. and / or ii. is selected from the group consisting of Y27632, thiazovivin, HA 1100 hydrochloride and GSK429286A, preferably wherein the pl60ROCK inhibitor is Y27632.
20. A human induced lateral ganglionic eminence precursor cell (hiLGEP).
21. The hiLGEP of claim 20, prepared by the method of any one of claims 6 to 14.
22. A pharmaceutical composition comprising at least one hiLGEP according to claim 20 or claim 21.
23. Use of a composition as defined in any one of claims 1 to 5 in promoting the induction of fibroblast cells into a lateral ganglionic eminence (LGE) precursor fate, preferably wherein the fibroblast cells are human fibroblast cells, human dermal fibroblast cells, adult human fibroblast cells or adult human dermal fibroblast cells.
24. Use of a composition comprising human induced lateral ganglionic eminence precursor cells (hiLGEPs) and a carrier in the treatment of Huntington’s disease.
25. Use of a human induced lateral ganglionic eminence precursor cell (hiLGEP) in the manufacture of a medicament for the treatment of Huntington’s disease.
26. A method of treating Huntington’s disease, the method comprising transplanting human induced lateral ganglionic eminence progenitor cells (hiLGEPs) into the striatum of a subject having or suspected of having Huntington’s disease.
27. The use of any one of claims 23 to 25, or the method of claim 24, wherein, The hiLGEPs are reprogrammed from fibroblasts, preferably human fibroblasts, human dermal fibroblasts, or adult human dermal fibroblasts.
28. The use of any one of claims 23 to 25, or the method of claim 24, wherein, The hiLGEPs are as defined in claim 21.
29. Use of a composition according to any one of claims 1 to 5 or a kit according to any one of claims 15 to 19 for reprogramming fibroblasts into hiLGEPs, preferably wherein the fibroblasts are human fibroblasts, human dermal fibroblasts, adult human fibroblasts, or adult human dermal fibroblasts.