Crispr / CAS screening platform to identify genetic modifiers of TAU seeding or aggregation

Abstract

Cas-protein-ready tau biosensor cells, CRISPR / Cas synergistic activation mediator (SAM)-ready tau biosensor cells, and methods of making and using such cells to screen for genetic modifiers of tau seeding or aggregation are provided. Reagents and methods for sensitizing such cells to tau seeding activity or tau aggregation or for causing tau aggregation are also provided.

Description

(19) *EP004729947A2* (11) EP 4 729 947 A2 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: 22.04.2026 Bulletin 2026 / 17 (21) Application number: 25223891.0 (22) Date of filing: 17.03.2020 (51) International Patent Classification (IPC): G01N 33 / 68 (2006.01) (52) Cooperative Patent Classification (CPC): G01N 33 / 6896; C12N 5 / 0686; C12N 9 / 22; C12N 15 / 11; C12N 2310 / 20; C12N 2510 / 00; G01N 2021 / 6441 (84) Designated Contracting States: AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR (30) Priority: 18.03.2019 US 201962820086 P (62) Document number(s) of the earlier application(s) in accordance with Art. 76 EPC: 23215659.6 / 4 317 950 20718950.7 / 3 768 826 (71) Applicant: Regeneron Pharmaceuticals, Inc. Tarrytown, NY 10591 (US) (72) Inventors: • PRISSETTE, Marine Tarrytown, 10591 (US) • KOSS, Matthew Tarrytown, 10591 (US) • FURY, Wen Tarrytown, 10591 (US) • ZAMBROWICZ, Brian Tarrytown, 10591 (US) (74) Representative: Mewburn Ellis LLP Aurora Building Counterslip Bristol BS1 6BX (GB) Remarks: •The complete document including Reference Table(s) and the Sequence Listing(s) can be downloaded from the EPO website •This application was filed on 16‑12‑2025 as a divisional application to the application mentioned under INID code 62. •Claims filed after the date of filing of the application / after the date of receipt of the divisional application (Rule 68(4) EPC). (54) CRISPR / CAS SCREENING PLATFORM TO IDENTIFY GENETIC MODIFIERS OF TAU SEEDING OR AGGREGATION (57) Cas-protein-ready tau biosensor cells, CRISPR / Cas synergistic activation mediator (SAM)‑ready tau biosensor cells, andmethods ofmaking and using such cells to screen for geneticmodifiers of tau seeding or aggregation are provided. Reagents and methods for sensitizing such cells to tau seeding activity or tauaggregationor for causing tauaggregationarealso provided. EP 4 72 9 94 7 A 2 Processed by Luminess, 75001 PARIS (FR) Description CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of US Application No. 62 / 820,086, filed March 18, 2019, which is herein incorporated by reference in its entirety for all purposes. REFERENCE TO A SEQUENCE LISTING SUBMITTED AS A TEXT FILE VIA EFS WEB

[0002] TheSequence Listingwritten in file 544635SEQLIST.txt is 75.7 kilobytes, was created onMarch 16, 2020, and is hereby incorporated by reference. BACKGROUND

[0003] Abnormal aggregation or fibrillization of proteins is a defining feature of many diseases, notably including a number of neurodegenerative diseases such as Alzheimer’s disease (AD), Parkinson’s disease (PD), frontotemporal dementia (FTD), amyotrophic lateral sclerosis (ALS), chronic traumatic encephalopathy (CTE), Creutzfeldt-Jakob disease (CJD), and others. In many of these diseases, the fibrillization of certain proteins into insoluble aggregates is not only a hallmark of disease, but has also been implicated as a causative factor of neurotoxicity. Furthermore, these diseases are characterized by propagation of aggregate pathology through the central nervous system following stereotypical patterns, a process which correlates with disease progression. The identification of genes and genetic pathways that modify the processes of abnormal protein aggregation, or cell-to-cell propagation of aggregates, are therefore of great value in better understanding neurodegenerative disease etiology as well as in devising strategies for therapeutic intervention. SUMMARY

[0004] Provided herein are methods of screening for genetic modifiers of tau aggregation, methods of producing a conditioned medium for inducing or sensitizing to tau aggregation, and methods of generating a population of tau- aggregation-positive cells. Also provided herein are Cas-tau biosensor cells or populations of such cells and in vitro cultures ofCas-tau biosensor cells and conditionedmedium. Also provided herein areCRISPR / Cas synergistic activation mediator (SAM)‑tau biosensor cells or populations of such cells and in vitro cultures of SAM-tau biosensor cells and conditioned medium.

[0005] In one aspect, provided aremethods of screening for genetic modifiers of tau aggregation. Some suchmethods (CRISPRn) can comprise: (a) providing a population of cells comprising aCas protein, a first tau repeat domain linked to a first reporter, and a second tau repeat domain linked to a second reporter; (b) introducing into the population of cells a library comprising a plurality of unique guide RNAs that target a plurality of genes; (c) culturing the population of cells to allowgenomeeditingandexpansion,wherein theplurality of uniqueguideRNAs formcomplexeswith theCasprotein, and the Cas protein cleaves the plurality of genes resulting in knockout of gene function to produce a genetically modified population of cells; (d) contacting the geneticallymodified population of cellswith a tau seeding agent to produce a seeded population of cells; (e) culturing the seeded population of cells to allow tau aggregates to form, wherein aggregates of the first tau repeat domain and the second tau repeat domain form in a subset of the seeded population of cells to produce an aggregation-positive populationof cells; and (f) determiningabundanceof eachof theplurality of uniqueguideRNAs in the aggregation-positive population of cells identified in step (e) relative to the genetically modified population of cells in step (c), wherein enrichment of a guide RNA in the aggregation-positive population of cells identified in step (e) relative to the cultured population of cells in step (c) indicates that the gene targeted by the guide RNA is a genetic modifier of tau aggregation, wherein disruption of the gene targeted by the guide RNA enhances tau aggregation, or is a candidate geneticmodifierof tauaggregation (e.g., for further testingviasecondary screens),whereindisruptionof thegene targeted by the guide RNA is expected to enhance tau aggregation.

[0006] In some such methods, the first tau repeat domain and / or the second tau repeat domain is a human tau repeat domain. In some such methods, the first tau repeat domain and / or the second tau repeat domain comprises a pro- aggregationmutation. Optionally, the first tau repeat domain and / or the second tau repeat domain comprises a tauP301S mutation.

[0007] In some such methods, the first tau repeat domain and / or the second tau repeat domain comprises a tau four- repeat domain. In somesuchmethods, the first tau repeat domainand / or the second tau repeat domain comprisesSEQ ID NO: 11. In some suchmethods, the first tau repeat domain and the second tau repeat domain are the same. In some such methods, the first tau repeat domain and the second tau repeat domain are the same and each comprises tau four-repeat domain comprising a tau P301S mutation. 2 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55

[0008] In somesuchmethods, first reporterand thesecond reporter arefluorescentproteins.Optionally, thefirst reporter and the second reporter are a fluorescence resonance energy transfer (FRET) pair. Optionally, the first reporter is cyan fluorescent protein (CFP) and the second reporter is yellow fluorescent protein (YFP).

[0009] In some suchmethods, theCas protein is aCas9 protein. Optionally, theCas protein isStreptococcus pyogenes Cas9.Optionally, theCas protein comprises SEQ IDNO: 21.Optionally, theCas protein is encoded by a coding sequence comprising the sequence set forth in SEQ ID NO: 22.

[0010] In some suchmethods, the Cas protein, the first tau repeat domain linked to the first reporter, and the second tau repeat domain linked to the second reporter are stably expressed in the population of cells. In somesuchmethods, nucleic acids encoding the Cas protein, the first tau repeat domain linked to the first reporter, and the second tau repeat domain linked to the second reporter are genomically integrated in the population of cells.

[0011] In some such methods, the cells are eukaryotic cells. Optionally, the cells are mammalian cells. Optionally, the cells are human cells. Optionally, the cells are HEK293T cells.

[0012] In some suchmethods, the plurality of unique guideRNAs are introduced at a concentration selected such that a majority of the cells receive only one of the unique guideRNAs. In some suchmethods, the plurality of unique guideRNAs target 100 or more genes, 1000 or more genes, or 10000 or more genes. In some suchmethods, the library is a genome- wide library.

[0013] In some suchmethods, a plurality of target sequences are targeted on average in each of the targeted plurality of genes. Optionally, at least three target sequences are targeted on average in each of the targeted plurality of genes. Optionally, about three to about six target sequences (e.g., about three, about four, or about six) are targeted onaverage in each of the targeted plurality of genes.

[0014] In some such methods, each guide RNA targets a constitutive exon. Optionally, each guide RNA targets a 5’ constitutive exon. In some such methods, each guide RNA targets a first exon, a second exon, or a third exon.

[0015] In some such methods, the plurality of unique guide RNAs are introduced into the population of cells by viral transduction. Optionally, each of the plurality of unique guide RNAs is in a separate viral vector. Optionally, the plurality of unique guide RNAs are introduced into the population of cells by lentiviral transduction. In some such methods, the population of cells is infected at a multiplicity of infection of less than about 0.3.

[0016] In somesuchmethods, theplurality of uniqueguideRNAsare introduced into thepopulationof cells togetherwith a selection marker, and step (b) further comprises selecting cells that comprise the selection marker. Optionally, the selectionmarker imparts resistance to a drug. Optionally, the selectionmarker imparts resistance to puromycin or zeocin. Optionally, the selection marker is selected from neomycin phosphotransferase, hygromycin B phosphotransferase, puromycin-N-acetyltransferase, and blasticidin S deaminase. Optionally, the selection marker is selected from neomycin phosphotransferase, hygromycin B phosphotransferase, puromycin-N-acetyltransferase, blasticidin S deaminase, and bleomycin resistance protein.

[0017] In somesuchmethods, the populationof cells intowhich theplurality of uniqueguideRNAsare introduced in step (b) comprises greater than about 300 cells per unique guide RNA.

[0018] In some such methods, step (c) is about 3 days to about 9 days. Optionally, step (c) is about 6 days.

[0019] In somesuchmethods, step (d) comprises culturing thegeneticallymodifiedpopulationof cells in thepresenceof conditionedmedium harvested from cultured tau-aggregation-positive cells in which a tau repeat domain stably presents in an aggregated state. Optionally, the conditioned medium was harvested after being on confluent tau-aggregation- positive cells for about 1 to about 7 days. Optionally, the conditioned mediumwas harvested after being on confluent tau- aggregation-positive cells for about 4 days. Optionally, step (d) comprises culturing the genetically modified population of cells in about 75% conditioned medium and about 25% fresh medium. In some such methods, the genetically modified population of cells is not co-culturedwith the tau-aggregation-positive cells inwhich a tau repeat domain stably presents in an aggregated state.

[0020] In some suchmethods, step (e) is about 2 days to about 6 days.Optionally, step (e) is about 4 days. In some such methods, the first reporter and the second reporter are a fluorescence resonance energy transfer (FRET) pair, and the aggregation-positive population of cells in step (e) is identified by flow cytometry.

[0021] In some such methods, abundance is determined by next-generation sequencing. In some such methods, a guide RNA is considered enriched if the abundance of the guide RNA relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold higher in the aggregation-positive population of cells in step (e) relative to the cultured population of cells in step (c).

[0022] In somesuchmethods, step (f) comprisesdeterminingabundanceofeachof thepluralityof uniqueguideRNAs in the aggregation-positive population of cells in step (e) relative to the cultured population of cells in step (c) at a first time point in step (c) and / or a second time point in step (c). Optionally, the first time point in step (c) is at a first passage of culturing the population of cells, and the second time point is in the middle of culturing the population of cells to allow genome editing and expansion. Optionally, the first time point in step (c) is after about three days of culturing, and the second time point in step (c) is after about six days of culturing.

[0023] In somesuchmethods, agene is consideredageneticmodifier of tauaggregation,wherein disruptionof thegene 3 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55 enhances tau aggregation (or a candidate genetic modifier of tau aggregation, wherein disruption of the gene is expected to enhance tau aggregation), if: (1) the abundance of a guide RNA targeting the gene relative to the total population of the plurality of unique guideRNAs is at least 1.5-fold higher in the aggregation-positive population of cells in step (e) relative to the cultured population of cells in step (c) at both the first time point in step (c) and the second time point in step (c); and / or (2) the abundance of at least two unique guide RNAs targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold higher in the aggregation-positive population of cells in step (e) relative to the cultured population of cells in step (c) at either the first time point in step (c) or the second time point in step (c).

[0024] In some such methods, the following steps are taken in step (f) to identify a gene as a genetic modifier of tau aggregation,wherein disruptionof thegeneenhances tauaggregation (or a candidategeneticmodifier of tauaggregation, whereindisruptionof thegene isexpected toenhance tauaggregation): (1) identifyingwhichof theplurality of uniqueguide RNAsare present in theaggregation-positive population of cells produced in step (e); (2) calculating the randomchanceof the guideRNAs identified in step (f)(1) beingpresent using the formula nCn’ * (x-n’)C(m-n) / xCm,wherein x is the variety of unique guide RNAs introduced into the population of cells in step (b), wherein m is the variety of unique guide RNAs identified in step (f)(1), wherein n is the variety of unique guide RNAs introduced into the population of cells in step (b) that target the gene, and wherein n’ is the variety of unique guide RNAs identified in step (f)(1) that target the gene; (3) calculatingaverageenrichment scores for theguideRNAs identified instep (f)(1),wherein theenrichment score foraguide RNA is the relativeabundanceof theguideRNA in theaggregation-positive populationof cells produced in step (e) divided by the relativeabundanceof theguideRNA in the culturedpopulationof cells in step (c), andwherein relativeabundance is the read count of the guideRNAdivided by the read count of the total population of the plurality of unique guideRNAs; and (4) selecting the gene if a guide RNA targeting the gene is significantly below the random chance of being present and above a threshold enrichment score.

[0025] Some such methods (CRISPRa) can comprise: (a) providing a population of cells comprising a chimeric Cas protein comprising a nuclease-inactive Cas protein fused to one or more transcriptional activation domains, a chimeric adaptor protein comprising an adaptor protein fused to one or more transcriptional activation domains, a first tau repeat domain linked to a first reporter, and a second tau repeat domain linked to a second reporter; (b) introducing into the population of cells a library comprising a plurality of unique guide RNAs that target a plurality of genes; (c) culturing the population of cells to allow transcriptional activation and expansion, wherein the plurality of unique guide RNAs form complexeswith the chimeric Cas protein and the chimeric adaptor protein, and the complexes activate transcription of the plurality of genes resulting in increased gene expression to produce a genetically modified population of cells; (d) contacting thegeneticallymodified population of cellswith a tau seeding agent to produce a seededpopulation of cells; (e) culturing the seeded population of cells to allow tau aggregates to form, wherein aggregates of the first tau repeat domain and the second tau repeat domain form in a subset of the seeded population of cells to produce an aggregation-positive populationof cells; and (f) determiningabundanceof eachof theplurality of uniqueguideRNAs in theaggregation-positive populationof cells identified instep (e) relative to thegeneticallymodifiedpopulationof cells in step (c),whereinenrichment of aguideRNA in theaggregation-positive populationof cells identified in step (e) relative to the culturedpopulationof cells in step (c) indicates that the gene targeted by the guide RNA is a genetic modifier of tau aggregation, wherein transcriptional activation of the gene targeted by the guide RNA enhances tau aggregation, or is a candidate genetic modifier of tau aggregation (e.g., for further testing via secondary screens), wherein transcriptional activation of the gene targeted by the guide RNA is expected to enhance tau aggregation.

[0026] In some such methods, the first tau repeat domain and / or the second tau repeat domain is a human tau repeat domain. In some such methods, the first tau repeat domain and / or the second tau repeat domain comprises a pro- aggregationmutation. Optionally, the first tau repeat domain and / or the second tau repeat domain comprises a tauP301S mutation.

[0027] In some such methods, the first tau repeat domain and / or the second tau repeat domain comprises a tau four- repeat domain. In somesuchmethods, the first tau repeat domainand / or the second tau repeat domain comprisesSEQ ID NO: 11. In some suchmethods, the first tau repeat domain and the second tau repeat domain are the same. In some such methods, the first tau repeat domain and the second tau repeat domain are the same and each comprises tau four-repeat domain comprising a tau P301S mutation.

[0028] In somesuchmethods, first reporterand thesecond reporter arefluorescentproteins.Optionally, thefirst reporter and the second reporter are a fluorescence resonance energy transfer (FRET) pair. Optionally, the first reporter is cyan fluorescent protein (CFP) and the second reporter is yellow fluorescent protein (YFP).

[0029] In some suchmethods, theCas protein is aCas9 protein. Optionally, theCas protein isStreptococcus pyogenes Cas9. In some such methods, the chimeric Cas protein comprises the nuclease-inactive Cas protein fused to a VP64 transcriptional activation domain, optionally wherein the chimeric Cas protein comprises from N-terminus to C-terminus: the nuclease-inactive Cas protein; a nuclear localization signal; and the VP64 transcriptional activator domain. In some suchmethods, the adaptor protein is anMS2 coat protein, andwherein the one ormore transcriptional activation domains in the chimeric adaptor protein comprise a p65 transcriptional activation domain and an HSF1 transcriptional activation domain, optionallywherein the chimeric adaptor protein comprises fromN-terminus toC-terminus: theMS2coat protein; a 4 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55 nuclear localization signal; the p65 transcriptional activation domain; and the HSF1 transcriptional activation domain. In some such methods, the chimeric Cas protein comprises SEQ ID NO: 36, optionally wherein the chimeric Cas protein is encoded by a coding sequence comprising the sequence set forth in SEQ IDNO: 38. In some suchmethods, the chimeric adaptor protein comprises SEQ ID NO: 37, optionally wherein the chimeric adaptor protein is encoded by a coding sequence comprising the sequence set forth in SEQ ID NO: 39.

[0030] In some suchmethods, the chimeric Cas protein, the chimeric adaptor protein, the first tau repeat domain linked to the first reporter, and the second tau repeat domain linked to the second reporter are stably expressed in the population of cells. In some suchmethods, nucleic acids encoding the chimeric Cas protein, the chimeric adaptor protein, the first tau repeat domain linked to the first reporter, and the second tau repeat domain linked to the second reporter are genomically integrated in the population of cells.

[0031] In some such methods, the cells are eukaryotic cells. Optionally, the cells are mammalian cells. Optionally, the cells are human cells. Optionally, the cells are HEK293T cells.

[0032] In some suchmethods, the plurality of unique guideRNAs are introduced at a concentration selected such that a majority of the cells receive only one of the unique guideRNAs. In some suchmethods, the plurality of unique guideRNAs target 100 or more genes, 1000 or more genes, or 10000 or more genes. In some suchmethods, the library is a genome- wide library.

[0033] In some suchmethods, a plurality of target sequences are targeted on average in each of the targeted plurality of genes. Optionally, at least three target sequences are targeted on average in each of the targeted plurality of genes. Optionally, about three to about six target sequences (e.g., about three, about four, or about six) are targeted onaverage in each of the targeted plurality of genes. Optionally, about three target sequences are targeted on average in each of the targeted plurality of genes.

[0034] In some such methods, each guide RNA targets a guide RNA target sequence within 200 bp upstream of a transcription start site. In somesuchmethods, eachguideRNAcomprises oneormoreadaptor-binding elements towhich the chimeric adaptor protein can specifically bind.Optionally, each guideRNAcomprises twoadaptor-binding elements to which the chimeric adaptor protein can specifically bind. Optionally, a first adaptor-binding element is within a first loop of each of the one or more guide RNAs, and a second adaptor-binding element is within a second loop of each of the one or more guide RNAs. Optionally, the adaptor-binding element comprises the sequence set forth in SEQ ID NO: 33. In some suchmethods,whereineachof oneormoreguideRNAs is asingleguideRNAcomprisingaCRISPRRNA(crRNA)portion fused to a transactivating CRISPR RNA (tracrRNA) portion, and the first loop is the tetraloop corresponding to residues 13‑16 of SEQ ID NO: 17, and the second loop is the stem loop 2 corresponding to residues 53‑56 of SEQ ID NO: 17.

[0035] In some such methods, the plurality of unique guide RNAs are introduced into the population of cells by viral transduction. Optionally, each of the plurality of unique guide RNAs is in a separate viral vector. Optionally, the plurality of unique guide RNAs are introduced into the population of cells by lentiviral transduction. In some such methods, the population of cells is infected at a multiplicity of infection of less than about 0.3.

[0036] In somesuchmethods, theplurality of uniqueguideRNAsare introduced into thepopulationof cells togetherwith a selection marker, and step (b) further comprises selecting cells that comprise the selection marker. Optionally, the selectionmarker imparts resistance to a drug. Optionally, the selectionmarker imparts resistance to puromycin or zeocin. Optionally, the selection marker is selected from neomycin phosphotransferase, hygromycin B phosphotransferase, puromycin-N-acetyltransferase, and blasticidin S deaminase. Optionally, the selection marker is selected from neomycin phosphotransferase, hygromycin B phosphotransferase, puromycin-N-acetyltransferase, blasticidin S deaminase, and bleomycin resistance protein.

[0037] In somesuchmethods, the populationof cells intowhich theplurality of uniqueguideRNAsare introduced in step (b) comprises greater than about 300 cells per unique guide RNA.

[0038] In some such methods, step (c) is about 3 days to about 9 days. Optionally, step (c) is about 6 days.

[0039] In somesuchmethods, step (d) comprises culturing thegeneticallymodifiedpopulationof cells in thepresenceof conditionedmedium harvested from cultured tau-aggregation-positive cells in which a tau repeat domain stably presents in an aggregated state. Optionally, the conditioned medium was harvested after being on confluent tau-aggregation- positive cells for about 1 to about 7 days. Optionally, the conditioned mediumwas harvested after being on confluent tau- aggregation-positive cells for about 4 days. Optionally, step (d) comprises culturing the genetically modified population of cells in about 75% conditioned medium and about 25% fresh medium. In some such methods, the genetically modified population of cells is not co-culturedwith the tau-aggregation-positive cells inwhich a tau repeat domain stably presents in an aggregated state.

[0040] In some suchmethods, step (e) is about 2 days to about 6 days.Optionally, step (e) is about 4 days. In some such methods, the first reporter and the second reporter are a fluorescence resonance energy transfer (FRET) pair, and the aggregation-positive population of cells in step (e) is identified by flow cytometry.

[0041] In some such methods, abundance is determined by next-generation sequencing. In some such methods, a guide RNA is considered enriched if the abundance of the guide RNA relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold higher in the aggregation-positive population of cells in step (e) relative to the 5 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55 cultured population of cells in step (c).

[0042] In somesuchmethods, step (f) comprisesdeterminingabundanceofeachof thepluralityof uniqueguideRNAs in the aggregation-positive population of cells in step (e) relative to the cultured population of cells in step (c) at a first time point in step (c) and / or a second time point in step (c). Optionally, the first time point in step (c) is at a first passage of culturing the population of cells, and the second time point is in the middle of culturing the population of cells to allow genome editing and expansion. Optionally, the first time point in step (c) is after about three days of culturing, and the second time point in step (c) is after about six days of culturing.

[0043] In some such methods, a gene is considered a genetic modifier of tau aggregation, wherein transcriptional activation of the gene enhances tau aggregation (or a candidate genetic modifier of tau aggregation, wherein transcrip- tional activation of the gene is expected to enhance tau aggregation), if: (1) the abundance of a guide RNA targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold higher in the aggregation- positive population of cells in step (e) relative to the cultured population of cells in step (c) at both the first time point in step (c) and the second time point in step (c); and / or (2) the abundance of at least two unique guide RNAs targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold higher in the aggregation-positive populationof cells in step (e) relative to theculturedpopulationof cells in step (c) at either thefirst timepoint in step (c) or the second time point in step (c).

[0044] In some such methods, the following steps are taken in step (f) to identify a gene as a genetic modifier of tau aggregation, wherein transcriptional activation of the gene enhances tau aggregation (or a candidate genetic modifier of tau aggregation, wherein transcriptional activation of the gene is expected to enhance tau aggregation): (1) identifying which of the plurality of unique guideRNAsare present in the aggregation-positive population of cells produced in step (e); (2) calculating the random chance of the guide RNAs identified in step (f)(1) being present using the formula nCn’ * (x-n’) C(m-n) / xCm,wherein x is the variety of unique guideRNAs introduced into the population of cells in step (b), whereinm is the variety of unique guide RNAs identified in step (f)(1), wherein n is the variety of unique guide RNAs introduced into the population of cells in step (b) that target the gene, andwherein n’ is the variety of unique guideRNAs identified in step (f)(1) that target the gene; (3) calculating average enrichment scores for the guide RNAs identified in step (f)(1), wherein the enrichment score for a guide RNA is the relative abundance of the guide RNA in the aggregation-positive population of cells produced in step (e) divided by the relative abundance of the guideRNA in the cultured population of cells in step (c), and wherein relative abundance is the read count of the guide RNA divided by the read count of the total population of the plurality of unique guide RNAs; and (4) selecting the gene if a guide RNA targeting the gene is significantly below the random chance of being present and above a threshold enrichment score.

[0045] In another aspect, provided are additional methods of screening for genetic modifiers of tau aggregation. Some such methods (CRISPRn) can comprise: (a) providing a population of cells comprising a Cas protein, a first tau repeat domain linked to a first reporter, and a second tau repeat domain linked to a second reporter; (b) introducing into the population of cells a library comprising a plurality of unique guide RNAs that target a plurality of genes; (c) culturing the populationof cells toallowgenomeeditingandexpansion,wherein thepluralityof uniqueguideRNAs formcomplexeswith the Cas protein, and the Cas protein cleaves the plurality of genes resulting in knockout of gene function to produce a geneticallymodified population of cells; (d) contacting the geneticallymodified population of cells with a tau seeding agent to produce a seeded population of cells; (e) culturing the seeded population of cells to allow tau aggregates to form, wherein aggregates of the first tau repeat domain and the second tau repeat domain form in a first subset of the seeded population of cells to produce an aggregation-positive population of cells and do not form in a second subset of the seeded population of cells to produce an aggregation-negative population of cells; and (f) determining abundance of each of the plurality of unique guide RNAs in the aggregation-positive population of cells identified in step (e) relative to the aggregation-negative population of cells identified in step (e) and / or the seeded population of cells in step (d), and / or determining abundance of each of the plurality of unique guide RNAs in the aggregation-negative population of cells identified in step (e) relative to the aggregation-positive population of cells identified in step (e) and / or the seeded population of cells in step (d), wherein enrichment of a guideRNA in the aggregation-negative population of cells identified in step (e) relative to the aggregation-positive population of cells identified in step (e) and / or the seeded population of cells in step (d)orwhereindepletionof aguideRNA in theaggregation-positivepopulationof cells identified in step (e) relative to the aggregation-negative population of cells identified in step (e) and / or the seeded population of cells in step (d) indicates that thegene targetedby theguideRNA isageneticmodifier of tauaggregation,wherein disruptionof thegene targetedby the guide RNA prevents tau aggregation, or is a candidate genetic modifier of tau aggregation (e.g., for further testing via secondary screens), wherein disruption of the gene targeted by the guide RNA is expected to prevent tau aggregation, and / orwhereinenrichment of aguideRNA in theaggregation-positivepopulationof cells identified in step (e) relative to the aggregation-negative population of cells identified in step (e) and / or the seeded population of cells in step (d) or wherein depletion of a guide RNA in the aggregation-negative population of cells identified in step (e) relative to the aggregation- positive population of cells identified in step (e) and / or the seeded population of cells in step (d) indicates that the gene targeted by the guide RNA is a genetic modifier of tau aggregation, wherein disruption of the gene targeted by the guide RNA promotes or enhances tau aggregation, or is a candidate genetic modifier of tau aggregation (e.g., for further testing 6 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55 via secondary screens), wherein disruption of the gene targeted by the guide RNA is expected to promote or enhance tau aggregation.

[0046] In some such methods, the Cas protein is a Cas9 protein. Optionally, Cas protein is Streptococcus pyogenes Cas9. In somesuchmethods, theCasprotein comprisesSEQ IDNO:21, optionallywherein theCasprotein is encodedby a coding sequence comprising the sequence set forth in SEQ ID NO: 22.

[0047] In some suchmethods, the Cas protein, the first tau repeat domain linked to the first reporter, and the second tau repeat domain linked to the second reporter are stably expressed in the population of cells. In somesuchmethods, nucleic acids encoding the Cas protein, the first tau repeat domain linked to the first reporter, and the second tau repeat domain linked to the second reporter are genomically integrated in the population of cells.

[0048] In some such methods, each guide RNA targets a constitutive exon. Optionally, each guide RNA targets a 5’ constitutive exon. In some such methods, each guide RNA targets a first exon, a second exon, or a third exon.

[0049] Some suchmethods (CRISPRa) comprise: (a) providing a population of cells comprising a chimeric Cas protein comprising a nuclease-inactive Cas protein fused to one or more transcriptional activation domains, a chimeric adaptor protein comprising an adaptor protein fused to one or more transcriptional activation domains, a first tau repeat domain linked to a first reporter, and a second tau repeat domain linked to a second reporter; (b) introducing into the population of cells a library comprisingaplurality of uniqueguideRNAs that target aplurality of genes; (c) culturing thepopulationof cells to allow transcriptional activation and expansion, wherein the plurality of unique guide RNAs form complexes with the chimeric Cas protein and the chimeric adaptor protein, and the complexes activate transcription of the plurality of genes resulting in increased gene expression to produce a geneticallymodified population of cells; (d) contacting the genetically modified population of cells with a tau seeding agent to produce a seeded population of cells; (e) culturing the seeded population of cells to allow tau aggregates to form, wherein aggregates of the first tau repeat domain and the second tau repeat domain form in a first subset of the seededpopulation of cells to produceanaggregation-positive population of cells and do not form in a second subset of the seeded population of cells to produce an aggregation-negative population of cells; and (f) determiningabundanceof eachof theplurality of uniqueguideRNAs in theaggregation-positive populationof cells identified in step (e) relative to the aggregation-negative population of cells identified in step (e) and / or the seeded population of cells in step (d), and / or determining abundance of each of the plurality of unique guide RNAs in the aggregation-negative population of cells identified in step (e) relative to the aggregation-positive population of cells identified in step (e) and / or the seeded population of cells in step (d), wherein enrichment of a guide RNA in the aggregation-negative population of cells identified in step (e) relative to the aggregation-positive population of cells identified in step (e) and / or the seeded population of cells in step (d) or wherein depletion of a guide RNA in the aggregation-positive population of cells identified in step (e) relative to the aggregation-negative population of cells identified in step (e) and / or the seeded population of cells in step (d) indicates that the gene targeted by the guideRNA is a geneticmodifier of tau aggregation, wherein transcriptional activation of the gene targeted by the guideRNA prevents tau aggregation, or is a candidate geneticmodifier of tau aggregation (e.g., for further testing via secondary screens), wherein transcriptional activation of the gene targeted by the guide RNA is expected to prevent tau aggregation, and / or wherein enrichment of a guide RNA in the aggregation-positive population of cells identified in step (e) relative to the aggregation- negative population of cells identified in step (e) and / or the seeded population of cells in step (d) or wherein depletion of a guide RNA in the aggregation-negative population of cells identified in step (e) relative to the aggregation-positive population of cells identified in step (e) and / or the seeded population of cells in step (d) indicates that the gene targeted by the guideRNA is a geneticmodifier of tau aggregation, wherein transcriptional activation of the gene targeted by the guide RNA promotes or enhances tau aggregation, or is a candidate genetic modifier of tau aggregation (e.g., for further testing via secondary screens),wherein transcriptional activationof thegene targetedby theguideRNA isexpected topromoteor enhance tau aggregation.

[0050] In some suchmethods, theCas protein is aCas9 protein. Optionally, theCas protein isStreptococcus pyogenes Cas9. In some such methods, the chimeric Cas protein comprises the nuclease-inactive Cas protein fused to a VP64 transcriptional activation domain, optionally wherein the chimeric Cas protein comprises from N-terminus to C-terminus: the nuclease-inactive Cas protein; a nuclear localization signal; and the VP64 transcriptional activator domain. In some suchmethods, the adaptor protein is anMS2 coat protein, andwherein the one ormore transcriptional activation domains in the chimeric adaptor protein comprise a p65 transcriptional activation domain and an HSF1 transcriptional activation domain, optionallywherein the chimeric adaptor protein comprises fromN-terminus toC-terminus: theMS2coat protein; a nuclear localization signal; the p65 transcriptional activation domain; and the HSF1 transcriptional activation domain. In some such methods, the chimeric Cas protein comprises SEQ ID NO: 36, optionally wherein the chimeric Cas protein is encoded by a coding sequence comprising the sequence set forth in SEQ IDNO: 38. In some suchmethods, the chimeric adaptor protein comprises SEQ ID NO: 37, optionally wherein the chimeric adaptor protein is encoded by a coding sequence comprising the sequence set forth in SEQ ID NO: 39.

[0051] In some suchmethods, the chimeric Cas protein, the chimeric adaptor protein, the first tau repeat domain linked to the first reporter, and the second tau repeat domain linked to the second reporter are stably expressed in the population of cells. In some suchmethods, nucleic acids encoding the chimeric Cas protein, the chimeric adaptor protein, the first tau 7 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55 repeat domain linked to the first reporter, and the second tau repeat domain linked to the second reporter are genomically integrated in the population of cells.

[0052] In some such methods, each guide RNA targets a guide RNA target sequence within 200 bp upstream of a transcription start site. In somesuchmethods, eachguideRNAcomprises oneormoreadaptor-binding elements towhich the chimeric adaptor protein can specifically bind.Optionally, each guideRNAcomprises twoadaptor-binding elements to which the chimeric adaptor protein can specifically bind. Optionally, a first adaptor-binding element is within a first loop of each of the one or more guide RNAs, and a second adaptor-binding element is within a second loop of each of the one or moreguideRNAs.Optionally, theadaptor-bindingelement comprises thesequenceset forth inSEQ IDNO:33.Optionally, each of one or more guide RNAs is a single guide RNA comprising a CRISPR RNA (crRNA) portion fused to a transactivating CRISPR RNA (tracrRNA) portion, and the first loop is the tetraloop corresponding to residues 13‑16 of SEQ ID NO: 17, and the second loop is the stem loop 2 corresponding to residues 53‑56 of SEQ ID NO: 17.

[0053] In somesuchmethods, step (c) isabout3days toabout13days. Insomesuchmethods, step (c) isabout7days to about 10 days, is about 7 days, or is about 10 days.

[0054] In somesuchmethods, step (d) comprises culturing thegeneticallymodifiedpopulationof cells in thepresenceof a medium comprising a cell lysate from cultured tau-aggregation-positive cells in which a tau repeat domain stably presents in an aggregated state.Optionally, the cell lysate in themedium is at a concentration of about 1 to about 5µg / mL. In some such methods, the medium comprising the cell lysate further comprises lipofectamine or another transfection reagent.Optionally, themediumcomprising thecell lysate comprises lipofectamineataconcentrationof about1.5 toabout 4 µL / mL. In some such methods, the genetically modified population of cells is not co-cultured with the tau-aggregation- positive cells in which a tau repeat domain stably presents in an aggregated state.

[0055] In some suchmethods, step (e) is about 1 day to about 3 days. Optionally, step (e) is about 2 days. In some such methods, the first reporter and the second reporter are a fluorescence resonance energy transfer (FRET) pair, and the aggregation-positive population of cells and the aggregation-negative population of cells in step (e) is identified by flow cytometry. In some such methods, abundance is determined by next-generation sequencing.

[0056] In some such methods, a guide RNA is considered enriched in the aggregation-negative population of cells in step (e) if the abundance of the guide RNA relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold higher in the aggregation-negative population of cells in step (e) relative to the aggregation-positive population of cells in step (e) and / or the seeded population of cells in step (d), and wherein a guide RNA is considered depleted in the aggregation-positive population of cells in step (e) if the abundance of the guide RNA relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold lower in the aggregation-positive population of cells in step (e) relative to the aggregation-negative population of cells in step (e) and / or the seededpopulation of cells in step (d), or wherein a guide RNA is considered enriched in the aggregation-positive population of cells in step (e) if the abundance of the guide RNA relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold higher in the aggregation-positive population of cells in step (e) relative to the aggregation-negative population of cells in step (e) and / or the seeded population of cells in step (d), and wherein a guide RNA is considered depleted in the aggregation-negative population of cells in step (e) if the abundance of the guideRNA relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold lower in the aggregation-negative population of cells in step (e) relative to the aggregation-positive population of cells in step (e) and / or the seeded population of cells in step (d).

[0057] In somesuchmethods, step (f) comprisesdeterminingabundanceofeachof thepluralityof uniqueguideRNAs in the aggregation-negative population of cells in step (e) relative to the aggregation-positive population of cells in step (e), the cultured population of cells in step (c) at a first timepoint, and the seededpopulation of cells in step (d) at a second time point, and / or wherein step (f) comprises determining abundance of each of the plurality of unique guide RNAs in the aggregation-positive population of cells in step (e) relative to the aggregation-negative population of cells in step (e), the cultured population of cells in step (c) at a first time point, and the seeded population of cells in step (d) at a second time point. Optionally, the first time point in step (c) is at a first passage of culturing the population of cells. Optionally, the first time point in step (c) is after about 3 days of culturing, and the second time point in step (c) is after about 7 days of culturing or about 10 days of culturing.

[0058] In some such methods, a gene is considered a genetic modifier of tau aggregation, wherein disruption (CRISPRn) or transcriptional activation (CRISPRa) of the gene prevents tau aggregation (or a candidate geneticmodifier of tau aggregation, wherein disruption or transcriptional activation of the gene is expected to prevent tau aggregation), if: (1) the abundance of a guideRNA targeting the gene relative to the total population of the plurality of unique guideRNAs is at least 1.5-fold higher in the aggregation-negative population of cells in step (e) relative to the aggregation-positive population of cells in step (e), the cultured population of cells in step (c) at the first time point, and the seeded population of cells in step (d) at the second time point; and / or (2) the abundance of a guide RNA targeting the gene relative to the total population of the plurality of unique guideRNAs is at least 1.5-fold higher in the aggregation-negative population of cells in step (e) relative to theaggregation-positivepopulationof cells in step (e)and theseededpopulationof cells in step (d)at the second time point; and / or (3) the abundance of a guide RNA targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold lower in the aggregation-positive population of cells in step (e) relative to 8 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55 the aggregation-negative population of cells in step (e), the cultured population of cells in step (c) at the first timepoint, and the seeded population of cells in step (d) at the second time point; and / or (4) the abundance of a guide RNA targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold lower in the aggregation- positive population of cells in step (e) relative to the aggregation-negative population of cells in step (e) and the seeded populationof cells in step (d)at thesecond timepoint. In somesuchmethods, agene is consideredageneticmodifier of tau aggregation,whereindisruption (CRISPRn)or transcriptional activation (CRISPRa)of thegenepromotesorenhances tau aggregation (or a candidategeneticmodifier of tauaggregation,wherein disruptionor transcriptional activationof thegene is expected to promote or enhance tauaggregation), if: (1) the abundance of a guideRNA targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold higher in the aggregation-positive population of cells in step (e) relative to theaggregation-negative population of cells in step (e), the cultured population of cells in step (c) at the first time point, and the seeded population of cells in step (d) at the second time point; and / or (2) the abundance of a guideRNA targeting the gene relative to the total population of the plurality of unique guideRNAs is at least 1.5-fold higher in the aggregation-positive population of cells in step (e) relative to the aggregation-negative population of cells in step (e) and the seeded population of cells in step (d) at the second time point; and / or (3) the abundance of a guide RNA targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold lower in the aggregation- negative population of cells in step (e) relative to the aggregation-positive population of cells in step (e), the cultured population of cells in step (c) at the first time point, and the seeded population of cells in step (d) at the second time point; and / or (4) the abundance of a guide RNA targeting the gene relative to the total population of the plurality of unique guide RNAs isat least 1.5-fold lower in theaggregation-negativepopulationof cells in step (e) relative to theaggregation-positive population of cells in step (e) and the seeded population of cells in step (d) at the second time point.

[0059] In some such methods, the following steps are taken in step (f) to identify a gene as a genetic modifier of tau aggregation, wherein disruption (CRISPRn) or transcriptional activation (CRISPRa) of the gene prevents tau aggregation (or as a candidate genetic modifier of tau aggregation, wherein disruption (CRISPRn) or transcriptional activation (CRISPRa) of the gene is expected to prevent tau aggregation): (1) identifying which of the plurality of unique guide RNAs are present in the aggregation-negative population of cells produced in step (e); (2) calculating the random chance of the guideRNAs identified in step (f)(1) beingpresent using the formula nCn’ * (x-n’)C(m-n) / xCm,wherein x is the variety of unique guide RNAs introduced into the population of cells in step (b), wherein m is the variety of unique guide RNAs identified in step (f)(1), wherein n is the variety of unique guide RNAs introduced into the population of cells in step (b) that target the gene, and wherein n’ is the variety of unique guide RNAs identified in step (f)(1) that target the gene; (3) calculatingaverageenrichment scores for theguideRNAs identified instep (f)(1),wherein theenrichment score foraguide RNA is the relative abundance of the guide RNA in the aggregation-negative population of cells produced in step (e) divided by the relative abundance of the guide RNA in the aggregation-positive population of cells produced in step (e) or the seededpopulationof cells in step (d), andwherein relativeabundance is the readcount of the guideRNAdividedby the read count of the total population of the plurality of unique guideRNAs; and (4) selecting the gene if a guideRNA targeting the gene is significantly below the randomchance of being present and above a threshold enrichment score. In somesuch methods, the following steps are taken in step (f) to identify a gene as a genetic modifier of tau aggregation, wherein disruption (CRISPRn) or transcriptional activation (CRISPRa) of the gene promotes or enhances tau aggregation (or as a candidate genetic modifier of tau aggregation, wherein disruption or transcriptional activation of the gene is expected to promote or enhance tau aggregation): (1) identifying which of the plurality of unique guide RNAs are present in the aggregation-positive population of cells produced in step (e); (2) calculating the random chance of the guide RNAs identified in step (f)(1) being present using the formula nCn’ * (x-n’)C(m-n) / xCm, wherein x is the variety of unique guide RNAs introduced into the population of cells in step (b), whereinm is the variety of unique guide RNAs identified in step (f) (1),wherein n is the variety of uniqueguideRNAs introduced into thepopulation of cells in step (b) that target the gene, and wherein n’ is the variety of unique guide RNAs identified in step (f)(1) that target the gene; (3) calculating average enrichment scores for the guideRNAs identified in step (f)(1), wherein the enrichment score for a guideRNA is the relative abundance of the guide RNA in the aggregation-positive population of cells produced in step (e) divided by the relative abundance of the guideRNA in the aggregation-negative population of cells produced in step (e) or the seededpopulation of cells in step (d), andwherein relative abundance is the read count of the guideRNAdivided by the read count of the total populationof theplurality of uniqueguideRNAs;and (4) selecting thegene if aguideRNA targeting thegene issignificantly below the random chance of being present and above a threshold enrichment score.

[0060] In some such methods, the first tau repeat domain and / or the second tau repeat domain is a human tau repeat domain. In some such methods, the first tau repeat domain and / or the second tau repeat domain comprises a pro- aggregationmutation.Optionally, the first tau repeat domain and / or the second tau repeat domain comprises a tauP301S mutation.

[0061] In some such methods, the first tau repeat domain and / or the second tau repeat domain comprises a tau four- repeat domain. In somesuchmethods, the first tau repeat domainand / or the second tau repeat domain comprisesSEQ ID NO: 11. In some suchmethods, the first tau repeat domain and the second tau repeat domain are the same. In some such methods, the first tau repeat domain and the second tau repeat domain are the same and each comprises tau four-repeat 9 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55 domain comprising a tau P301S mutation.

[0062] In somesuchmethods, first reporterand thesecond reporter arefluorescentproteins.Optionally, thefirst reporter and the second reporter are a fluorescence resonance energy transfer (FRET) pair. Optionally, the first reporter is cyan fluorescent protein (CFP) and the second reporter is yellow fluorescent protein (YFP).

[0063] In some such methods, the cells are eukaryotic cells. Optionally, the cells are mammalian cells. Optionally, the cells are human cells. Optionally, the cells are HEK293T cells.

[0064] In some suchmethods, the plurality of unique guideRNAs are introduced at a concentration selected such that a majority of the cells receive only one of the unique guideRNAs. In some suchmethods, the plurality of unique guideRNAs target 100 or more genes, 1000 or more genes, or 10000 or more genes. In some suchmethods, the library is a genome- wide library.

[0065] In some suchmethods, a plurality of target sequences are targeted on average in each of the targeted plurality of genes. Optionally, at least three target sequences are targeted on average in each of the targeted plurality of genes. Optionally, about three to about six target sequences (e.g., about three, about four, or about six) are targeted onaverage in each of the targeted plurality of genes. Optionally, about three target sequences are targeted on average in each of the targeted plurality of genes.

[0066] In some such methods, the plurality of unique guide RNAs are introduced into the population of cells by viral transduction. Optionally, each of the plurality of unique guide RNAs is in a separate viral vector. Optionally, the plurality of unique guide RNAs are introduced into the population of cells by lentiviral transduction. In some such methods, the population of cells is infected at a multiplicity of infection of less than about 0.3.

[0067] In somesuchmethods, theplurality of uniqueguideRNAsare introduced into thepopulationof cells togetherwith a selection marker, and step (b) further comprises selecting cells that comprise the selection marker. Optionally, the selectionmarker imparts resistance to a drug. Optionally, the selectionmarker imparts resistance to puromycin or zeocin. Optionally, the selection marker is selected from neomycin phosphotransferase, hygromycin B phosphotransferase, puromycin-N-acetyltransferase, and blasticidin S deaminase. Optionally, the selection marker is selected from neomycin phosphotransferase, hygromycin B phosphotransferase, puromycin-N-acetyltransferase, blasticidin S deaminase, and bleomycin resistance protein.

[0068] In somesuchmethods, the populationof cells intowhich theplurality of uniqueguideRNAsare introduced in step (b) comprises greater than about 300 cells per unique guide RNA.

[0069] In another aspect, provided are methods of screening for genetic modifiers of tau aggregation and / or disag- gregation. Some such methods (CRISPRn) comprise: (a) providing a population of cells comprising a Cas protein, a first tau repeat domain linked to a first reporter, and a second tau repeat domain linked to a second reporter, wherein the cells are tau-aggregation-positive cells inwhich a tau repeat domain stably presents in an aggregated state; (b) introducing into the population of cells a library comprising a plurality of unique guideRNAs that target a plurality of genes; (c) culturing the populationof cells toallowgenomeeditingandexpansion,wherein thepluralityof uniqueguideRNAs formcomplexeswith the Cas protein, and the Cas protein cleaves the plurality of genes resulting in knockout of gene function to produce a geneticallymodifiedpopulationof cells, andwherein the culturing results inanaggregation-positive populationof cells and an aggregation-negative population of cells; (d) identifying the aggregation-positive population of cells and the aggrega- tion-negative population of cells; and (e) determining abundance of each of the plurality of unique guide RNAs in the aggregation-positive population of cells identified in step (d) relative to the aggregation-negative population of cells identified in step (d) and / or the cultured population of cells at one or more time points in step (c), and / or determining abundance of each of the plurality of unique guide RNAs in the aggregation-negative population of cells identified in step (d) relative to the aggregation-positive population of cells identified in step (d) and / or the cultured population of cells at one ormore timepoints in step (c),whereinenrichmentof aguideRNA in theaggregation-negativepopulationof cells identified in step (d) relative to theaggregation-positive population of cells identified in step (d) and / or the culturedpopulation of cells at one or more time points in step (c) or wherein depletion of a guide RNA in the aggregation-positive population of cells identified in step (d) relative to the aggregation-negative population of cells identified in step (d) and / or cultured population of cells at one or more time points in step (c) indicates that the gene targeted by the guide RNA is a genetic modifier of tau disaggregation, wherein disruption of the gene targeted by the guide RNA promotes tau disaggregation, or is a candidate genetic modifier of tau disaggregation (e.g., for further testing via secondary screens), wherein disruption of the gene targeted by the guide RNA is expected to promote tau disaggregation, and / or wherein enrichment of a guide RNA in the aggregation-positive population of cells identified in step (d) relative to the aggregation-negative population of cells identified in step (d) and / or the cultured population of cells at one or more time points in step (c) or wherein depletion of a guide RNA in the aggregation-negative population of cells identified in step (d) relative to the aggregation-positive populationof cells identified instep (d)and / or culturedpopulationof cellsat oneormore timepoints in step (c) indicates that the gene targetedby the guideRNA is a geneticmodifier of tau aggregation, wherein disruption of the gene targeted by the guide RNA promotes or enhances tau aggregation, or is a candidate genetic modifier of tau aggregation (e.g., for further testing via secondary screens), wherein disruption of the gene targeted by the guide RNA is expected to promote or enhance tau aggregation. 10 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55

[0070] In some such methods, the Cas protein is a Cas9 protein. Optionally, Cas protein is Streptococcus pyogenes Cas9. In somesuchmethods, theCasprotein comprisesSEQ IDNO:21, optionallywherein theCasprotein is encodedby a coding sequence comprising the sequence set forth in SEQ ID NO: 22.

[0071] In some suchmethods, the Cas protein, the first tau repeat domain linked to the first reporter, and the second tau repeat domain linked to the second reporter are stably expressed in the population of cells. In somesuchmethods, nucleic acids encoding the Cas protein, the first tau repeat domain linked to the first reporter, and the second tau repeat domain linked to the second reporter are genomically integrated in the population of cells.

[0072] In some such methods, each guide RNA targets a constitutive exon. Optionally, each guide RNA targets a 5’ constitutive exon. In some such methods, each guide RNA targets a first exon, a second exon, or a third exon.

[0073] Some suchmethods (CRISPRa) comprise: (a) providing a population of cells comprising a chimeric Cas protein comprising a nuclease-inactive Cas protein fused to one or more transcriptional activation domains, a chimeric adaptor protein comprising an adaptor protein fused to one or more transcriptional activation domains, a first tau repeat domain linked toa first reporter, andasecond tau repeat domain linked toasecond reporter,wherein the cells are tau-aggregation- positive cells in which a tau repeat domain stably presents in an aggregated state; (b) introducing into the population of cells a library comprisingaplurality of uniqueguideRNAs that target aplurality of genes; (c) culturing thepopulationof cells to allow transcriptional activation and expansion, wherein the plurality of unique guide RNAs form complexes with the chimeric Cas protein and the chimeric adaptor protein, and the complexes activate transcription of the plurality of genes resulting in increased gene expression to produce a genetically modified population of cells, and wherein the culturing results in an aggregation-positive population of cells and an aggregation-negative population of cells; (d) identifying the aggregation-positive population of cells and the aggregation-negative population of cells; and (e) determining abundance of each of the plurality of unique guide RNAs in the aggregation-positive population of cells identified in step (d) relative to theaggregation-negative population of cells identified in step (d) and / or the culturedpopulation of cells at oneormore time points in step (c), and / or determining abundance of each of the plurality of unique guideRNAs in the aggregation-negative population of cells identified in step (d) relative to the aggregation-positive population of cells identified in step (d) and / or the cultured population of cells at one or more time points in step (c), wherein enrichment of a guide RNA in the aggregation-negative population of cells identified in step (d) relative to the aggregation-positive population of cells identified in step (d) and / or the cultured population of cells at one or more time points in step (c) or wherein depletion of a guide RNA in the aggregation-positive population of cells identified in step (d) relative to the aggregation-negative populationof cells identified instep (d)and / or culturedpopulationof cellsat oneormore timepoints in step (c) indicates that the gene targeted by the guide RNA is a genetic modifier of tau disaggregation, wherein transcriptional activation of the gene targeted by the guide RNA promotes tau disaggregation, or is a candidate genetic modifier of tau disaggregation (e.g., for further testing via secondary screens),wherein transcriptional activation of the gene targeted by theguideRNA is expected topromote taudisaggregation, and / orwhereinenrichmentof aguideRNA in theaggregation-positivepopulation of cells identified in step (d) relative to the aggregation-negative population of cells identified in step (d) and / or the cultured population of cells at one or more time points in step (c) or wherein depletion of a guide RNA in the aggregation-negative population of cells identified in step (d) relative to the aggregation-positive population of cells identified in step (d) and / or cultured population of cells at one or more time points in step (c) indicates that the gene targeted by the guide RNA is a genetic modifier of tau aggregation, wherein transcriptional activation of the gene targeted by the guide RNA promotes or enhances tau aggregation, or is a candidate genetic modifier of tau aggregation (e.g., for further testing via secondary screens), wherein transcriptional activation of the gene targeted by the guide RNA is expected to promote or enhance tau aggregation.

[0074] In some suchmethods, theCas protein is aCas9 protein. Optionally, theCas protein isStreptococcus pyogenes Cas9. In some such methods, the chimeric Cas protein comprises the nuclease-inactive Cas protein fused to a VP64 transcriptional activation domain, optionally wherein the chimeric Cas protein comprises from N-terminus to C-terminus: the nuclease-inactive Cas protein; a nuclear localization signal; and the VP64 transcriptional activator domain. In some suchmethods, the adaptor protein is anMS2 coat protein, andwherein the one ormore transcriptional activation domains in the chimeric adaptor protein comprise a p65 transcriptional activation domain and an HSF1 transcriptional activation domain, optionallywherein the chimeric adaptor protein comprises fromN-terminus toC-terminus: theMS2coat protein; a nuclear localization signal; the p65 transcriptional activation domain; and the HSF1 transcriptional activation domain. In some such methods, the chimeric Cas protein comprises SEQ ID NO: 36, optionally wherein the chimeric Cas protein is encoded by a coding sequence comprising the sequence set forth in SEQ IDNO: 38. In some suchmethods, the chimeric adaptor protein comprises SEQ ID NO: 37, optionally wherein the chimeric adaptor protein is encoded by a coding sequence comprising the sequence set forth in SEQ ID NO: 39.

[0075] In some suchmethods, the chimeric Cas protein, the chimeric adaptor protein, the first tau repeat domain linked to the first reporter, and the second tau repeat domain linked to the second reporter are stably expressed in the population of cells. In some suchmethods, nucleic acids encoding the chimeric Cas protein, the chimeric adaptor protein, the first tau repeat domain linked to the first reporter, and the second tau repeat domain linked to the second reporter are genomically integrated in the population of cells. 11 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55

[0076] In some such methods, each guide RNA targets a guide RNA target sequence within 200 bp upstream of a transcription start site. In somesuchmethods, eachguideRNAcomprises oneormoreadaptor-binding elements towhich the chimeric adaptor protein can specifically bind.Optionally, each guideRNAcomprises twoadaptor-binding elements to which the chimeric adaptor protein can specifically bind. Optionally, a first adaptor-binding element is within a first loop of each of the one or more guide RNAs, and a second adaptor-binding element is within a second loop of each of the one or moreguideRNAs.Optionally, theadaptor-bindingelement comprises thesequenceset forth inSEQ IDNO:33.Optionally, each of one or more guide RNAs is a single guide RNA comprising a CRISPR RNA (crRNA) portion fused to a transactivating CRISPR RNA (tracrRNA) portion, and the first loop is the tetraloop corresponding to residues 13‑16 of SEQ ID NO: 17, and the second loop is the stem loop 2 corresponding to residues 53‑56 of SEQ ID NO: 17.

[0077] In some suchmethods, step (c) is about 3 days to about 14 days.Optionally, step (c) is about 10 days to about 14 days or about 12 days to about 14 days.

[0078] In some such methods, step (d) comprises synchronizing cell cycle progression to obtain a cell population predominantly enriched in S phase. Optionally, the synchronization is achieved by double thymidine block.

[0079] In some such methods, the first reporter and the second reporter are a fluorescence resonance energy transfer (FRET) pair, and the aggregation-positive population of cells and the aggregation-negative population of cells in step (d) is identified by flow cytometry. In some such methods, abundance is determined by next-generation sequencing.

[0080] In some such methods, a guide RNA is considered enriched in the aggregation-negative population of cells in step (d) if the abundance of the guide RNA relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold higher in the aggregation-negative population of cells in step (d) relative to the aggregation-positive population of cells in step (d) and / or the cultured population of cells at one or more time points in step (c), and wherein a guide RNA is considereddepleted in theaggregation-positive population of cells in step (d) if the abundanceof the guideRNA relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold lower in the aggregation-positive population of cells in step (d) relative to the aggregation-negative population of cells in step (d) and / or the cultured population of cells at oneormore timepoints in step (c), orwhereinaguideRNA isconsideredenriched in theaggregation-positivepopulationof cells in step (d) if the abundance of the guideRNA relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold higher in the aggregation-positive population of cells in step (d) relative to the aggregation-negative population of cells in step (d) and / or the cultured population of cells at one or more time points in step (c), and wherein aguideRNA is considereddepleted in theaggregation-negativepopulationof cells in step (d) if theabundanceof theguide RNA relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold lower in the aggregation- negative population of cells in step (d) relative to the aggregation-positive population of cells in step (d) and / or the cultured population of cells at one or more time points in step (c).

[0081] In some suchmethods, step (e) comprises determining abundance of each of the plurality of unique guideRNAs in the aggregation-negative population of cells in step (d) relative to the aggregation-positive population of cells in step (d), the culturedpopulation of cells in step (c) at a first timepoint, and the culturedpopulation of cells in step (c) at a second time point, and / or wherein step (e) comprises determining abundance of each of the plurality of unique guide RNAs in the aggregation-positive population of cells in step (d) relative to the aggregation-negative population of cells in step (e), the cultured population of cells in step (c) at a first time point, and the cultured population of cells in step (c) at a second time point. Optionally, the first time point in step (c) is at a first passage of culturing the population of cells, and the second time point is in themiddle of culturing the population of cells to allow genomeediting and expansion or transcriptional activation and expansion. Optionally, the first time point in step (c) is after about 7 days of culturing, and the second time point in step (c) is after about 10 days of culturing.

[0082] In some such methods, a gene is considered a genetic modifier of tau disaggregation, wherein disruption (CRISPRn) or transcriptional activation (CRISPRa) of the gene promotes tau disaggregation (or a candidate genetic modifier of tau disaggregation, wherein disruption or transcriptional activation of the gene is expected to promote tau disaggregation), if: (1) the abundance of a guide RNA targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold higher in the aggregation-negative population of cells in step (d) relative to the aggregation-positive population of cells in step (d), the cultured population of cells in step (c) at the first time point, and the culturedpopulation of cells in step (c) at the second timepoint; and / or (2) the abundanceof aguideRNA targeting thegene relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold higher in the aggregation-negative population of cells in step (d) relative to the aggregation-positive population of cells in step (d) and the cultured population of cells in step (c) at the second time point; and / or (3) the abundance of a guideRNA targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold lower in the aggregation-positive population of cells in step (d) relative to the aggregation-negative population of cells in step (d), the cultured population of cells in step (c) at the first time point, and the cultured population of cells in step (c) at the second time point; and / or (4) the abundance of a guide RNA targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold lower in the aggregation-positive population of cells in step (d) relative to the aggregation-negative population of cells in step (d) and the cultured population of cells in step (c) at the second time point. In some suchmethods, a gene is considered a genetic modifier of tau aggregation, wherein disruption (CRISPRn) or transcriptional activation (CRISPRa) of the gene promotes 12 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55 or enhances tau aggregation (or a candidate genetic modifier of tau aggregation, wherein disruption or transcriptional activation of the gene is expected to promote or enhance tau aggregation), if: (1) the abundance of a guide RNA targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold higher in the aggregation- positive population of cells in step (d) relative to the aggregation-negative population of cells in step (d), the cultured population of cells in step (c) at the first time point, and the cultured population of cells in step (c) at the second time point; and / or (2) the abundance of a guide RNA targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold higher in the aggregation-positive population of cells in step (d) relative to the aggregation- negative population of cells in step (d) and the culturedpopulation of cells in step (c) at the second timepoint; and / or (3) the abundanceof aguideRNA targeting thegene relative to the total populationof theplurality of uniqueguideRNAs is at least 1.5-fold lower in the aggregation-negative population of cells in step (d) relative to the aggregation-positive population of cells in step (d), the cultured population of cells in step (c) at the first time point, and the cultured population of cells in step (c) at the second time point; and / or (4) the abundance of a guide RNA targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold lower in the aggregation-negative population of cells in step (d) relative to the aggregation-positive population of cells in step (d) and the cultured population of cells in step (c) at the second time point.

[0083] In some such methods, the following steps are taken in step (e) to identify a gene as a genetic modifier of tau disaggregation, wherein disruption (CRISPRn) or transcriptional activation (CRISPRa) of the gene promotes tau disaggregation (or a candidate genetic modifier of tau disaggregation, wherein disruption or transcriptional activation of the gene is expected to promote tau disaggregation): (1) identifying which of the plurality of unique guide RNAs are present in theaggregation-negative population of cells identified in step (d); (2) calculating the randomchanceof the guide RNAs identified in step (e)(1) being present using the formula nCn’ * (x-n’)C(m-n) / xCm, wherein x is the variety of unique guide RNAs introduced into the population of cells in step (b), wherein m is the variety of unique guide RNAs identified in step (e)(1), wherein n is the variety of unique guide RNAs introduced into the population of cells in step (b) that target the gene, and wherein n’ is the variety of unique guide RNAs identified in step (e)(1) that target the gene; (3) calculating average enrichment scores for the guide RNAs identified in step (e)(1), wherein the enrichment score for a guide RNA is the relative abundance of the guideRNA in theaggregation-negative population of cells identified in step (d) divided by the relative abundance of the guide RNA in the aggregation-positive population of cells identified in step (d) or the cultured population of cells in step (c) at the first time point or the second time point, and wherein relative abundance is the read count of the guide RNA divided by the read count of the total population of the plurality of unique guide RNAs; and (4) selecting thegene if aguideRNA targeting thegene is significantly below the randomchanceof beingpresent andabovea threshold enrichment score. In some suchmethods, the following steps are taken in step (e) to identify a gene as a genetic modifier of tau aggregation, wherein disruption (CRISPRn) or transcriptional activation (CRISPRa) of the gene promotes or enhances tau aggregation (or a candidate genetic modifier of tau aggregation, wherein disruption or transcriptional activation of the gene is expected to promote or enhance tau aggregation): (1) identifying which of the plurality of unique guide RNAs are present in the aggregation-positive population of cells identified in step (d); (2) calculating the random chance of the guide RNAs identified in step (e)(1) being present using the formula nCn’ * (x-n’)C(m-n) / xCm, wherein x is the variety of unique guideRNAs introduced into the population of cells in step (b), whereinm is the variety of unique guide RNAs identified in step (e)(1), wherein n is the variety of unique guide RNAs introduced into the population of cells in step (b) that target the gene, andwherein n’ is the variety of unique guide RNAs identified in step (e)(1) that target the gene; (3) calculating average enrichment scores for the guide RNAs identified in step (e)(1), wherein the enrichment score for a guide RNA is the relative abundance of the guide RNA in the aggregation-positive population of cells identified in step (d) divided by the relative abundance of the guide RNA in the aggregation-negative population of cells identified in step (d) or the cultured population of cells in step (c) at the first time point or the second time point, andwherein relative abundance is the read count of the guideRNAdivided by the read count of the total population of the plurality of unique guideRNAs; and (4) selecting the gene if a guide RNA targeting the gene is significantly below the random chance of being present and above a threshold enrichment score.

[0084] In some such methods, the first tau repeat domain and / or the second tau repeat domain is a human tau repeat domain. In some such methods, the first tau repeat domain and / or the second tau repeat domain comprises a pro- aggregationmutation. Optionally, the first tau repeat domain and / or the second tau repeat domain comprises a tauP301S mutation.

[0085] In some such methods, the first tau repeat domain and / or the second tau repeat domain comprises a tau four- repeat domain. In somesuchmethods, the first tau repeat domainand / or the second tau repeat domain comprisesSEQ ID NO: 11. In some suchmethods, the first tau repeat domain and the second tau repeat domain are the same. In some such methods, the first tau repeat domain and the second tau repeat domain are the same and each comprises tau four-repeat domain comprising a tau P301S mutation.

[0086] In somesuchmethods, first reporterand thesecond reporter arefluorescentproteins.Optionally, thefirst reporter and the second reporter are a fluorescence resonance energy transfer (FRET) pair. Optionally, the first reporter is cyan fluorescent protein (CFP) and the second reporter is yellow fluorescent protein (YFP). 13 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55

[0087] In some such methods, the cells are eukaryotic cells. Optionally, the cells are mammalian cells. Optionally, the cells are human cells. Optionally, the cells are HEK293T cells.

[0088] In some suchmethods, the plurality of unique guideRNAs are introduced at a concentration selected such that a majority of the cells receive only one of the unique guideRNAs. In some suchmethods, the plurality of unique guideRNAs target 100 or more genes, 1000 or more genes, or 10000 or more genes. In some suchmethods, the library is a genome- wide library.

[0089] In some suchmethods, a plurality of target sequences are targeted on average in each of the targeted plurality of genes. Optionally, at least three target sequences are targeted on average in each of the targeted plurality of genes. Optionally, about three to about six target sequences (e.g., about three, about four, or about six) are targeted onaverage in each of the targeted plurality of genes. Optionally, about three target sequences are targeted on average in each of the targeted plurality of genes.

[0090] In some such methods, the plurality of unique guide RNAs are introduced into the population of cells by viral transduction. Optionally, each of the plurality of unique guide RNAs is in a separate viral vector. Optionally, the plurality of unique guide RNAs are introduced into the population of cells by lentiviral transduction. In some such methods, the population of cells is infected at a multiplicity of infection of less than about 0.3.

[0091] In somesuchmethods, theplurality of uniqueguideRNAsare introduced into thepopulationof cells togetherwith a selection marker, and step (b) further comprises selecting cells that comprise the selection marker. Optionally, the selectionmarker imparts resistance to a drug. Optionally, the selectionmarker imparts resistance to puromycin or zeocin. Optionally, the selection marker is selected from neomycin phosphotransferase, hygromycin B phosphotransferase, puromycin-N-acetyltransferase, and blasticidin S deaminase. Optionally, the selection marker is selected from neomycin phosphotransferase, hygromycin B phosphotransferase, puromycin-N-acetyltransferase, blasticidin S deaminase, and bleomycin resistance protein.

[0092] In somesuchmethods, the populationof cells intowhich theplurality of uniqueguideRNAsare introduced in step (b) comprises greater than about 300 cells per unique guide RNA.

[0093] In another aspect, provided areCas-tau biosensor cells or populations of such cells. Somesuch cells comprise a populationofoneormorecells comprisingaCasprotein, afirst tau repeatdomain linked toafirst reporter, andasecond tau repeat domain linked to a second reporter.

[0094] In some such cells, the first tau repeat domain and / or the second tau repeat domain is a human tau repeat domain. In some such cells, the first tau repeat domain and / or the second tau repeat domain comprises a pro-aggregation mutation. Optionally, the first tau repeat domain and / or the second tau repeat domain comprises a tau P301 S mutation.

[0095] In some such cells, the first tau repeat domain and / or the second tau repeat domain comprises a tau four-repeat domain. In some such cells, the first tau repeat domain and / or the second tau repeat domain comprises SEQ IDNO: 11. In some such cells, the first tau repeat domain and the second tau repeat domain are the same. In some such cells, the first tau repeatdomainand thesecond tau repeatdomainare thesameandeachcomprises tau four-repeat domaincomprising a tau P301S mutation.

[0096] In somesuchcells, the first reporter and the second reporter are fluorescent proteins.Optionally, the first reporter and the second reporter are a fluorescence resonance energy transfer (FRET) pair. Optionally, the first reporter is cyan fluorescent protein (CFP) and the second reporter is yellow fluorescent protein (YFP).

[0097] In some such cells, the Cas protein is a Cas9 protein. Optionally, the Cas protein is Streptococcus pyogenes Cas9.Optionally, theCas protein comprises SEQ IDNO: 21.Optionally, theCas protein is encoded by a coding sequence comprising the sequence set forth in SEQ ID NO: 22.

[0098] In some such cells, the Cas protein, the first tau repeat domain linked to the first reporter, and the second tau repeat domain linked to the second reporter are stably expressed in the cell. In somesuchcells, nucleic acidsencoding the Cas protein, the first tau repeat domain linked to the first reporter, and the second tau repeat domain linked to the second reporter are genomically integrated in the cell.

[0099] In some such cells, the cells are eukaryotic cells. Optionally, the cells are mammalian cells. Optionally, the cells are human cells. Optionally, the cells are HEK293T cells. Some such cells are in vitro.

[0100] In some such cells, wherein the first tau repeat domain linked to the first reporter and the second tau repeat domain linked to the second reporter are not stably present in an aggregated state. In some such cells, the first tau repeat domain linked to the first reporter and the second tau repeat domain linked to the second reporter stably present in an aggregated state.

[0101] In another aspect, provided are in vitro cultures of Cas-tau biosensor cells and conditionedmedium. Some such in vitro cultures comprise any of the populations of cells described above or elsewhere herein and a culture medium comprising a conditioned medium harvested from cultured tau-aggregation-positive cells in which a tau repeat domain stably presents in an aggregated state.

[0102] In some such in vitro cultures, the conditionedmediumwas harvested after being on confluent tau-aggregation- positive cells for about 1 to about 7 days. Optionally, the conditioned mediumwas harvested after being on confluent tau- aggregation-positive cells for about 4 days. 14 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55

[0103] In some such in vitro cultures, the culture medium comprises about 75% conditioned medium and about 25% fresh medium. In some such in vitro cultures, the population of cells is not co-cultured with the cultured tau-aggregation- positive cells in which a tau repeat domain stably presents in an aggregated state.

[0104] Inanotheraspect, providedareSAM-taubiosensor cells orpopulationsof suchcells.Somesuchcells comprisea population of oneormore cells comprising a chimericCasprotein comprisinganuclease-inactiveCasprotein fused toone ormore transcriptional activation domains, a chimeric adaptor protein comprising an adaptor protein fused to one ormore transcriptional activationdomains, a first tau repeat domain linked toa first reporter, andasecond tau repeat domain linked to a second reporter.

[0105] In some such cells, the first tau repeat domain and / or the second tau repeat domain is a human tau repeat domain. In some such cells, the first tau repeat domain and / or the second tau repeat domain comprises a pro-aggregation mutation. Optionally, the first tau repeat domain and / or the second tau repeat domain comprises a tau P301S mutation.

[0106] In some such cells, the first tau repeat domain and / or the second tau repeat domain comprises a tau four-repeat domain. In some such cells, the first tau repeat domain and / or the second tau repeat domain comprises SEQ IDNO: 11. In some such cells, the first tau repeat domain and the second tau repeat domain are the same. In some such cells, the first tau repeatdomainand thesecond tau repeatdomainare thesameandeachcomprises tau four-repeat domaincomprising a tau P301S mutation.

[0107] In somesuchcells, the first reporter and the second reporter are fluorescent proteins.Optionally, the first reporter and the second reporter are a fluorescence resonance energy transfer (FRET) pair. Optionally, the first reporter is cyan fluorescent protein (CFP) and the second reporter is yellow fluorescent protein (YFP).

[0108] In some such cells, the Cas protein is a Cas9 protein. Optionally, the Cas protein is Streptococcus pyogenes Cas9. In some such cells, the chimeric Cas protein comprises the nuclease-inactive Cas protein fused to a VP64 transcriptional activation domain, optionally wherein the chimeric Cas protein comprises from N-terminus to C-terminus: the nuclease-inactive Cas protein; a nuclear localization signal; and the VP64 transcriptional activator domain. In some suchcells, theadaptorprotein isanMS2coatprotein, andwherein theoneormore transcriptional activationdomains in the chimeric adaptor protein comprise a p65 transcriptional activation domain and anHSF1 transcriptional activation domain, optionally wherein the chimeric adaptor protein comprises fromN-terminus toC-terminus: theMS2 coat protein; a nuclear localization signal; the p65 transcriptional activation domain; and the HSF1 transcriptional activation domain. In some suchcells, thechimericCasprotein comprisesSEQ IDNO:36, optionallywherein thechimericCasprotein is encodedbya coding sequence comprising the sequence set forth in SEQ ID NO: 38. In some such cells, the chimeric adaptor protein comprises SEQ ID NO: 37, optionally wherein the chimeric adaptor protein is encoded by a coding sequence comprising the sequence set forth in SEQ ID NO: 39.

[0109] In somesuchcells, the chimericCasprotein, thechimeric adaptor protein, the first tau repeat domain linked to the first reporter, and the second tau repeat domain linked to the second reporter are stably expressed in the cell. In somesuch cells, nucleicacidsencoding thechimericCasprotein, thechimericadaptorprotein, thefirst tau repeatdomain linked to the first reporter, and the second tau repeat domain linked to the second reporter are genomically integrated in the cell.

[0110] In some such cells, the cells are eukaryotic cells. Optionally, the cells are mammalian cells. Optionally, the cells are human cells. Optionally, the cells are HEK293T cells. Some such cells are in vitro.

[0111] In some such cells, wherein the first tau repeat domain linked to the first reporter and the second tau repeat domain linked to the second reporter are not stably present in an aggregated state. In some such cells, the first tau repeat domain linked to the first reporter and the second tau repeat domain linked to the second reporter stably present in an aggregated state.

[0112] In another aspect, provided are in vitro cultures of SAM-tau biosensor cells and conditionedmedium. Some such in vitro cultures comprise any of the populations of cells described above or elsewhere herein and a culture medium comprising a conditioned medium harvested from cultured tau-aggregation-positive cells in which a tau repeat domain stably presents in an aggregated state.

[0113] In some such in vitro cultures, the conditionedmediumwas harvested after being on confluent tau-aggregation- positive cells for about 1 to about 7 days. Optionally, the conditioned mediumwas harvested after being on confluent tau- aggregation-positive cells for about 4 days.

[0114] In some such in vitro cultures, the culture medium comprises about 75% conditioned medium and about 25% fresh medium. In some such in vitro cultures, the population of cells is not co-cultured with the cultured tau-aggregation- positive cells in which a tau repeat domain stably presents in an aggregated state.

[0115] In another aspect, provided are in vitro cultures of Cas-tau biosensor cells or SAM-tau biosensor cells and a culture medium comprising a cell lysate from cultured tau-aggregation-positive cells in which a tau repeat domain stably presents in an aggregated state. Some such in vitro cultures comprise any of the populations of cells described above or elsewhere herein.

[0116] In some such in vitro cultures, the cell lysate in the medium is at a concentration of about 1 to about 5 µg / mL. In some such in vitro cultures, themedium comprising the cell lysate further comprises lipofectamine or another transfection reagent.Optionally, themediumcomprising thecell lysate comprises lipofectamineataconcentrationof about1.5 toabout 15 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55 4µL / mL. In some such in vitro cultures, the cell lysatewas produced by sonication of the tau-aggregation-positive cells for about 2 minutes to about 4 minutes after collecting the cells in a buffer comprising protease inhibitors.

[0117] In another aspect, provided are methods of producing conditioned medium for inducing or sensitizing to tau aggregation. Some such methods comprise: (a) providing a population of tau-aggregation-positive cells in which a tau repeat domain stably presents in an aggregated state; (b) culturing the population of tau-aggregation-positive cells in a medium to produce a conditioned medium; and (c) harvesting the conditioned medium.

[0118] In some such methods, the tau-aggregation-positive cells are cultured in step (b) to confluence. Optionally, the conditionedmedium is harvested after being on the confluent tau-aggregation-positive cells in step (c) for about 1 to about 7 days.Optionally, the conditionedmedium is harvested after being on the confluent tau-aggregation-positive cells in step (c) for about 4 days.

[0119] In another aspect, providedaremethodsof generatingapopulation of tau-aggregation-positive cells. Somesuch methods comprise: (a) producing a conditioned medium for inducing tau aggregation according to any of the methods described above or elsewhere herein; and (b) culturing a population of cells comprising a protein comprising a tau repeat domain in a culture medium comprising the conditioned medium to produce the population of tau-aggregation-positive cells.

[0120] In some such methods, the culture medium comprises about 75% conditioned medium and about 25% fresh medium. In some such methods, the population of cells is not co-cultured with the tau-aggregation-positive cells used in the method to produce the conditioned medium.

[0121] In somesuchmethods, the tau repeat domaincomprisesapro-aggregationmutation. In somesuchmethods, the tau repeat domain comprises a tau P301Smutation. In some suchmethods, the tau repeat domain comprises a tau four- repeat domain. In some such methods, the tau repeat domain comprises SEQ ID NO: 11.

[0122] In another aspect, provided are methods of producing a medium comprising a cell lysate from cultured tau- aggregation-positive cells for inducing tau aggregation. Some such methods comprise: (a) providing a population of tau- aggregation-positive cells in which a tau repeat domain stably presents in an aggregated state; (b) collecting the tau- aggregation-positive cells in a buffer comprising protease inhibitors; (c) sonicating the tau-aggregation-positive cells for about 2 minutes to about 4 minutes to produce the cell lysate; and (d) adding the cell lysate to a growth medium.

[0123] In some such methods, the cell lysate in the growth medium is at a concentration of about 1 to about 5 µg / mL. Some suchmethods further comprise adding lipofectamine or another transfection reagent to the growth medium in step (d). Optionally, step (d) comprising adding lipofectamine at a concentration of about 1.5 to about 4 µL / mL.

[0124] In another aspect, providedaremethodsof generatingapopulationof tau-aggregation-positive cells. Somesuch methods comprise: (a) producing a medium comprising a cell lysate from cultured tau-aggregation-positive cells according to the any of the above methods; and (b) culturing a population of cells comprising a protein comprising a tau repeat domain in the medium comprising a cell lysate from cultured tau-aggregation-positive cells.

[0125] In some such methods, the population of cells is not co-cultured with the tau-aggregation-positive cells used in the method to produce the conditioned medium.

[0126] In somesuchmethods, the tau repeat domaincomprisesapro-aggregationmutation. In somesuchmethods, the tau repeat domain comprises a tau P301Smutation. In some suchmethods, the tau repeat domain comprises a tau four- repeat domain. In some such methods, the tau repeat domain comprises SEQ ID NO: 11. BRIEF DESCRIPTION OF THE FIGURES

[0127] Figure 1 (not to scale) shows a schematic of tau isoform2N4R. The tau biosensor lines include only tau4RD-YFPand tau4RD-CFP as transgenes, not the full 2N4R. Figure 2 shows a schematic of how aggregate formation is monitored by fluorescence resonance energy transfer (FRET) in tau biosensor cell lines. The tau4RD‑CFP protein is excited by violet light and emits blue light. The tau4RD‑YFP fusion protein is excited by blue light and emits yellow light. If there is no aggregation, excitation by violet light will not lead to FRET. If there is tau aggregation, excitation by violet light will lead to FRET and yellow light emission. Figure 3A shows relative Cas9 mRNA expression in tau4RD‑CFP / tau4RD‑YFP (TCY) biosensor cell clones trans- duced with lentiviral Cas9 expression constructs relative to clone Cas9H1, which is a control underperforming Cas9- expression TCY clone that was previously isolated. Figure 3B shows cutting efficiency at the PERK locus and the SNCA locus in the Cas9 TCY clones three and seven days after transduction with sgRNAs targeting PERK and SNCA respectively. Figure 4 shows a schematic of the strategy for disruption of target genes inCas9TCYbiosensor cell using a genome- wide CRISPR / Cas9 sgRNA library. Figure 5 is a schematic showing derivation of tau4RD‑YFP Agg[+] subclones containing stably propagating tau 16 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55 aggregates when tau4RD‑YFP cells are seeded with tau4RD fibrils. A fluorescence microscopy image showing the subclone with tau aggregates is also shown. Figure 6 is a schematic showing that conditioned medium from tau4RD‑YFPAgg[+] subclones collected after three days on confluent cells can provide a source of tau aggregation activity whereas medium from tau4RD‑YFP Agg[‑] subclones does not. Conditioned medium was applied to recipient cells as 75% conditioned medium and 25% fresh medium.Fluorescence-activatedcell sorting (FACS)analysis imagesareshown foreach.Thex-axis showsCFP(405 nm laser excitation), and they-axis showsFRET (excitation fromCFPemission). Theupper right quadrant is FRET[+], the lower right quadrant is CFP[+], and the lower left quadrant is double-negative. Figure 7 is a schematic showing the strategy for a genome-wide CRISPR nuclease (CRISPRn) screen to identify modifier genes that promote tau aggregation. Figure 8 is a schematic showing the concepts of abundance and enrichment for next-generation sequencing (NGS) analysis using the gnome-wide CRISPRn screen. Figure 9 shows a schematic for secondary screening for Target Genes 1‑14 identified in the genome-wide screen for modifier genes that promote tau aggregation. Figure 10 is a graph showing FRET induction by tau aggregate conditioned medium in Cas9 TCY biosensor cells transduced with lentiviral expression constructs for sgRNAs targeting Target Genes 1‑14. The secondary screen confirmed that Target Genes 2 and 8 modulate cell susceptibility to tau seeding / aggregation. Figure 11 shows FACS analysis images for Cas9 TCY biosensor cells transduced with lentiviral expression constructs for Target Gene 2 gRNA1, Target Gene 8 gRNA5, a non-targeting gRNA, and no gRNA. The cells were cultured in conditioned medium or fresh medium. The x-axis shows CFP (405 nm laser excitation), and the y-axis showsFRET (excitation fromCFPemission). The upper right quadrant is FRET[+], the lower right quadrant isCFP[+], and the lower left quadrant is double-negative. Disruption of Target Gene 2 or 8 increases the formation of tau aggregates in response to tau aggregate conditioned medium but not fresh medium. Figure 12 shows a schematic for secondary screening in Cas9 TCY biosensor cells transduced with lentiviral expression constructs for sgRNAs targeting Target Genes 2 and 8, including mRNA expression analysis, protein expression analysis, andFRETanalysis. Two sgRNAswere usedagainst TargetGene 2 (g1 andg3), one sgRNAwas used against Target Gene 8 (g5), and a non-targeting sgRNA (g3) was used as a non-targeting control. Figure13 shows relativeexpression of TargetGene2andTargetGene8 inCas9TCYbiosensor cells as assessedby qRT-PCR at Day 6 following transduction with the lentiviral sgRNA expression constructs. Figure 14 shows expression of Protein 2 (encoded by Target Gene 2) and Protein 8 (encoded by Target Gene 8) in Cas9 TCY biosensor cells as assessed by western blot at Day 13 following transduction with the lentiviral sgRNA expression constructs. Figure 15 shows tau aggregation as measured by percent FRET[+] cells in Cas9 TCY biosensor cells at Day 10 following transduction with the lentiviral sgRNA expression constructs. No lipofectamine was used. Figure16showsexpressionofTargetGene2andTargetGene8 in theknockdownCas9TCYcell clonesasassessed by western blot. Figure 17 shows expression of tau aggregation in the Target Gene 2 and Target Gene 8 knockdown Cas9 TCY cell clones as assessed by FRET. Figure18showsexpressionofTargetGene2andTargetGene8 in theknockdownCas9TCYcell clonesasassessed by western blot and phosphorylation of tau at positions S262 and S356 in those clones as assessed by western blot. Figure 19 shows whole cell lysate from tau-YFPAgg[+] clone18 can induce tau aggregation and FRETsignal in tau biosensor cells. Different amounts of whole cell lysate were tested, and different sonication conditions for producing the lysate were tested. Figure 20 shows whole cell lysate from tau-YFPAgg[+] clone18 can induce tau aggregation and FRETsignal in tau biosensor cells. Different amounts of whole cell lysate were tested, and different amounts of lipofectamine were tested. Figure 21 shows whole cell lysate from tau-YFPAgg[+] clone18 can induce tau aggregation and FRETsignal in tau biosensor cells butwhole cell lysate fromAgg[‑] clones cannot.Different amountsofwhole cell lysatewere tested, and different amounts of lipofectamine were tested. Figure 22 shows a schematic showing the strategy for a genome-wide CRISPR nuclease (CRISPRn) screen to identify modifier genes that prevent tau aggregation. Figure 23 is a graph showing the identification of genes with uniquely enriched sgRNAs in FRET[‑] samples. Figure 24 is a graph showing the identification of genes with uniquely depleted sgRNAs in FRET[‑] samples. Figure 25 shows a schematic showing the strategy for secondary screening to confirm identifiedmodifier genes that prevent tau aggregation. Figure 26 shows a schematic showing the strategy for a genome-wide CRISPR activation (CRISPRa) screen to identify modifier genes that prevent tau aggregation. Figure 27 shows a schematic showing the strategy for a genome-wide CRISPR nuclease (CRISPRn) screen to 17 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55 identify modifier genes that promote tau disaggregation. Figure 28 shows gating used for sorting Agg[+], speckles[+], and Agg[‑] cell populations. Figure 29 shows a schematic for a thymidine block strategy used in the genome-wideCRISPR nuclease (CRISPRn) screen to identify modifier genes that promote tau disaggregation. DEFINITIONS

[0128] The terms "protein," "polypeptide," and "peptide," used interchangeablyherein, includepolymeric formsof amino acids of any length, including coded and non-coded amino acids and chemically or biochemically modified or derivatized amino acids. The terms also include polymers that have been modified, such as polypeptides having modified peptide backbones. The term "domain" refers to any part of a protein or polypeptide having a particular function or structure.

[0129] Proteins are said to have an "N-terminus" and a "C-terminus." The term "N-terminus" relates to the start of a protein or polypeptide, terminated by an amino acid with a free amine group (-NH2). The term "C-terminus" relates to the end of an amino acid chain (protein or polypeptide), terminated by a free carboxyl group (-COOH).

[0130] The terms "nucleic acid" and "polynucleotide," used interchangeably herein, include polymeric forms of nucleotides of any length, including ribonucleotides, deoxyribonucleotides, or analogs or modified versions thereof. They include single‑, double‑, and multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, and polymers comprising purine bases, pyrimidine bases, or other natural, chemicallymodified, biochemically modified, non-natural, or derivatized nucleotide bases.

[0131] Nucleic acids are said to have "5’ ends" and "3’ ends" because mononucleotides are reacted to make oligonucleotides in a manner such that the 5’ phosphate of onemononucleotide pentose ring is attached to the 3’ oxygen of its neighbor inonedirectionviaaphosphodiester linkage.Anendofanoligonucleotide is referred toas the "5’ end" if its 5’ phosphate is not linked to the3’ oxygenof amononucleotidepentose ring.Anendof anoligonucleotide is referred toas the "3’ end" if its 3’ oxygen is not linked to a 5’ phosphate of another mononucleotide pentose ring. A nucleic acid sequence, even if internal to a larger oligonucleotide, also may be said to have 5’ and 3’ ends. In either a linear or circular DNA molecule, discrete elements are referred to as being "upstream" or 5’ of the "downstream" or 3’ elements.

[0132] The term "genomically integrated" refers to a nucleic acid that has been introduced into a cell such that the nucleotide sequence integrates into the genome of the cell. Any protocol may be used for the stable incorporation of a nucleic acid into the genome of a cell.

[0133] The term "targeting vector" refers to a recombinant nucleic acid that can be introduced by homologous recombination, non-homologous-end-joining-mediated ligation, or any other means of recombination to a target position in the genome of a cell.

[0134] The term "viral vector" refers to a recombinant nucleic acid that includes at least one element of viral origin and includes elements sufficient for or permissive of packaging into a viral vector particle. The vector and / or particle can be utilized for the purpose of transferringDNA,RNA, or other nucleic acids into cells either ex vivo or in vivo.Numerous forms of viral vectors are known.

[0135] The term "wild type" includes entities having a structure and / or activity as found in a normal (as contrasted with mutant, diseased, altered, or so forth) state or context. Wild type genes and polypeptides often exist in multiple different forms (e.g., alleles).

[0136] The term "endogenous sequence" refers to a nucleic acid sequence that occurs naturally within a cell or organism. For example, an endogenous MAPT sequence of a cell or organism refers to a native MAPT sequence that naturally occurs at the MAPT locus in the cell or organism.

[0137] "Exogenous" molecules or sequences include molecules or sequences that are not normally present in a cell in that form. Normal presence includes presence with respect to the particular developmental stage and environmental conditionsof the cell. Anexogenousmoleculeor sequence, for example, can includeamutated versionof a corresponding endogenous sequence within the cell, such as a humanized version of the endogenous sequence, or can include a sequence corresponding to anendogenous sequencewithin the cell but in a different form (i.e., notwithin a chromosome). In contrast, endogenousmolecules or sequences includemolecules or sequences that arenormally present in that form in a particular cell at a particular developmental stage under particular environmental conditions.

[0138] The term "heterologous" when used in the context of a nucleic acid or a protein indicates that the nucleic acid or protein comprises at least two segments that do not naturally occur together in the samemolecule. For example, the term "heterologous,"whenusedwith reference to segments of a nucleic acid or segments of a protein, indicates that the nucleic acid or protein comprises twoormore sub-sequences that are not found in the same relationship to eachother (e.g., joined together) in nature. As one example, a "heterologous" region of a nucleic acid vector is a segment of nucleic acid within or attached to another nucleic acidmolecule that is not found in associationwith the othermolecule in nature. For example, a heterologous region of a nucleic acid vector could include a coding sequence flanked by sequences not found in association with the coding sequence in nature. Likewise, a "heterologous" region of a protein is a segment of amino acids within or attached to another peptide molecule that is not found in association with the other peptide molecule in 18 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55 nature (e.g., a fusion protein, or a protein with a tag). Similarly, a nucleic acid or protein can comprise a heterologous label or a heterologous secretion or localization sequence.

[0139] The term "locus" refers to a specific location of a gene (or significant sequence), DNA sequence, polypeptide- encoding sequence, or position on a chromosome of the genome of an organism. For example, a "MAPT locus"may refer to the specific location of aMAPT gene,MAPTDNA sequence, microtubule-associated-protein-tau-encoding sequence, orMAPT position on a chromosome of the genome of an organism that has been identified as to where such a sequence resides. A "MAPT locus" may comprise a regulatory element of a MAPT gene, including, for example, an enhancer, a promoter, 5’ and / or 3’ untranslated region (UTR), or a combination thereof.

[0140] The term "gene" refers to a DNA sequence in a chromosome that codes for a product (e.g., an RNA product and / or a polypeptide product) and includes the coding region interrupted with non-coding introns and sequence located adjacent to the coding region on both the 5’ and 3’ ends such that the gene corresponds to the full-lengthmRNA (including the 5’ and 3’ untranslated sequences). The term "gene" also includes other non-coding sequences including regulatory sequences (e.g., promoters, enhancers, and transcription factor binding sites), polyadenylation signals, internal ribosome entry sites, silencers, insulating sequence, and matrix attachment regions. These sequences may be close to the coding regionof thegene (e.g.,within10kb)or at distant sites, and they influence the level or rateof transcriptionand translationof the gene.

[0141] The term "allele" refers to a variant form of a gene. Some genes have a variety of different forms, which are located at the sameposition, or genetic locus, on a chromosome.A diploid organismhas two alleles at each genetic locus. Each pair of alleles represents the genotype of a specific genetic locus. Genotypes are described as homozygous if there are two identical alleles at a particular locus and as heterozygous if the two alleles differ.

[0142] A"promoter" is a regulatory regionofDNAusually comprisingaTATAboxcapableof directingRNApolymerase II to initiateRNAsynthesis at the appropriate transcription initiation site for a particular polynucleotide sequence.Apromoter may additionally comprise other regions which influence the transcription initiation rate. The promoter sequences disclosed herein modulate transcription of an operably linked polynucleotide. A promoter can be active in one or more of the cell types disclosed herein (e.g., a human cell, a pluripotent cell, a one-cell stage embryo, a differentiated cell, or a combination thereof). A promoter can be, for example, a constitutively active promoter, a conditional promoter, an inducible promoter, a temporally restricted promoter (e.g., a developmentally regulated promoter), or a spatially restricted promoter (e.g., a cell-specific or tissue-specific promoter). Examples of promoters can be found, for example, in WO 2013 / 176772, herein incorporated by reference in its entirety for all purposes.

[0143] "Operable linkage" or being "operably linked" includes juxtaposition of twoormore components (e.g., a promoter and another sequence element) such that both components function normally and allow the possibility that at least one of thecomponents canmediatea function that is exerteduponat least oneof theother components. For example, apromoter can be operably linked to a coding sequence if the promoter controls the level of transcription of the coding sequence in response to the presence or absence of one ormore transcriptional regulatory factors. Operable linkage can include such sequences being contiguouswith each other or acting in trans (e.g., a regulatory sequence can act at a distance to control transcription of the coding sequence).

[0144] The term "variant" refers to a nucleotide sequence differing from the sequence most prevalent in a population (e.g., by one nucleotide) or a protein sequence different from the sequence most prevalent in a population (e.g., by one amino acid).

[0145] The term "fragment" when referring to a proteinmeans a protein that is shorter or has fewer amino acids than the full-length protein. The term "fragment" when referring to a nucleic acid means a nucleic acid that is shorter or has fewer nucleotides than the full-length nucleic acid. A fragment can be, for example, an N-terminal fragment (i.e., removal of a portion of the C-terminal end of the protein), a C-terminal fragment (i.e., removal of a portion of the N-terminal end of the protein), or an internal fragment.

[0146] "Sequence identity" or "identity" in the context of two polynucleotides or polypeptide sequences refers to the residues in the two sequences that are the samewhenaligned formaximumcorrespondenceover a specified comparison window. When percentage of sequence identity is used in reference to proteins, residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule. When sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution. Sequences that differ by such conservative substitutions are said to have "sequence similarity" or "similarity." Means for making this adjustment are well known. Typically, this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non- conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of conservative substitutions is calculated, e.g., as implemented in the program PC / GENE (Intelligenetics, Mountain View, California).

[0147] "Percentageof sequence identity" includes the value determinedbycomparing twooptimally aligned sequences 19 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55 (greatest number of perfectly matched residues) over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number ofmatched positions, dividing the number ofmatched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity. Unlessotherwisespecified (e.g., the shorter sequence includesa linkedheterologoussequence), thecomparisonwindow is the full length of the shorter of the two sequences being compared.

[0148] Unless otherwise stated, sequence identity / similarity values include the value obtained using GAP Version 10 using the following parameters: % identity and% similarity for a nucleotide sequence usingGAPWeight of 50 and Length Weight of 3, and the nwsgapdna.cmp scoring matrix; % identity and % similarity for an amino acid sequence using GAP Weight of 8 and Length Weight of 2, and the BLOSUM62 scoring matrix; or any equivalent program thereof. "Equivalent program" includes any sequence comparison program that, for any two sequences in question, generates an alignment having identical nucleotide or amino acid residuematches and an identical percent sequence identity when compared to the corresponding alignment generated by GAP Version 10.

[0149] The term "conservativeaminoacidsubstitution" refers to thesubstitutionofanaminoacid that is normally present in the sequence with a different amino acid of similar size, charge, or polarity. Examples of conservative substitutions include the substitution of a non-polar (hydrophobic) residue such as isoleucine, valine, or leucine for another non-polar residue. Likewise, examples of conservative substitutions include the substitution of one polar (hydrophilic) residue for another such as between arginine and lysine, between glutamine and asparagine, or between glycine and serine. Additionally, the substitution of a basic residue such as lysine, arginine, or histidine for another, or the substitution of one acidic residue such as aspartic acid or glutamic acid for another acidic residue are additional examples of conservative substitutions.Examplesofnon-conservativesubstitutions include thesubstitutionofanon-polar (hydrophobic) aminoacid residue such as isoleucine, valine, leucine, alanine, or methionine for a polar (hydrophilic) residue such as cysteine, glutamine, glutamic acid or lysine and / or a polar residue for a non-polar residue. Typical amino acid categorizations are summarized below. Table 1. Amino Acid Categorizations. Alanine Ala A Nonpolar Neutral 1.8 Arginine Arg R Polar Positive ‑4.5 Asparagine Asn N Polar Neutral ‑3.5 Aspartic acid Asp D Polar Negative ‑3.5 Cysteine Cys C Nonpolar Neutral 2.5 Glutamic acid Glu E Polar Negative ‑3.5 Glutamine Gln Q Polar Neutral ‑3.5 Glycine Gly G Nonpolar Neutral ‑0.4 Histidine His H Polar Positive ‑3.2 Isoleucine Ile I Nonpolar Neutral 4.5 Leucine Leu L Nonpolar Neutral 3.8 Lysine Lys K Polar Positive ‑3.9 Methionine Met M Nonpolar Neutral 1.9 Phenylalanine Phe F Nonpolar Neutral 2.8 Proline Pro P Nonpolar Neutral ‑1.6 Serine Ser S Polar Neutral ‑0.8 Threonine Thr T Polar Neutral ‑0.7 Tryptophan Trp W Nonpolar Neutral ‑0.9 Tyrosine Tyr Y Polar Neutral ‑1.3 Valine Val V Nonpolar Neutral 4.2

[0150] A "homologous" sequence (e.g., nucleic acid sequence) includes a sequence that is either identical or substantially similar to a known reference sequence, such that it is, for example, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%,at least 98%,at least 99%,or 100% identical to theknown referencesequence.Homologoussequencescan include, for example, orthologous sequence and paralogous sequences. Homologous genes, for example, typically descend from a common ancestral DNA sequence, either through a speciation event (orthologous genes) or a genetic duplication event 20 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55 (paralogous genes). "Orthologous" genes include genes in different species that evolved from a common ancestral gene by speciation. Orthologs typically retain the same function in the course of evolution. "Paralogous" genes include genes related by duplication within a genome. Paralogs can evolve new functions in the course of evolution.

[0151] The term "in vitro" includes artificial environments and to processes or reactions that occur within an artificial environment (e.g., a test tube or an isolated cell or cell line). The term "in vivo" includes natural environments (e.g., a cell or organism or body) and to processes or reactions that occur within a natural environment. The term "ex vivo" includes cells that have been removed from the body of an individual and to processes or reactions that occur within such cells.

[0152] The term "reporter gene" refers to a nucleic acid having a sequence encoding a gene product (typically an enzyme) that is easily and quantifiably assayedwhen a construct comprising the reporter gene sequence operably linked to a heterologous promoter and / or enhancer element is introduced into cells containing (or which can bemade to contain) the factorsnecessary for theactivationof thepromoterand / orenhancerelements.Examplesof reportergenes include,but arenot limited, to genesencoding beta-galactosidase (lacZ), the bacterial chloramphenicol acetyltransferase (cat) genes, firefly luciferase genes, genes encoding beta-glucuronidase (GUS), and genes encoding fluorescent proteins. A "reporter protein" refers to a protein encoded by a reporter gene.

[0153] The term "fluorescent reporter protein" as used herein means a reporter protein that is detectable based on fluorescence wherein the fluorescencemay be either from the reporter protein directly, activity of the reporter protein on a fluorogenic substrate, or a protein with affinity for binding to a fluorescent tagged compound. Examples of fluorescent proteins include green fluorescent proteins (e.g., GFP, GFP‑2, tagGFP, turboGFP, eGFP, Emerald, Azami Green, Monomeric Azami Green, CopGFP, AceGFP, and ZsGreenl), yellow fluorescent proteins (e.g., YFP, eYFP, Citrine, Venus, YPet, PhiYFP, and ZsYellowl), blue fluorescent proteins (e.g., BFP, eBFP, eBFP2, Azurite, mKalamal, GFPuv, Sapphire, andT-sapphire), cyan fluorescent proteins (e.g., CFP, eCFP,Cerulean,CyPet, AmCyanl, andMidoriishi-Cyan), red fluorescent proteins (e.g., RFP, mKate, mKate2, mPlum, DsRed monomer, mCherry, mRFP1, DsRed-Express, DsRed2, DsRed-Monomer, HcRed-Tandem, HcRedl, AsRed2, eqFP611, mRaspberry, mStrawberry, and Jred), orange fluorescent proteins (e.g.,mOrange,mKO,Kusabira-Orange,MonomericKusabira-Orange,mTangerine, and tdTomato), and any other suitable fluorescent protein whose presence in cells can be detected by flow cytometry methods.

[0154] Repair in response to double-strand breaks (DSBs) occurs principally through two conserved DNA repair pathways: homologous recombination (HR) and non-homologous end joining (NHEJ).SeeKasparek &Humphrey (2011) Seminars in Cell & Dev. Biol. 22:886‑897, herein incorporated by reference in its entirety for all purposes. Likewise, repair of a target nucleic acid mediated by an exogenous donor nucleic acid can include any process of exchange of genetic information between the two polynucleotides.

[0155] The term "recombination" includesany processof exchangeof genetic information between twopolynucleotides and can occur by any mechanism. Recombination can occur via homology directed repair (HDR) or homologous recombination (HR). HDR or HR includes a form of nucleic acid repair that can require nucleotide sequence homology, uses a "donor" molecule as a template for repair of a "target" molecule (i.e., the one that experienced the double-strand break), and leads to transfer of genetic information from the donor to target.Without wishing to be bound by any particular theory, such transfer can involve mismatch correction of heteroduplex DNA that forms between the broken target and the donor, and / or synthesis-dependent strand annealing, in which the donor is used to resynthesize genetic information that will become part of the target, and / or related processes. In some cases, the donor polynucleotide, a portion of the donor polynucleotide, a copy of the donor polynucleotide, or a portion of a copy of the donor polynucleotide integrates into the target DNA. SeeWang et al. (2013) Cell 153:910‑918; Mandalos et al. (2012) PLOSONE 7:e45768:1‑9; andWang et al. (2013) Nat Biotechnol. 31:530‑532, each of which is herein incorporated by reference in its entirety for all purposes.

[0156] NHEJ includes the repair of double-strand breaks in a nucleic acid by direct ligation of the break ends to one another or toanexogenoussequencewithout theneed for a homologous template. Ligationof non-contiguous sequences by NHEJ can often result in deletions, insertions, or translocations near the site of the double-strand break. For example, NHEJ can also result in the targeted integration of an exogenous donor nucleic acid through direct ligation of the break ends with the ends of the exogenous donor nucleic acid (i.e., NHEJ-based capture). Such NHEJ-mediated targeted integration can be preferred for insertion of an exogenous donor nucleic acid when homology directed repair (HDR) pathways are not readily usable (e.g., in non-dividing cells, primary cells, and cells which perform homology-based DNA repair poorly). In addition, in contrast to homology-directed repair, knowledge concerning large regions of sequence identity flanking thecleavagesite is notneeded,whichcanbebeneficialwhenattempting targeted insertion intoorganisms that havegenomes forwhich there is limited knowledgeof the genomic sequence. The integration canproceed via ligation of blunt ends between the exogenous donor nucleic acid and the cleaved genomic sequence, or via ligation of sticky ends (i.e., having 5’ or 3’ overhangs) using an exogenous donor nucleic acid that is flanked by overhangs that are compatible with those generated by a nuclease agent in the cleaved genomic sequence. See, e.g., US 2011 / 020722, WO 2014 / 033644, WO 2014 / 089290, and Maresca et al. (2013) Genome Res. 23(3):539‑546, each of which is herein incorporated by reference in its entirety for all purposes. If blunt ends are ligated, target and / or donor resection may be needed to generation regions of microhomology needed for fragment joining, which may create unwanted alterations in the target sequence. 21 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55

[0157] Compositions or methods "comprising" or "including" one or more recited elements may include other elements not specifically recited. For example, a composition that "comprises" or "includes" a protein may contain the protein alone or in combinationwith other ingredients. The transitional phrase "consisting essentially of"means that the scope of a claim is tobe interpreted toencompass thespecifiedelements recited in theclaimand those thatdonotmaterially affect thebasic and novel characteristic(s) of the claimed invention. Thus, the term "consisting essentially of" when used in a claim of this invention is not intended to be interpreted to be equivalent to "comprising."

[0158] "Optional" or "optionally" means that the subsequently described event or circumstance may or may not occur and that the description includes instances in which the event or circumstance occurs and instances in which it does not.

[0159] Designation of a range of values includes all integers within or defining the range, and all subranges defined by integers within the range.

[0160] Unless otherwise apparent from the context, the term "about" encompasses values within a standard margin of error of measurement (e.g., SEM) of a stated value.

[0161] The term "and / or" refers to and encompasses any andall possible combinations of one ormore of the associated listed items, as well as the lack of combinations when interpreted in the alternative ("or").

[0162] The term "or" refers to any onemember of a particular list and also includes any combination of members of that list.

[0163] The singular forms of the articles "a," "an," and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a protein" or "at least one protein" can include a plurality of proteins, includingmixtures thereof.

[0164] Statistically significant means p ≤0.05. DETAILED DESCRIPTION I. Overview

[0165] Cas-protein-ready tau biosensor cells and methods of making and using such cells to screen for genetic modifiers of tau seeding or aggregation are provided. CRISPR / Cas synergistic activation mediator (SAM)‑ready tau biosensor cells andmethods of making and using such cells to screen for genetic modifiers of tau seeding or aggregation are provided. Cas-protein-ready tau biosensor cells and methods of making and using such cells to screen for genetic modifiers of tau disaggregation are provided. CRISPR / Cas synergistic activation mediator (SAM)‑ready tau biosensor cells and methods of making and using such cells to screen for genetic modifiers of tau disaggregation are provided. Reagentsandmethods for sensitizingsuchcells to tauseedingactivityor tauaggregationarealsoprovided.Reagentsand methods for inducing tau aggregation are also provided.

[0166] To identify genes and pathways that modify the processes of abnormal tau protein aggregation, a platform was developed for performing screens with CRISPR (e.g., CRISPR / Cas9) nuclease (CRISPRn) sgRNA libraries to identify genes that regulate the potential of cells to be "seeded" by tau disease-associated protein aggregates (e.g., geneswhich, when disrupted, cause cells to bemore susceptible to tau aggregate formation when exposed to a source of tau fibrillized protein). To further identify genes andpathways thatmodify the processes of abnormal tau protein aggregation, a platform was developed for performing screenswith CRISPRactivation (CRISPRa) sgRNA libraries to identify genes that regulate the potential of cells to be "seeded" by tau disease-associated protein aggregates (e.g., genes which, when transcrip- tionally activated, cause cells to bemore susceptible to tauaggregate formationwhenexposed to a source of tau fibrillized protein). Likewise, a platform was developed for performing screens with CRISPR (e.g., CRISPR / Cas9) nuclease (CRISPRn) sgRNA libraries to identify genes that, when disrupted, prevent tau aggregation or promote tau disaggrega- tion. Likewise, a platform was developed for performing screens with CRISPR activation (CRISPRa) sgRNA libraries to identify genes that, when transcriptionally activated, prevent tau aggregation or promote tau disaggregation. A "seed" refers to one ormore proteins that nucleate aggregation of other proteins with a similar aggregation domain. The seeding activity of a sample refers to the ability of a sample to nucleate (i.e. induce) aggregation of a protein with a similar aggregation domain. The identification of such genes may elucidate the mechanisms of tau cell-to-cell aggregate propagation and genetic pathways that govern the susceptibility of neurons to form tau aggregates in the context of neurodegenerative diseases.

[0167] The screens employ a tau biosensor cell line (e.g., human cell line, or HEK293T) consisting of cells stably expressing tau repeat domain (e.g., tau four-repeat domain, tau_4RD) with a pathogenic mutation (e.g., the P301S pathogenic mutation), linked to unique reporters that can act together as an intracellular biosensor that produces a detectable signal when aggregated. In one non-limiting example, the cell lines contain two transgenes stably expressing disease-associated protein variants fused to the fluorescent proteinCFP (e.g., eCFP) or the fluorescent protein YFP (e.g., eYFP): tau4RD‑CFP / tau4RD‑YFP (TCY),wherein the tau repeat domain (4RD) comprises theP301Spathogenicmutation. In these biosensor lines, tau-CFP / tau-YFP protein aggregation produces a fluorescence resonance energy transfer (FRET) signal, the result of a transfer of fluorescent energy from donor CFP to acceptor YFP. The term CFP (cyan 22 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55 fluorescent protein) when used herein includes eCFP (enhanced cyan fluorescent protein), and the term YFP (yellow fluorescent protein) when used herein includes eYFP (enhanced yellow fluorescent protein). FRET-positive cells, which contain tauaggregates, canbesortedand isolatedbyflowcytometry.At baseline, unstimulatedcells express the reporters in a stable, soluble state with minimal FRETsignal. Upon stimulation (e.g., liposome transfection of seed particles), the reporter proteins form aggregates, producing a FRETsignal. Aggregate-containing cells can be isolated by FACS. Stably propagating aggregate-containing cell lines, Agg[+], can be isolated by clonal serial dilution of Agg[‑] cell lines.

[0168] Several modifications were made to this tau biosensor cell line to make it useful for genetic screening using CRISPRn libraries. First, these tau biosensor cells were modified by introducing a Cas-expressing transgene (e.g., Cas9 or SpCas9) for use in the CRISPRn screens. Second, reagents and a method were developed for sensitizing cells to tau seedingactivityand tauaggregation.Acell linewasdeveloped inwhich tauaggregatesstablypersist inall cellswithgrowth and multiple passages over time. These cells were used to produce conditioned medium by collecting medium that has beenonconfluent cells for aperiodof time.This conditionedmediumcan thenbeappliedontonaive taubiosensor tau cells at a ratio of so that tauaggregation couldbe induced in asmall percentageof these recipient cells, therebysensitizing them to tauseedingactivity and tauaggregation.Conditionedmediumwithout co-culturinghasnotbeenused in this context asa seeding agent before. However, the conditioned medium is particularly useful for large-scale genome-wide screens because tau fibrils produced in vitro are a limited resource. In addition, conditioned medium is more physiologically relevant because it is produced and secreted by cells rather than in vitro.

[0169] These cell lineswere used to develop amethodof screening inwhichCas-expressing taubiosensor cellswithout aggregates (Agg[‑]) were transduced with a CRISPR guide RNA library to introduce knock-out mutations at each target gene. After culturing the cells to allow genome editing and expansion, the cells were grown in conditioned medium to sensitize them to the seeding activity, and cells were identified in which tau aggregation occurred. Guide RNAs were identified that were enriched in the aggregation-positive sub-population relative to earlier time points during genome editing and expansion to identify genes that can regulate the susceptibility of cells to tau seeding when exposed to an external source of tau seeding activity.

[0170] Likewise, several modifications were made to this tau biosensor cell line to make it useful for genetic screening usingCRISPRa libraries (e.g., for usewith aCRISPR / Cas synergistic activationmediator (SAM)system). In anexemplary SAMsystem, several activationdomains interact to causeagreater transcriptional activation thancouldbe inducedbyany one factor alone. For example, an exemplary SAM system comprises a chimeric Cas protein comprising a nuclease- inactive Cas protein fused to one or more transcriptional activation domains (e.g., VP64) and a chimeric adaptor protein comprisinganadaptorprotein (e.g.,MS2coatprotein (MCP)) fused tooneormore transcriptional activationdomains (e.g., fused to p65 and HSF1). TheMCP naturally binds to MS2 stem loops. In an exemplary SAM system, MCP interacts MS2 stem loops engineered into the CRISPR-associated sgRNA and thereby shuttles the bound transcription factors to the appropriate genomic location.

[0171] First, these tau biosensor cells were modified by introducing one or more transgenes expressing the chimeric Cas protein comprising the nuclease-inactive Cas protein fused to one or more transcriptional activation domains (e.g., VP64)and thechimericadaptorprotein comprising theadaptorprotein (e.g.,MS2coatprotein (MCP)) fused tooneormore transcriptional activation domains (e.g., fused to p65 and HSF1). Although SAM systems are described herein, other CRISPRa systems such as a nuclease-inactive Cas protein fused to one or more transcriptional activation domains, wherein such systems do not also include a chimeric adaptor protein, can also be used. In such cases, the tau biosensor cells would be modified by introducing a transgene expressing the chimeric Cas protein.

[0172] Second, reagents and amethodwere developed for sensitizing cells to tau seeding activity and tau aggregation. A cell line was developed in which tau aggregates stably persist in all cells with growth and multiple passages over time. Thesecellswereused toproduceconditionedmediumbycollectingmedium that hasbeenonconfluent cells for aperiodof time. This conditioned medium can then be applied onto naive tau biosensor tau cells at a ratio of so that tau aggregation could be induced in a small percentage of these recipient cells, thereby sensitizing them to tau seeding activity and tau aggregation. Conditioned medium without co-culturing has not been used in this context as a seeding agent before. However, the conditionedmedium is particularly useful for large-scale genome-wide screensbecause tau fibrils produced in vitro are a limited resource. In addition, conditionedmedium ismore physiologically relevant because it is produced and secreted by cells rather than in vitro.

[0173] These cell lines were used to develop a method of screening in which SAM-expressing tau biosensor cells without aggregates (Agg[‑]) were transduced with a CRISPRa guide RNA library to transcriptionally activate each target gene. After culturing the cells to allow genome editing and expansion, the cells were grown in conditioned medium to sensitize them to the seeding activity, and cells were identified in which tau aggregation occurred. Guide RNAs were identified that were enriched in the aggregation-positive sub-population relative to earlier time points during genome editing and expansion to identify genes that can regulate the susceptibility of cells to tau seeding when exposed to an external source of tau seeding activity. II. Cas / Tau Biosensor and SAM / Tau Biosensor Cell Lines and Methods of Generating 23 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55 A. Cas / Tau Biosensor Cells and SAM / Tau Biosensor Cells

[0174] Disclosed herein are cells not only expressing a first tau repeat domain (e.g., comprising the tau microtubule binding domain (MBD)) linked to a first reporter and a second tau repeat domain linked to a second reporter, but also expressing aCas protein, suchasCas9. Also disclosed herein are cells not only expressing a first tau repeat domain (e.g., comprising the taumicrotubule binding domain (MBD)) linked to a first reporter and a second tau repeat domain linked to a second reporter, but also expressing a chimeric Cas protein comprising a nuclease-inactive Cas protein fused to one or more transcriptional activationdomainsandachimeric adaptor protein comprisinganadaptor protein fused tooneormore transcriptional activation domains. The first tau repeat domain linked to the first reporter can be stably expressed, and the second tau repeat domain linked to the second reporter can be stably expressed. For example, DNAencoding the first tau repeat domain linked to the first reporter can be genomically integrated, andDNAencoding the second tau repeat domain linked to the second reporter can be genomically integrated. Similarly, the Cas protein can be stably expressed in the Cas / tau biosensor cells. For example, DNA encoding the Cas protein can be genomically integrated. Likewise, the chimeric Cas protein and / or the chimeric adaptor protein can be stably expressed in the SAM / tau biosensor cells. For example, DNA encoding the chimeric Cas protein can be genomically integrated and / or DNA encoding the chimeric adaptor protein can be genomically integrated. The cells can be tau-aggregation-negative or can be tau-aggregation- positive. 1. Tau and Tau Repeat Domains Linked to Reporters

[0175] Microtubule-associated protein tau is a protein that promotes microtubule assembly and stability and is predominantly expressed in neurons. Tau has a role in stabilizing neuronal microtubules and thus in promoting axonal outgrowth. InAlzheimer’sdisease (AD)anda family of relatedneurodegenerativediseases called tauopathies, tauprotein is abnormally hyperphosphorylated and aggregated into bundles of filaments (paired helical filaments), whichmanifest as neurofibrillary tangles. Tauopathies are a group of heterogeneous neurodegenerative conditions characterized by deposition of abnormal tau in the brain.

[0176] The tau repeat domain can be from a tau protein from any animal or mammal, such as human, mouse, or rat. In one specific example, the tau repeat domain is from a human tau protein. An exemplary human tau protein is assigned UniProt accession number P10636. The tau proteins are the products of alternate splicing from a single gene that in humans is designated MAPT (microtubule-associated protein tau). The tau repeat domain carries the sequence motifs responsible for aggregation (i.e., it is theaggregation-pronedomain from tau).Dependingonsplicing, the repeat domainof the tau protein has either three or four repeat regions that constitute the aggregation-prone core of the protein, which is often termed the repeat domain (RD). Specifically, the repeat domain of tau represents the core of themicrotubule binding regionandharbors thehexapeptidemotifs inR2andR3 that are responsible forTauaggregation. In thehumanbrain, there are six tau isoforms ranging from352 to 441 amino acids in length. These isoforms vary at the carboxyl terminal according to the presence of either three repeat or four repeat domains (R1-R4), in addition to the presence or absence of one or two insert domains at the amino-terminus. The repeat domains, located at the carboxyl-terminal half of tau, are believed to be important for microtubule binding as well as for the pathological aggregation of tau into paired helical filaments (PHFs), whichare thecoreconstituentsof theneurofibrillary tangles found in tauopathies.Exemplary sequences for the four repeat domains (R1-R4)areprovided inSEQIDNOS:1‑4, respectively.Exemplarycodingsequences for the four repeatdomains (R1-R4) are provided in SEQ ID NOS: 5‑8. An exemplary sequence for the Tau four-repeat domain is provided in SEQ ID NO: 9. An exemplary coding sequence for the Tau four-repeat domain is provided in SEQ ID NO: 10. An exemplary sequence for the Tau four-repeat domain with the P301S mutation is provided in SEQ ID NO: 11. An exemplary coding sequence for the Tau four-repeat domain with the P301S mutation is provided in SEQ ID NO: 12.

[0177] The tau repeat domain used in the Cas / tau biosensor cells or the SAM / tau biosensor cells can comprise the tau microtubule binding domain (MBD). The tau repeat domain used in the Cas / tau biosensor cells or the SAM / tau biosensor cells can comprise one or more or all of the four repeat domains (R1-R4). For example, the tau repeat domain can comprise, consist essentially of, or consist of one ormore or all of SEQ IDNOS: 1, 2, 3, and 4, or sequences at least about 90%,91%,92%,93%,94%,95%,96%,97%,98%,or 99% identical toSEQ IDNOS:1, 2, 3, and4. Inonespecificexample, the tau repeat domain is the tau four-repeat domain (R1-R4) found in several tau isoforms.The tau four-repeat domain can be used instead of full-length tau because it reliably forms fibrils in cultured cells. For example, the tau repeat domain can comprise, consist essentially of, or consist ofSEQ IDNO:9orSEQ IDNO:11orasequenceat least about 90%,91%,92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ IDNO: 9orSEQ IDNO: 11. In one specific example, the nucleic acid encoding the tau repeat domain can comprise, consist essentially of, or consist of SEQ ID NO: 12 or a sequence at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ IDNO: 12, optionally wherein the nucleic acid encodes a protein comprising, consisting essentially of, or consisting of SEQ ID NO: 11. In another specific example, the nucleic acid encoding the second tau repeat domain linked to the second reporter can comprise, consist essentially of, or consist of SEQ IDNO:10or a sequenceat least about 90%, 91%, 92%, 93%,94%, 95%, 96%, 97%,98%, 24 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55 or99% identical toSEQIDNO:10, optionallywherein thenucleicacidencodesaprotein comprising, consistingessentially of, or consisting of SEQ ID NO: 9. The first and second tau repeat domains in the cells disclosed herein can be the same, similar, or different.

[0178] Oneorbothof thefirst tau repeat domain linked to the first reporter and thesecond tau repeat domain linked to the second reporter canbestably expressed in the cells. For example, nucleic acidsencodingoneor bothof the first tau repeat domain linked to the first reporter and the second tau repeat domain linked to the second reporter can be genomically integrated in the population of cells and operably linked to promoters active in the cell.

[0179] The tau repeatdomainsused in thecells disclosedherein canalsocomprisea taupathogenicmutation, suchasa pro-aggregationmutation. Such amutation can be, for example, amutation that is associated with (e.g., segregates with) or causes a tauopathy. As one example, the mutation can be an aggregation-sensitizing mutation that sensitizes tau to seedingbut doesnot result in tau readily aggregatingon its own.For example, themutation canbe thedisease-associated P301Smutation. By P301Smutation is meant the human tau P301Smutation or a correspondingmutation in another tau protein when optimally aligned with the human tau protein. The P301Smutation in tau exhibits high sensitivity to seeding, but it does not readily aggregate on its own. Thus, although at baseline tau reporter proteins comprising the P301S mutation exist in a stable, soluble form within the cell, exposure to exogenous tau seeds leads to tau reporter protein aggregation. Other tau mutations include, for example, K280del, P301L, V337M, P301L / V337M, and K280del / I227- P / I308P.

[0180] Thefirst tau repeatdomaincanbe linked to thefirst reporterand thesecond tau repeatdomaincanbe linked to the second reporter by any means. For example, the reporter can be fused to the tau repeat domain (e.g., as part of a fusion protein).

[0181] The first reporter and second reporter can be and pair of unique reporters that can act together as an intracellular biosensor that produces a detectable signal when the first and second proteins are aggregated. As one example, the reporters can be fluorescent proteins, and fluorescence resonance energy transfer (FRET) can be used to measure protein aggregation. Specifically, the first and second reporters can be a FRET pair. Examples of FRET pairs (donor and acceptor fluorophores) are well known. See, e.g., Bajar et al. (2016) Sensors (Basel) 16(9):1488, herein incorporated by reference in its entirety for all purposes. Typical fluorescence microscopy techniques rely upon the absorption by a fluorophore of light at one wavelength (excitation), followed by the subsequent emission of secondary fluorescence at a longerwavelength. Themechanismof fluorescence resonance energy transfer involves a donor fluorophore in an excited electronic state, which may transfer its excitation energy to a nearby acceptor chromophore in a non-radiative fashion through long-range dipole-dipole interactions. For example, the FRET energy donor may be the first reporter, and the FRETenergy acceptormay be the second reporter. Alternatively, the FRETenergy donormay be the second reporter, and the FRETenergy acceptormaybe the first reporter. In a specific example, the first and second reporters areCFPandYFP. Exemplary protein and coding sequences for CFP are provided, e.g., in SEQ IDNOS: 13 and 14, respectively. Exemplary protein and coding sequences for YFP are provided, e.g., in SEQ IDNOS: 15 and 16, respectively. As a specific example, the CFP can comprise, consist essentially of, or consist of SEQ ID NO: 13 or a sequence at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical toSEQ IDNO: 13.As another specific example, theYFPcan comprise, consist essentially of, or consist of SEQ ID NO: 15 or a sequence at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 15.

[0182] As another example, a protein fragment complementation strategy can be used to detect aggregation. For example, a split-luciferase can be used to produce bioluminescence from a substrate, and the first and second reporters can be amino‑ (NLuc) and carboxy‑ (CLuc) terminal fragments of the luciferase. Examples of luciferase include Renilla, firefly, click beetle, and Metridia luciferase.

[0183] In one non-limiting example, the biosensor cells disclosed herein contain two transgenes stably expressing disease-associated tau protein variants fused to the fluorescent protein CFP or the fluorescent protein YFP, respectively (tau4RD‑CFP / tau4RD‑YFP(TCY)),wherein the tau four repeatdomain (4RD)comprises theP301Spathogenicmutation. In thesebiosensor lines, tau-CFP / tau-YFPprotein aggregationproducesaFRETsignal, the result of a transfer of fluorescent energy fromdonorCFP to acceptorYFP. FRET-positive cells, which contain tauaggregates, canbe sorted and isolatedby flow cytometry. At baseline, unstimulated cells express the reporters in a stable, soluble state with minimal FRETsignal. Upon stimulation (e.g., liposome transfection of seed particles), the reporter proteins form aggregates, producing a FRET signal.

[0184] The Cas / tau biosensor cells disclosed herein can be aggregation-positive (Agg[+]) cells in which the tau repeat domain stably presents in an aggregated state, meaning that the tau repeat domain aggregates stably persist in all cells with growth and multiple passages over time. Alternatively, the Cas / tau biosensor cells disclosed herein can be aggregation-negative (Agg[‑]). 2. Cas Proteins and Chimeric Cas Proteins

[0185] TheCas / tau biosensor cells disclosed herein also comprise nucleic acids (DNA or RNA) encodingCas proteins. 25 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55 Optionally, the Cas protein is stably expressed. Optionally, the cells comprise a genomically integrated Cas coding sequence. Likewise, the SAM / tau biosensor cells disclosed herein also comprise nucleic acids (DNA or RNA) encoding chimeric Cas proteins comprising a nuclease-inactiveCas protein fused to one ormore transcriptional activation domains (e.g., VP64). Optionally, the chimeric Cas protein is stably expressed. Optionally, the cells comprise a genomically integrated chimeric Cas coding sequence.

[0186] Cas proteins are part of Clustered Regularly Interspersed Short Palindromic Repeats (CRISPR) / CRISPR- associated (Cas) systems. CRISPR / Cas systems include transcripts and other elements involved in the expression of, or directing theactivity of,Casgenes.ACRISPR / Cassystemcanbe, for example, a type I, a type II, a type III system,ora type V system (e.g., subtype V-A or subtype V-B). The methods and compositions disclosed herein can employ CRISPR / Cas systems by utilizingCRISPR complexes (comprising a guideRNA (gRNA) complexedwith aCas protein) for site-directed binding or cleavage of nucleic acids.

[0187] CRISPR / Cas systemsused in the compositions andmethods disclosed herein can be non-naturally occurring. A "non-naturally occurring" system includes anything indicating the involvement of the hand of man, such as one or more components of the system being altered or mutated from their naturally occurring state, being at least substantially free fromat least one other component withwhich they are naturally associated in nature, or being associatedwith at least one other component with which they are not naturally associated. For example, some CRISPR / Cas systems employ non- naturally occurringCRISPRcomplexes comprising a gRNAand aCas protein that do not naturally occur together, employ a Cas protein that does not occur naturally, or employ a gRNA that does not occur naturally.

[0188] Cas proteins generally comprise at least one RNA recognition or binding domain that can interact with guide RNAs. Cas proteins can also comprise nuclease domains (e.g., DNase domains or RNase domains), DNA-binding domains, helicase domains, protein-protein interaction domains, dimerization domains, and other domains. Some such domains (e.g., DNase domains) can be from a native Cas protein. Other such domains can be added to make amodified Cas protein. A nuclease domain possesses catalytic activity for nucleic acid cleavage, which includes the breakage of the covalent bonds of a nucleic acid molecule. Cleavage can produce blunt ends or staggered ends, and it can be single- stranded or double-stranded. For example, a wild type Cas9 protein will typically create a blunt cleavage product. Alternatively, a wild type Cpf1 protein (e.g., FnCpf1) can result in a cleavage product with a 5-nucleotide 5’ overhang, with the cleavageoccurring after the 18th basepair from thePAMsequenceon the non-targeted strand andafter the 23rd base on the targeted strand. A Cas protein can have full cleavage activity to create a double-strand break at a target genomic locus (e.g., a double-strand break with blunt ends), or it can be a nickase that creates a single-strand break at a target genomic locus.

[0189] Examples of Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas5e (CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas9 (Csn1 or Csx12), Cas10, Cas10d, CasF, CasG, CasH, Csy1, Csy2, Csy3, Cse1 (CasA), Cse2 (CasB), Cse3 (CasE), Cse4 (CasC), Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1,Cmr3,Cmr4,Cmr5,Cmr6,Csb1,Csb2,Csb3,Csx17,Csx14,Csx10,Csx16,CsaX,Csx3,Csx1,Csx15,Csf1,Csf2, Csf3, Csf4, and Cu1966, and homologs or modified versions thereof.

[0190] An exemplary Cas protein is a Cas9 protein or a protein derived from a Cas9 protein. Cas9 proteins are from a type II CRISPR / Cas systemand typically share four keymotifs with a conserved architecture.Motifs 1, 2, and 4 areRuvC- like motifs, and motif 3 is an HNH motif. Exemplary Cas9 proteins are from Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiri- cum, Lactobacillus delbrueckii, Lactobacillus salivarius, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaera watsonii, Cyanothece sp., Microcystis aeruginosa, Synechococcus sp., Acetohalobium arabaticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillusferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halo- philus, Nitrosococcus watsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Methanohalobium evestiga- tum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga mobilis, Thermosipho africanus, Acaryochloris marina,Neisseriameningitidis,orCampylobacter jejuni.Additional examplesof theCas9 familymembersaredescribed in WO 2014 / 131833, herein incorporated by reference in its entirety for all purposes. Cas9 from S. pyogenes (SpCas9) (assigned SwissProt accession number Q99ZW2) is an exemplary Cas9 protein. Exemplary SpCas9 protein and coding sequence are set forth in SEQ ID NOS: 21 and 22, respectively. Cas9 from S. aureus (SaCas9) (assigned UniProt accession number J7RUA5) is another exemplary Cas9 protein. Cas9 from Campylobacter jejuni (CjCas9) (assigned UniProt accession numberQ0P897) is another exemplaryCas9 protein.See, e.g.,Kimet al. (2017)Nat. Comm. 8:14500, herein incorporated by reference in its entirety for all purposes. SaCas9 is smaller than SpCas9, and CjCas9 is smaller than both SaCas9 and SpCas9. Cas9 fromNeisseria meningitidis (Nme2Cas9) is another exemplary Cas9 protein. See, e.g., Edraki et al. (2019) Mol. Cell 73(4):714‑726, herein incorporated by reference in its entirety for all purposes. Cas9 26 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55 proteins from Streptococcus thermophilus (e.g., Streptococcus thermophilus LMD‑9 Cas9 encoded by the CRISPR1 locus (St1Cas9) or Streptococcus thermophilus Cas9 from the CRISPR3 locus (St3Cas9)) are other exemplary Cas9 proteins. Cas9 from Francisella novicida (FnCas9) or the RHA Francisella novicida Cas9 variant that recognizes an alternativePAM(E1369R / E1449H / R1556Asubstitutions) areother exemplaryCas9proteins. Theseandother exemplary Cas9 proteins are reviewed, e.g., in Cebrian-Serrano and Davies (2017) Mamm. Genome 28(7):247‑261, herein incorporated by reference in its entirety for all purposes.

[0191] As one example, the Cas protein can be a Cas9 protein. For example, the Cas9 protein can be a Streptococcus pyogenesCas9protein.Asonespecificexample, theCasprotein cancomprise, consist essentially of, or consist ofSEQID NO:21or asequenceat least about 90%, 91%,92%,93%,94%,95%,96%,97%,98%,or 99% identical toSEQ IDNO:21. As another specific example, a chimeric Cas protein comprising a nuclease-inactive Cas protein and one or more transcriptional activation domains can comprise, consist essentially of, or consist of SEQ IDNO: 36 or a sequence at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 36.

[0192] Another example of a Cas protein is a Cpfl (CRISPR from Prevotella and Francisella 1) protein. Cpfl is a large protein (about 1300 amino acids) that contains aRuvC-like nuclease domain homologous to the corresponding domain of Cas9 along with a counterpart to the characteristic arginine-rich cluster of Cas9. However, Cpf1 lacks the HNH nuclease domain that is present in Cas9 proteins, and theRuvC-like domain is contiguous in the Cpfl sequence, in contrast to Cas9 where it contains long inserts including the HNH domain. See, e.g., Zetsche et al. (2015) Cell 163(3):759‑771, herein incorporated by reference in its entirety for all purposes. Exemplary Cpfl proteins are from Francisella tularensis 1, Francisella tularensis subsp. novicida, Prevotella albensis, Lachnospiraceae bacterium MC2017 1, Butyrivibrio proteo- clasticus, Peregrinibacteria bacterium GW2011_GWA2_33_10, Parcubacteria bacterium GW2011_GWC2_44_17, Smithella sp. SCADC, Acidaminococcus sp. BV3L6, Lachnospiraceae bacteriumMA2020, Candidatus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi 237, Leptospira inadai, Lachnospiraceae bacterium ND2006, Por- phyromonas crevioricanis 3, Prevotella disiens, and Porphyromonas macacae. Cpf1 from Francisella novicida U112 (FnCpf1; assigned UniProt accession number A0Q7Q2) is an exemplary Cpfl protein.

[0193] Cas proteins can be wild type proteins (i.e., those that occur in nature), modified Cas proteins (i.e., Cas protein variants), or fragments of wild type or modified Cas proteins. Cas proteins can also be active variants or fragments with respect to catalytic activity of wild type or modified Cas proteins. Active variants or fragments with respect to catalytic activity can comprise at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the wild type or modified Cas protein or a portion thereof, wherein the active variants retain the ability to cut at a desired cleavage site and hence retain double-strand-break-inducing activity. Assays for double-strand-break-inducing activity are known and generally measure the overall activity and specificity of the Cas protein on DNA substrates containing the cleavage site.

[0194] One example of a modified Cas protein is the modified SpCas9-HF1 protein, which is a high-fidelity variant of Streptococcus pyogenes Cas9 harboring alterations (N497A / R661A / Q695A / Q926A) designed to reduce non-specific DNA contacts. See, e.g., Kleinstiver et al. (2016) Nature 529(7587):490‑495, herein incorporated by reference in its entirety for all purposes. Another example of a modified Cas protein is the modified eSpCas9 variant (K848A / K1003A / R1060A) designed to reduce off-target effects. See, e.g., Slaymaker et al. (2016) Science 351(6268):84‑88, herein incorporated by reference in its entirety for all purposes. Other SpCas9 variants include K855A and K810A / K1003A / R1060A. These and other modified Cas proteins are reviewed, e.g., in Cebrian-Serrano and Davies (2017) Mamm. Genome 28(7):247‑261, herein incorporated by reference in its entirety for all purposes. Another example of amodifiedCas9 protein is xCas9,which is a SpCas9 variant that can recognize an expanded range of PAM sequences. See, e.g., Hu et al. (2018) Nature 556:57‑63, herein incorporated by reference in its entirety for all purposes.

[0195] Cas proteins can be modified to increase or decrease one or more of nucleic acid binding affinity, nucleic acid binding specificity, and enzymatic activity. Cas proteins can also bemodified to change any other activity or property of the protein, such as stability. For example, a Cas protein can be truncated to remove domains that are not essential for the function of the protein or to optimize (e.g., enhance or reduce) the activity of or a property of the Cas protein. As another example, one or more nuclease domains of the Cas protein can be modified, deleted, or inactivated (e.g., for use in the SAM / tau biosensor cells comprising a nuclease-inactive Cas protein).

[0196] Cas proteins can comprise at least one nuclease domain, such as a DNase domain. For example, a wild type Cpf1 protein generally comprises a RuvC-like domain that cleaves both strands of target DNA, perhaps in a dimeric configuration. Cas proteins can also comprise at least two nuclease domains, such as DNase domains. For example, a wild type Cas9 protein generally comprises a RuvC-like nuclease domain and an HNH-like nuclease domain. The RuvC and HNH domains can each cut a different strand of double-stranded DNA to make a double-stranded break in the DNA. See, e.g., Jinek et al. (2012) Science 337:816‑821, herein incorporated by reference in its entirety for all purposes.

[0197] Oneormoreorall of thenucleasedomains canbedeletedormutatedso that theyareno longer functional or have reduced nuclease activity. For example, if one of the nuclease domains is deleted or mutated in a Cas9 protein, the resulting Cas9 protein can be referred to as a nickase and can generate a single-strand break within a double-stranded 27 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55 target DNA but not a double-strand break (i.e., it can cleave the complementary strand or the non-complementary strand, but not both). If both of the nuclease domains are deleted or mutated, the resulting Cas protein (e.g., Cas9) will have a reduced ability to cleaveboth strands of a double-strandedDNA (e.g., a nuclease-null or nuclease-inactiveCasprotein, or acatalyticallydeadCasprotein (dCas)).Anexampleofamutation that convertsCas9 intoanickase isaD10A (aspartate to alanine at position 10 of Cas9) mutation in the RuvC domain of Cas9 from S. pyogenes. Likewise, H939A (histidine to alanine at amino acid position 839), H840A (histidine to alanine at amino acid position 840), or N863A (asparagine to alanine at amino acid position N863) in the HNH domain of Cas9 from S. pyogenes can convert the Cas9 into a nickase. Other examples of mutations that convert Cas9 into a nickase include the corresponding mutations to Cas9 from S. thermophilus. See, e.g.,Sapranauskas et al. (2011) Nucleic AcidsRes. 39(21):9275‑9282 andWO2013 / 141680, each of which is herein incorporated by reference in its entirety for all purposes. Suchmutations can be generated usingmethods such as site-directed mutagenesis, PCR-mediated mutagenesis, or total gene synthesis. Examples of other mutations creating nickases can be found, for example, in WO 2013 / 176772 and WO 2013 / 142578, each of which is herein incorporated by reference in its entirety for all purposes. If all of the nuclease domains are deleted or mutated in a Cas protein (e.g., both of the nucleasedomains are deletedormutated in aCas9protein), the resultingCasprotein (e.g., Cas9) will have a reducedability to cleaveboth strandsof a double-strandedDNA (e.g., a nuclease-null or nuclease-inactiveCas protein). One specific example is a D10A / H840AS. pyogenesCas9 doublemutant or a corresponding doublemutant in a Cas9 fromanother specieswhen optimally alignedwithS. pyogenesCas9. Another specific example is aD10A / N863AS. pyogenesCas9 double mutant or a corresponding double mutant in a Cas9 from another species when optimally aligned with S. pyogenes Cas9.

[0198] Examples of inactivatingmutations in the catalytic domains of xCas9 are the same as those described above for SpCas9. Examples of inactivating mutations in the catalytic domains of Staphylococcus aureus Cas9 proteins are also known. For example, the Staphylococcus aureus Cas9 enzyme (SaCas9) may comprise a substitution at position N580 (e.g., N580A substitution) and a substitution at positionD10 (e.g., D10A substitution) to generate a nuclease-inactive Cas protein. See, e.g., WO 2016 / 106236, herein incorporated by reference in its entirety for all purposes. Examples of inactivating mutations in the catalytic domains of Nme2Cas9 are also known (e.g., combination of D16A and H588A). Examples of inactivatingmutations in the catalytic domains of St1Cas9 are also known (e.g., combination of D9A, D598A, H599A, and N622A). Examples of inactivating mutations in the catalytic domains of St3Cas9 are also known (e.g., combination of D10A and N870A). Examples of inactivating mutations in the catalytic domains of CjCas9 are also known (e.g., combination of D8A and H559A). Examples of inactivating mutations in the catalytic domains of FnCas9 and RHA FnCas9 are also known (e.g., N995A).

[0199] Examples of inactivating mutations in the catalytic domains of Cpfl proteins are also known. With reference to Cpf1 proteins from Francisella novicida U112 (FnCpf1), Acidaminococcus sp. BV3L6 (AsCpf1), Lachnospiraceae bacterium ND2006 (LbCpf1), and Moraxella bovoculi 237 (MbCpf1 Cpf1), such mutations can include mutations at positions 908, 993, or 1263 of AsCpf1 or corresponding positions in Cpf1 orthologs, or positions 832, 925, 947, or 1180 of LbCpf1 or corresponding positions in Cpfl orthologs. Such mutations can include, for example one or more of mutations D908A, E993A, and D1263A of AsCpf1 or corresponding mutations in Cpf1 orthologs, or D832A, E925A, D947A, and D1180A of LbCpf1 or corresponding mutations in Cpfl orthologs. See, e.g., US 2016 / 0208243, herein incorporated by reference in its entirety for all purposes.

[0200] Cas proteins can also be operably linked to heterologous polypeptides as fusion proteins. For example, a Cas protein can be fused to a cleavage domain, an epigenetic modification domain, a transcriptional activation domain, or a transcriptional repressor domain. SeeWO2014 / 089290, herein incorporated by reference in its entirety for all purposes. For example, Cas proteins can be operably linked or fused to a transcriptional activation domain for use in the SAM / tau biosensor cells. Examples of transcriptional activation domains include a herpes simplex virus VP16 activation domain, VP64 (which is a tetrameric derivative of VP16), a NFκB p65 activation domain, p53 activation domains 1 and 2, a CREB (cAMP response element binding protein) activation domain, an E2A activation domain, and an NFAT (nuclear factor of activated T-cells) activation domain. Other examples include activation domains from Oct1, Oct‑2A, SP1, AP‑2, CTF1, P300, CBP, PCAF, SRC1, PvALF, ERF‑2, OsGAI, HALF‑1, C1, AP1, ARF‑5, ARF‑6, ARF‑7, ARF‑8, CPRF1, CPRF4, MYC-RP / GP, TRAB1PC4, and HSF1.See, e.g.,US 2016 / 0237456, EP3045537, andWO2011 / 146121, each of which is incorporated by reference in its entirety for all purposes. In some cases, a transcriptional activation system can be used comprising a dCas9-VP64 fusion protein paired withMS2-p65-HSF1. GuideRNAs in such systems can be designedwith aptamer sequences appended to sgRNA tetraloop and stem-loop 2 designed to bind dimerized MS2 bacteriophage coat proteins.See, e.g.,Konermannet al. (2015)Nature 517(7536):583‑588, herein incorporated by reference in its entirety for all purposes. Examples of transcriptional repressor domains include inducible cAMP early repressor (ICER) domains, Kruppel-associated boxA (KRAB-A) repressor domains, YY1glycine rich repressor domains, Sp1 -like repressors, E(spl) repressors, IκB repressor, and MeCP2. Other examples include transcriptional repressor domains from A / B, KOX, TGF- beta-inducibleearly gene (TIEG), v-erbA,SID,SID4X,MBD2,MBD3,DNMT1,DNMG3A,DNMT3B,Rb,ROM2,See,e.g., EP3045537 andWO2011 / 146121, each of which is incorporated by reference in its entirety for all purposes. Cas proteins can also be fused to a heterologous polypeptide providing increased or decreased stability. The fused domain or 28 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55 heterologous polypeptide can be located at the N-terminus, the C-terminus, or internally within the Cas protein.

[0201] Casproteins canalsobeoperably linked toheterologouspolypeptidesas fusionproteins. Asoneexample, aCas protein canbe fused tooneormoreheterologouspolypeptides that provide for subcellular localization. Suchheterologous polypeptides can include, for example, one ormore nuclear localization signals (NLS) such as themonopartite SV40NLS and / or a bipartite alpha-importin NLS for targeting to the nucleus, a mitochondrial localization signal for targeting to the mitochondria, an ER retention signal, and the like. See, e.g., Lange et al. (2007) J. Biol. Chem. 282:5101‑5105, herein incorporated by reference in its entirety for all purposes. Such subcellular localization signals can be located at the N- terminus, theC-terminus, oranywherewithin theCasprotein.AnNLScancompriseastretchofbasicaminoacids, andcan beamonopartite sequenceor abipartite sequence.Optionally, aCasprotein cancomprise twoormoreNLSs, includingan NLS (e.g., an alpha-importin NLS or a monopartite NLS) at the N-terminus and an NLS (e.g., an SV40 NLS or a bipartite NLS) at the C-terminus. ACas protein can also comprise two ormore NLSs at the N-terminus and / or two or more NLSs at the C-terminus.

[0202] Cas proteins can also be operably linked to a cell-penetrating domain or protein transduction domain. For example, the cell-penetrating domain can be derived from the HIV‑1 TAT protein, the TLM cell-penetrating motif from human hepatitis B virus, MPG, Pep‑1, VP22, a cell penetrating peptide from Herpes simplex virus, or a polyarginine peptide sequence.See, e.g.,WO2014 / 089290 andWO 2013 / 176772, each of which is herein incorporated by reference in its entirety for all purposes. The cell-penetrating domain can be located at the N-terminus, the C-terminus, or anywhere within the Cas protein.

[0203] Cas proteins can also be operably linked to a heterologous polypeptide for ease of tracking or purification, such as a fluorescent protein, a purification tag, or an epitope tag. Examples of fluorescent proteins include green fluorescent proteins (e.g., GFP, GFP‑2, tagGFP, turboGFP, eGFP, Emerald, Azami Green, Monomeric Azami Green, CopGFP, AceGFP, ZsGreenl), yellow fluorescent proteins (e.g., YFP, eYFP, Citrine, Venus, YPet, PhiYFP, ZsYellowl), blue fluorescent proteins (e.g., eBFP, eBFP2, Azurite, mKalamal, GFPuv, Sapphire, T-sapphire), cyan fluorescent proteins (e.g., eCFP,Cerulean, CyPet, AmCyanl, Midoriishi-Cyan), red fluorescent proteins (e.g.,mKate,mKate2,mPlum,DsRed monomer, mCherry, mRFP1, DsRed-Express, DsRed2, DsRed-Monomer, HcRed-Tandem, HcRedl, AsRed2, eqFP611, mRaspberry, mStrawberry, Jred), orange fluorescent proteins (e.g., mOrange, mKO, Kusabira-Orange, Monomeric Kusabira-Orange, mTangerine, tdTomato), and any other suitable fluorescent protein. Examples of tags include glu- tathione-S-transferase (GST), chitin binding protein (CBP), maltose binding protein, thioredoxin (TRX), poly(NANP), tandemaffinity purification (TAP) tag,myc,AcV5,AU1,AU5,E,ECS,E2, FLAG,hemagglutinin (HA), nus,Softag1,Softag 3, Strep, SBP, Glu-Glu, HSV, KT3, S, S1, T7, V5, VSV-G, histidine (His), biotin carboxyl carrier protein (BCCP), and calmodulin.

[0204] Casproteins canbeprovided in any form. For example, aCasprotein canbeprovided in the formof aprotein. For example, a Cas protein can be provided as a Cas protein complexed with a gRNA. Alternatively, a Cas protein can be provided in the form of a nucleic acid encoding the Cas protein, such as an RNA (e.g., messenger RNA (mRNA)) or DNA. Optionally, the nucleic acid encoding the Cas protein can be codon optimized for efficient translation into protein in a particular cell or organism. For example, the nucleic acid encoding the Cas protein can be modified to substitute codons having a higher frequency of usage in a bacterial cell, a yeast cell, a human cell, a non-human cell, a mammalian cell, a rodent cell, amouse cell, a rat cell, or any other host cell of interest, as compared to the naturally occurring polynucleotide sequence. For example, the nucleic acid encoding theCas protein can be codon optimized for expression in a human cell. Whenanucleic acidencoding theCasprotein is introduced into the cell, theCasprotein canbe transiently, conditionally, or constitutively expressed in the cell.

[0205] Cas proteins provided as mRNAs can be modified for improved stability and / or immunogenicity properties. The modifications may be made to one or more nucleosides within the mRNA. Examples of chemical modifications to mRNA nucleobases include pseudouridine, 1-methyl-pseudouridine, and 5-methyl-cytidine. For example, capped and poly- adenylated Cas mRNA containing N1-methyl pseudouridine can be used. Likewise, Cas mRNAs can be modified by depletion of uridine using synonymous codons.

[0206] Nucleic acids encoding Cas proteins can be stably integrated in the genome of a cell and operably linked to a promoter active in the cell. In one specific example, the nucleic acid encoding the Cas protein can comprise, consist essentially of, or consist of SEQ IDNO:22or a sequenceat least about 90%, 91%, 92%, 93%,94%, 95%, 96%, 97%,98%, or99% identical toSEQIDNO:22, optionallywherein thenucleicacidencodesaprotein comprising, consistingessentially of, or consisting of SEQ ID NO: 21. In another specific example, the nucleic acid encoding a chimeric Cas protein comprising a nuclease-inactive Cas protein and one or more transcriptional activation domains can comprise, consist essentially of, or consist of SEQ IDNO:38or a sequenceat least about 90%, 91%, 92%, 93%,94%, 95%, 96%, 97%,98%, or99% identical toSEQIDNO:38, optionallywherein thenucleicacidencodesaprotein comprising, consistingessentially of, or consisting of SEQ IDNO: 36. Alternatively, nucleic acids encodingCas proteins can be operably linked to a promoter in an expression construct. Expression constructs include any nucleic acid constructs capable of directing expression of a gene or other nucleic acid sequence of interest (e.g., a Cas gene) and which can transfer such a nucleic acid sequence of interest to a target cell. Promoters that can be used in an expression construct include promoters active, for example, in 29 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55 oneormoreof aeukaryotic cell, a humancell, a non-humancell, amammalian cell, a non-humanmammalian cell, a rodent cell, amouse cell, a rat cell, a pluripotent cell, an embryonic stem (ES) cell, an adult stemcell, a developmentally restricted progenitor cell, an induced pluripotent stem (iPS) cell, or a one-cell stage embryo. Such promoters can be, for example, conditional promoters, inducible promoters, constitutive promoters, or tissue-specific promoters. 3. Chimeric Adaptor Proteins

[0207] The SAM / tau biosensor cells disclosed herein can comprise not only nucleic acids (DNA or RNA) encoding a chimeric Cas protein comprising a nuclease-inactive Cas protein fused to one or more transcriptional activation domains (e.g., VP64) but optionally also nucleic acids (DNA or RNA) encoding a chimeric adaptor protein comprising an adaptor protein (e.g., MS2 coat protein (MCP)) fused to one or more transcriptional activation domains (e.g., fused to p65 and HSF1). Optionally, the chimeric Cas protein and / or the chimeric adaptor protein is stably expressed. Optionally, the cells comprise a genomically integrated chimeric Cas protein coding sequence and / or a genomically integrated chimeric adaptor protein coding sequence.

[0208] Suchchimericadaptorproteins comprise: (a) anadaptor (i.e., adaptordomainoradaptorprotein) that specifically binds to an adaptor-binding element within a guide RNA; and (b) one or more heterologous transcriptional activation domains. For example, such fusionproteins cancomprise 1, 2, 3, 4, 5, ormore transcriptional activationdomains (e.g., two ormoreheterologous transcriptionalactivationdomainsor threeormoreheterologous transcriptional activationdomains). In one example, such chimeric adaptor proteins can comprise: (a) an adaptor (i.e., an adaptor domain or adaptor protein) that specifically binds to an adaptor-binding element in a guide RNA; and (b) two or more transcriptional activation domains. For example, the chimeric adaptor protein can comprise: (a) anMS2 coat protein adaptor that specifically binds tooneormoreMS2aptamers inaguideRNA (e.g., twoMS2aptamers in separate locations inaguideRNA); and (b) oneor more (e.g., twoormore transcriptional activationdomains). For example, the two transcriptional activationdomains canbe p65 and HSF1 transcriptional activation domains or functional fragments or variants thereof. However, chimeric adaptor proteins in which the transcriptional activation domains comprise other transcriptional activation domains or functional fragments or variants thereof are also provided.

[0209] The one or more transcriptional activation domains can be fused directly to the adaptor. Alternatively, the one or more transcriptional activation domains can be linked to the adaptor via a linker or a combination of linkers or via one or moreadditional domains. Likewise, if twoormore transcriptional activationdomainsarepresent, theycanbe fuseddirectly to each other or can be linked to each other via a linker or a combination of linkers or via one or more additional domains. Linkers that can be used in these fusion proteins can include any sequence that does not interfere with the function of the fusionproteins.Exemplary linkers are short (e.g., 2‑20aminoacids) andare typically flexible (e.g., comprisingaminoacids with a high degree of freedom such as glycine, alanine, and serine).

[0210] The one or more transcriptional activation domains and the adaptor can be in any order within the chimeric adaptor protein. Asoneoption, the oneormore transcriptional activationdomains canbeC-terminal to theadaptor and the adaptor can be N-terminal to the one or more transcriptional activation domains. For example, the one or more transcriptional activation domains can be at the C-terminus of the chimeric adaptor protein, and the adaptor can be at the N-terminus of the chimeric adaptor protein. However, the one or more transcriptional activation domains can be C- terminal to the adaptor without being at the C-terminus of the chimeric adaptor protein (e.g., if a nuclear localization signal is at the C-terminus of the chimeric adaptor protein). Likewise, the adaptor can be N-terminal to the one or more transcriptional activation domains without being at the N-terminus of the chimeric adaptor protein (e.g., if a nuclear localization signal is at the N-terminus of the chimeric adaptor protein). As another option, the one or more transcriptional activation domains can be N-terminal to the adaptor and the adaptor can be C-terminal to the one or more transcriptional activation domains. For example, the one or more transcriptional activation domains can be at the N-terminus of the chimeric adaptor protein, and theadaptor canbeat theC-terminus of the chimeric adaptor protein. As yet another option, if the chimeric adaptor protein comprises two or more transcriptional activation domains, the two or more transcriptional activation domains can flank the adaptor.

[0211] Chimeric adaptor proteins can also be operably linked or fused to additional heterologous polypeptides. The fused or linked heterologous polypeptide can be located at the N-terminus, the C-terminus, or anywhere internally within the chimeric adaptor protein. For example, a chimeric adaptor protein can further comprise a nuclear localization signal. A specific example of such a protein comprises an MS2 coat protein (adaptor) linked (either directly or via an NLS) to a p65 transcriptional activationdomainC-terminal to theMS2coat protein (MCP), andHSF1 transcriptional activationdomainC- terminal to thep65 transcriptional activationdomain.Suchaprotein cancomprise fromN-terminus toC-terminus: anMCP; a nuclear localization signal; a p65 transcriptional activation domain; and an HSF1 transcriptional activation domain. For example, a chimeric adaptor protein can comprise, consist essentially of, or consist of an amino acid sequence at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to theMCP-p65-HSF1 chimeric adaptor protein sequence set forth in SEQ ID NO: 37. Likewise, a nucleic acid encoding a chimeric adaptor protein can comprise, consist essentially of, or consist of a sequence at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 30 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55 100% identical to the MCP-p65-HSF1 chimeric adaptor protein coding sequence set forth in SEQ ID NO: 39

[0212] Adaptors (i.e., adaptor domains or adaptor proteins) are nucleic-acid-binding domains (e.g., DNA-binding domains and / or RNA-binding domains) that specifically recognize and bind to distinct sequences (e.g., bind to distinct DNA and / or RNA sequences such as aptamers in a sequence-specific manner). Aptamers include nucleic acids that, through their ability to adopt a specific three-dimensional conformation, can bind to a targetmolecule with high affinity and specificity. Such adaptors can bind, for example, to a specific RNA sequence and secondary structure. These sequences (i.e., adaptor-binding elements) can be engineered into a guide RNA. For example, an MS2 aptamer can be engineered into a guide RNA to specifically bind an MS2 coat protein (MCP). For example, the adaptor can comprise, consist essentially of, or consist of an aminoacid sequenceat least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the MCP sequence set forth in SEQ ID NO: 40. Likewise, a nucleic acid encoding the adaptor can comprise, consist essentially of, or consist of an amino acid sequence at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the MCP coding sequence set forth in SEQ ID NO: 41. Specific examples of adaptors and targets include, for example, RNA-binding protein / aptamer combinations that exist within the diversity of bacteriophage coat proteins.See, e.g.,US2019‑0284572 andWO2019 / 183123, each of which is herein incorporated by reference in its entirety for all purposes.

[0213] The chimeric adaptor proteins disclosed herein comprise one or more transcriptional activation domains. Such transcriptional activation domains can be naturally occurring transcriptional activation domains, can be functional fragments or functional variants of naturally occurring transcriptional activation domains, or can be engineered or synthetic transcriptional activation domains. Transcriptional activation domains that can be used include those described, for example, in US 2019‑0284572 andWO 2019 / 183123, each of which is herein incorporated by reference in its entirety for all purposes. 4. Cell Types

[0214] The Cas / tau biosensor cells disclosed herein can be any type of cell and can be in vitro, ex vivo, or in vivo. A Cas / tau biosensor cell line or population of cells can be amonoclonal cell line or population of cells. Likewise, theSAM / tau biosensor cells disclosed herein can be any type of cell and can be in vitro, ex vivo, or in vivo.ASAM / tau biosensor cell line or population of cells can be amonoclonal cell line or population of cells. The cell can be fromany source. For example, the cell canbeaeukaryotic cell, an animal cell, a plant cell, or a fungal (e.g., yeast) cell. Such cells canbe fish cells or bird cells, or such cells can bemammalian cells, such as human cells, non-humanmammalian cells, rodent cells, mouse cells, or rat cells.Mammals include, for example, humans,non-humanprimates,monkeys, apes, catsdogs,horses,bulls, deer, bison, sheep, rodents (e.g., mice, rats, hamsters, guinea pigs), livestock (e.g., bovine species such as cows and steer; ovine species such as sheep and goats; and porcine species such as pigs and boars). Birds include, for example, chickens, turkeys, ostrich, geese, and ducks. Domesticated animals and agricultural animals are also included. The term "non- human animal" excludes humans. In a specific example, the Cas / tau biosensor cells are human cells (e.g., HEK293T cells). Likewise, in a specific example, the SAM / tau biosensor cells are human cells (e.g., HEK293T cells).

[0215] The cell can be, for example, a totipotent cell or a pluripotent cell (e.g., an embryonic stem (ES) cell such as a rodent ES cell, amouse ES cell, or a rat ES cell). Totipotent cells include undifferentiated cells that can give rise to any cell type, andpluripotent cells includeundifferentiated cells that possess theability todevelop intomore thanonedifferentiated cell types. Such pluripotent and / or totipotent cells can be, for example, ES cells or ES-like cells, such as an induced pluripotent stem (iPS) cells. ES cells include embryo-derived totipotent or pluripotent cells that are capable of contributing toany tissueof thedevelopingembryoupon introduction intoanembryo.EScells canbederived from the innercellmassof a blastocyst and are capable of differentiating into cells of any of the three vertebrate germ layers (endoderm, ectoderm, and mesoderm).

[0216] Thecell canalsobeaprimarysomatic cell, or acell that isnotaprimarysomatic cell. Somatic cells can includeany cell that is not a gamete, germ cell, gametocyte, or undifferentiated stem cell. The cell can also be a primary cell. Primary cells include cells or cultures of cells that have been isolated directly from an organism, organ, or tissue. Primary cells include cells that are neither transformed nor immortal. They include any cell obtained from an organism, organ, or tissue whichwas not previously passed in tissue culture or has been previously passed in tissue culture but is incapable of being indefinitely passed in tissue culture. Such cells can be isolated by conventional techniques and include, for example, somatic cells, hematopoietic cells, endothelial cells, epithelial cells, fibroblasts, mesenchymal cells, keratinocytes, melanocytes, monocytes, mononuclear cells, adipocytes, preadipocytes, neurons, glial cells, hepatocytes, skeletal myoblasts, and smoothmuscle cells. For example, primary cells can be derived from connective tissues, muscle tissues, nervous system tissues, or epithelial tissues.

[0217] Such cells also include would normally not proliferate indefinitely but, due tomutation or alteration, have evaded normal cellular senescenceand insteadcankeepundergoingdivision.Suchmutationsoralterationscanoccurnaturally or be intentionally induced. Examples of immortalized cells include Chinese hamster ovary (CHO) cells, human embryonic kidney cells (e.g., HEK293Tcells), andmouseembryonic fibroblast cells (e.g., 3T3cells). Numerous typesof immortalized 31 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55 cells are well known. Immortalized or primary cells include cells that are typically used for culturing or for expressing recombinant genes or proteins.

[0218] The cell can also be a differentiated cell, such as a neuronal cell (e.g., a human neuronal cell). B. Methods of Generating Cas / Tau Biosensor Cells and SAM / Tau Biosensor Cells

[0219] TheCas / taubiosensor cells disclosedherein canbegeneratedbyanyknownmeans. Thefirst tau repeat domain linked to the first reporter, the second tau repeat domain linked to the second reporter, and the Cas protein can be introduced into the cell in any form (e.g., DNA, RNA, or protein) by any known means. Likewise, the SAM / tau biosensor cells disclosed herein can be generated by any known means. The first tau repeat domain linked to the first reporter, the second tau repeat domain linked to the second reporter, the chimericCas protein, and the chimeric adaptor protein can be introduced into the cell in any form (e.g., DNA, RNA, or protein) by any knownmeans. "Introducing" includes presenting to the cell the nucleic acid or protein in such amanner that the sequence gains access to the interior of the cell. Themethods provided herein do not depend on a particular method for introducing a nucleic acid or protein into the cell, only that the nucleic acidor protein gainsaccess to the interior of a least onecell.Methods for introducingnucleic acidsandproteins into various cell types are known and include, for example, stable transfection methods, transient transfection methods, and virus-mediated methods. Optionally, targeting vectors can be used.

[0220] Transfection protocols as well as protocols for introducing nucleic acids or proteins into cells may vary. Non- limiting transfection methods include chemical-based transfection methods using liposomes; nanoparticles; calcium phosphate (Grahamet al. (1973) Virology 52 (2): 456‑67, Bacchetti et al. (1977) Proc. Natl. Acad. Sci. USA74 (4): 1590‑4, and Kriegler, M (1991). Transfer and Expression: A Laboratory Manual. New York: W. H. Freeman and Company. pp. 96‑97); dendrimers; or cationic polymers such as DEAE-dextran or polyethylenimine. Non-chemical methods include electroporation, Sono-poration, and optical transfection. Particle-based transfection includes the use of a gene gun, or magnet-assisted transfection (Bertram (2006) Current Pharmaceutical Biotechnology 7, 277‑28). Viral methods can also be used for transfection.

[0221] Introduction of nucleic acids or proteins into a cell can also be mediated by electroporation, by intracytoplasmic injection, by viral infection, by adenovirus, by adeno-associated virus, by lentivirus, by retrovirus, by transfection, by lipid- mediated transfection, or by nucleofection. Nucleofection is an improved electroporation technology that enables nucleic acid substrates to be delivered not only to the cytoplasm but also through the nuclear membrane and into the nucleus. In addition, use of nucleofection in the methods disclosed herein typically requires much fewer cells than regular electro- poration (e.g., only about 2 million compared with 7 million by regular electroporation). In one example, nucleofection is performed using the LONZA® NUCLEOFECTOR™ system.

[0222] Introduction of nucleic acids or proteins into a cell can also be accomplished by microinjection. Microinjection of anmRNA ispreferably into the cytoplasm (e.g., to delivermRNAdirectly to the translationmachinery),whilemicroinjection of a protein or a DNA encoding a protein is preferably into the nucleus. Alternatively, microinjection can be carried out by injection intoboth thenucleusand thecytoplasm:aneedlecanfirst be introduced into thenucleusandafirst amount canbe injected, and while removing the needle from the cell a second amount can be injected into the cytoplasm. Methods for carrying out microinjection are well known. See, e.g., Nagy et al. (Nagy A, Gertsenstein M, Vintersten K, Behringer R., 2003,Manipulating theMouseEmbryo.ColdSpringHarbor,NewYork:ColdSpringHarbor LaboratoryPress);Meyer et al. (2010) Proc. Natl. Acad. Sci. USA 107:15022‑15026 and Meyer et al. (2012) Proc. Natl. Acad. Sci. USA 109:9354‑9359.

[0223] Other methods for introducing nucleic acid or proteins into a cell can include, for example, vector delivery, particle-mediated delivery, exosome-mediated delivery, lipid-nanoparticle-mediated delivery, cell-penetrating-peptide- mediated delivery, or implantable-device-mediated delivery. Methods of administering nucleic acids or proteins to a subject to modify cells in vivo are disclosed elsewhere herein.

[0224] In one example, the first tau repeat domain linked to the first reporter, the second tau repeat domain linked to the second reporter, and the Cas protein can be introduced via viral transduction such as lentiviral transduction.

[0225] Screening for cells comprising thefirst tau repeat domain linked to thefirst reporter, thesecond tau repeatdomain linked to the second reporter, and the Cas protein can be performed by any known means.

[0226] As one example, reporter genes can be used to screen for cells that have the Cas protein, the first tau repeat domain linked to thefirst reporter, or thesecond tau repeat domain linked to thesecond reporter.Exemplary reportergenes include those encoding luciferase, β-galactosidase, green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), enhanced yellow fluorescent protein (eYFP), blue fluorescent protein (BFP), enhanced blue fluorescent protein (eBFP), DsRed, ZsGreen, MmGFP, mPlum, mCherry, tdTomato, mStrawberry, J-Red, mOrange, mKO, mCitrine, Venus, YPet, Emerald, CyPet, Cerulean, T-Sapphire, and alkaline phosphatase. For example, if the first reporter and the second reporter are fluorescent proteins (e.g., CFP and YFP), cells comprising these reporters canbeselected by flowcytometry to select for dual-positive cells. Thedual-positive cells can then be combined to generate a polyclonal line, or monoclonal lines can be generated from single dual-positive cells. 32 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55

[0227] As another example, selection markers can be used to screen for cells that have the Cas protein, the first tau repeat domain linked to the first reporter, or the second tau repeat domain linked to the second reporter. Exemplary selectionmarkers include neomycin phosphotransferase (neor), hygromycin B phosphotransferase (hygr), puromycin-N- acetyltransferase (puror), blasticidin S deaminase (bsrr), xanthine / guanine phosphoribosyl transferase (gpt), or herpes simplex virus thymidine kinase (HSV-k). Another exemplary selectionmarker is bleomycin resistance protein, encodedby the Sh ble gene (Streptoalloteichus hindustanus bleomycin gene), which confers zeocin (phleomycin D1) resistance.

[0228] Aggregation-positive (Agg[+]) cells in which the tau repeat domain stably presents in an aggregated state, meaning that the tau repeat domain aggregates stably persist in all cells with growth andmultiple passages over time, can be generated, for example, by seeding with tau aggregates. For example, naive aggregation-negative (Agg[‑]) Cas / tau biosensor cells disclosed herein can be treated with recombinant fibrillized tau (e.g., recombinant fibrillized tau repeat domain) to seed the aggregation of the tau repeat domain protein stably expressed by these cells. Likewise, naïve aggregation-negative (Agg[-]) SAM / tau biosensor cells disclosed herein can be treated with recombinant fibrillized tau (e.g., recombinant fibrillized tau repeat domain) to seed theaggregation of the tau repeat domain protein stably expressed by thesecells. Thefibrillized tau repeat domaincanbe thesameas, similar to, or different from the tau repeatdomainstably expressed by the cells. Optionally, the recombinant fibrillized tau can be mixed with lipofectamine reagent. The seeded cells can then be serially diluted to obtain single-cell-derived clones and to identify clonal cell lines in which tau repeat domain aggregates stably persist in all cells with growth and multiple passages over time.

[0229] As another example, aggregation-positive (Agg[+]) cells in which the tau repeat domain stably presents in an aggregated state, meaning that the tau repeat domain aggregates stably persist in all cells with growth and multiple passages over time, can be generated, for example, by seeding cells (e.g., tau aggregation-negative cells) with cell lysate from tauaggregation-positive cells. This is the "maximal seeding" described in theexamplesherein. For example, thecells can be seeded using a medium comprising the cell lysate (e.g., fresh medium comprising the cell lysate). "Maximal seeding" can refer to seeding that, by itself, induces tau aggregation in a majority of aggregation-negative tau biosensor cells. "Minimal seeding" can refer to seeding that, by itself, is insufficient to induce tauaggregation in aggregation-negative tau biosensor cells (or only minimally induces tau aggregation) but sensitizes such cells to induction of aggregation.

[0230] The amount or concentration of the cell lysate in the medium can be any suitable amount or concentration. For example, the concentration of cell lysate in the medium can be between about 0.1 µg / mL and about 50 µg / mL, between about 0.1µg / mLandabout 25µg / mL,betweenabout 0.1µg / mLandabout 10µg / mL,betweenabout 0.1µg / mLandabout 5µg / mL,betweenabout0.1µg / mLandabout4.5µg / mL,betweenabout0.1µg / mLandabout4µg / mL,betweenabout0.1 µg / mL and about 3.5 µg / mL, between about 0.1 µg / mL and about 3 µg / mL, between about 0.1 µg / mL and about 2.5 µg / mL, between about 0.1µg / mL and about 2µg / mL, between about 0.1µg / mL and about 1.5µg / mL, between about 0.1 µg / mLandabout 1µg / mL, betweenabout 0.5µg / mLandabout 50µg / mL, betweenabout 0.5µg / mLandabout 25µg / mL, between about 0.5 µg / mL and about 10 µg / mL, between about 0.5 µg / mL and about 5 µg / mL, between about 0.5 µg / mL and about 4.5 µg / mL, between about 0.5 µg / mL and about 4 µg / mL, between about 0.5 µg / mL and about 3.5 µg / mL, between about 0.5µg / mL and about 3µg / mL, between about 0.5µg / mL and about 2.5µg / mL, between about 0.5µg / mL and about 2 µg / mL, between about 0.5 µg / mL and about 1.5 µg / mL, between about 0.5 µg / mL and about 1 µg / mL, between about 1 µg / mL and about 50 µg / mL, between about 1 µg / mL and about 25 µg / mL, between about 1 µg / mL and about10µg / mL,betweenabout1µg / mLandabout5µg / mL,betweenabout1µg / mLandabout4.5µg / mL,betweenabout 1 µg / mL and about 4 µg / mL, between about 1 µg / mL and about 3.5 µg / mL, between about 1 µg / mL and about 3 µg / mL, between about 1 µg / mL and about 2.5 µg / mL, between about 1 µg / mL and about 2 µg / mL, between about 1 µg / mL and about 1.5µg / mL, betweenabout 1.5µg / mLandabout 50µg / mL, betweenabout 1.5µg / mLandabout 25µg / mL, between about 1.5µg / mL and about 10µg / mL, between about 1.5µg / mL and about 5µg / mL, between about 1.5µg / mL and about 4.5µg / mL, between about 1.5µg / mL and about 4µg / mL, between about 1.5µg / mL and about 3.5µg / mL, between about 1.5 µg / mL and about 3 µg / mL, between about 1.5 µg / mL and about 2.5 µg / mL, between about 1.5 µg / mL and about 2 µg / mL, between about 2 µg / mL and about 50 µg / mL, between about 2 µg / mL and about 25 µg / mL, between about 2 µg / mL and about 10 µg / mL, between about 2 µg / mL and about 5 µg / mL, between about 2 µg / mL and about 4.5 µg / mL, between about 2 µg / mL and about 4 µg / mL, between about 2 µg / mL and about 3.5 µg / mL, between about 2 µg / mL and about 3 µg / mL, between about 2 µg / mL and about 2.5 µg / mL, between about 2.5 µg / mL and about 50 µg / mL, between about 2.5µg / mLandabout 25µg / mL,betweenabout 2.5µg / mLandabout 10µg / mL,betweenabout 2.5µg / mLandabout 5µg / mL,betweenabout2.5µg / mLandabout4.5µg / mL,betweenabout2.5µg / mLandabout4µg / mL,betweenabout2.5 µg / mL and about 3.5µg / mL, or between about 2.5µg / mL and about 3µg / mL ofmedium (e.g., fresh culturemedium). For example, the cell lysate in the culture medium can be at a concentration of between about 1 µg / mL and about 5 µg / mL or can be at a concentration of about 1.5µg / mL, about 2µg / mL, about 2.5µg / mL, about 3µg / mL, about 3.5µg / mL, about 4 µg / mL,about 4.5µg / mL,or about5µg / mL.Optionally, thecell lysate canbe inabuffer, suchasphosphate-bufferedsaline. Optionally, the buffer can comprise protease inhibitors. Examples of protease inhibitors include, but are not limited to, AEBSF, aprotinin, bestatin, E‑64, leupeptin, pepstatin A, and ethylenediaminetetracetic acid (EDTA). The buffer can comprise any of these inhibitors or any combination thereof (e.g., the buffer can comprise all of these protease inhibitors).

[0231] The cells for producing the lysate can be collected in a buffer, such as phosphate-buffered saline. Optionally, the 33 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55 buffer can comprise protease inhibitors. Examples of protease inhibitors include, but are not limited to, AEBSF, aprotinin, bestatin, E‑64, leupeptin, pepstatin A, and ethylenediaminetetracetic acid (EDTA). The buffer can comprise any of these inhibitors or any combination thereof (e.g., the buffer can comprise all of these protease inhibitors).

[0232] The cell lysate can, for example, be collected by sonicating the tau-aggregation-positive cells (e.g., cells collected in a buffer and protease inhibitors as described above) for any suitable amount of time. For example, the cells can be sonicated for betweenabout 1minute and about 6minutes, between about 1minute andabout 5minutes, between about 1minute and about 4minutes, between about 1minute and about 3minutes, between about 2minutes and about 6 minutes, between about 2minutes and about 5minutes, between about 2minutes and about 4minutes, between about 2 minutes and about 3 minutes, between about 2 minutes and about 6 minutes, between about 3 minutes and about 5 minutes, or between about 3 minutes and about 4 minutes. For example, the cells can be sonicated for between about 2 minutes and about 4 minutes or for about 3 minutes.

[0233] Optionally, the medium comprises lipofectamine or liposomes (e.g., cationic liposomes) or phospholipids or another transfection agent. Optionally, the medium comprises lipofectamine. Optionally, the medium does not comprise lipofectamine or liposomes (e.g., cationic liposomes) or phospholipids or another transfection agent. Optionally, the medium does not comprise lipofectamine. The amount or concentration of the lipofectamine or liposomes (e.g., cationic liposomes) or phospholipids or other transfection agent in the medium can be any suitable amount or concentration. For example, the concentration of lipofectamine or liposomes (e.g., cationic liposomes) or phospholipids or other transfection agent in the medium can be between about 0.5 µL / mL to about 10 µL / mL, between about 0.5 µL / mL to about 5 µL / mL, between about 0.5 µL / mL to about 4.5 µL / mL, between about 0.5 µL / mL to about 4 µL / mL, between about 0.5 µL / mL to about 3.5 µL / mL, between about 0.5 µL / mL to about 3 µL / mL, between about 0.5 µL / mL to about 2.5 µL / mL, between about 0.5 µL / mL to about 2 µL / mL, between about 0.5 µL / mL to about 1.5 µL / mL, between about 0.5 µL / mL to about 1 µL / mL, between about 1µL / mL to about 10µL / mL, between about 1µL / mL to about 5µL / mL, between about 1µL / mL to about 4.5µL / mL, between about 1µL / mL to about 4µL / mL, between about 1µL / mL to about 3.5µL / mL, between about 1 µL / mL to about 3µL / mL, between about 1µL / mL to about 2.5µL / mL, between about 1µL / mL to about 2µL / mL, between about 1 µL / mL to about 1.5 µL / mL, between about 1.5 µL / mL to about 10 µL / mL, between about 1.5 µL / mL to about 5 µL / mL, between about 1.5 µL / mL to about 4.5 µL / mL, between about 1.5 µL / mL to about 4 µL / mL, between about 1.5 µL / mL to about 3.5 µL / mL, between about 1.5 µL / mL to about 3 µL / mL, between about 1.5 µL / mL to about 2.5 µL / mL, betweenabout 1.5µL / mL toabout 2µL / mL, betweenabout 2µL / mL toabout 10µL / mL, betweenabout 2µL / mL toabout 5 µL / mL, between about 2µL / mL to about 4.5µL / mL, between about 2µL / mL to about 4µL / mL, between about 2µL / mL to about3.5µL / mL,betweenabout2µL / mL toabout 3µL / mL,or betweenabout 2µL / mL toabout2.5µL / mLofmedium(e.g., freshmedium).Forexample, theconcentrationof lipofectamineor liposomes (e.g., cationic liposomes)orphospholipidsor other transfection agent in themedium can be between about 1.5µL / mL and about 4µL / mL or it can be about 1.5µL / mL, about 2 µL / mL, about 2.5 µL / mL, about 3 µL / mL, about 3.5 µL / mL, or about 4 µL / mL.

[0234] Tau cell-to-cell propagationmayalso result from tau aggregation activity secreted byaggregate-containing cells. For example, Agg[+] cells, or cells sensitized to becoming Agg[+] cells (e.g., sensitized to tau seeding or tau aggregation activity), can be generated by co-culturing Agg[‑] Cas / tau biosensor cells with Agg[+] cells. Likewise, Agg[+] cells, or cells sensitized to becoming Agg[+] cells (e.g., sensitized to tau seeding or tau aggregation activity), can be generated by co- culturing Agg[‑] SAM / tau biosensor cells with Agg[+] cells.

[0235] Agg[+] cells, or cells sensitized to becoming Agg[+] cells (e.g., sensitized to tau seeding or tau aggregation activity), canalsobegeneratedusing conditionedmediumharvested fromcultured tau-aggregation-positive cells inwhich a tau repeat domain stably presents in an aggregated state as described herein. This is the "minimal seeding" disclosed in the examples herein. Conditioned medium refers to spent medium harvested from cultured cells. It contains metabolites, growth factors, andextracellularmatrixproteinssecreted into themediumby theculturedcells.Useof conditionedmedium does not involve co-culturing with Agg[+] cells (i.e., the naïve Agg[‑] cells are not co-cultured with Agg[+] cells). As one example, conditioned medium can be generated by collecting medium that has been on confluent Agg[+] cells. The mediumcanhavebeenon the confluent Agg[+] cells for about 12hours, about 24hours, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, or about 10 days. For example, themedium can have been on the confluent Agg[+] cells for about 1 to about 7, about 2 to about 6, about 3 to about 5, or about 4 days. Conditioned medium can then be applied to naïve (Agg[-]) Cas / tau biosensor cells in combination with fresh medium. Likewise, conditioned medium can then be applied to naïve (Agg[-]) SAM / tau biosensor cells in combination with fresh medium.The ratioof conditionedmedium to freshmediumcanbe, for example, about 10:1, about9:1, about8:1, about7:1, about 6:1, about 5:1, about 4:1, about 3:1, about 2:1, about 1:1, about 1:2, about 1:3, about 1:4, about 1:5, about 1:6, about 1:7, about 1:8, about 1:9, or about 1:10. For example, the ratio of conditionedmedium of freshmedium can be from about 5:1 to about 1:1, about 4:1 to about 2:1, or about 3:1. For example, it can comprise culturing the genetically modified population of cells in about 90% conditionedmedium and about 10% fresh medium, about 85% conditioned medium and about 15% freshmedium, about 80%conditionedmediumand about 20% freshmedium, about 75%conditionedmedium and about 25% fresh medium, about 70% conditioned medium and about 30% fresh medium, about 65% conditioned medium and about 35% fresh medium, about 60% conditioned medium and about 40% fresh medium, about 55% 34 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55 conditionedmedium and about 45% freshmedium, about 50% conditionedmedium and about 50% freshmedium, about 45% conditioned medium and about 55% fresh medium, about 40% conditioned medium and about 60% fresh medium, about 35% conditioned medium and about 65% fresh medium, about 30% conditioned medium and about 70% fresh medium, about 25% conditioned medium and about 75% fresh medium, about 20% conditioned medium and about 80% fresh medium, about 15% conditioned medium and about 85% fresh medium, or about 10% conditioned medium and about90%freshmedium. Inoneexample, it cancompriseculturing thegeneticallymodifiedpopulationof cells inamedium that comprises at least about 50%conditionedmediumand nomore than about 50% freshmedium. In a specific example, it can comprise culturing the genetically modified population of cells in about 75% conditioned medium and about 25% fresh medium. Optionally, the conditioned medium is applied to the naïve Agg[-] cells without lipofectamine or without liposomes (e.g., cationic liposomes) orwithout phospholipids.Optionally, the geneticallymodifiedpopulation of cells is not co-cultured with the tau-aggregation-positive cells in which a tau repeat domain stably presents in an aggregated state.

[0236] Conditionedmediumwithout co-culturing has not been used in this context as a seeding agent before. However, conditionedmedium is particularly useful for large-scale genome-wide screens because tau fibrils produced in vitro are a limited resource. In addition, conditionedmedium ismore physiologically relevant because it is produced and secreted by cells rather than in vitro. Use of conditioned medium as described herein provides a boost of tau seeding activity (e.g., ~0.1% as measured by FRET induction as disclosed elsewhere herein) to sensitize cells to tau aggregation. C. In Vitro Cultures and Conditioned Medium

[0237] Also disclosed herein are in vitro cultures or compositions comprising the Cas / tau biosensor cells disclosed herein and medium for culturing those cells. Also disclosed herein are in vitro cultures or compositions comprising the SAM / taubiosensor cells disclosedhereinandmedium for culturing thosecells.Thecells canbeAgg[‑] cells orAgg[+] cells. For example, the culture or composition can comprise Agg[‑] cells. In one example, the medium comprises conditioned medium fromAgg[+] cells as disclosed elsewhere herein.Optionally, the cells in the culture or composition are Agg[‑] cells and are not being co-cultured with Agg[+] cells. The medium can comprise a mixture of conditioned medium and fresh medium. As one example, the ratio of conditioned medium to fresh medium can be, for example, about 10:1, about 9:1, about 8:1, about 7:1, about 6:1, about 5:1, about 4:1, about 3:1, about 2:1, about 1:1, about 1:2, about 1:3, about 1:4, about 1:5, about1:6, about1:7, about1:8, about1:9, or about1:10.Forexample, the ratioof conditionedmediumof freshmedium can be from about 5:1 to about 1:1, about 4:1 to about 2:1, or about 3:1. For example, it can comprise culturing the genetically modified population of cells in about 90% conditioned medium and about 10% fresh medium, about 85% conditionedmedium and about 15% freshmedium, about 80% conditionedmedium and about 20% freshmedium, about 75% conditioned medium and about 25% fresh medium, about 70% conditioned medium and about 30% fresh medium, about 65% conditioned medium and about 35% fresh medium, about 60% conditioned medium and about 40% fresh medium, about 55% conditioned medium and about 45% fresh medium, about 50% conditioned medium and about 50% freshmedium, about 45% conditionedmedium and about 55% freshmedium, about 40% conditionedmedium and about 60% fresh medium, about 35% conditioned medium and about 65% fresh medium, about 30% conditioned medium and about 70% freshmedium, about 25%conditionedmediumand about 75% freshmedium, about 20%conditionedmedium and about 80% fresh medium, about 15% conditioned medium and about 85% fresh medium, or about 10% conditioned medium and about 90% fresh medium. In one example, it can comprise culturing the genetically modified population of cells in amedium that comprises at least about 50%conditionedmediumand nomore than about 50% freshmedium. In a specific example, it can comprise culturing the genetically modified population of cells in about 75% conditioned medium and about 25% freshmedium. Optionally, themedium comprises lipofectamine or liposomes (e.g., cationic liposomes) or phospholipids. Optionally, the medium does not comprise lipofectamine or liposomes (e.g., cationic liposomes) or phospholipids. Optionally, the medium does not comprise lipofectamine. D. In Vitro Cultures and Medium Comprising Lysate from Tau-Aggregation-Positive Cells

[0238] Also disclosed herein are in vitro cultures or compositions comprising the Cas / tau biosensor cells disclosed herein and medium for culturing those cells. Also disclosed herein are in vitro cultures or compositions comprising the SAM / tau biosensor cells disclosed herein andmedium for culturing those cells. In one example, themedium comprises a cell lysate from cultured tau-aggregation-positive cells in which a tau repeat domain stably presents in an aggregated state. The cells can be Agg[‑] cells or Agg[+] cells. For example, the culture or composition can comprise Agg[‑] cells. Optionally, the cells in the culture or composition are Agg[‑] cells and are not being co-cultured with Agg[+] cells. The medium can comprise a mixture of fresh medium and the cell lysate.

[0239] The amount or concentration of the cell lysate in the medium can be any suitable amount or concentration. For example, the concentration of cell lysate in the medium can be between about 0.1 µg / mL and about 50 µg / mL, between about 0.1µg / mLandabout 25µg / mL,betweenabout 0.1µg / mLandabout 10µg / mL,betweenabout 0.1µg / mLandabout 5µg / mL,betweenabout0.1µg / mLandabout4.5µg / mL,betweenabout0.1µg / mLandabout4µg / mL,betweenabout0.1 35 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55 µg / mL and about 3.5 µg / mL, between about 0.1 µg / mL and about 3 µg / mL, between about 0.1 µg / mL and about 2.5 µg / mL, between about 0.1µg / mL and about 2µg / mL, between about 0.1µg / mL and about 1.5µg / mL, between about 0.1 µg / mLandabout 1µg / mL, betweenabout 0.5µg / mLandabout 50µg / mL, betweenabout 0.5µg / mLandabout 25µg / mL, between about 0.5 µg / mL and about 10 µg / mL, between about 0.5 µg / mL and about 5 µg / mL, between about 0.5 µg / mL and about 4.5 µg / mL, between about 0.5 µg / mL and about 4 µg / mL, between about 0.5 µg / mL and about 3.5 µg / mL, between about 0.5µg / mL and about 3µg / mL, between about 0.5µg / mL and about 2.5µg / mL, between about 0.5µg / mL and about 2 µg / mL, between about 0.5 µg / mL and about 1.5 µg / mL, between about 0.5 µg / mL and about 1 µg / mL, between about 1 µg / mL and about 50 µg / mL, between about 1 µg / mL and about 25 µg / mL, between about 1 µg / mL and about10µg / mL,betweenabout1µg / mLandabout5µg / mL,betweenabout1µg / mLandabout4.5µg / mL,betweenabout 1 µg / mL and about 4 µg / mL, between about 1 µg / mL and about 3.5 µg / mL, between about 1 µg / mL and about 3 µg / mL, between about 1 µg / mL and about 2.5 µg / mL, between about 1 µg / mL and about 2 µg / mL, between about 1 µg / mL and about 1.5µg / mL, betweenabout 1.5µg / mLandabout 50µg / mL, betweenabout 1.5µg / mLandabout 25µg / mL, between about 1.5µg / mL and about 10µg / mL, between about 1.5µg / mL and about 5µg / mL, between about 1.5µg / mL and about 4.5µg / mL, between about 1.5µg / mL and about 4µg / mL, between about 1.5µg / mL and about 3.5µg / mL, between about 1.5 µg / mL and about 3 µg / mL, between about 1.5 µg / mL and about 2.5 µg / mL, between about 1.5 µg / mL and about 2 µg / mL, between about 2 µg / mL and about 50 µg / mL, between about 2 µg / mL and about 25 µg / mL, between about 2 µg / mL and about 10 µg / mL, between about 2 µg / mL and about 5 µg / mL, between about 2 µg / mL and about 4.5 µg / mL, between about 2 µg / mL and about 4 µg / mL, between about 2 µg / mL and about 3.5 µg / mL, between about 2 µg / mL and about 3 µg / mL, between about 2 µg / mL and about 2.5 µg / mL, between about 2.5 µg / mL and about 50 µg / mL, between about 2.5µg / mLandabout 25µg / mL,betweenabout 2.5µg / mLandabout 10µg / mL,betweenabout 2.5µg / mLandabout 5µg / mL,betweenabout2.5µg / mLandabout4.5µg / mL,betweenabout2.5µg / mLandabout4µg / mL,betweenabout2.5 µg / mL and about 3.5µg / mL, or between about 2.5µg / mL and about 3µg / mL ofmedium (e.g., fresh culturemedium). For example, the cell lysate in the culture medium can be at a concentration of between about 1 µg / mL and about 5 µg / mL or can be at a concentration of about 1.5µg / mL, about 2µg / mL, about 2.5µg / mL, about 3µg / mL, about 3.5µg / mL, about 4 µg / mL,about 4.5µg / mL,or about5µg / mL.Optionally, thecell lysate canbe inabuffer, suchasphosphate-bufferedsaline. Optionally, the buffer can comprise protease inhibitors. Examples of protease inhibitors include, but are not limited to, AEBSF, aprotinin, bestatin, E‑64, leupeptin, pepstatin A, and ethylenediaminetetracetic acid (EDTA). The buffer can comprise any of these inhibitors or any combination thereof (e.g., the buffer can comprise all of these protease inhibitors).

[0240] The cells for producing the lysate can be collected in a buffer, such as phosphate-buffered saline. Optionally, the buffer can comprise protease inhibitors. Examples of protease inhibitors include, but are not limited to, AEBSF, aprotinin, bestatin, E‑64, leupeptin, pepstatin A, and ethylenediaminetetracetic acid (EDTA). The buffer can comprise any of these inhibitors or any combination thereof (e.g., the buffer can comprise all of these protease inhibitors).

[0241] The cell lysate can, for example, be collected by sonicating the tau-aggregation-positive cells (e.g., cells collected in a buffer and protease inhibitors as described above) for any suitable amount of time. For example, the cells can be sonicated for betweenabout 1minute and about 6minutes, between about 1minute andabout 5minutes, between about 1minute and about 4minutes, between about 1minute and about 3minutes, between about 2minutes and about 6 minutes, between about 2minutes and about 5minutes, between about 2minutes and about 4minutes, between about 2 minutes and about 3 minutes, between about 2 minutes and about 6 minutes, between about 3 minutes and about 5 minutes, or between about 3 minutes and about 4 minutes. For example, the cells can be sonicated for between about 2 minutes and about 4 minutes or for about 3 minutes.

[0242] Optionally, the medium comprises lipofectamine or liposomes (e.g., cationic liposomes) or phospholipids or another transfection agent. Optionally, the medium comprises lipofectamine. Optionally, the medium does not comprise lipofectamine or liposomes (e.g., cationic liposomes) or phospholipids or another transfection agent. Optionally, the medium does not comprise lipofectamine. The amount or concentration of the lipofectamine or liposomes (e.g., cationic liposomes) or phospholipids or other transfection agent in the medium can be any suitable amount or concentration. For example, the concentration of lipofectamine or liposomes (e.g., cationic liposomes) or phospholipids or other transfection agent in the medium can be between about 0.5 µL / mL to about 10 µL / mL, between about 0.5 µL / mL to about 5 µL / mL, between about 0.5 µL / mL to about 4.5 µL / mL, between about 0.5 µL / mL to about 4 µL / mL, between about 0.5 µL / mL to about 3.5 µL / mL, between about 0.5 µL / mL to about 3 µL / mL, between about 0.5 µL / mL to about 2.5 µL / mL, between about 0.5 µL / mL to about 2 µL / mL, between about 0.5 µL / mL to about 1.5 µL / mL, between about 0.5 µL / mL to about 1 µL / mL, between about 1µL / mL to about 10µL / mL, between about 1µL / mL to about 5µL / mL, between about 1µL / mL to about 4.5µL / mL, between about 1µL / mL to about 4µL / mL, between about 1µL / mL to about 3.5µL / mL, between about 1 µL / mL to about 3µL / mL, between about 1µL / mL to about 2.5µL / mL, between about 1µL / mL to about 2µL / mL, between about 1 µL / mL to about 1.5 µL / mL, between about 1.5 µL / mL to about 10 µL / mL, between about 1.5 µL / mL to about 5 µL / mL, between about 1.5 µL / mL to about 4.5 µL / mL, between about 1.5 µL / mL to about 4 µL / mL, between about 1.5 µL / mL to about 3.5 µL / mL, between about 1.5 µL / mL to about 3 µL / mL, between about 1.5 µL / mL to about 2.5 µL / mL, betweenabout 1.5µL / mL toabout 2µL / mL, betweenabout 2µL / mL toabout 10µL / mL, betweenabout 2µL / mL toabout 5 µL / mL, between about 2µL / mL to about 4.5µL / mL, between about 2µL / mL to about 4µL / mL, between about 2µL / mL to 36 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55 about3.5µL / mL,betweenabout2µL / mL toabout 3µL / mL,or betweenabout 2µL / mL toabout2.5µL / mLofmedium(e.g., freshmedium).Forexample, theconcentrationof lipofectamineor liposomes (e.g., cationic liposomes)orphospholipidsor other transfection agent in themedium can be between about 1.5µL / mL and about 4µL / mL or it can be about 1.5µL / mL, about 2 µL / mL, about 2.5 µL / mL, about 3 µL / mL, about 3.5 µL / mL, or about 4 µL / mL. III. Guide RNA Knockout Libraries

[0243] TheCRISPRn screeningmethods disclosed herein make use of CRISPR guide RNA (gRNA) knockout libraries suchasgenome-widegRNAknockout libraries.CasnucleasessuchasCas9canbeprogrammed to inducedouble-strand breaks at specific genomic loci through gRNAs designed to target specific target sequences. Because the targeting specificity of Cas proteins is conferred by short gRNAs, pooled genome-scale functional screening is possible. Such libraries have several advantages over libraries such as shRNA libraries, which reduce protein expression by targeting mRNA. In contrast, gRNA libraries achieve knockout via frameshift mutations introduced in genomic coding regions of genes.

[0244] The CRISPRa screening methods disclosed herein make use of CRISPR guide RNA (gRNA) transcriptional activation libraries such as genome-wide gRNA transcriptional activation libraries. SAM systems can be programmed to activate transcription of genes at specific genomic loci through gRNAs designed to target specific target sequences. Because the targeting specificity of Cas proteins is conferred by short gRNAs, pooled genome-scale functional screening is possible.

[0245] The gRNAs in a library can target any number of genes. For example, the gRNAs can target about 50 or more genes, about 100ormoregenes, about 200ormoregenes, about 300ormoregenes, about 400ormoregenes, about 500 or more genes, about 1000 or more genes, about 2000 or more genes, about 3000 or more genes, about 4000 or more genes, about 5000 or more genes, about 10000 or more genes, or about 20000 or more genes. In some libraries, the gRNAs can be selected to target genes in a particular signaling pathway. Some libraries are genome-wide libraries.

[0246] The genome-wide libraries include one or more gRNAs (e.g., sgRNAs) targeting each gene in the genome. The genome being targeted can any type of genome. For example, the genome can be a eukaryotic genome, a mammalian genome, a non-humanmammalian genome, a rodent genome, a mouse genome, a rat genome, or a human genome. In one example, the targeted genome is a human genome.

[0247] The gRNAs can target any number of sequences within each individual targeted gene. In some libraries, a plurality of target sequences are targeted on average in each of the targeted plurality of genes. For example, about 2 to about 10, about 2 toabout 9, about 2 toabout 8, about 2 toabout 7, about 2 toabout 6, about 2 toabout 5, about 2 toabout 4, or about 2 to about 3 unique target sequences can be targeted on average in each of the targeted plurality of genes. For example, at least about 2, at least about 3, at least about 4, at least about 5, or at least about 6unique target sequencescan be targeted on average in each of the targeted plurality of genes. As a specific example, about 6 target sequences can be targeted onaverage in each of the targeted plurality of genes. As another specific example, about 3 to about 6 or about 4 to about 6 target sequences are targeted on average in each of the targeted plurality of genes.

[0248] For example, the libraries can target geneswith an average coverage of about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, or about 10 gRNAs per gene. In a specific example a library can target geneswith an average coverage of about 3‑4 gRNAs per gene or about 6 gRNAs per gene.

[0249] The gRNAs can target any desired location in the target genes. The CRISPRn gRNAs can be designed to target coding regionsof genesso that cleavageby thecorrespondingCasproteinwill result in frameshift insertion / deletion (indel) mutations that result in a loss-of-function allele. More specifically, frameshift mutations can be achieved through targeted DNAdouble strand breaks and subsequentmutagenic repair via the non-homologous end joining (NHEJ) pathway, which produces indels at the site of break. The indel being introduced into the DSB is random, with some indels leading to frameshift mutations that cause premature termination of the gene.

[0250] In someCRISPRn libraries, each gRNA targets a constitutive exon if possible. In someCRISPRn libraries, each gRNA targets a 5’ constitutive exon if possible. In somemethods, each gRNA targets a first exon, a second exon, or a third exon (from the 5’ end of the gene) if possible.

[0251] As one example, the gRNAs in the CRISPRn library can target constitutive exons. Constitutive exons are exons that are consistently conservedafter splicing.Exonsexpressedacross all tissues canbeconsidered constitutive exons for gRNA targeting. The gRNAs in the library can target constitutive exons near the 5’ end of each gene. Optionally, the first and last exons of each gene can be excluded as potential targets. Optionally, any exon containing an alternative splicing site can be excluded as potential targets. Optionally, the two earliest exons meeting the above criteria are selected as potential targets. Optionally, exons 2 and 3 are selected as potential targets (e.g., if no constitutive exons are identified). In addition, the gRNAs in the library can be selected and designed to minimize off-target effects.

[0252] In a specific example, the genome-wide CRISPRn gRNA library or libraries comprise sgRNAs targeting 5’ constitutive exons of > 18,000 genes in the human genome with an average coverage of ~6 sgRNAs per gene, with each target site was selected to minimize off-target modification. 37 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55

[0253] TheCRISPRa gRNAs can be designed to target sequences adjacent to the transcription start site of a gene. For example, the target sequence can be within 1000, 900, 800, 700, 600, 500, 400, 300, 200, 190, 180, 170, 160, 150, 140, 130, 120, 110, 100, 90, 80,70, 60, 50, 40, 30,20, 10, 5, or 1basepair of the transcriptionstart site. Forexample, eachgRNA in the CRISPRa library can target a sequence within 200 bp upstream of a transcription start site. Optionally, the target sequence is within the region 200 base pairs upstream of the transcription start site and 1 base pair downstream of the transcription start site (‑200 to +1).

[0254] The gRNAs in the genome-wide library can be in any form. For example, the gRNA library can be packaged in a viral vector, such as retroviral vectors, lentiviral vectors, or adenoviral vectors. In a specific example, the gRNA library is packaged in lentiviral vectors. The vectors can further comprise reporter genes or selectionmarkers to facilitate selection of cells that receive the vectors. Examples of such reporter genes and selection markers are disclosed elsewhere herein. As one example, the selection marker can be one that imparts resistance to a drug, such as neomycin phosphotransfer- ase, hygromycin B phosphotransferase, puromycin-N-acetyltransferase, and blasticidin S deaminase. Another exemp- lary selection marker is bleomycin resistance protein, encoded by the Sh ble gene (Streptoalloteichus hindustanus bleomycin gene), which confers zeocin (phleomycin D1) resistance. For example, cells can be selected with a drug (e.g., puromycin) so that only cells transduced with a guide RNA construct are preserved for being used to carry out screening. A. Guide RNAs

[0255] A "guideRNA" or "gRNA" is anRNAmolecule that binds to aCas protein (e.g., Cas9 protein) and targets theCas protein to a specific location within a target DNA. Guide RNAs can comprise two segments: a "DNA-targeting segment" and a "protein-binding segment." "Segment" includes a section or region of a molecule, such as a contiguous stretch of nucleotides in an RNA. Some gRNAs, such as those for Cas9, can comprise two separate RNAmolecules: an "activator- RNA" (e.g., tracrRNA) and a "targeter-RNA" (e.g., CRISPR RNA or crRNA). Other gRNAs are a single RNA molecule (single RNA polynucleotide), which can also be called a "single-molecule gRNA," a "single-guide RNA," or an "sgRNA." See, e.g., WO 2013 / 176772, WO 2014 / 065596, WO 2014 / 089290, WO 2014 / 093622, WO 2014 / 099750, WO 2013 / 142578, and WO 2014 / 131833, each of which is herein incorporated by reference in its entirety for all purposes. For Cas9, for example, a single-guide RNA can comprise a crRNA fused to a tracrRNA (e.g., via a linker). For Cpfl, for example, only a crRNA is needed to achieve binding to a target sequence. The terms "guide RNA" and "gRNA" include both double-molecule (i.e., modular) gRNAs and single-molecule gRNAs.

[0256] An exemplary two-molecule gRNA comprises a crRNA-like ("CRISPR RNA" or "targeter-RNA" or "crRNA" or "crRNA repeat") molecule and a corresponding tracrRNA-like ("trans-acting CRISPR RNA" or "activator-RNA" or "tracrRNA") molecule. A crRNA comprises both the DNA-targeting segment (single-stranded) of the gRNA and a stretch of nucleotides that formsonehalf of thedsRNAduplexof theprotein-bindingsegment of thegRNA.Anexampleof a crRNA tail, located downstream (3’) of the DNA-targeting segment, comprises, consists essentially of, or consists of GUUUUA- GAGCUAUGCU (SEQ IDNO:23). Anyof theDNA-targeting segments disclosedherein canbe joined to the5’ endofSEQ ID NO: 23 to form a crRNA.

[0257] A corresponding tracrRNA (activator-RNA) comprises a stretch of nucleotides that forms the other half of the dsRNAduplex of the protein-binding segment of the gRNA. A stretch of nucleotides of a crRNAare complementary to and hybridize with a stretch of nucleotides of a tracrRNA to form the dsRNAduplex of the protein-binding domain of the gRNA. As such, each crRNA can be said to have a corresponding tracrRNA. An example of a tracrRNA sequence comprises, consists essentially of, or consists of AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUG GCACCGAGUCGGUGCUUU(SEQIDNO:24).Otherexamplesof tracrRNAsequencescomprise, consist essentially of, or consist of any one of or

[0258] In systems in which both a crRNA and a tracrRNA are needed, the crRNA and the corresponding tracrRNA hybridize to form a gRNA. In systems in which only a crRNA is needed, the crRNA can be the gRNA. The crRNA additionally provides the single-stranded DNA-targeting segment that hybridizes to the complementary strand of a target DNA. If used for modification within a cell, the exact sequence of a given crRNA or tracrRNAmolecule can be designed to 38 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55 bespecific to the species inwhich theRNAmoleculeswill beused.See, e.g.,Mali et al. (2013)Science339:823‑826; Jinek et al. (2012) Science 337:816‑821; Hwang et al. (2013) Nat. Biotechnol. 31:227‑229; Jiang et al. (2013) Nat. Biotechnol. 31:233‑239; and Cong et al. (2013) Science 339:819‑823, each of which is herein incorporated by reference in its entirety for all purposes.

[0259] The DNA-targeting segment (crRNA) of a given gRNA comprises a nucleotide sequence that is complementary to a sequence on the complementary strand of the target DNA, as described in more detail below. The DNA-targeting segment of a gRNA interacts with the target DNA in a sequence-specific manner via hybridization (i.e., base pairing). As such, the nucleotide sequence of theDNA-targeting segmentmay vary and determines the locationwithin the target DNA with which the gRNA and the target DNA will interact. The DNA-targeting segment of a subject gRNA can be modified to hybridize to any desired sequence within a target DNA. Naturally occurring crRNAs differ depending on the CRISPR / Cas system and organism but often contain a targeting segment of between 21 to 72 nucleotides length, flanked by two direct repeats (DR) of a length of between 21 to 46 nucleotides (see, e.g.,WO2014 / 131833, herein incorporated by reference in its entirety for all purposes). In the case of S. pyogenes, the DRs are 36 nucleotides long and the targeting segment is 30 nucleotides long. The 3’ located DR is complementary to and hybridizes with the corresponding tracrRNA, which in turn binds to the Cas protein.

[0260] TheDNA-targeting segment can have, for example, a length of at least about 12, 15, 17, 18, 19, 20, 25, 30, 35, or 40 nucleotides. SuchDNA-targeting segments can have, for example, a length from about 12 to about 100, from about 12 to about 80, from about 12 to about 50, from about 12 to about 40, from about 12 to about 30, from about 12 to about 25, or from about 12 to about 20 nucleotides. For example, the DNA targeting segment can be from about 15 to about 25 nucleotides (e.g., from about 17 to about 20 nucleotides, or about 17, 18, 19, or 20 nucleotides). See, e.g., US 2016 / 0024523, herein incorporated by reference in its entirety for all purposes. For Cas9 from S. pyogenes, a typical DNA-targeting segment is between 16 and 20 nucleotides in length or between 17 and 20 nucleotides in length. For Cas9 from S. aureus, a typical DNA-targeting segment is between 21 and 23 nucleotides in length. For Cpfl, a typical DNA- targeting segment is at least 16 nucleotides in length or at least 18 nucleotides in length.

[0261] TracrRNAs can be in any form (e.g., full-length tracrRNAs or active partial tracrRNAs) and of varying lengths. They can include primary transcripts or processed forms. For example, tracrRNAs (as part of a single-guide RNA or as a separate molecule as part of a two-molecule gRNA)may comprise, consist essentially of, or consist of all or a portion of a wild type tracrRNAsequence (e.g., about ormore thanabout 20, 26, 32, 45, 48, 54, 63, 67, 85, ormorenucleotidesof awild type tracrRNA sequence). Examples of wild type tracrRNA sequences from S. pyogenes include 171-nucleotide, 89- nucleotide, 75-nucleotide, and 65-nucleotide versions. See, e.g., Deltcheva et al. (2011) Nature 471:602‑607; WO 2014 / 093661, each of which is herein incorporated by reference in its entirety for all purposes. Examples of tracrRNAs within single-guide RNAs (sgRNAs) include the tracrRNA segments found within +48, +54, +67, and +85 versions of sgRNAs, where "+n" indicates that up to the +n nucleotide of wild type tracrRNA is included in the sgRNA. See US 8,697,359, herein incorporated by reference in its entirety for all purposes.

[0262] The percent complementarity between the DNA-targeting segment of the guide RNA and the complementary strand of the target DNA can be at least 60% (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%). The percent complementarity between the DNA-targeting segment and the complementary strand of the target DNA can be at least 60% over about 20 contiguous nucleotides. As an example, the percent complementarity between the DNA-targeting segment and the complementary strand of the target DNA can be 100%over the 14 contiguous nucleotides at the 5’ end of the complementary strand of the target DNA and as low as 0% over the remainder. In such a case, the DNA-targeting segment can be considered to be 14 nucleotides in length. As another example, the percent complementarity between the DNA-targeting segment and the complementary strand of the target DNA can be 100% over the seven contiguous nucleotides at the 5’ end of the complementary strandof the targetDNAandas lowas0%over the remainder. In sucha case, theDNA-targeting segment can be considered to be 7 nucleotides in length. In some guide RNAs, at least 17 nucleotides within the DNA-targeting segment are complementary to the complementary strand of the target DNA. For example, the DNA-targeting segment can be 20 nucleotides in length and can comprise 1, 2, or 3mismatcheswith the complementary strand of the target DNA. In one example, the mismatches are not adjacent to the region of the complementary strand corresponding to the protospacer adjacent motif (PAM) sequence (i.e., the reverse complement of the PAM sequence) (e.g., the mismatches are in the 5’ end of theDNA-targeting segment of the guideRNA, or themismatches are at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 base pairs away from the region of the complementary strand corresponding to the PAM sequence).

[0263] The protein-binding segment of a gRNA can comprise two stretches of nucleotides that are complementary to one another. The complementary nucleotides of the protein-binding segment hybridize to form a double-stranded RNA duplex (dsRNA). The protein-binding segment of a subject gRNA interacts with a Cas protein, and the gRNA directs the bound Cas protein to a specific nucleotide sequence within target DNA via the DNA-targeting segment.

[0264] Single-guide RNAs can comprise a DNA-targeting segment and a scaffold sequence (i.e., the protein-binding or Cas-binding sequenceof theguideRNA). For example, suchguideRNAscanhavea5’DNA-targeting segment joined toa 39 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55 3’ scaffold sequence. Exemplary scaffold sequences comprise, consist essentially of, or consist of: and Other exemplary scaffold sequences comprise, consist essentially of, or consist of: or GuideRNAs targeting any of the guideRNA target sequences disclosed herein can include, for example, aDNA-targeting segment on the 5’ end of the guide RNA fused to any of the exemplary guide RNA scaffold sequences on the 3’ end of the guideRNA.That is, anyof theDNA-targeting segments disclosedherein canbe joined to the5’ endof anyoneof the above scaffold sequences to form a single guide RNA (chimeric guide RNA).

[0265] GuideRNAscan includemodifications or sequences that provide for additional desirable features (e.g.,modified or regulated stability; subcellular targeting; trackingwith a fluorescent label; a binding site for a protein or protein complex; and the like). Examples of such modifications include, for example, a 5’ cap (e.g., a 7-methylguanylate cap (m7G)); a 3’ polyadenylated tail (i.e., a 3’ poly(A) tail); a riboswitch sequence (e.g., to allow for regulated stability and / or regulated accessibility by proteins and / or protein complexes); a stability control sequence; a sequence that forms a dsRNA duplex (i.e., a hairpin); a modification or sequence that targets the RNA to a subcellular location (e.g., nucleus, mitochondria, chloroplasts, and the like); a modification or sequence that provides for tracking (e.g., direct conjugation to a fluorescent molecule, conjugation to a moiety that facilitates fluorescent detection, a sequence that allows for fluorescent detection, and so forth); amodification or sequence that provides a binding site for proteins (e.g., proteins that act on DNA, including transcriptional activators, transcriptional repressors, DNA methyltransferases, DNA demethylases, histone acetyltrans- ferases, histone deacetylases, and the like); and combinations thereof. Other examples of modifications include engineered stem loop duplex structures, engineered bulge regions, engineered hairpins 3’ of the stem loop duplex structure, or any combination thereof. See, e.g.,US 2015 / 0376586, herein incorporated by reference in its entirety for all purposes. A bulge can be an unpaired region of nucleotides within the duplex made up of the crRNA-like region and the minimum tracrRNA-like region. A bulge can comprise, on one side of the duplex, an unpaired 5’-XXXY‑3’ where X is any purine and Y can be a nucleotide that can form a wobble pair with a nucleotide on the opposite strand, and an unpaired 40 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55 nucleotide region on the other side of the duplex.

[0266] In some cases, a transcriptional activation system can be used comprising a dCas9-VP64 fusion protein paired with MS2-p65-HSF1. Guide RNAs in such systems can be designed with aptamer sequences appended to sgRNA tetraloop and stem-loop 2 designed to bind dimerized MS2 bacteriophage coat proteins. See, e.g., Konermann et al. (2015) Nature 517(7536):583‑588, herein incorporated by reference in its entirety for all purposes.

[0267] Unmodified nucleic acids can be prone to degradation. Exogenous nucleic acids can also induce an innate immune response. Modifications can help introduce stability and reduce immunogenicity. Guide RNAs can comprise modified nucleosides and modified nucleotides including, for example, one or more of the following: (1) alteration or replacement of oneorbothof thenon-linkingphosphateoxygensand / orof oneormoreof the linkingphosphateoxygens in the phosphodiester backbone linkage; (2) alteration or replacement of a constituent of the ribose sugar such as alteration or replacement of the 2’ hydroxyl on the ribose sugar; (3) replacement of the phosphatemoietywith dephospho linkers; (4) modification or replacement of a naturally occurring nucleobase; (5) replacement or modification of the ribose-phosphate backbone; (6) modification of the 3’ end or 5’ end of the oligonucleotide (e.g., removal, modification or replacement of a terminal phosphate group or conjugation of a moiety); and (7) modification of the sugar. Other possible guide RNA modifications include modifications of or replacement of uracils or poly-uracil tracts. See, e.g.,WO2015 / 048577 and US 2016 / 0237455, each of which is herein incorporated by reference in its entirety for all purposes. Similar modifications can bemade to Cas-encoding nucleic acids, such as CasmRNAs. For example, CasmRNAs can bemodified by depletion of uridine using synonymous codons.

[0268] As one example, nucleotides at the 5’ or 3’ end of a guide RNA can include phosphorothioate linkages (e.g., the bases can have a modified phosphate group that is a phosphorothioate group). For example, a guide RNA can include phosphorothioate linkages between the 2, 3, or 4 terminal nucleotides at the 5’ or 3’ end of the guide RNA. As another example, nucleotidesat the5’ and / or 3’ endofaguideRNAcanhave2’-O-methylmodifications.Forexample, aguideRNA can include2’-O-methylmodificationsat the2, 3, or 4 terminal nucleotidesat the5’ and / or 3’ endof theguideRNA (e.g., the 5’ end).See, e.g.,WO2017 / 173054A1 and Finn et al. (2018) Cell Reports 22:1‑9, each of which is herein incorporated by reference in its entirety for all purposes. Other possible modifications are described in more detail elsewhere herein. In a specific example, a guide RNA includes 2’-O-methyl analogs and 3’ phosphorothioate internucleotide linkages at the first three 5’ and 3’ terminal RNA residues. Such chemical modifications can, for example, provide greater stability and protection fromexonucleases to guideRNAs, allowing them to persist within cells for longer than unmodified guideRNAs. Such chemical modifications can also, for example, protect against innate intracellular immune responses that can actively degrade RNA or trigger immune cascades that lead to cell death.

[0269] In some guideRNAs (e.g., single guideRNAs), at least one loop (e.g., two loops) of the guideRNA ismodified by insertion of a distinct RNA sequence that binds to one or more adaptors (i.e., adaptor proteins or domains). Such adaptor proteins can be used to further recruit one or more heterologous functional domains, such as transcriptional activation domains (e.g., for use in CRISPRa screening in the SAM / tau biosensor cells). Examples of fusion proteins comprising such adaptor proteins (i.e., chimeric adaptor proteins) are disclosed elsewhere herein. For example, anMS2-binding loop ggccAACAUGAGGAUCACCCAUGUCUGCAGggcc (SEQ ID NO: 33) may replace nucleotides +13 to +16 and nucleo- tides+53 to+56of the sgRNAscaffold (backbone) set forth inSEQ IDNO:17orSEQ IDNO:19 (orSEQ IDNO:30or 31) or the sgRNA backbone for the S. pyogenes CRISPR / Cas9 system described in WO 2016 / 049258 and Konermann et al. (2015) Nature 517(7536):583‑588, each of which is herein incorporated by reference in its entirety for all purposes. See also US 2019‑0284572 and WO 2019 / 183123, each of which is herein incorporated by reference in its entirety for all purposes. The guideRNAnumbering used herein refers to the nucleotide numbering in the guideRNA scaffold sequence (i.e., the sequence downstream of the DNA-targeting segment of the guide RNA). For example, the first nucleotide of the guide RNA scaffold is +1, the second nucleotide of the scaffold is +2, and so forth. Residues corresponding with nucleotides +13 to +16 in SEQ ID NO: 17 or SEQ ID NO: 19 (or SEQ ID NO: 30 or 31) are the loop sequence in the region spanning nucleotides +9 to +21 in SEQ ID NO: 17 or SEQ IDNO: 19 (or SEQ ID NO: 30 or 31), a region referred to herein as the tetraloop. Residues correspondingwith nucleotides +53 to +56 in SEQ IDNO: 17 or SEQ IDNO: 19 (or SEQ IDNO: 30 or 31) are the loop sequence in the region spanning nucleotides +48 to +61 in SEQ IDNO: 17 or SEQ IDNO: 19 (or SEQ IDNO: 30 or 31), a region referred to herein as the stem loop 2.Other stem loop sequences in inSEQ IDNO: 17 or SEQ IDNO: 19 (or SEQ IDNO: 30 or 31) comprise stem loop 1 (nucleotides +33 to + 41) and stem loop 3 (nucleotides +63 to + 75). The resulting structure is an sgRNA scaffold in which each of the tetraloop and stem loop 2 sequences have been replaced by anMS2 binding loop. The tetraloop and stem loop 2 protrude from the Cas9 protein in such away that adding anMS2-binding loop should not interferewith anyCas9 residues. Additionally, the proximity of the tetraloop and stem loop 2sites to theDNA indicates that localization to these locations could result in a highdegree of interaction between theDNA and any recruited protein, such as a transcriptional activator. Thus, in some sgRNAs, nucleotides corresponding to +13 to +16and / or nucleotides corresponding to +53 to+56of theguideRNAscaffold set forth inSEQ IDNO:17orSEQ IDNO: 19 (or SEQ ID NO: 30 or 31) or corresponding residues when optimally aligned with any of these scaffold / backbones are replaced by the distinct RNA sequences capable of binding to one or more adaptor proteins or domains. Alternatively or additionally, adaptor-binding sequences canbe added to the 5’ end or the 3’ end of a guideRNA.Anexemplary guideRNA 41 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55 scaffold comprising MS2-binding loops in the tetraloop and stem loop 2 regions can comprise, consist essentially of, or consist of thesequenceset forth inSEQIDNO:34.Anexemplarygeneric singleguideRNAcomprisingMS2-binding loops in the tetraloop and stem loop 2 regions can comprise, consist essentially of, or consist of the sequence set forth in SEQ ID NO: 35.

[0270] Guide RNAs can be provided in any form. For example, the gRNA can be provided in the form of RNA, either as twomolecules (separate crRNAand tracrRNA) or as onemolecule (sgRNA), and optionally in the formof a complexwith a Cas protein. The gRNA can also be provided in the form of DNA encoding the gRNA. The DNA encoding the gRNA can encode a single RNA molecule (sgRNA) or separate RNA molecules (e.g., separate crRNA and tracrRNA). In the latter case, the DNA encoding the gRNA can be provided as one DNA molecule or as separate DNA molecules encoding the crRNA and tracrRNA, respectively.

[0271] When a gRNA is provided in the form of DNA, the gRNA can be transiently, conditionally, or constitutively expressed in the cell. DNAs encoding gRNAs can be stably integrated into the genome of the cell and operably linked to a promoter active in the cell. Alternatively, DNAs encoding gRNAs can be operably linked to a promoter in an expression construct. For example, theDNAencoding the gRNAcan be in a vector comprising a heterologous nucleic acid, such as a nucleic acid encoding a Cas protein. Alternatively, it can be in a vector or a plasmid that is separate from the vector comprising the nucleic acid encoding the Cas protein. Promoters that can be used in such expression constructs include promotersactive, for example, in oneormoreofaeukaryotic cell, ahumancell, a non-humancell, amammaliancell, anon- humanmammalian cell, a rodent cell, amouse cell, a rat cell, a pluripotent cell, an embryonic stem (ES) cell, an adult stem cell, a developmentally restricted progenitor cell, an induced pluripotent stem (iPS) cell, or a one-cell stage embryo. Such promoters can be, for example, conditional promoters, inducible promoters, constitutive promoters, or tissue-specific promoters. Such promoters can also be, for example, bidirectional promoters. Specific examples of suitable promoters include an RNA polymerase III promoter, such as a human U6 promoter, a rat U6 polymerase III promoter, or a mouse U6 polymerase III promoter.

[0272] Alternatively, gRNAscanbepreparedby variousothermethods. For example, gRNAscanbepreparedby in vitro transcription using, for example, T7RNApolymerase (see, e.g.,WO2014 / 089290andWO2014 / 065596, eachofwhich is herein incorporated by reference in its entirety for all purposes). Guide RNAs can also be a synthetically produced molecule prepared by chemical synthesis. For example, a guide RNA can be chemically synthesized to include 2’-O- methyl analogs and 3’ phosphorothioate internucleotide linkages at the first three 5’ and 3’ terminal RNA residues.

[0273] GuideRNAs (ornucleic acidsencodingguideRNAs)canbe in compositions comprisingoneormoreguideRNAs (e.g., 1, 2, 3, 4, or more guide RNAs) and a carrier increasing the stability of the guide RNA (e.g., prolonging the period under given conditions of storage (e.g., ‑20°C, 4°C, or ambient temperature) forwhich degradation products remain below a threshold, such below 0.5% by weight of the starting nucleic acid or protein; or increasing the stability in vivo). Non- limiting examples of such carriers include poly(lactic acid) (PLA) microspheres, poly(D,L-lactic-coglycolic-acid) (PLGA) microspheres, liposomes, micelles, inverse micelles, lipid cochleates, and lipid microtubules. Such compositions can further comprise a Cas protein, such as a Cas9 protein, or a nucleic acid encoding a Cas protein. B. Guide RNA Target Sequences

[0274] TargetDNAs for guideRNAs includenucleic acid sequencespresent inaDNA towhichaDNA-targetingsegment of a gRNA will bind, provided sufficient conditions for binding exist. Suitable DNA / RNA binding conditions include physiological conditions normally present in a cell. Other suitable DNA / RNA binding conditions (e.g., conditions in a cell-free system)are known in theart (see, e.g.,MolecularCloning:ALaboratoryManual, 3rdEd. (Sambrooket al., Harbor LaboratoryPress 2001), herein incorporated by reference in its entirety for all purposes). The strandof the target DNA that is complementary to and hybridizes with the gRNA can be called the "complementary strand," and the strand of the target DNA that is complementary to the "complementary strand" (and is therefore not complementary to the Cas protein or gRNA) can be called "noncomplementary strand" or "template strand."

[0275] The targetDNA includesboth the sequenceon the complementary strand towhich theguideRNAhybridizesand the corresponding sequence on the non-complementary strand (e.g., adjacent to the protospacer adjacent motif (PAM)). The term "guide RNA target sequence" as used herein refers specifically to the sequence on the non-complementary strand corresponding to (i.e., the reverse complement of) the sequence to which the guide RNA hybridizes on the complementary strand. That is, the guide RNA target sequence refers to the sequence on the non-complementary strand adjacent to thePAM(e.g., upstreamor 5’ of thePAM in the caseofCas9). AguideRNA target sequence is equivalent to the DNA-targeting segment of a guide RNA, but with thymines instead of uracils. As one example, a guide RNA target sequence for an SpCas9 enzyme can refer to the sequence upstream of the 5’-NGG‑3’ PAM on the non-complementary strand. A guide RNA is designed to have complementarity to the complementary strand of a target DNA, where hybridization between the DNA-targeting segment of the guide RNA and the complementary strand of the target DNA promotes the formation of a CRISPR complex. Full complementarity is not necessarily required, provided that there is sufficient complementarity to cause hybridization and promote formation of a CRISPR complex. If a guideRNA is referred 42 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55 to herein as targeting a guideRNA target sequence, what ismeant is that the guideRNAhybridizes to the complementary strand sequence of the target DNA that is the reverse complement of the guide RNA target sequence on the non- complementary strand.

[0276] A target DNA or guide RNA target sequence can comprise any polynucleotide, and can be located, for example, in the nucleus or cytoplasmof a cell orwithin an organelle of a cell, such as amitochondrion or chloroplast. A targetDNAor guide RNA target sequence can be any nucleic acid sequence endogenous or exogenous to a cell. The guide RNA target sequence can be a sequence coding a gene product (e.g., a protein) or a non-coding sequence (e.g., a regulatory sequence) or can include both.

[0277] For CRISPRa and SAM systems, it can be preferable for the target sequence to be adjacent to the transcription start site of a gene.For example, the target sequencecanbewithin 1000, 900, 800, 700, 600, 500, 400, 300, 200, 190, 180, 170, 160, 150, 140, 130, 120, 110, 100, 90, 80, 70, 60, 50, 40, 30, 20, 10, 5, or 1 base pair of the transcription start site. Optionally, the target sequence is within the region 200 base pairs upstream of the transcription start site and 1 base pair downstream of the transcription start site (‑200 to +1).

[0278] Site-specific binding and cleavage of a target DNA by aCas protein can occur at locations determined by both (i) base-pairing complementarity between the guide RNA and the complementary strand of the target DNA and (ii) a short motif, called theprotospacer adjacentmotif (PAM), in thenon-complementary strandof the targetDNA.ThePAMcanflank the guideRNA target sequence.Optionally, the guideRNA target sequence can be flanked on the 3’ end by thePAM (e.g., for Cas9). Alternatively, the guide RNA target sequence can be flanked on the 5’ end by the PAM (e.g., for Cpfl). For example, the cleavage site of Cas proteins can be about 1 to about 10 or about 2 to about 5 base pairs (e.g., 3 base pairs) upstream or downstream of the PAM sequence (e.g., within the guide RNA target sequence). In the case of SpCas9, the PAM sequence (i.e., on the non-complementary strand) can be 5’-N1GG‑3’, where N1 is any DNA nucleotide, and where thePAM is immediately 3’ of theguideRNA target sequenceon thenon-complementary strandof the targetDNA.As such, the sequence corresponding to the PAM on the complementary strand (i.e., the reverse complement) would be 5’- CCN2‑3’,whereN2 isanyDNAnucleotideand is immediately5’ of thesequence towhich theDNA-targetingsegmentof the guide RNA hybridizes on the complementary strand of the target DNA. In some such cases, N1 and N2 can be complementary and the N1‑ N2 base pair can be any base pair (e.g., N1=C and N2=G; N1=G and N2=C; N1=A and N2=T; orN1=T, andN2=A). In the case of Cas9 fromS. aureus, thePAMcan beNNGRRTorNNGRR,whereN canA,G,C, or T, and R can be G or A. In the case of Cas9 fromC. jejuni, the PAM can be, for example, NNNNACAC or NNNNRYAC, whereNcan beA,G,C, or T, andRcanbeGorA. In somecases (e.g., for FnCpf1), thePAMsequence canbe upstreamof the 5’ end and have the sequence 5’-TTN‑3’.

[0279] An example of a guide RNA target sequence is a 20-nucleotide DNA sequence immediately preceding an NGG motif recognized by an SpCas9 protein. For example, two examples of guide RNA target sequences plus PAMs are GN19NGG(SEQIDNO:25)orN20NGG(SEQIDNO:26).See,e.g.,WO2014 / 165825,herein incorporatedby reference in its entirety for all purposes. The guanine at the 5’ end can facilitate transcription by RNA polymerase in cells. Other examples of guideRNA target sequencesplusPAMscan include twoguaninenucleotides at the 5’ end (e.g.,GGN20NGG; SEQ ID NO: 27) to facilitate efficient transcription by T7 polymerase in vitro. See, e.g., WO 2014 / 065596, herein incorporated by reference in its entirety for all purposes. Other guide RNA target sequences plus PAMs can have between 4‑22 nucleotides in length of SEQ IDNOS: 25‑27, including the 5’G orGGand the 3’GGorNGG.Yet other guide RNA target sequences plus PAMs can have between 14 and 20 nucleotides in length of SEQ ID NOS: 25‑27.

[0280] Formation of a CRISPR complex hybridized to a target DNA can result in cleavage of one or both strands of the targetDNAwithin or near the regioncorresponding to theguideRNA target sequence (i.e., theguideRNA target sequence on the non-complementary strand of the target DNA and the reverse complement on the complementary strand to which the guideRNAhybridizes). For example, the cleavage site can bewithin the guideRNA target sequence (e.g., at a defined location relative to the PAM sequence). The "cleavage site" includes the position of a target DNA at which a Cas protein produces a single-strand break or a double-strand break. The cleavage site can be on only one strand (e.g., when a nickase is used) or on both strands of a double-strandedDNA.Cleavage sites can be at the sameposition on both strands (producing blunt ends; e.g. Cas9)) or can be at different sites on each strand (producing staggered ends (i.e., overhangs); e.g., Cpf1). Staggered ends can be produced, for example, by using two Cas proteins, each of which produces a single- strandbreakat a different cleavagesite onadifferent strand, therebyproducingadouble-strandbreak.For example, a first nickase can create a single-strand break on the first strand of double-stranded DNA (dsDNA), and a second nickase can createasingle-strandbreakon thesecondstrandofdsDNAsuch thatoverhangingsequencesarecreated. In somecases, the guide RNA target sequence or cleavage site of the nickase on the first strand is separated from the guide RNA target sequence or cleavage site of the nickase on the second strand by at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 75, 100, 250, 500, or 1,000 base pairs. IV. Methods of Screening for Genetic Modifiers of Tau Seeding or Aggregation

[0281] TheCas / taubiosensor cell linesdisclosedherein canbeused inmethodsof screening forgeneticmodifiersof tau 43 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55 seeding or aggregation. Such methods can comprise providing a population of Cas / tau biosensor cells as disclosed elsewhere herein, introducing a library comprising a plurality of unique guide RNAs, and assessing tau seeding or aggregation in the targeted cells.

[0282] As one example, a method can comprise providing a population of Cas / tau biosensor cells (e.g., a population of cells comprisingaCasprotein, a first tau repeat domain linked toa first reporter, andasecond tau repeat domain linked toa second reporter), introducing into the population of cells a library comprising a plurality of unique guide RNAs that target a plurality of genes,andculturing thepopulationof cells toallowgenomeeditingandexpansion.Theplurality of uniqueguide RNAs formcomplexeswith theCasprotein, and theCasprotein cleaves theplurality of genes resulting in knockout of gene function to produce a genetically modified population of cells. The genetically modified population of cells can then be contactedwith a tau seedingagent to producea seededpopulationof cells. The seededpopulation of cells canbecultured to allow tau aggregates to form, wherein aggregates of the first tau repeat domain and the second tau repeat domain form in a subset of the seeded population of cells to produce an aggregation-positive population of cells. Finally, abundance of each of the plurality of unique guideRNAs can be determined in the aggregation-positive population of cells relative to the populationof cells beingculturedafter introductionof theguideRNA library.Enrichment of aguideRNA in theaggregation- positive population of cells relative to the population of cells being cultured after introduction of the guide RNA library indicates that the gene targeted by the guide RNA is a genetic modifier of tau aggregation, wherein disruption of the gene targetedby theguideRNAenhances tauaggregation, or is a candidate geneticmodifier of tauaggregation (e.g., for further testing via secondary screens), wherein disruption of the gene targeted by the guide RNA is expected to enhance tau aggregation.

[0283] Similarly, the SAM / tau biosensor cell lines disclosed herein can be used in methods of screening for genetic modifiers of tau seedingor aggregation.Suchmethods cancomprise providingapopulation ofSAM / taubiosensor cells as disclosed elsewhere herein, introducing a library comprising a plurality of unique guide RNAs, and assessing tau seeding or aggregation in the targeted cells.

[0284] As one example, amethod can comprise providing a population of SAM / tau biosensor cells (e.g., a population of cells comprising a chimeric Cas protein comprising a nuclease-inactive Cas protein fused to one or more transcriptional activation domains, a chimeric adaptor protein comprising an adaptor protein fused to one or more transcriptional activation domains, a first tau repeat domain linked to a first reporter, and a second tau repeat domain linked to a second reporter), introducing into the population of cells a library comprising a plurality of unique guideRNAs that target a plurality of genes, and culturing the population of cells to allow transcriptional activation and expansion. The plurality of unique guide RNAs form complexes with the chimeric Cas protein and the chimeric adaptor protein, and the complexes activate transcription of the plurality of genes resulting in increased gene expression and a modified population of cells. The modified population of cells can then be contacted with a tau seeding agent to produce a seeded population of cells. The seeded population of cells can be cultured to allow tau aggregates to form, wherein aggregates of the first tau repeat domain and the second tau repeat domain form in a subset of the seeded population of cells to produce an aggregation- positive population of cells. Finally, abundance of each of the plurality of unique guide RNAs can be determined in the aggregation-positive populationof cells relative to thepopulationof cells being culturedafter introduction of the guideRNA library. Enrichment of a guide RNA in the aggregation-positive population of cells relative to the population of cells being cultured after introduction of the guide RNA library indicates that the gene targeted by the guide RNA is a geneticmodifier of tau aggregation, wherein transcriptional activation of the gene targeted by the guideRNAenhances tau aggregation, or is a candidate genetic modifier of tau aggregation (e.g., for further testing via secondary screens), wherein transcriptional activation of the gene targeted by the guide RNA is expected to enhance tau aggregation.

[0285] The Cas / tau biosensor cells used in the method can be any of the Cas / tau biosensor cells disclosed elsewhere herein. Likewise, the SAM / tau biosensor cells used in the method can be any of the SAM / tau biosensor cells disclosed elsewhere herein. The first tau repeat domain and the second tau repeat domain can be different or can be similar or the same. The tau repeat domain can be any of the tau repeat domains disclosed elsewhere herein. For example, the first tau repeat domain and / or the second tau repeat domain can be a wild type tau repeat domain or can comprise a pro- aggregation mutation (e.g., a pathogenic, pro-aggregation mutation), such as a tau P301S mutation. The first tau repeat domain and / or the second tau repeat domain can comprise a tau four-repeat domain. As one specific example, the first tau repeat domain and / or the second tau repeat domain can comprise, consist essentially of, or consist of SEQ IDNO: 11 or a sequence at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 11. In one specific example, the nucleic acid encoding the tau repeat domain can comprise, consist essentially of, or consist of SEQ IDNO: 12 or a sequence at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ IDNO: 12, optionallywherein thenucleic acidencodesaprotein comprising, consistingessentially of, or consistingofSEQ IDNO: 11.

[0286] Thefirst tau repeatdomaincanbe linked to thefirst reporterand thesecond tau repeatdomaincanbe linked to the second reporter by any means. For example, the reporter can be fused to the tau repeat domain (e.g., as part of a fusion protein). The reporter proteins canbeanypair of reporter proteins that produceadetectable signalwhen thefirst tau repeat domain linked to the first reporter is aggregated with the second tau repeat domain linked to the second reporter. As one 44 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55 example, the first and second reporters can be a split luciferase protein. As another example, the first and second reporter proteins can be a fluorescence resonance energy transfer (FRET) pair. FRET is a physical phenomenon in which a donor fluorophore in its excited state non-radiatively transfers its excitation energy to a neighboring acceptor fluorophore, thereby causing the acceptor to emit its characteristic fluorescence. Examples of FRET pairs (donor and acceptor fluorophores) are well known.See, e.g.,Bajar et al. (2016) Sensors (Basel) 16(9):1488, herein incorporated by reference in its entirety for all purposes. As one specific example of a FRET pair, the first reporter can be cyan fluorescent protein (CFP) and the second reporter can be yellow fluorescent protein (YFP). As a specific example, the CFP can comprise, consist essentially of, or consist of SEQ ID NO: 13 or a sequence at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ IDNO: 13. As another specific example, the YFP can comprise, consist essentially of, or consist of SEQ ID NO: 15 or a sequence at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 15.

[0287] For the Cas / tau biosensor cells, the Cas protein can be any Cas protein disclosed elsewhere herein. As one example, the Cas protein can be a Cas9 protein. For example, the Cas9 protein can be a Streptococcus pyogenesCas9 protein. As one specific example, the Cas protein can comprise, consist essentially of, or consist of SEQ ID NO: 21 or a sequence at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 21.

[0288] One or more or all of the Cas protein, the first tau repeat domain linked to the first reporter, and the second tau repeat domain linked to the second reporter can be stably expressed in the population of cells. For example, nucleic acids encoding one or more or all of the Cas protein, the first tau repeat domain linked to the first reporter, and the second tau repeat domain linked to the second reporter can be genomically integrated in the population of cells. In one specific example, the nucleic acid encoding the Cas protein can comprise, consist essentially of, or consist of SEQ IDNO: 22 or a sequence at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ IDNO: 22, optionally wherein the nucleic acid encodes a protein comprising, consisting essentially of, or consisting of SEQ ID NO: 21.

[0289] For the SAM / tau biosensor cells, the Cas protein can be any Cas protein disclosed elsewhere herein. As one example, the Cas protein can be a Cas9 protein. For example, the Cas9 protein can be a Streptococcus pyogenesCas9 protein.Asonespecificexample, thechimericCasprotein cancomprise thenuclease-inactiveCasprotein fused toaVP64 transcriptional activation domain. For example, the chimericCas protein can comprise fromN-terminus toC-terminus: the nuclease-inactiveCasprotein; anuclear localization signal; and theVP64 transcriptional activator domain.Asonespecific example, the adaptor protein can be an MS2 coat protein, and the one or more transcriptional activation domains in the chimeric adaptor protein can comprise a p65 transcriptional activation domain and an HSF1 transcriptional activation domain. For example, the chimeric adaptor protein can comprise fromN-terminus to C-terminus: the MS2 coat protein; a nuclear localization signal; the p65 transcriptional activation domain; and the HSF1 transcriptional activation domain. In one specific example, the nucleic acid encoding the chimericCasprotein can comprise, consist essentially of, or consist of SEQ IDNO:38or a sequenceat least about 90%,91%,92%, 93%,94%, 95%,96%, 97%,98%,or 99% identical toSEQ ID NO:38, optionallywherein thenucleic acid encodesaprotein comprising, consistingessentially of, or consistingofSEQ ID NO: 36. In one specific example, the nucleic acid encoding the chimeric adaptor protein can comprise, consist essentially of, or consist of SEQ ID NO: 39 or a sequence at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ IDNO: 39, optionally wherein the nucleic acid encodes a protein comprising, consisting essentially of, or consisting of SEQ ID NO: 37.

[0290] One or more or all of the chimeric Cas protein, the chimeric adaptor protein, the first tau repeat domain linked to the first reporter, and the second tau repeat domain linked to the second reporter canbe stably expressed in thepopulation of cells. For example, nucleic acids encoding one or more or all of the chimeric Cas protein, the chimeric adaptor protein, thefirst tau repeatdomain linked to thefirst reporter, and thesecond tau repeatdomain linked to thesecond reporter canbe genomically integrated in the population of cells.

[0291] As disclosed elsewhere herein, the cells can be any type of cells. For example, the cells can be eukaryotic cells, mammalian cells, or human cells (e.g., HEK293T cells or neuronal cells).

[0292] The plurality of unique guide RNAs can be introduced into the population of cells by any knownmeans. In some methods, the guideRNAs are introduced into the population of cells by viral transduction, such as retroviral, adenoviral, or lentiviral transduction. In a specific example, the guide RNAs can be introduced by lentiviral transduction. Each of the plurality of unique guideRNAscanbe in a separate viral vector. The population of cells can be infected at anymultiplicity of infection. For example, themultiplicity of infection can be between about 0.1 and about 1.0, between about 0.1 and about 0.9, between about 0.1 and about 0.8, between about 0.1 and about 0.7, between about 0.1 and about 0.6, between about 0.1 and about 0.5, between about 0.1 and about 0.4, or between about 0.1 and about 0.3. Alternatively, the multiplicity of infection can be less than about 1.0, less than about 0.9, less than about 0.8, less than about 0.7, less than about 0.6, less than about 0.5, less than about 0.4, less than about 0.3, or less than about 0.2. In a specific example, the multiplicity of infection can be less than about 0.3.

[0293] TheguideRNAscanbe introduced into thepopulationof cells togetherwithaselectionmarkeror reporter gene to select for cells that have the guide RNAs, and themethod can further comprise selecting cells that comprise the selection marker or reporter gene. Examples of selection markers and reporter genes are provided elsewhere herein. As one 45 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55 example, the selection marker can be one that imparts resistance to a drug, such as neomycin phosphotransferase, hygromycin B phosphotransferase, puromycin-N-acetyltransferase, and blasticidin S deaminase. Another exemplary selectionmarker is bleomycin resistance protein, encoded by theSh ble gene (Streptoalloteichus hindustanus bleomycin gene), which confers zeocin (phleomycinD1) resistance. For example, cells can be selectedwith a drug (e.g., puromycin) so that only cells transducedwith a guideRNAconstruct are preserved for being used to carry out screening. For example, the drug can be puromycin or zeocin (phleomycin D1).

[0294] In some methods, the plurality of unique guide RNAs are introduced at a concentration selected such that a majority of the cells receive only one of the unique guide RNAs. For example, if the guide RNAs are being introduced by viral transduction, the cells can be infected at a low multiplicity of infection to ensure that most cells receive only one viral construct with high probability. As one specific example, the multiplicity of infection can be less than about 0.3.

[0295] The population of cells into which the plurality of unique guide RNAs is introduced can be any suitable number of cells. For example, the population of cells can comprise greater than about 50, greater than about 100, greater than about 200, greater than about 300, greater than about 400, greater than about 500, greater than about 600, greater than about 700, greater than about 800, greater than about 900, or greater than about 1000 cells per unique guide RNA. In a specific example, the population of cells comprises greater than about 300 cells or greater than about 500 cells per unique guide RNA.

[0296] The plurality of unique guide RNAs can target any number of genes. For example, the plurality of unique guide RNAs can target about 50 or more genes, about 100 or more genes, about 200 or more genes, about 300 or more genes, about 400 ormore genes, about 500 ormore genes, about 1000 ormore genes, about 2000 ormore genes, about 3000 or more genes, about 4000 or more genes, about 5000 or more genes, about 10000 or more genes, or about 20000 or more genes. In some methods, the guide RNAs can be selected to target genes in a particular signaling pathway. In some methods, the library of unique guide RNAs is a genome-wide library.

[0297] The plurality of unique guide RNAs can target any number of sequences within each individual targeted gene. In some methods, a plurality of target sequences are targeted on average in each of the targeted plurality of genes. For example, about 2 to about 10, about 2 to about 9, about 2 to about 8, about 2 to about 7, about 2 to about 6, about 2 to about 5, about 2 to about 4, or about 2 to about 3 unique target sequences can be targeted on average in each of the targeted plurality of genes. For example, at least about 2, at least about 3, at least about 4, at least about 5, or at least about 6unique target sequences can be targeted on average in each of the targeted plurality of genes. As a specific example, about 6 target sequencescanbe targetedonaverage in eachof the targetedplurality of genes.Asanother specific example, about 3 to about 6 or about 4 to about 6 target sequences are targeted on average in each of the targeted plurality of genes.

[0298] The guide RNAs can target any desired location in the target genes. In some CRISPRn methods using the Cas / taubiosensor cells, eachguideRNA targets aconstitutive exon if possible. In somemethods, eachguideRNA targets a 5’ constitutive exon if possible. In some methods, each guide RNA targets a first exon, a second exon, or a third exon (from the 5’ end of the gene) if possible. In some CRISPRamethods using the SAM / tau biosensor cells, each guide RNA can target a guideRNA target sequencewithin 200 bp upstreamof a transcription start site, if possible. In someCRISPRa methods using the SAM / tau biosensor cells, wherein each guide RNA can comprise one or more adaptor-binding elements to which the chimeric adaptor protein can specifically bind. In one example, each guide RNA comprises two adaptor-binding elements to which the chimeric adaptor protein can specifically bind, optionally wherein a first adaptor- bindingelement iswithinafirst loopofeachof theoneormoreguideRNAs,andasecondadaptor-bindingelement iswithin a second loop of each of the one or more guide RNAs. For example, the adaptor-binding element can comprise the sequence set forth in SEQ ID NO: 33. In a specific example, each of one or more guide RNAs is a single guide RNA comprising aCRISPRRNA (crRNA) portion fused to a transactivating CRISPRRNA (tracrRNA) portion, and the first loop is the tetraloop corresponding to residues 13‑16 of SEQ ID NO: 17, 19, 30, or 31, and the second loop is the stem loop 2 corresponding to residues 53‑56 of SEQ ID NO: 17, 19, 30, or 31.

[0299] The step of culturing the population of cells to allow genome editing and expansion can be any suitable period of time. For example, the culturing can be for between about 2 days and about 10 days, between about 3 days and about 9 days, betweenabout 4 days andabout 8 days, betweenabout 5days andabout 7 days, or about 6 days. Likewise, the step of culturing the population of cells to allow transcriptional activation and expansion can be any suitable period of time. For example, the culturing can be for between about 2 days and about 10 days, between about 3 days and about 9 days, between about 4 days and about 8 days, between about 5 days and about 7 days, or about 6 days.

[0300] Any suitable tau seeding agent can be used to produce a seeded population of cells. Suitable tau seeding agents are disclosed elsewhere herein. Some suitable seeding agents comprise a tau repeat domain that can be, for example, different fromor similar to or the sameas the first tau repeat domain and / or the second tau repeat domain. In one example, the seeding step comprises culturing the genetically modified population of cells in the presence of conditioned medium harvested from cultured tau-aggregation-positive cells in which a tau repeat domain stably presents in an aggregated state. For example, the conditionedmedium can have been harvested from confluent tau-aggregation-positive cells after being on the confluent cells for about 1 to about 7 days, about 2 to about 6 days, about 3 to about 5 days, or about 4 days. The seeding step can comprise culturing the genetically modified population of cells in any suitable ratio of conditioned 46 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55 medium to freshmedium. For example, it can comprise culturing the genetically modified population of cells in about 90% conditionedmedium and about 10% freshmedium, about 85% conditionedmedium and about 15% freshmedium, about 80% conditioned medium and about 20% fresh medium, about 75% conditioned medium and about 25% fresh medium, about 70% conditioned medium and about 30% fresh medium, about 65% conditioned medium and about 35% fresh medium, about 60% conditioned medium and about 40% fresh medium, about 55% conditioned medium and about 45% freshmedium, about 50% conditionedmedium and about 50% freshmedium, about 45% conditionedmedium and about 55% fresh medium, about 40% conditioned medium and about 60% fresh medium, about 35% conditioned medium and about 65% freshmedium, about 30%conditionedmediumand about 70% freshmedium, about 25%conditionedmedium and about 75% fresh medium, about 20% conditioned medium and about 80% fresh medium, about 15% conditioned mediumandabout 85%freshmedium,or about 10%conditionedmediumandabout 90% freshmedium. Inoneexample, it can comprise culturing the genetically modified population of cells in a medium that comprises at least about 50% conditioned medium and no more than about 50% fresh medium. In a specific example, it can comprise culturing the genetically modified population of cells in about 75% conditioned medium and about 25% fresh medium. Optionally, the genetically modified population of cells is not co-cultured with the tau-aggregation-positive cells in which a tau repeat domain stably presents in an aggregated state.

[0301] Thestepof culturing theseededpopulationof cells toallow tauaggregates to form,whereinaggregatesof thefirst tau repeat domain and the second tau repeat domain form in a subset of the seeded population of cells to produce an aggregation-positive population of cells, can be any suitable length of time. For example, the culturing can be for between about 1 day andabout 7 days, between about 2 days andabout 6 days, between about 3 days andabout 5 days, or about 4 days. Aggregation can be determined by any suitablemeans, depending on the reporters used. For example, in methods in which the first reporter and the second reporter are a fluorescence resonance energy transfer (FRET) pair, the aggregation-positive population of cells can be identified by flow cytometry.

[0302] Abundance of guide RNAs can be determined by any suitable means. In a specific example, abundance is determined by next-generation sequencing. Next-generation sequencing refers to non-Sanger-based high-throughput DNA sequencing technologies. For example, determining abundance of a guide RNA can comprise measuring read counts of the guide RNA.

[0303] In some methods, a guide RNA is considered enriched if the abundance of the guide RNA relative to the total population of the plurality of unique guide RNAs is at least about 1.5-fold higher in the aggregation-positive population of cells relative to the population of cells being cultured after introduction of the guide RNA library. Different enrichment thresholds can also be used. For example, an enrichment threshold can be set higher to be more stringent (e.g., at least about 1.6-fold, at least about 1.7-fold, at least about 1.8-fold, at least about 1.9-fold, at least about 2-fold, at least about 2.5- fold, or at least about 2.5-fold). Alternatively, an enrichment threshold can be set lower to be less stringent (e.g., at least about 1.4-fold, at least about 1.3-fold, or at least about 1.2-fold).

[0304] In one example, the step of determining abundance can comprise determining abundance of the plurality of unique guide RNAs in the aggregation-positive population relative to the population of cells cultured after introduction of the guideRNA library at a first time point during the culturing and / or a second time point during the culturing. For example, the first time point can be at a first passage of culturing the population of cells, and the second time point can be in the middle of culturing the population of cells to allow genome editing and expansion. For example, the first time point can be after a sufficient amount of time for the guide RNAs to form complexes with the Cas protein, and for the Cas protein to cleave theplurality of genes resulting in knockout of gene function (CRISPRn) or to transcriptionally activate theplurality of genes (CRISPRa). However, the first time point should ideally be at the first cell passage to determine the gRNA library representation soon after infection (i.e., before further expansion and genome editing) and to determine if each gRNA representation evolves from the first time point to the second time points and to any additional time points to a final time point. This allows ruling out enriched gRNAs / targets due to cell growth advantages during the course of the screen by verifying gRNA abundance is unchanged between the first and second time points. As a specific example, the first time point can be after about 1 day, about 2 days, about 3 days, or about 4 days of culturing andexpansion, and the second time point can be after about 3 days, about 4 days, about 5 days, or about 6 days of culturing and expansion. For example, the first time point can be after about 3 days of culturing and expansion, and the second time point can be after about 6 days of culturing and expansion. In somemethods, a gene can then be considered a geneticmodifier of tau aggregation, wherein disruption (CRISPRn) or transcriptional activation (CRISPRa) of the gene enhances (or is expected to enhance) tau aggregation, if the abundance of a guide RNA targeting the gene relative to the total population of the plurality of unique guideRNAs is at least 1.5-fold higher (or higher thanadifferent selected enrichment threshold) in the aggregation-positive population of cells relative to the population of cells cultured after introduction of the guideRNA library at both the first time point and the second time point. Alternatively or additionally, a gene can be considered a genetic modifier of tau aggregation, wherein disruption (CRISPRn) or transcriptional activation (CRISPRa) of the gene enhances (or is expected to enhance) tau aggregation, if the abundance of at least two unique guide RNAs targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold higher (or higher than a different selected enrichment threshold) in the aggregation-positive population of cells relative to the population of cells cultured after introduction of the 47 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55 guide RNA library at either the first time point or the second time point.

[0305] In some CRISPRn methods, the following steps are taken to identify a gene as a genetic modifier of tau aggregation, wherein disruption (CRISPRn) or transcriptional activation (CRISPRa) of the gene enhances (or is expected to enhance) tau aggregation. Likewise, in some CRISPRa methods, the following steps are taken to identify a gene as a geneticmodifier of tauaggregation,wherein transcriptional activation of thegeneenhances tauaggregation. The first step comprises identifying which of the plurality of unique guide RNAs are present in the aggregation-positive population of cells. The second step comprises calculating the random chance of the guide RNAs identified being present using the formula nCn’ * (x-n’)C(m-n) / xCm, where x is the variety of unique guide RNAs introduced into the population of cells, m is the variety of unique guideRNAs identified in step (1), n is the variety of unique guideRNAs introduced into the population of cells that target the gene, and n’ is the variety of unique guide RNAs identified in step (1) that target the gene. The third stepcomprisescalculatingaverageenrichment scores for theguideRNAs identified in step (1). Theenrichment score for a guideRNA is the relativeabundanceof theguideRNA in theaggregation-positive populationof cells dividedby the relative abundance of the guide RNA in the population of cells cultured after introduction of the guide RNA library. The relative abundance is the read count of the guide RNA divided by the read count of the total population of the plurality of unique guide RNAs. The fourth step comprises selecting the gene if a guide RNA targeting the gene is significantly below the random chance of being present and above a threshold enrichment score. Possible threshold enrichment scores are discussed above. As a specific example, the threshold enrichment score can be set at about 1.5-fold.

[0306] Variety when used in the phrase variety of unique guide RNAs means the number of unique guide RNA sequences. It is not the abundance, but rather the qualitative "present" or "not present." Variety of unique guide RNAs means the number of unique guide RNA sequence. The variety of unique guide RNA is determined by next generation sequencing (NGS) to identify all the unique guide RNAs present in a cell population. It is done by using two primers that recognize theconstant regionsof theviral vector toamplify thegRNA that isbetween theconstant regionsandaprimer that recognizes one constant region for sequencing. Each unique guide RNA present in the sample will generate read counts using thesequencingprimer.TheNGSresultswill include thesequenceandalso thenumberof readscorresponding to the sequence. The number of readswill be used for the enrichment score calculation for each guideRNA, and the presence of each unique sequence will tell us which guide RNAs are present. For instance, if there are three unique guide RNAs for a gene before selection, and all three are retained post-selection, then both n and n’ are 3. These numbers are used for calculating the statistics but not the actual read counts. However, the read counts for each guide RNA (in one example, 100, 200, 50, which correspond to each of the 3 unique guide RNAs) will be used for the calculation of enrichment score. V. Methods of Screening for Genetic Modifiers of Tau Aggregation that Prevent Tau Aggregation

[0307] TheCas / taubiosensor cell linesdisclosedherein canbeused inmethodsof screening forgeneticmodifiersof tau aggregation (e.g., that prevent tau aggregation or are expected to prevent tau aggregation). Suchmethods can comprise providingapopulationofCas / taubiosensor cells asdisclosedelsewhereherein, introducinga library comprisingaplurality of unique guide RNAs, and assessing tau aggregation in the targeted cells.

[0308] As one example, a method can comprise providing a population of Cas / tau biosensor cells (e.g., a population of cells comprisingaCasprotein, a first tau repeat domain linked toa first reporter, andasecond tau repeat domain linked toa second reporter), introducing into the population of cells a library comprising a plurality of unique guide RNAs that target a plurality of genes,andculturing thepopulationof cells toallowgenomeeditingandexpansion.Theplurality of uniqueguide RNAs formcomplexeswith theCasprotein, and theCasprotein cleaves theplurality of genes resulting in knockout of gene function to produce a genetically modified population of cells. The genetically modified population of cells can then be contacted with a tau seeding agent to produce a seeded population of cells. For example, the tau seeding agent can be a "maximum seeding" agent as described elsewhere herein, such as cell lysates from tau-aggregation-positive cells. The seeded population of cells can be cultured to allow tau aggregates to form, wherein aggregates of the first tau repeat domain and the second tau repeat domain form in a subset of the seeded population of cells to produce an aggregation- positive population of cells and wherein aggregates do not form in a second subset of the seeded population of cells to produce an aggregation-negative population of cells. Finally, abundance of each of the plurality of unique guideRNAs can bedetermined in theaggregation-positivepopulationof cells relative to theaggregation-negativepopulationof cellsand / or relative to the population of cells after being seeded and / or relative to the population of cells being cultured after introduction of the guide RNA library. Enrichment of a guide RNA in the aggregation-negative population of cells relative to the aggregation-positive population of cells and / or relative to thepopulation of cells after being seededand / or relative to the population of cells being cultured after introduction of the guide RNA library indicates that the gene targeted by the guideRNA is a geneticmodifier of tau aggregation, wherein disruption of the gene targeted by the guideRNAprevents tau aggregation, or is a candidate geneticmodifier of tau aggregation (e.g., for further testing via secondary screens), wherein disruption of the gene targeted by the guide RNA is expected to prevent tau aggregation. Likewise, depletion of a guide RNA in the aggregation-positive population of cells relative to the aggregation-negative population of cells and / or relative to the population of cells after being seeded and / or relative to the population of cells being cultured after introduction of the 48 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55 guide RNA library indicates that the gene targeted by the guide RNA is a genetic modifier of tau aggregation, wherein disruption of the gene targeted by the guide RNA prevents tau aggregation, or is a candidate genetic modifier of tau aggregation (e.g., for further testing via secondary screens), wherein disruption of the gene targeted by the guide RNA is expected to prevent tau aggregation. Enrichment of a guideRNA in the aggregation-positive population of cells relative to the aggregation-negative population of cells and / or relative to the population of cells after being seeded and / or relative to the population of cells being cultured after introduction of the guide RNA library indicates that the gene targeted by the guideRNA is a geneticmodifier of tau aggregation, wherein disruption of the gene targeted by the guideRNApromotes or enhances tau aggregation, or is a candidate genetic modifier of tau aggregation (e.g., for further testing via secondary screens), wherein disruption of the gene targeted by the guide RNA is expected to promote or enhance tau aggregation. Likewise, depletion of a guide RNA in the aggregation-negative population of cells relative to the aggregation-positive populationof cellsand / or relative to thepopulationof cells afterbeingseededand / or relative to thepopulationof cells being cultured after introduction of the guide RNA library indicates that the gene targeted by the guide RNA is a geneticmodifier of tau aggregation, wherein disruption of the gene targeted by the guideRNApromotes or enhances tau aggregation, or is a candidate genetic modifier of tau aggregation (e.g., for further testing via secondary screens), wherein disruption of the gene targeted by the guide RNA is expected to promote or enhance tau aggregation.

[0309] Similarly, the SAM / tau biosensor cell lines disclosed herein can be used in methods of screening for genetic modifiersof tauaggregation (e.g., that prevent tauaggregationor areexpected toprevent tauaggregation).Suchmethods can comprise providing a population of SAM / tau biosensor cells as disclosed elsewhere herein, introducing a library comprising a plurality of unique guide RNAs, and assessing tau aggregation in the targeted cells.

[0310] As one example, amethod can comprise providing a population of SAM / tau biosensor cells (e.g., a population of cells comprising a chimeric Cas protein comprising a nuclease-inactive Cas protein fused to one or more transcriptional activation domains, a chimeric adaptor protein comprising an adaptor protein fused to one or more transcriptional activation domains, a first tau repeat domain linked to a first reporter, and a second tau repeat domain linked to a second reporter), introducing into the population of cells a library comprising a plurality of unique guideRNAs that target a plurality of genes, and culturing the population of cells to allow transcriptional activation and expansion. The plurality of unique guide RNAs form complexes with the chimeric Cas protein and the chimeric adaptor protein, and the complexes activate transcription of the plurality of genes resulting in increased gene expression and a modified population of cells. The modified population of cells can then be contacted with a tau seeding agent to produce a seeded population of cells. For example, the tau seeding agent can be a "maximum seeding" agent as described elsewhere herein, such as cell lysates from tau-aggregation-positive cells. The seeded population of cells can be cultured to allow tau aggregates to form, wherein aggregates of the first tau repeat domain and the second tau repeat domain form in a subset of the seeded population of cells to produce an aggregation-positive population of cells andwherein aggregates do not form in a second subset of the seeded population of cells to produce an aggregation-negative population of cells. Finally, abundance of each of the plurality of unique guideRNAs can be determined in the aggregation-positive population of cells relative to the aggregation-negative population of cells and / or relative to the population of cells after being seeded and / or relative to the populationof cells beingculturedafter introductionof theguideRNA library.Enrichment of aguideRNA in theaggregation- negative population of cells relative to the aggregation-positive population of cells and / or relative to the population of cells after being seeded and / or relative to the population of cells being cultured after introduction of the guide RNA library indicates that the gene targeted by the guide RNA is a genetic modifier of tau aggregation, wherein transcriptional activation of the gene targeted by the guide RNA prevents tau aggregation, or is a candidate genetic modifier of tau aggregation (e.g., for further testing via secondary screens), wherein transcriptional activation of the gene targeted by the guide RNA is expected to prevent tau aggregation. Likewise, depletion of a guide RNA in the aggregation-positive population of cells relative to the aggregation-negative population of cells and / or relative to the population of cells after being seeded and / or relative to the population of cells being cultured after introduction of the guide RNA library indicates that the gene targeted by the guide RNA is a genetic modifier of tau aggregation, wherein transcriptional activation of the gene targeted by the guide RNA prevents tau aggregation, or is a candidate genetic modifier of tau aggregation (e.g., for further testing via secondary screens), wherein transcriptional activation of the gene targeted by the guide RNA is expected to prevent tau aggregation. Enrichment of a guideRNA in the aggregation-positive population of cells relative to the aggregation-negative population of cells and / or relative to the population of cells after being seeded and / or relative to the population of cells being cultured after introduction of the guide RNA library indicates that the gene targeted by the guide RNA is a genetic modifier of tau aggregation, wherein transcriptional activation of the gene targeted by the guide RNA promotes or enhances tau aggregation, or is a candidate genetic modifier of tau aggregation (e.g., for further testing via secondary screens),wherein transcriptional activationof thegene targetedby theguideRNA isexpected topromoteor enhance tauaggregation. Likewise, depletionof aguideRNA in theaggregation-negativepopulationof cells relative to the aggregation-positive population of cells and / or relative to the population of cells after being seeded and / or relative to the population of cells being cultured after introduction of the guide RNA library indicates that the gene targeted by the guide RNA is a genetic modifier of tau aggregation, wherein transcriptional activation of the gene targeted by the guide RNA promotes or enhances tau aggregation, or is a candidate genetic modifier of tau aggregation (e.g., for further testing via 49 EP 4 729 947 A2 5 10 15 20 25 30 35 40 45 50 55 secondary screens), wherein transcriptional activation of the gene targeted by the guide RNA is expected to promote or enhance tau aggregation.

[0311] The Cas / tau biosensor cells used in the method can be any of the Cas / tau biosensor cells disclosed elsewhere herein. Likewise, the SAM / tau biosensor cells used in the method can be any of the SAM / tau biosensor cells disclosed elsewhere herein. The first tau repeat domain and the second tau repeat domain can be different or can be similar or the same. The tau repeat domain can be any of the tau repeat domains disclosed elsewhere herein. For example, the first tau repeat domain and / or the second tau repeat domain can be a wild type tau repeat domain or can comprise a pro- aggregation mutation (e.g., a pathogenic, pro-aggregation mutation), such as a tau P301S mutation. The first tau repeat domain and / or the second tau repeat domain can comprise a tau four-repeat domain. As one specific example, the first tau repeat domain and / or the second tau repeat domain can comprise, consist essentially of, or consist of SEQ IDNO: 11 or a sequence at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 11. In one specific example, the nucleic acid encoding the tau repeat domain can comprise, consist essentially of, or consist of SEQ IDNO: 12 or a sequence at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ IDNO: 12, optionallywherein thenucleic acidencodesaprotein comprising, consistingessentially of, or consistingofSEQ IDNO: 11.

[0312] Thefirst tau repeatdomaincanbe linked to thefirst reporterand thesecond tau repeatdomaincanbe linked to the second reporter by any means. For example, the reporter can be fused to the tau repeat domain (e.g., as part of a fusion protein). The reporter proteins canbeanypair of reporter proteins that produceadetectable signalwhen thefirst tau repeat domain linked to the first reporter is aggregated with the second tau repeat domain linked to the second reporter. As one example, the first and second reporters can be a split luciferase protein. As another example, the first and second reporter proteins can be a fluorescence resonance energy transfer (FRET) pair. FRET is a physical phenomenon in which a donor fluorophore in its excited state non-radiatively transfers its excitation energy to a neighboring acceptor fluorophore, thereby causing the acceptor to emit its characteristic fluorescence. Examples of FRET pairs (donor and accepto...

Claims

1. A method of screening for genetic modifiers of tau aggregation and / or disaggregation, comprising: (a) providing a population of cells comprising a Cas protein, a first tau repeat domain linked to a first reporter, and a second tau repeat domain linked to a second reporter, wherein the cells are tau-aggregation-positive cells in which a tau repeat domain stably presents in an aggregated state, wherein the first reporter and the second reporter are fluorescent proteins, wherein the first reporter and the second reporter are a fluorescence resonance energy transfer (FRET) pair, and wherein the cells are mammalian cells; (b) introducing into the population of cells a library comprising a plurality of unique guide RNAs that target a plurality of genes; (c) culturing the population of cells to allow genome editing and expansion, wherein the plurality of unique guide RNAs form complexes with the Cas protein, and the Cas protein cleaves the plurality of genes resulting in knockout of gene function to produce a genetically modified population of cells, and wherein the culturing results in an aggregation-positive population of cells and an aggregation-negative population of cells; (d) synchronizing cell cycle progression to obtain a cell population predominantly enriched in S phase and identifying the aggregation-positive population of cells and the aggregation-negative population of cells, wherein the aggregation-positive population of cells and the aggregation-negative population of cells are identified by flow cytometry; and (e) determining abundance of each of the plurality of unique guide RNAs in the aggregation-positive population of cells identified in step (d) relative to the aggregation-negative population of cells identified in step (d) and / or the cultured population of cells at one or more time points in step (c), and / or determining abundance of each of the plurality of unique guide RNAs in the aggregation-negative population of cells identified in step (d) relative to the aggregation-positive population of cells identified in step (d) and / or the cultured population of cells at one or more time points in step (c), wherein enrichment of a guide RNA in the aggregation-negative population of cells identified in step (d) relative to the aggregation-positive population of cells identified in step (d) and / or the cultured population of cells at one or more time points in step (c) or wherein depletion of a guide RNA in the aggregation-positive population of cells identified in step (d) relative to the aggregation-negative population of cells identified in step (d) and / or cultured population of cells at one or more time points in step (c) indicates that the gene targeted by the guide RNA is a genetic modifier of tau disaggregation, wherein disruption of the gene targeted by the guide RNA promotes tau disaggregation, and / or wherein enrichment of a guide RNA in the aggregation-positive population of cells identified in step (d) relative to the aggregation-negative population of cells identified in step (d) and / or the cultured population of cells at one or more time points in step (c) or wherein depletion of a guide RNA in the aggregation-negative population of cells identified in step (d) relative to the aggregation-positive population of cells identified in step (d) and / or cultured population of cells at one or more time points in step (c) indicates that the gene targeted by the guide RNA is a genetic modifier of tau aggregation, wherein disruption of the gene targeted by the guide RNA promotes or enhances tau aggregation.

2. The method of claim 1, wherein the Cas protein is a Cas9 protein, optionally wherein the Cas protein is a Streptococcus pyogenes Cas9 protein, optionally wherein the Cas protein comprises SEQ ID NO: 21, and optionally wherein the Cas protein is encoded by a coding sequence comprising the sequence set forth in SEQ ID NO: 22.

3. The method of claim 1 or 2, wherein the Cas protein, the first tau repeat domain linked to the first reporter, and the second tau repeat domain linked to the second reporter are stably expressed in the population of cells, or wherein nucleic acids encoding the Cas protein, the first tau repeat domain linked to the first reporter, and the second tau repeat domain linked to the second reporter are genomically integrated in the population of cells.

4. The method of any one of claims 1-3, wherein each guide RNA targets a constitutive exon, optionally wherein each guide RNA targets a 5' constitutive exon, or wherein each guide RNA targets a first exon, a second exon, or a third exon.

5. A method of screening for genetic modifiers of tau aggregation and / or disaggregation, comprising: (a) providing a population of cells comprising a chimeric Cas protein comprising a nuclease-inactive Cas protein fused to one or more transcriptional activation domains, a chimeric adaptor protein comprising an adaptor protein fused to one or more transcriptional activation domains, a first tau repeat domain linked to a first reporter, and a second tau repeat domain linked to a second reporter, wherein the cells are tau-aggregation-positive cells in which a tau repeat domain stably presents in an aggregated state, wherein the first reporter and the second reporter are fluorescent proteins, wherein the first reporter and the second reporter are a fluorescence resonance energy transfer (FRET) pair, and wherein the cells are mammalian cells; (b) introducing into the population of cells a library comprising a plurality of unique guide RNAs that target a plurality of genes; (c) culturing the population of cells to allow transcriptional activation and expansion, wherein the plurality of unique guide RNAs form complexes with the chimeric Cas protein and the chimeric adaptor protein, and the complexes activate transcription of the plurality of genes resulting in increased gene expression to produce a genetically modified population of cells, and wherein the culturing results in an aggregation-positive population of cells and an aggregation-negative population of cells; (d) synchronizing cell cycle progression to obtain a cell population predominantly enriched in S phase and identifying the aggregation-positive population of cells and the aggregation-negative population of cells, wherein the aggregation-positive population of cells and the aggregation-negative population of cells are identified by flow cytometry; and (e) determining abundance of each of the plurality of unique guide RNAs in the aggregation-positive population of cells identified in step (d) relative to the aggregation-negative population of cells identified in step (d) and / or the cultured population of cells at one or more time points in step (c), and / or determining abundance of each of the plurality of unique guide RNAs in the aggregation-negative population of cells identified in step (d) relative to the aggregation-positive population of cells identified in step (d) and / or the cultured population of cells at one or more time points in step (c), wherein enrichment of a guide RNA in the aggregation-negative population of cells identified in step (d) relative to the aggregation-positive population of cells identified in step (d) and / or the cultured population of cells at one or more time points in step (c) or wherein depletion of a guide RNA in the aggregation-positive population of cells identified in step (d) relative to the aggregation-negative population of cells identified in step (d) and / or cultured population of cells at one or more time points in step (c) indicates that the gene targeted by the guide RNA is a genetic modifier of tau disaggregation, wherein transcriptional activation of the gene targeted by the guide RNA promotes tau disaggregation, and / or wherein enrichment of a guide RNA in the aggregation-positive population of cells identified in step (d) relative to the aggregation-negative population of cells identified in step (d) and / or the cultured population of cells at one or more time points in step (c) or wherein depletion of a guide RNA in the aggregation-negative population of cells identified in step (d) relative to the aggregation-positive population of cells identified in step (d) and / or cultured population of cells at one or more time points in step (c) indicates that the gene targeted by the guide RNA is a genetic modifier of tau aggregation, wherein transcriptional activation of the gene targeted by the guide RNA promotes or enhances tau aggregation.

6. The method of claim 5, wherein the Cas protein is a Cas9 protein, optionally wherein the Cas protein is a Streptococcus pyogenes Cas9 protein, and wherein the chimeric Cas protein comprises the nuclease-inactive Cas protein fused to a VP64 transcriptional activation domain, optionally wherein the chimeric Cas protein comprises from N-terminus to C-terminus: the nuclease-inactive Cas protein; a nuclear localization signal; and the VP64 transcriptional activation domain, optionally wherein the chimeric Cas protein comprises SEQ ID NO: 36, and optionally wherein the chimeric Cas protein is encoded by a coding sequence comprising the sequence set forth in SEQ ID NO: 38, and wherein the adaptor protein is an MS2 coat protein, and wherein the one or more transcriptional activation domains in the chimeric adaptor protein comprise a p65 transcriptional activation domain and an HSF1 transcriptional activation domain, optionally wherein the chimeric adaptor protein comprises from N-terminus to C-terminus: the MS2 coat protein; a nuclear localization signal; the p65 transcriptional activation domain; and the HSF1 transcriptional activation domain, optionally wherein the chimeric adaptor protein comprises SEQ ID NO: 37, and optionally wherein the chimeric adaptor protein is encoded by a coding sequence comprising the sequence set forth in SEQ ID NO: 39.

7. The method of claim 5 or 6, wherein the chimeric Cas protein, the chimeric adaptor protein, the first tau repeat domain linked to the first reporter, and the second tau repeat domain linked to the second reporter are stably expressed in the population of cells, or wherein nucleic acids encoding the chimeric Cas protein, the chimeric adaptor protein, the first tau repeat domain linked to the first reporter, and the second tau repeat domain linked to the second reporter are genomically integrated in the population of cells.

8. The method of any one of claims 5-7, wherein each guide RNA targets a guide RNA target sequence within 200 bp upstream of a transcription start site, and wherein each guide RNA comprises one or more adaptor-binding elements to which the chimeric adaptor protein can specifically bind, optionally wherein each guide RNA comprises two adaptor-binding elements to which the chimeric adaptor protein can specifically bind, optionally wherein a first adaptor-binding element is within a first loop of each guide RNA, and a second adaptor-binding element is within a second loop of each guide RNA, optionally wherein the adaptor-binding elements comprise the sequence set forth in SEQ ID NO: 33, and optionally wherein each guide RNA is a single guide RNA comprising a CRISPR RNA (crRNA) portion fused to a transactivating CRISPR RNA (tracrRNA) portion, and the first loop is a tetraloop corresponding to residues 13-16 of SEQ ID NO: 17, and the second loop is a stem loop 2 corresponding to residues 53-56 of SEQ ID NO: 17.

9. The method of any one of claims 1-8, wherein: (I) step (c) is about 3 days to about 14 days, optionally wherein step (c) is about 10 days to about 14 days; and / or (II) the synchronizing of cell cycle progression to obtain a cell population predominantly enriched in S phase is achieved by double thymidine block; and / or (III) abundance is determined by next-generation sequencing.

10. The method of any one of claims 1-9, wherein a guide RNA is considered enriched in the aggregation-negative population of cells in step (d) if the abundance of the guide RNA relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold higher in the aggregation-negative population of cells in step (d) relative to the aggregation-positive population of cells in step (d) and / or the cultured population of cells at one or more time points in step (c), and wherein a guide RNA is considered depleted in the aggregation-positive population of cells in step (d) if the abundance of the guide RNA relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold lower in the aggregation-positive population of cells in step (d) relative to the aggregation-negative population of cells in step (d) and / or the cultured population of cells at one or more time points in step (c), or wherein a guide RNA is considered enriched in the aggregation-positive population of cells in step (d) if the abundance of the guide RNA relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold higher in the aggregation-positive population of cells in step (d) relative to the aggregation-negative population of cells in step (d) and / or the cultured population of cells at one or more time points in step (c), and wherein a guide RNA is considered depleted in the aggregation-negative population of cells in step (d) if the abundance of the guide RNA relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold lower in the aggregation-negative population of cells in step (d) relative to the aggregation-positive population of cells in step (d) and / or the cultured population of cells at one or more time points in step (c).

11. The method of any one of claims 1-10, wherein step (e) comprises determining abundance of each of the plurality of unique guide RNAs in the aggregation-negative population of cells in step (d) relative to the aggregation-positive population of cells in step (d), the cultured population of cells in step (c) at a first time point, and the cultured population of cells in step (c) at a second time point, and / or wherein step (e) comprises determining abundance of each of the plurality of unique guide RNAs in the aggregation-positive population of cells in step (d) relative to the aggregation-negative population of cells in step (e), the cultured population of cells in step (c) at a first time point, and the cultured population of cells in step (c) at a second time point, optionally wherein the first time point in step (c) is at a first passage of culturing the population of cells, and the second time point is in the middle of culturing the population of cells to allow genome editing and expansion or transcriptional activation and expansion, and optionally wherein the first time point in step (c) is after about 7 days of culturing, and the second time point in step (c) is after about 10 days of culturing.

12. The method of claim 11, wherein: (I) a gene is considered a genetic modifier of tau disaggregation, wherein disruption or transcriptional activation of the gene promotes tau disaggregation, if: (1) the abundance of a guide RNA targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold higher in the aggregation-negative population of cells in step (d) relative to the aggregation-positive population of cells in step (d), the cultured population of cells in step (c) at the first time point, and the cultured population of cells in step (c) at the second time point; and / or (2) the abundance of a guide RNA targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold higher in the aggregation-negative population of cells in step (d) relative to the aggregation-positive population of cells in step (d) and the cultured population of cells in step (c) at the second time point; and / or (3) the abundance of a guide RNA targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold lower in the aggregation-positive population of cells in step (d) relative to the aggregation-negative population of cells in step (d), the cultured population of cells in step (c) at the first time point, and the cultured population of cells in step (c) at the second time point; and / or (4) the abundance of a guide RNA targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold lower in the aggregation-positive population of cells in step (d) relative to the aggregation-negative population of cells in step (d) and the cultured population of cells in step (c) at the second time point; or (II) a gene is considered a genetic modifier of tau aggregation, wherein disruption or transcriptional activation of the gene promotes or enhances tau aggregation, if: (1) the abundance of a guide RNA targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold higher in the aggregation-positive population of cells in step (d) relative to the aggregation-negative population of cells in step (d), the cultured population of cells in step (c) at the first time point, and the cultured population of cells in step (c) at the second time point; and / or (2) the abundance of a guide RNA targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold higher in the aggregation-positive population of cells in step (d) relative to the aggregation-negative population of cells in step (d) and the cultured population of cells in step (c) at the second time point; and / or (3) the abundance of a guide RNA targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold lower in the aggregation-negative population of cells in step (d) relative to the aggregation-positive population of cells in step (d), the cultured population of cells in step (c) at the first time point, and the cultured population of cells in step (c) at the second time point; and / or (4) the abundance of a guide RNA targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold lower in the aggregation-negative population of cells in step (d) relative to the aggregation-positive population of cells in step (d) and the cultured population of cells in step (c) at the second time point.

13. The method of any one of claims 1-12, wherein: (I) the following steps are taken in step (e) to identify a gene as a genetic modifier of tau disaggregation, wherein disruption or transcriptional activation of the gene promotes tau disaggregation: (1) identifying which of the plurality of unique guide RNAs are present in the aggregation-negative population of cells identified in step (d); (2) calculating the random chance of the guide RNAs identified in step (e)(1) being present using the formula nCn' * (x-n')C(m-n) / xCm, wherein x is the variety of unique guide RNAs introduced into the population of cells in step (b), wherein m is the variety of unique guide RNAs identified in step (e)(1), wherein n is the variety of unique guide RNAs introduced into the population of cells in step (b) that target the gene, and wherein n' is the variety of unique guide RNAs identified in step (e)(1) that target the gene; (3) calculating average enrichment scores for the guide RNAs identified in step (e)(1), wherein the enrichment score for a guide RNA is the relative abundance of the guide RNA in the aggregation-negative population of cells identified in step (d) divided by the relative abundance of the guide RNA in the aggregation-positive population of cells identified in step (d) or the cultured population of cells in step (c) at the first time point or the second time point, and wherein relative abundance is the read count of the guide RNA divided by the read count of the total population of the plurality of unique guide RNAs; and (4) selecting the gene if a guide RNA targeting the gene is significantly below the random chance of being present and above a threshold enrichment score, or (II) the following steps are taken in step (e) to identify a gene as a genetic modifier of tau aggregation, wherein disruption or transcriptional activation of the gene promotes or enhances tau aggregation: (1) identifying which of the plurality of unique guide RNAs are present in the aggregation-positive population of cells identified in step (d); (2) calculating the random chance of the guide RNAs identified in step (e)(1) being present using the formula nCn' * (x-n')C(m-n) / xCm, wherein x is the variety of unique guide RNAs introduced into the population of cells in step (b), wherein m is the variety of unique guide RNAs identified in step (e)(1), wherein n is the variety of unique guide RNAs introduced into the population of cells in step (b) that target the gene, and wherein n' is the variety of unique guide RNAs identified in step (e)(1) that target the gene; (3) calculating average enrichment scores for the guide RNAs identified in step (e)(1), wherein the enrichment score for a guide RNA is the relative abundance of the guide RNA in the aggregation-positive population of cells identified in step (d) divided by the relative abundance of the guide RNA in the aggregation-negative population of cells identified in step (d) or the cultured population of cells in step (c) at the first time point or the second time point, and wherein relative abundance is the read count of the guide RNA divided by the read count of the total population of the plurality of unique guide RNAs; and (4) selecting the gene if a guide RNA targeting the gene is significantly below the random chance of being present and above a threshold enrichment score.

14. The method of any one of claims 1-13, wherein the first tau repeat domain and / or the second tau repeat domain is a human tau repeat domain, and / or wherein the first tau repeat domain and / or the second tau repeat domain comprises a pro-aggregation mutation, optionally wherein the first tau repeat domain and / or the second tau repeat domain comprises a tau P301S mutation; and / or wherein the first tau repeat domain and / or the second tau repeat domain comprises a tau four-repeat domain; and / or wherein the first tau repeat domain and / or the second tau repeat domain comprises SEQ ID NO: 11; and / or wherein the first tau repeat domain and the second tau repeat domain are the same.

15. The method of any one of claims 1-14, wherein: (I) the first tau repeat domain and the second tau repeat domain are the same and each comprises tau four-repeat domain comprising a tau P301S mutation; and / or (II) the first reporter is cyan fluorescent protein (CFP) and the second reporter is yellow fluorescent protein (YFP); and / or (III) the cells are human cells, optionally wherein the cells are HEK293T cells.

16. The method of any one of claims 1-15, wherein: (I) the plurality of unique guide RNAs are introduced at a concentration selected such that a majority of the cells receive only one of the unique guide RNAs; and / or (II) the plurality of unique guide RNAs target 100 or more genes, 1000 or more genes, or 10000 or more genes, or wherein the library is a genome-wide library.

17. The method of any one of claims 1-16, wherein: (I) a plurality of target sequences are targeted on average in each of the targeted plurality of genes, optionally wherein at least three target sequences are targeted on average in each of the targeted plurality of genes, optionally wherein about three to about six target sequences are targeted on average in each of the targeted plurality of genes; and / or (II) the plurality of unique guide RNAs are introduced into the population of cells by viral transduction, optionally wherein each of the plurality of unique guide RNAs is in a separate viral vector, optionally wherein the plurality of unique guide RNAs are introduced into the population of cells by lentiviral transduction, and optionally wherein the population of cells is infected at a multiplicity of infection of less than about 0.3.

18. The method of any one of claims 1-17, wherein: (I) the population of cells into which the plurality of unique guide RNAs are introduced in step (b) comprises greater than about 300 cells per unique guide RNA; and / or (II) the plurality of unique guide RNAs are introduced into the population of cells together with a selection marker, and step (b) further comprises selecting cells that comprise the selection marker, optionally wherein the selection marker imparts resistance to a drug, optionally wherein the selection marker imparts resistance to puromycin or zeocin, and optionally wherein the selection marker is selected from neomycin phosphotransferase, hygromycin B phosphotransferase, puromycin-N-acetyltransferase, and blasticidin S deaminase.

Images