Targeting e coli cells

Abstract

The technology described herein relates to methods and compositions for targeting E coli cells, such as for treating or preventing an infection by E coli cells in human or animal subjects. The method, in an embodiment, comprises administering to the subject a particle cocktail comprising a plurality of different transduction particles to E coli cells. The method, in an embodiment, comprises administering to the subject a plurality of transduction particles that encode a nuclease for targeting the genomes of B2 phylogroup E coli cells.

Description

(19) *EP004660305A2* (11) EP 4 660 305 A2 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: 10.12.2025 Bulletin 2025 / 50 (21) Application number: 25195750.2 (22) Date of filing: 29.06.2023 (51) International Patent Classification (IPC): C12N 15 / 10 (2006.01) (52) Cooperative Patent Classification (CPC): C12N 7 / 00; A61P 31 / 04; C12N 15 / 102; C12N 15 / 70; C12N 2310 / 20; C12N 2795 / 10121; C12N 2795 / 10142; C12N 2795 / 10145 (84) Designated Contracting States: AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR (30) Priority: 29.06.2022 GB 202209518 06.03.2023 GB 202303242 (62) Document number(s) of the earlier application(s) in accordance with Art. 76 EPC: 23738642.0 / 4 392 550 (71) Applicant: SNIPR Biome ApS. 2100 Copenhagen (DK) (72) Inventors: • KRAUSE HAABER, Jakob 2100 Copenhagen (DK) • SEMSEY, Szabolcs 2100 Copenhagen (DK) • GROVE, Mette 2100 Copenhagen (DK) • DAMHOLT, Birgitte 2100 Copenhagen (DK) • JASINSKYTE, Dziuginta 2100 Copenhagen (DK) • GENÇAY, Yilmaz Emre 2100 Copenhagen (DK) (74) Representative: CMS Cameron McKenna Nabarro Olswang LLP Cannon Place 78 Cannon Street London EC4N 6AF (GB) Remarks: •The complete document including Reference Table(s) and the Sequence Listing(s) can be downloaded from the EPO website •This application was filed on 13‑08‑2025 as a divisional application to the application mentioned under INID code 62. •Claims filed after the date of filing of the application / after the date of receipt of the divisional application (Rule 68(4) EPC). (54) TARGETING E COLI CELLS (57) The technology described herein relates to methods and compositions for targeting E coli cells, such as for treating or preventing an infection by E coli cells in human or animal subjects. The method, in an embodi- ment, comprises administering to the subject a particle cocktail comprising a plurality of different transduction particles to E coli cells. The method, in an embodiment, comprises administering to the subject a plurality of transduction particles that encode a nuclease for target- ing the genomes of B2 phylogroup E coli cells. EP 4 66 0 30 5 A 2 Processed by Luminess, 75001 PARIS (FR) Description TECHNICAL FIELD

[0001] The technology described herein relates to methods and compositions for targeting E coli cells, such as for treating or preventing an infection by E coli cells in human or animal subjects. Themethod, in an embodiment, comprises administering to the subject a particle cocktail comprising a plurality of different transduction particles to E coli cells. The method, in an embodiment, comprises administering to the subject a plurality of transduction particles that encode a nuclease for targeting the genomes of B2 phylogroup E coli cells. BACKGROUND

[0002] E coli infection has been identified as harmful or life-threatening in various settings, such as UTI infections, transplant patients, cancer patients and other patients that are immunocompromised or on immunosuppressant.

[0003] Nuclease targeting ofE coli, such as bymeans of CRISPR / Cas systems, has been proposedwith delivery using transduction particles that can target the nuclease toE coli cells for chromosomal or episomal cutting, thereby killing cells or reducing their growth or proliferation. Suitable transduction particles are phage or engineered particles (such as non- self-replicative transductionparticles) comprisingcapsids that contain nucleic acidencodingat least crRNAsorgRNAs (or additionally aCasnuclease) for targeting.Advantageously, selective targetingcanbeachievedwhich is not possible using conventional antibiotics, such as broad-spectrum antibiotics. Such selective targeting can avoid killing of beneficial species and strains in treated patients. Indeed, disturbances of the microbiome with broad-spectrum antibiotics is a risk- factor in the prophylactic management of cancer patients at risk of febrile neutropenia.

[0004] Bacteriophage (phage) therapy has been used prior to the broad availability of antibiotics, but has now re-gained interest due to the rise in bacterial antimicrobial resistance (AMR) combined with several successful individual case reports.

[0005] Bacteriophages (phages) are a phylum of viruses that infect bacteria, and are distinct from the animal and plant viruses. Phages can have either a "lytic" life cycle, a "lysogenic" life cycle that can potentially become lytic, or a "non-lytic" life cycle. Phages replicating through the lytic cycle cause lysis of the host bacterial cell as a normal part of their life cycles. Phages replicating through the lysogenic cyclesarecalled temperatephages, andcaneither replicatebymeansof the lytic life cycle and cause lysis of the host bacterium, or they can incorporate their DNA into the host bacterial DNA and become noninfectious prophages.

[0006] The natural capability of phages to infect and kill bacteria, together with the specificity of the phage-bacterial interactions, is the basic phenomena on which the concept of phage therapy is built. Therefore, phages that possess lytic life cycle are suitable candidates for phage therapy.

[0007] InternationalPatentApplicationNo.WO00 / 69269discloses theuseof certain phagestrain for treating infections caused by Vancomycin-sensitive as well as resistant strains of Enterococcus faecium, and International Patent Applica- tion No. WO 01 / 93904 discloses the use of bacteriophage, alone or in combination with other anti-microbial means, for preventing or treating gastrointestinal diseases associated with the species of the genus Clostridium.

[0008] US Patent Application No. 2002 / 0001590 discloses the use of phage therapy against multi-drug resistant bacteria, specifically methicillin-resistantStaphylococcus aureus, and International Patent Application No.WO02 / 07742 discloses the development of bacteriophage having multiple host range.

[0009] Theuseofphage therapy for the treatmentof specificbacterial-infectiousdisease isdisclosed, for example, inUS Patent Application Nos. 2002 / 0044922: 2002 / 0058027 and International Patent Application No. WO 01 / 93904.

[0010] US20160333348 describes the use of CRISPR / Cas systems delivered to host bacterial cells using phage as vectors.

[0011] Amongst the several phylogroups of E coli, it has been observed that antibitic-resitant (eg, fluoroquinolone (FQ)‑resistant) and multi-drug resistant (MDR) strains are frequently found in the B2 phylogroup. B2 strains ST131 and ST1193 have been found that are associated with antibiotic resistance. ST131 is a globally dominant multidrug resistant clone associatedwith high rates in rUTI. ST131 is amajor contributor to hospital‑ and community-acquiredUTI, aswell as E coli bloodstream infections and infections in companion animals and poultry. Originally identified in 2008, ST131 is associated with the worldwide spread of the CTX-M‑15 extended spectrum β-lactamase (ESBL) resistance gene. ST131 isnowstrongly associatedwithmultidrug resistance (MDR), including resistance to fluoroquinolones.Recent reports have also identified strains that are resistant to last-line carbapenems. Sequence type 1193 has recently emerged as a new, virulent and resistant lineage among fluoroquinolone resistant E coli.

[0012] Classic antibiotics, such as FQ and broad-spectrum antibiotics are not, thus, sufficiently effective for combatting such infections. There is, therefore, a need to find alternative means to address these infections. 2 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 SUMMARY OF THE INVENTION

[0013] The invention provides means for treating or preventing B2 phylogroup E coli infections in humans and animals by combining the use of selective killing with nucleases targeted using specific types of transduction particles. The particles of the invention target by adhesion to LPS, LamBor Tsx, which has surprisingly been found highly advantageous for killingand inhibitinggrowthofB2E coli cells ofmanydifferent strains (including thepotentially lethal ST131andST1193 strains). As exemplified herein, surprisingly more than 10 different ST131 strains were killed (plaques formed) and more than 10 different ST1193 strains were killed (plaques formed).

[0014] The invention finds utility, for example, to treat or prevent potentially life-threatingB2 phylogroupE coli infections in patients, such as in immunosuppressed, cancer, transplant and UTI patients, who are susceptible to infection by B2 strains (and often bymultiple different B2 strains). As demonstrated in theExamples, the invention is useful for preventing E coli B2 phylogroup bacteraemia (infection of the blood stream by E coli) in a subject.

[0015] To this end, the invention provides:- In a First Configuration In a First Aspect:-

[0016] A composition comprising a plurality of transduction particles for use in a method of treating or preventing an infection by E coli cells in a human or animal subject, wherein the method comprises administering the particles to the subject, wherein (a) each particle comprises a nucleic acid encoding a nuclease for targeting the genomes of E coli cells, wherein the said administeredparticles contact the cells and introduce therein thenucleic acid,wherein thenuclease is expressed in the cells and cuts genomic DNAof the cells, thereby killing the cells or reducing growth or proliferation of the cells in the subject; (b) the E coli cells are cells of E coli phylogroup B2; and (c) each particle comprises an adhesionmoiety for recognising and binding to a cognatemoiety selected from a LPS, LamB and Tsx displayed on the surface of the phylogroup B2 E coli cells. In a Second Aspect:-

[0017] A composition comprising a plurality of transduction particles for use in a method of treating or preventing E coli bacteriaemia in a human or animal subject, wherein the method comprises administering the particles to the subject, wherein (a) each particle comprises a nucleic acid encoding a nuclease for targeting the genomes of cells of said E coli, wherein the said administered particles contact the cells and introduce therein the nucleic acid, wherein the nuclease is expressed in the cells and cuts genomicDNAof the cells, thereby killing the cells or reducing growth or proliferation of the cells in the subject; (b) the E coli cells are cells of E coli phylogroup B2; and (c) each particle comprises an adhesionmoiety for recognising and binding to a cognatemoiety selected from a LPS, LamB and Tsx displayed on the surface of the phylogroup B2 E coli cells. In a Second Configuration In a First Aspect:-

[0018] A method for treating or preventing an infection by E coli cells in a human or animal subject, the method comprising administering to the subject a plurality of transduction particles, wherein (a) each particle comprises a nucleic acid encoding a nuclease for targeting the genomes of E coli cells, wherein the said administeredparticles contact the cells and introduce therein thenucleic acid,wherein thenuclease is expressed in the cells and cuts genomic DNAof the cells, thereby killing the cells or reducing growth or proliferation of the cells in the subject: (b) the E coli cells are cells of E coli phylogroup B2; and (c) each particle comprises an adhesionmoiety for recognising and binding to a cognatemoiety selected from a LPS, LamB and Tsx displayed on the surface of the phylogroup B2 E coli cells. 3 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 In a Second Aspect:-

[0019] A method for treating or preventing an infection by E coli cells in a human or animal subject, the method comprising administering to the subject a plurality of transduction particles, wherein (a) each particle comprises a nucleic acid encoding a crRNA or guide RNA that is operable with a Cas nuclease for chromosomal targeting in the cells, wherein the said administered particles contact the cells and introduce therein the nucleic acid, wherein the crRNA or guide RNA is expressed and guides the Cas nuclease wherein the nuclease cuts the chromosomes of the cells, thereby killing the cells or reducing growth or proliferation of the cells in the subject; (b) the E coli cells are cells of E coli phylogroup B2; and (c) each particle comprises an adhesionmoiety for recognising and binding to a cognatemoiety selected from a LPS, LamB and Tsx displayed on the surface of the phylogroup B2 E coli cells. In a Third Aspect:-

[0020] A method for treating or preventing E coli bacteriaemia in a human or animal subject, the method comprising administering to the subject a plurality of transduction particles, wherein (a) each particle comprises a nucleic acid encoding a nuclease for targeting the genomes of cells of said E coli, wherein the said administered particles contact the cells and introduce therein the nucleic acid, wherein the nuclease is expressed in the cells and cuts genomicDNAof the cells, thereby killing the cells or reducing growth or proliferation of the cells in the subject; (b) the E coli cells are cells of E coli phylogroup B2; and (c) each particle comprises an adhesionmoiety for recognising and binding to a cognatemoiety selected from a LPS, LamB and Tsx displayed on the surface of the phylogroup B2 E coli cells. In a Fourth Aspect:-

[0021] A method for treating or preventing E coli bacteriaemia in a human or animal subject, the method comprising administering to the subject a plurality of transduction particles, wherein (a) each particle comprises a nucleic acid encoding a crRNA or guide RNA that is operable with a Cas nuclease for chromosomal targeting in cells of said E coli, wherein the said administered particles contact the cells and introduce therein the nucleic acid, wherein the crRNA or guide RNA is expressed and guides the Cas nuclease wherein the nuclease cuts the chromosomes of the cells, thereby killing the cells or reducing growth or proliferation of the cells in the subject; (b) the E coli cells are cells of E coli phylogroup B2; and (c) each particle comprises an adhesionmoiety for recognising and binding to a cognatemoiety selected from a LPS, LamB and Tsx displayed on the surface of the phylogroup B2 E coli cells. In a Third Configuration In a First Aspect:-

[0022] Use of a composition comprising a plurality of transduction particles in a method for treating or preventing an infectionbyphylogroupB2E colicells inahumanoranimal subject, themethodcomprisingadministering to thesubject the composition, wherein (a) each particle comprises a nucleic acid encoding a nuclease for targeting the genomes of E coli cells, wherein the said administeredparticles contact the cells and introduce therein thenucleic acid,wherein thenuclease is expressed in the cells and cuts genomic DNAof the cells, thereby killing the cells or reducing growth or proliferation of the cells in the subject; and (b) each particle comprises an adhesionmoiety for recognising and binding to a cognatemoiety selected from a LPS, LamB and Tsx displayed on the surface of the phylogroup B2 E coli cells. In a Second Aspect:-

[0023] Use of a composition comprising a plurality of transduction particles in a method for treating or preventing an 4 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 infectionbyphylogroupB2E colicells inahumanoranimal subject, themethodcomprisingadministering to thesubject the composition, wherein (a) each particle comprises a nucleic acid encoding a crRNA or guide RNA that is operable with a Cas nuclease for chromosomal targeting in the cells, wherein the said administered particles contact the cells and introduce therein the nucleic acid, wherein the crRNA or guide RNA is expressed and guides the Cas nuclease wherein the nuclease cuts the chromosomes of the cells, thereby killing the cells or reducing growth or proliferation of the cells in the subject; (b) the E coli cells are cells of E coli phylogroup B2; and (c) each particle comprises an adhesionmoiety for recognising and binding to a cognatemoiety selected from a LPS, LamB and Tsx displayed on the surface of the phylogroup B2 E coli cells. In a Third Aspect:-

[0024] Use of a composition comprising a plurality of transduction particles in a method for treating or preventing phylogroup B2 E coli bacteraemia in a human or animal subject, the method comprising administering to the subject the composition, wherein (a) each particle comprises a nucleic acid encoding a nuclease for targeting the genomes of cells of said E coli, wherein the said administered particles contact the cells and introduce therein the nucleic acid, wherein the nuclease is expressed in the cells and cuts genomicDNAof the cells, thereby killing the cells or reducing growth or proliferation of the cells in the subject; and (b) each particle comprises an adhesionmoiety for recognising and binding to a cognatemoiety selected from a LPS, LamB and Tsx displayed on the surface of the phylogroup B2 E coli cells. In a Fourth Aspect:-

[0025] Use of a composition comprising a plurality of transduction particles in a method for treating or preventing phylogroup B2 E coli bacteraemia in a human or animal subject, the method comprising administering to the subject the composition, wherein (a) each particle comprises a nucleic acid encoding a crRNA or guide RNA that is operable with a Cas nuclease for chromosomal targeting in cells of said E coli, wherein the said administered particles contact the cells and introduce therein the nucleic acid, wherein the crRNA or guide RNA is expressed and guides the Cas nuclease wherein the nuclease cuts the chromosomes of the cells, thereby killing the cells or reducing growth or proliferation of the cells in the subject; (b) the E coli cells are cells of E coli phylogroup B2; and (c) each particle comprises an adhesionmoiety for recognising and binding to a cognatemoiety selected from a LPS, LamB and Tsx displayed on the surface of the phylogroup B2 E coli cells. In a Fourth Configuration In a First Aspect:-

[0026] A composition comprising a plurality of transduction particles for use in a method of treating or preventing an infection byE coli cells (optionally B2 phylogroupE coli cells)in a human or animal subject, wherein themethod comprises administering the particles to the subject, wherein (a) each particle comprises a nucleic acid encoding a nuclease for targeting the genomes of E coli cells, wherein the said administered particles contact the cells and introduce therein the nucleic acid, wherein the nuclease is expressed in the cells and cuts genomic DNA of the cells, thereby killing the cells or reducing growth or proliferation of the cells in the subject; and (b) each particle comprised by the composition is aT-evenphage capsid; optionally a capsid of a T2 phage, T2-like phage, RB69 phage or a RB69-like phage.

[0027] A composition comprising a plurality of different types of transduction particles, wherein each of said particles comprises a nucleic acid and said particles are capable of contacting E coli cells and introducing therein the nucleic acid, wherein (a) said nucleic acid of each particle comprises a nucleotide sequence encoding a product of interest (POI), wherein the nucleic acid is capable of expressing the POI in an E coli cell; (b) each particle comprises an adhesionmoiety for recognising and binding to a cognatemoiety selected from a LPS, 5 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 LamB and Tsx (optionally selected from LPS and Tsx) displayed on the surface of E coli cells: and (c) said plurality of different types of transduction particles comprises (i) a first type of particles that comprise a LPS adhesion moiety; and (ii) a second type of particles that comprise a Tsx adhesion moiety. In a Second Aspect:-

[0028] A method of treating or preventing sepsis, septicaemia or diarrhoea in a human or animal subject, the method comprising administering to the subject the composition of the invention, wherein theE coli cells comprise a strain ofE coli that causes sepsis, septicaemia or diarrhoea in humans or animals. In a Third Aspect:-

[0029] A method of treating or preventing infection of by E coli cells in a human or animal subject, wherein the method comprises administering the composition of the invention to the subject, wherein the infection is treated or prevented. In a Fourth Aspect:-

[0030] A method of detecting the presence of E coli (optionally B2 phylogroup E coli cells) in a sample, the method comprising (a) contacting the sample with a composition according to this Configuration; and (b) detecting that E coli cells have been killed or the growth or proliferation thereof has been reduced. In a Fifth Aspect:-

[0031] A method of detecting the presence of E coli (optionally B2 phylogroup E coli cells) in a sample, the method comprising (a) contacting the sample with a composition according to this Configuration; wherein particles of the composition comprise a nucleic acid comprising or encoding a detectable label, wherein the said particles contact the cells and introduce therein the nucleic acid, wherein optionally the label is expressed in the cells; and (b) detecting that E coli cells comprising the label. In a Sixth Aspect:-

[0032] Amethod formodifying thegenomesofE colicells, themethodcomprisingcontacting thecellswithacomposition of this Configuration, wherein nucleic acid encoding the POI is introduced into the cells therebymodifying the genomes of the cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1: Killing and growth inhibition activity of a composition of the invention when tested against E coli of several different phylogroups and different strainswithin each group (E coli taken from clinical samples); the compositionwas surprisingly highly effective at killing acrossmany phylogroups (and particularly in the B2 phylogroup, wheremultiple strains - including those known to be potentially life-threatening and related with antibiotic resistnance - were killed or whose growth was effectively inhibited). The 6 negatives comprised non E coli and non FQ resistant samples. Figure 2:Phylo-grouping of strains used in the study and showing particularly advantageous and extensive targeting of many clinical B2 phylogroup strains. Figure 3: A) CRISPR-Cas driven elimination of an abbreviated panel of 82 E. coli clinical isolates by conjugation of CGV-EcCAS and empty vector. The conjugation efficiency was determined by spotting a dilution series of the conjugation reaction onLBagar supplementedwith antibiotics and calculatedasCFU / ml. The limit of detection (LOD) of this assay was 200 CFU / mL. The experiment was carried out in triplicates and is indicated by dots. CGV-EcCAS conjugation experiments indicated by arrow; empty vector conjugations indicated above the dotted line labelled LOD. 6 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 B) Fraction of CRISPR-armed phage™ (CAP) andWT phage during co-culture with a host strain susceptible to both phages. CAP α15.2 increases its relative abundance compared to the WT phage from 7% to 86% over two consecutive passages. C) CAP α20.4 outcompeted WT α20 by increasing its relative abundance during co-culture with the common target E. coli strain b230 from 10% to 68% over four consecutive passages. B-C) The ratio of CAP andWTphageduring co-culturewith a host strain (E. coli b230) susceptible toα15.2,α15,α20.4 andα20.CAPα15.2 increase its relative abundance compared to theWT phage from 7% to 86% (G) while CAP α 20.4 outcompetedWT α20 from 10% to 68% (H). Figure4:Specificity evaluationofSNIPR001and individualCAPsagainst a panel of clinically relevant bacteria andE. coli strain b2480 (positive control) showing no off-target effects. Positive values represent bacterial growth (absence of observed killing), while negative values indicate bacterial killing following phage treatment within the assessed time-period. All values indicated as means of four biological replicates with standard deviations, measuring growth over a 4-hour period, measured in CFU / mL. Figure 5: A) An unrooted phylogenetic tree of the JMI strains displaying a clinical panel of 382 E. coli strains encompassing nine phylogroupsand118MLSTs.Plaquingdata reflects a single plaquing replicate.One strain, E. coli b4038, with a long branch has been truncated to 37% of the original length. Phylogenetic distance scale indicated below the phylogenetic tree, as computed by MASH. B) A spot assay was used to analyze the efficacy of SNIPR001 against the clinical panel of 382 E. coli strains (from JMI, North Liberty, IA, USA) isolated from bloodstream infections and the internal 429 E. coli strain panel. The spot assaywas conducted as two independent experiments, with results presented as mean± SD values. The standard deviation shown is based on the discrepancy of results between the two runs, calculated as the average absolute deviation of themean prevalence of a given spotting type, normalized to the panel size. C) Coverage of SNIPR001 does not depend on antibiotic resistant phenotypes; consequently, SNIPR001 targets >90% of E. coli strains that are carbapenem-resistant, extended-spectrum β-lactamase (ESBL)‑producing or multi-drug resistant (MDR), and 89% of fluroquinolone resistant E. coli strains. Numbers indicated in each green or grey bar indicates number of bacteria susceptible or resistant to SNIPR001, respectively, for each resistance category. D) A midpoint rooted phylogenetic tree of the 72 fluroquinolone resistant E. coli strains isolated from fecal samples of hematological cancer patients. 67 of the 72 strains are susceptible to at least one of the four CAPS in SNIPR001. E) Redundancy distribution showing 82% of the fluroquinolone resistant E. coli strains (n = 72) from panel D are targeted by at least 2 different CAPs. Figure 6: A) CAP recovery in minipigs feces after a single p.o. dose of 2 x 1012 PFU of SNIPR001 (n = 8, shown in green) or vehicle (n = 6, shown in grey) over one week with daily sampling. Trend lines indicate average recovered phage in PFU / g feces, dots indicate individual measurement points. LOD of 33 PFU / g feces indicated by the dotted line. B) CAP recovery inminipig feces after a single p.o. dose of 2 x 1012 PFU of a single CAP (n = 8minipigs received either α15.2, α20.4 or α51.5, n = 7 minipigs received α48.4) over one week with daily sampling. Trend lines indicate average recovery,while points indicate individualmeasurements.Recoverywasmeasured inPFU / g feces. LODof33 PFU / g feces is indicated by the dotted line. C) CAP recovery in mouse feces 8h, 24h, and 48h after the start of treatment with three times daily administration of varying doses of SNIPR001 (n = 10 for low, medium, and high, indicated in green), vehicle (n=10, indicated in grey), or gentamicin (n=4, indicated in grey).Recovery ismeasured in PFU / g feces, LOD of 371 PFU / g feces is indicated by the dotted line. D) E. coli b17 recovery inmouse feces indicates increasedSNIPR001 effect with increased dose. Statistical analyseswere performed using two-sidedKruskal-Wallis tests for comparison of the SNIPR001-treated groups, two-sided Mann-Whitney U test for comparison of treated groups with vehicle. P<0.05=*,0.01=**,0.001=***, FDR corrected using Holm’s method separately for each day. Recovery is measured in CFU / g feces, with a limit of detection of 371 CFU / g feces. Animals that have begun SNIPR001 treatment are indicated in green, others in grey. E)E. coli b17 recovery inmouse feces 8hand24hafter the start of treatment with three times daily administration of CAPs α15.2, α20.4, α48.4 or α51.5 and in combination as SNIPR001 confirming synergy of the CAPs. DETAILED DESCRIPTION

[0034] The invention finds application to combat harmful or life-threatening B2E coli infections in various settings, such as UTI infections, transplant patients, cancer patients and other patients that are immunocompromised or on immuno- suppressant.

[0035] Cancer treatment continues to advance and survival rates for people with hematological malignancies are increasing. However, this population is immunocompromised and chemotherapy regimens cause bone-marrow suppres- sion and gastrointestinal mucositis with associated increased intestinal permeability. Translocation of gut bacteria, including E coli, from the gastrointestinal tract is a frequent cause of bloodstream infections (BSIs). The mortality-related 7 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 to BSIs can be up to 50%; thus, antimicrobial prophylaxis is applied in people at risk of febrile neutropenia. There are no approved therapies for the prevention of BSIs in patients with hematological cancers, yet fluoroquinolones are used off- label in the United States. This antibiotic prophylaxis practice is at odds with the emerging paradigm that maintaining a normal microbiome is important for upholding immunological tonus potentially benefiting the outcome of oncology treatments. Indeed, disturbances of the microbiome with broad-spectrum antibiotics is a risk-factor in the prophylactic management of patients at risk of febrile neutropenia. Beyond the side effects of fluoroquinolones, including safety warnings and precautions, bacterial resistance is rising and approaching 60% in USA.

[0036] In immunocompromised patients with hematological malignancies at risk of developing neutropenia, E coli is responsible for 25.1‑30% of all bacteraemia cases with a 35.8% 90-day mortality rate. Moreover, up to 65% of E coli isolated as the causative pathogen fromBSIs in patients with hematological cancers undergoing hematopoietic stem cell transplantation (HSCT) were resistant to fluoroquinolones. Accordingly, novel narrow-spectrum treatment and prophy- lactic options are needed to prevent infections in these vulnerable patients. The invention addresses this need.

[0037] To this end, the invention provides compositions, methods and uses according to the above Configurations. There is, thus, provided the following description with numbered Embodiments. 1. A composition comprising a plurality of transduction particles for use in a method of treating or preventing an infection byE coli cells in a human or animal subject, wherein themethod comprises administering the particles to the subject, wherein (a) each particle comprises a nucleic acid encoding a nuclease for targeting the genomes ofE coli cells, wherein the said administered particles contact the cells and introduce therein the nucleic acid, wherein the nuclease is expressed in the cells and cuts genomic DNA of the cells, thereby killing the cells or reducing growth or proliferation of the cells in the subject, (b) the E coli cells are cells of E coli phylogroup B2; and (c) each particle comprises an adhesion moiety for recognising and binding to a cognate moiety selected from a LPS, LamB and Tsx displayed on the surface of phylogroup B2 E coli cells. Optionally, (i) each particle comprises a phage capsid containing the nucleic acid: (ii) theparticlesof the composition target aplurality of differentE coligenes, optionally selected fromessential and virulence genes; and (iii) the composition comprises A: particles which comprise a LPS adhesion moiety and a LamB adhesion moiety; B: particles which comprise a LPS adhesion moiety and a Tsx adhesion moiety; or C: : particles which comprise a Tsx adhesion moiety but is devoid of LamB and LPS adhesion moieties. 2. Amethod for treating or preventing an infection byE coli cells in a human or animal subject, themethod comprising administering to the subject a plurality of transduction particles, wherein the method comprises administering the particles to the subject, wherein (a) each particle comprises a nucleic acid encoding a nuclease for targeting the genomes ofE coli cells, wherein the said administered particles contact the cells and introduce therein the nucleic acid, wherein the nuclease is expressed in the cells and cuts genomic DNA of the cells, thereby killing the cells or reducing growth or proliferation of the cells in the subject; (b) the E coli cells are cells of E coli phylogroup B2; and (c) each particle comprises an adhesion moiety for recognising and binding to a cognate moiety selected from a LPS, LamB and Tsx displayed on the surface of the phylogroup B2 E coli cells. Optionally, (i) each particle comprises a phage capsid containing the nucleic acid; (ii) theparticlesof the composition target aplurality of differentE coligenes, optionally selected fromessential and virulence genes; and (iii) the composition comprises A: particles which comprise a LPS adhesion moiety and a LamB adhesion moiety; 8 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 B: particles which comprise a LPS adhesion moiety and a Tsx adhesion moiety: or C: : particles which comprise a Tsx adhesion moiety but is devoid of LamB and LPS adhesion moieties.

[0038] Optionally, the genomic DNA is chromosomal DNA of the cells. Additionally or alternatively, the genomic DNA is plasmid DNA of the cells.

[0039] Optionally, each particle comprises a nucleic acid encoding a nuclease for chromosomal targeting, wherein the said administered particles contact the cells and introduce therein the nucleic acid, wherein the nuclease is expressed in the cells and cuts the chromosomesof the cells, thereby killing the cells or reducinggrowthor proliferation of the cells in the subject.

[0040] The humanmay be amale or female. The humanmay be an adult or child. The humanmay be 18 years of age or older, eg, 40, 50, 60, 7080orolder. Thehumanmaybeyounger than18, eg, a teenager, eg, ababy, eg, up to5yearsof age, eg, up to 2 years of age. The animalmay be be a livestock or companion animal eg, a dog or cat). The animalmay be a bird (eg, a poultry bird, eg, a chicken, turkey or duck, preferably a chicken), cow, sheep, goat or pig (eg, a neonatal swine or a swine under 6 months of age).

[0041] The infection may be a bloodstream infection. The infection may be a nosocomial infection.

[0042] In an example, each adhesion moiety is a tail fibre protein. In an example, each particle comprises a phage tail fibre that comprises or is fused to a said adhesion moiety. In an example, each adhesion moiety is an antibody fragment, eg,anantibodysinglevariabledomain. Inanexample, eachadhesionmoiety isananobody. Inanexample, eachadhesion moiety comprises an antibody binding site that is capable of binding to the cognate moiety. For example, each adhesion moiety comprises an antibody single variable domain (ie, a dAb), such as a nanobody. In an example, each particle comprises one or more phage tail fibres or spikes, each fibre or spike comprising a said adhesion moiety.

[0043] Forexample, at least 2, 3or 4different typesof said transductionparticleareadministered to thesubject andeach typecomprisesoneor aplurality of typesof tail fibres comprisingadhesionmoieties,wherein theotherparticle typesdonot comprise said one or plurality of tail fibre types. In an example, each type of said plurality of tail fibre types differs from the other types by the type of adhesion moiety it comprises.

[0044] Optionally, the particles comprise adhesion moieties for binding to LPS, LamB and Tsx. Optionally, the particles comprise adhesionmoieties for binding to LamBand Tsx. Optionally, the particles comprise adhesionmoieties for binding to LPS and Tsx. Optionally, the particles comprise adhesion moieties for binding to LPS and LamB.

[0045] InGram-negative bacteria, the peptidoglycan layer is relatively thin and is located inward of the outermembrane, the major component of the cell wall. These two layers are connected by Braun’s lipoproteins. The outer membrane is a sophisticated structure composed of a lipid bilayer ornamented with proteins, polysaccharides and lipids; the latter two molecules form the LPS layer. LPSs are complexes that consist of three parts: lipid A, the core polysaccharide and the O- polysaccharide. Lipid A is, in general, composed of fatty acids attached to glucosamine phosphate disaccharides. The core polysaccharide is connected to the lipid A through a ketodeoxyoctonate linker. The core polysaccharide and the O- polysaccharide (O-chain or O-antigen) contain several units of sugar residues extending outward to the outermembrane. Cells that contain all three components of the LPS are denominated as smooth (S) type and those that lack the O- polysaccharide portion are distinguished as rough (R) type.

[0046] Optionally, the LPS is smooth LPS or rough LPS.

[0047] For example, the particles comprise at least one type of particle whose adhesion moiety is capable of binding to O-antigen of LPS.

[0048] E coli is a very versatile species for which diversity has been explored from various perspectives highlighting, for example, phylogenetic groupings, pathovars as well as a wide range of O serotypes. The highly variable O-antigen, the most external part of the lipopolysaccharide component of the outer membrane of E coli, is linked to the innermost lipid A through the core region of LPS of which 5 different structures, denominated K‑12, R1, R2, R3 and R4, have been characterizedso far.PhylogroupsB2andCstrainsaremainlydominatedby theR1 type.StrainswithinphylogroupB2may carry a K‑12 core, eg, belonging to the complex STc131, one of the major clone of extra-intestinal pathogenic E coli (ExPEC) strains.

[0049] Preferably, the LPS comprises a R1 core region. In an example, the LPS comprises a R2 core region. In an example, theLPScomprisesaR3core region. Inanexample, theLPScomprisesaR4core region. Inanexample, theLPS comprises a K‑12 core region.

[0050] Optionally, the LamBcomprises theaminoacid of SEQ IDNO: 1or anaminoacid sequence that is at least 70, 80, 90 or 95% identical to SEQ ID NO: 1. Optionally, the Tsx comprises the amino acid of SEQ ID NO: 2 or an amino acid sequence that is at least 70, 80, 90 or 95% identical to SEQ ID NO: 2. Optionally, the LamB is encoded by the nucleotide sequence of SEQ ID NO: 3 or an amino acid sequence that is at least 70, 80, 90 or 95% identical to SEQ ID NO: 3. Optionally, the Tsx is encoded by the nucleotide sequence of SEQ IDNO: 4 or an amino acid sequence that is at least 70, 80, 90 or 95% identical to SEQ ID NO: 4.

[0051] The Escherichia coli tsx gene encodes an integral outer-membrane protein (Tsx) that functions as a substrate- specific channel for deoxynucleosidesand theantibiotic albicidin. Inanexample, theNucleoside-specific channel-forming 9 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 protein Tsx of E coli has a Uniprot Accession Number of P0A927 or is a homologue thereof. In an example, the maltose outermembrane porin (maltoporin) LamBofE coli has aUniprot AccessionNumber of P02943 or is a homologue thereof.

[0052] Homologue:Agene, nucleotide or protein sequence related to a secondgene, nucleotide or protein sequenceby descent fromacommonancestral DNAor protein sequence. The term, homologue,mayapply to the relationship between genes separated by the event of or to the relationship between genes separated by the event of genetic duplication.

[0053] In an embodiment, the E coli cells comprise UPEC E coli. In an embodiment, the E coli cells comprise intestinal pathogenic E coli (ExPEC) cells.

[0054] 3. The composition ormethodofEmbodiment 1 or 2 respectively, wherein themethod is for treating or preventing infection of the subject by an E coli strain selected from the group ST131, ST1193, ST648, ST315, ST405, ST361, ST88 and ST453.

[0055] In a preferred example, the strain is ST1193. In another preferred example, the strain is ST131.

[0056] 4. The composition or method of any preceding Embodiment, wherein the method is for treating or preventing infection of the subject by a plurality of different phylogroupB2 strains ofE coli:optionallywherein theplurality comprisesE coli ST131 and ST1193 cells.

[0057] E coli ST131 and / or ST1193 have been found to be virulent and associated with fluoroquinolone resistance. As shown in theExample section herein, the invention is useful for treating or preventing infection by such strains. Optionally, said plurality of strains comprises E coli ST131 and / or ST1193 strains. Optionally, said plurality of strains comprises fluoroquinolone-resistant strains. For example, said plurality of strains comprises E coli ST131 and / or ST1193 fluor- oquinolone-resistant strains.

[0058] E coli strainsB2-ST73 (CH24‑30);B2-ST73 (CH24‑103); B2-ST131 (CH40‑30);B2-ST141 (CH52‑5);B2-ST372 (CH103‑9); B2-ST404 (CH14‑27); B2-ST404 (CH14‑807) and B2-ST1193 (CH14‑64) have been found in UTI settings. In an embodiment (eg, wherein the subject is suffering from or at risk of UTI), the B2 E coli comprise one or more strains selected from B2-ST73 (CH24‑30); B2-ST73 (CH24‑103): B2-ST131 (CH40‑30); B2-ST141 (CH52‑5); B2-ST372 (CH103‑9); B2-ST404 (CH14‑27); B2-ST404 (CH14‑807) and B2-ST1193 (CH14‑64).

[0059] 5.ThecompositionormethodofanyprecedingEmbodiment,wherein thesubject is a transplant or cancerpatient (optionally a haematological cancer patient), or wherein the patient is suffering from or at risk of a urinary tract infection (UTI); and optionally wherein the transplant is a solid organ or stem cell transplant (optionally a haematopoietic cell transplant) or wherein the transplant is a transplant of a medical device.

[0060] For example, the subject is a haematological cancer patient suffering fromneutropenia. For example, the subject is a haematopoietic stem cell transplant patient.

[0061] A suitablemedical devicemay be, eg, heart device (eg, ventricular assist device, such as a left ventricular assist device (LVAD)), a catheter (eg, a biliary catheter) or a prosthesis (eg, a joint) prosthesis.

[0062] In anexample, the patient is suffering fromasequesteredB2phylogroupE coli infection. In anexample, theE coli are sequestered B2 phylogroup E coli.

[0063] Forexample, thesubject is suffering fromorat riskof acutebacterial sinusitis, pneumonia, urinary tract infections, chronic prostatitis or gastroenteritis caused by B2 phylogroup E coli. For example, the subject is a male human prostate surgery patient.

[0064] 6. The composition or method of any preceding Embodiment, wherein the method is carried out prior to the subject receiving a transplant. For example, the transplant is a solid organ or stem cell transplant (optionally a haematopoietic cell transplant).

[0065] 7. The composition or method of any preceding Embodiment, wherein the B2 E coli cells comprise a strain of E coli that causes sepsis, septicaemia or diarrhoea in humans.

[0066] EnterohemorrhagicEscherichia coli (EHEC) serotype O157:H7 is a human pathogen responsible for outbreaks of bloody diarrhoea and haemolytic uremic syndrome (HUS) worldwide. Conventional antimicrobials trigger an SOS response in EHEC that promotes the release of the potent Shiga toxin that is responsible for much of the morbidity and mortality associated with EHEC infection. Cattle are a natural reservoir of EHEC, and approximately 75% of EHEC outbreaksare linked to theconsumptionof contaminatedbovine-derivedproducts.EHECcausesdisease inhumansbut is asymptomatic in adult ruminants. Characteristics of E. coli serotype O157:H7 (EHEC) infection includes abdominal cramps and bloody diarrhoea, as well as the life-threatening complication haemolytic uremic syndrome (HUS). Currently there is a need for a treatment for EHEC infections (Goldwater and Bettelheim, 2012). The use of conventional antibiotics exacerbates Shiga toxin-mediated cytotoxicity. In an epidemiology study conducted by the Centers for Disease Control and Prevention, patients treated with antibiotics for EHEC enteritis had a higher risk of developing HUS (Slutsker et al., 1998). Additional studies support the contraindication of antibiotics in EHEC infection; children on antibiotic therapy for hemorrhagic colitis associatedwith EHEChad an increased chance of developingHUS (Wonget al., 2000; Zimmerhackl, 2000: Safdar et al., 2002; Tarr et al., 2005). Conventional antibiotics promote Shiga toxin production by enhancing the replication and expression of stx genes that are encodedwithin a chromosomally integrated lambdoid prophage genome. The approach of the present invention may rely on nuclease cutting of target cell genomic DNA. Stx induction also promotes phage-mediated lysis of the EHEC cell envelope, allowing for the release and dissemination of Shiga toxin into 10 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 the environment (Karch et al., 1999; Matsushiro et al., 1999; Wagner et al., 2002). Thus, advantageously, the invention provides alternative means for treating B2 phylogroup EHEC in human and animal subjects. In an example, the subject (eg, a human) is suffering from or at risk of haemolytic uremic syndrome (HUS), eg, the subject is suffering from an E coli infection, such as an EHEC E coli infection.

[0067] 8. The composition ormethod of any precedingEmbodiment for preventing haemolytic uremic syndrome (HUS), a UTI infection, sepsis, septicaemia or diarrhoea in the subject. The composition ormethodmay be for treating or preventing a blood stream infection by pathogenic B2 phylogroupE coli cells in the subject.

[0068] 9. The composition or method of any preceding Embodiment, wherein each particle comprises a phage capsid containing the nucleic acid; optionally wherein the capsid comprises capsid proteins of a T-even (optionally T4) or lambda phage.

[0069] As is known the to the skilled addressee, transduction particles are operable to infect their cognate host cells to introduce therein nucleic acid by transduction.

[0070] 10. The composition ormethod of any precedingEmbodiment, wherein eachparticle is a phage (optionally a lytic phage) or packaged phagemid.

[0071] 11. The composition or method of any preceding Embodiment, wherein at least 2, 3 or 4 different types of transduction particle are administered to the subject.

[0072] For example, each particle types comprises a type of adhesionmoiety or collection of adhesionmoiety types that differs from the other types of particles.

[0073] In an example, 2 different types of transduction particle are administered to the subject. In an example, 3 different types of transduction particle are administered to the subject. In an example, 4 different types of transduction particle are administered to the subject. In an example, 5 different types of transduction particle are administered to the subject. In an example, 6 different types of transduction particle are administered to the subject.

[0074] 12. The composition or method of any preceding Embodiment, wherein a first type of transduction particle and a second type of transduction particle are administered to the subject, wherein the first type of particle comprises a first adhesion moiety that is capable of recognising and binding to a first cognate moiety selected from the group LPS, LamB and Tsx displayed on B2 E coli, and the second type of particle comprises a second adhesion moiety that is capable of recognising and binding to a second cognate moiety selected from said group, wherein the first and second adhesion moieties different from each other.

[0075] For example, the first and second adhesion moieties different from each other by their tail fibres, optionally wherein the first adhesion moiety is cognate to LPS and the second moiety is cognate to LamB; or optionally wherein the first adhesion moiety is cognate to LPS and the second moiety is cognate to Tsx; optionally wherein the first adhesion moiety is cognate to Tsx and the second moiety is cognate to LamB.

[0076] For example, each particle comprises a phage capsid containing a said nucleic acid; wherein at least 2, 3 or 4 different typesof transductionparticleareadministered to thesubject; andwhereinafirst typeof transductionparticleanda second type of transduction particle are administered to the subject, wherein the first type of particle comprises a first adhesion moiety that is capable of recognising and binding to a first cognate moiety selected from the group LPS, LamB and Tsx displayed on B2 E coli, and the second type of particle comprises a second adhesion moiety that is capable of recognising and binding to a second cognate moiety selected from said group, wherein the first and second adhesion moieties different from each other.

[0077] For example, each particle comprises a phage capsid containing a said nucleic acid: wherein at least 2, 3 or 4 different typesof transductionparticleareadministered to thesubject; andwhereinafirst typeof transductionparticleanda second type of transduction particle are administered to the subject, wherein the first type of particle comprises a first adhesion moiety that is capable of recognising and binding to LPS displayed on B2 E coli, and the second type of particle comprises a second adhesion moiety that is capable of recognising and binding to LamB displayed on B2 E coli.

[0078] For example, each particle comprises a phage capsid containing a said nucleic acid: wherein at least 2, 3 or 4 different typesof transductionparticleareadministered to thesubject; andwhereinafirst typeof transductionparticleanda second type of transduction particle are administered to the subject, wherein the first type of particle comprises a first adhesion moiety that is capable of recognising and binding to Tsx displayed on B2 E coli, and the second type of particle comprises a second adhesion moiety that is capable of recognising and binding to LamB displayed on B2 E coli.

[0079] For example, each particle comprises a phage capsid containing a said nucleic acid; wherein at least 2, 3 or 4 different typesof transductionparticleareadministered to thesubject, andwhereinafirst typeof transductionparticleanda second type of transduction particle are administered to the subject, wherein the first type of particle comprises a first adhesion moiety that is capable of recognising and binding to LPS displayed on B2 E coli, and the second type of particle comprises a second adhesion moiety that is capable of recognising and binding to Tsx displayed on B2 E coli.

[0080] For example, each particle comprises a phage capsid containing a said nucleic acid; wherein at least 3 different types of transduction particle are administered to the subject; and wherein a first type of transduction particle, a second typeof transductionparticleanda third typeof transductionparticleareadministered to thesubject,wherein thefirst typeof 11 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 particle comprises a first adhesion moiety that is capable of recognising and binding to LPS displayed on B2 E coli, the second type of particle comprises a second adhesionmoiety that is capable of recognising and binding to LamBdisplayed onB2E coli,and the third typeof particle comprisesasecondadhesionmoiety that is capable of recognisingandbinding to Tsx displayed on B2 E coli.

[0081] For example, each particle comprises a phage capsid containing a said nucleic acid; wherein at least 4 different types of transduction particle are administered to the subject; and wherein a first type of transduction particle, a second type of transduction particle, a third type of transduction particle and a fourth type of transduction particle are administered to the subject, wherein the first type of particle comprises a first adhesionmoiety that is capable of recognising and binding to LPS displayed on B2 E coli, the second type of particle comprises a second adhesion moiety that is capable of recognising andbinding to LamBdisplayed onB2E coli, the third type of particle comprises a secondadhesionmoiety that is capable of recognising and binding to Tsx displayed on B2 E coli, and the fourth type of particle comprises a second adhesionmoiety that is capableof recognisingandbinding toLPSdisplayedonB2E coli,wherein theadhesionmoietiesof said particles are different from each other.

[0082] For example, each particle comprises a phage capsid containing a said nucleic acid: wherein at least 4 different types of transduction particle are administered to the subject; and wherein a first type of transduction particle, a second type of transduction particle, a third type of transduction particle and a fourth type of transduction particle are administered to the subject, wherein the first type of particle comprises a first adhesionmoiety that is capable of recognising and binding to LPS displayed on B2 E coli, the second type of particle comprises a second adhesion moiety that is capable of recognising andbinding to LamBdisplayed onB2E coli, the third type of particle comprises a secondadhesionmoiety that is capable of recognising and binding to Tsx displayed on B2 E coli, and the fourth type of particle comprises a second adhesionmoiety that is capable of recognising andbinding to LamBdisplayed onB2E coli,wherein the adhesionmoieties of said particles are different from each other.

[0083] For example, each particle comprises a phage capsid containing a said nucleic acid; wherein at least 4 different types of transduction particle are administered to the subject; and wherein a first type of transduction particle, a second type of transduction particle, a third type of transduction particle and a fourth type of transduction particle are administered to the subject, wherein the first type of particle comprises a first adhesionmoiety that is capable of recognising and binding to LPS displayed on B2 E coli, the second type of particle comprises a second adhesion moiety that is capable of recognising andbinding to LamBdisplayed onB2E coli, the third type of particle comprises a secondadhesionmoiety that is capable of recognising and binding to Tsx displayed on B2 E coli, and the fourth type of particle comprises a second adhesionmoiety that is capable of recognising and binding to Tsx displayed onB2E coli,wherein the adhesionmoieties of said particles are different from each other.

[0084] 13. The composition or method of Embodiment 12, wherein the first and second cognate moieties are different from each other.

[0085] In an alternative, the first and second cognate moieties are identical. In an alternative, the first and second cognate moieties are LPS. In an alternative, the first and second cognate moieties are Tsx. In an alternative, the first and second cognate moieties are LamB.

[0086] 14. The composition or method of any preceding Embodiment, wherein the nucleic acid of each particle comprises a nucleotide sequence (N1) encoding said nuclease, wherein each particle is a synthetic T-even phage (optionally a T4 phage) comprising an insertion of N1 into the genome of the phage, wherein the region is between the pin (protease inhibitor) gene and the iPII (internal protein) gene.

[0087] Optionally, the phage is (a) a synthetic T-even (eg, a T4) phage that comprises a deletion of DNA from, and / or an insertion of heterologous DNA into, a region of the genome of the phage corresponding to a region between coordinates (i) 1887 and 8983; (ii) 2625 and 8092; (iii) 1904 and 8113; (iv) 2668 and 7178; (v) 7844 and 11117; (vi) 8643 and 10313; (vii) 9231 and 13383; (viii) 9480 and 12224; (ix) 8454 and 17479; or (x) 9067 and 16673; wherein coordinates are with reference to wild-type T4 phage genome (SEQ ID NO: 5);

[0088] 15. The composition or method of any preceding Embodiment, wherein said nuclease is a guided nuclease, 12 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 optionally a Cas, meganuclease, zinc finger nuclease or TALEN.

[0089] 16. The composition or method of any preceding Embodiment, wherein the nuclease is a Type I, II, III, IV, Vor VI nuclease, optionally a Cas9 or a Cas3.

[0090] 17. The composition or method of any preceding Embodiment, wherein at least 1 x 107 PFU of particles are administered to the subject.

[0091] In an example, 1 x 108 to 1 x 1013 PFU of particles are administered to the subject. In an example, 1 x 108 to 1 x 1012PFUof particles are administered to the subject. In an example, 1 x 1010 to 1 x 1012PFUof particles are administered to the subject.

[0092] 18. The composition or method of any preceding Embodiment, wherein the particles are administered to the subject at an MOI (multiplicity of infection) of at least 0.01.

[0093] Optionally, the particles are administered to the subject at anMOI of nomore than 1. Optionally, the particles are administered to the subject at an MOI from 0.001 to 1. Optionally, the particles are administered to the subject at an MOI from 0.01 to 1. Optionally, the particles are administered to the subject at an MOI from 0.1 to 1.

[0094] 19. The composition or method of any preceding Embodiment, wherein the strain or at least one strain is an antibiotic-resistant or MDR strain; and / or wherein the strain or at least one strain is a B2-I strain.

[0095] For example, the strain or at least one strain is a strain selected from B2-I (STc131), B2-II, B2-IX, and B2-VI.

[0096] For example, at least one MDR strain is resistant to fluoroquinolone and the strain is a beta-lactamase (ESBL)‑producing E coli.

[0097] 20. The composition or method of Embodiment 19, wherein the antibiotic is fluoroquinolone (optionally levo- floxacin), carbapenem or vancomycin; and / or wherein the E coli are beta-lactamase (ESBL)‑producing E coli.

[0098] Optionally, the antibiotic is selected from ciprofloxacin (eg, Cipro™), gemifloxacin (eg, Factive™), levofloxacin (eg, Levaquin™), moxifloxacin (eg, Avelox™), and ofloxacin.

[0099] For example, the E coli produce CTX-M‑15. CTX-M‑15 is the most abundant enzyme in ESBL-producing E. coli causing human infections.

[0100] Preferably, the antibiotic is fluoroquinolone (FQ). For example, the FQ is levofloxacin. Levofloxacin, sold under the brand name Levaquin™ among others, is an antibiotic medication. It is used to treat a number of bacterial infections including acute bacterial sinusitis, pneumonia, urinary tract infections, chronic prostatitis, and some types of gastro- enteritis. Levofloxacin prophylaxis is recommended to prevent gram-negative bloodstream infections (BSIs) in patients with prolonged chemotherapy-induced neutropenia. However, increasing fluoroquinolone resistance may decrease the effectiveness of this approach (eg, Clin Infect Dis. 2021 Oct 5;73(7):1257‑1265. doi: 10.1093 / cid / ciab404, "Colonization With Fluoroquinolone-Resistant Enterobacterales Decreases the Effectiveness of Fluoroquinolone Prophylaxis in Hematopoietic Cell Transplant Recipients, Michael J Satlin et al). This study found that in the patients tested, nearly one-third of hematopoietic cell transplantation (HCT) recipients with pretransplant fluoroquinolone-resistant Enterobac- terales (FQRE) colonization developed gram-negative bloodstream infections (BSIs) while receiving levofloxacin pro- phylaxis, and infections were typically caused by their colonizing strains. In contrast, levofloxacin prophylaxis was highly effective in patients not initially colonized with FQRE. The authors found that 23% of patients admitted for HCT were colonized with FQRE and E. coli was the predominant species. Patients with hematologic malignancies who receive intensive chemotherapy, including those undergoing hematopoietic cell transplantation (HCT), frequently develop severe neutropenia and gastrointestinal mucositis, placing them at high risk of developing bloodstream infections (BSIs) from gram-negative enteric bacteria (Enterobacterales). Neutropenic patients often suffer severe consequences from BSIs caused by Enterobacterales, with mortality rates as high as 15%‑20%. Moreover, many fluoroquinolone-resistant Enterobacterales (FQRE) also harbor extended-spectrum β-lactamases (ESBLs); thus, breakthrough infections that occur despite fluoroquinolone prophylaxis may be resistant to first-line antimicrobial therapies for fever and neutropenia. Finally, adverse effects of fluoroquinolones have become increasingly apparent, includingClostridioides difficile infection, aortic dissection and rupture, dysglycemia, tendinopathy, QT interval prolongation, and mental status changes. Thus, fluoroquinolones should only be administered to patients when they are likely to provide clinical benefit to justify these potential adverse effects. Thus, Although fluoroquinolonesmay decrease the risk of gram-negative BSI in many patients, those who are colonized with FQRE may not benefit from fluoroquinolone prophylaxis.

[0101] The high rate and absence of risk factors for FQRE colonization suggest that FQRE are prevalent in the community. Indeed, a study of urinary isolates among outpatients in the United States demonstrated that 12% of E. coli isolates from youngwomen and 29%ofE. coli isolates fromelderly womenwere fluoroquinolone resistant. A surveillance study of 1831 urinary E. coli isolates from 2017 found that one-quarter were FQ resistant. Furthermore, 13%‑16% ofmen undergoing transrectal prostate biopsieswere found tobe colonizedwith fluoroquinolone-resistantE. coli.Nearly one-half of fluoroquinolone-resistantE coli isolates in the studywere ST131, a common sequence type that has spread throughout the world and whose isolates are frequently fluoroquinolone resistant and ESBL producers.

[0102] Bacteraemia caused by extended-spectrum β-lactamase (ESBL)‑producing Enterobacteriaceae (ESBL-E), such as E coli, is associated with inadequate empirical therapy and substantial mortality in neutropenic patients (see eg, "ColonizationWith Levofloxacin-resistant Extended-spectrum β-Lactamase-producing Enterobacteriaceae and Risk 13 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 of Bacteremia in Hematopoietic Stem Cell Transplant Recipients", Satlin MJ et al, Clin Infect Dis. 2018 Nov 13;67(11):1720‑1728. doi: 10.1093 / cid / ciy363). The study found that HSCT recipients who are colonized with levoflox- acin-resistant ESBL-E pre-transplant and receive levofloxacin prophylaxis have high rates of bacteraemia from their colonizing strain during neutropenia. In this single-centre study of 312 HSCT recipients, it was found that 10% of patients were colonized with ESBL-E prior to their transplant. Nearly one-third of patients with pre-transplant ESBL-E colonization developed subsequent ESBL-E bacteraemia while neutropenic after their transplant, compared to <1% of patients who were not initially colonized with ESBL-E. Furthermore, the bloodstream and gastrointestinal ESBL-E had identical MLST and PFGE profiles in all cases, suggesting that these patients developed bacteraemia from their colonizing isolates.

[0103] In an example, the composition or method of the invention is for preventing the translocation of B2 phylogroupE coli from the gastrointestinal tract to the blood stream of the subject, thereby preventing or reducing bacteriaemia in the patient.

[0104] In an example, the composition or method of the invention is for preventing the translocation of B2 phylogroupE coli from the urinary tract to the blood stream of the subject, thereby preventing or reducing bacteriaemia in the patient.

[0105] In an example, theE coli are comprised by the gastrointestinal tract of the subject. Optionally, in these examples, the composition is administered orally to the subject.

[0106] In another example, the E coli are comprised by the urinary tract of the subject. For example, the infection is a kidney, bladder or urethra infection. Optionally, in these examples, the composition is administered to the urinary tract of the subject, such as by a catheter.

[0107] 21. The composition or method of any preceding Embodiment, wherein (i) the nuclease is a Cas, (ii) each particle comprises a phage capsid containing the nucleic acid; and (iii) wherein a first type of transduction particle and a second type of transduction particle are administered to the subject,wherein the first typeof particle comprisesafirst adhesionmoiety that is capableof recognisingandbinding to afirst cognatemoiety selected from thegroupLPS,LamBandTsxdisplayedonB2strainE coli,and the second typeof particle comprises a second adhesion moiety that is capable of recognising and binding to a second cognate moiety selected from said group, wherein the first and second adhesion moieties different from each other.

[0108] 22. A method for treating or preventing an infection by E coli cells in a human or animal subject, the method comprising administering to the subject a plurality of transduction particles, wherein (a) each particle comprises a nucleic acid encoding a crRNA or guide RNA that is operable with a Cas nuclease for chromosomal targeting in the cells, wherein the said administered particles contact the cells and introduce therein the nucleic acid, wherein the crRNA or guide RNA is expressed and guides the Cas nuclease wherein the nuclease cuts the chromosomes of the cells, thereby killing the cells or reducing growth or proliferation of the cells in the subject; (b) the E coli cells are cells of E coli phylogroup B2; and (c) each particle comprises an adhesionmoiety for recognising and binding to a cognatemoiety selected from a LPS, LamB and Tsx displayed on the surface of the phylogroup B2 E coli cells.

[0109] Each nucleic acid preferably encodes a plurality of different cRNAs comprising spacer sequences that target E coli chromosomal genes. For example, Each nucleic acid preferably encodes a plurality of different cRNAs comprising spacer sequences that target 2, 3 or 4 E coli chromosomal genes selected from fimH, bolA, rpoH, lptA and murA.

[0110] Optionally, each crRNA or guide RNA comprises a spacer that targets an E coli gene selected from the group fimH, bolA, rpoH, lptA and murA. Optionally, each nucleic acid encodes a plurality of different cRNAs or guide RNAs, wherein the cRNAsor guideRNAs target at least 2, 3 or 4 (or targets all of)E coligenes selected from thegroup fimH, bolA, rpoH, lptA and murA. Optionally, each nucleic acid encodes a plurality of different cRNAs or guide RNAs, wherein the cRNAs or guide RNAs target fimH and bolA. Optionally, each nucleic acid encodes a plurality of different cRNAs or guide RNAs,wherein thecRNAsorguideRNAs target rpoHand lptA.Optionally, eachnucleicacidencodesaplurality of different cRNAs or guide RNAs, wherein the cRNAs or guide RNAs target fimH and murA. Optionally, each crRNA or guide RNA comprises a spacer sequence that is complementary to anE coli gene selected from the group fimH, bolA, rpoH, lptA and murA. Optionally, each crRNA or guide RNA comprises a spacer sequence that is at least 80, 90 or 95% identical to a nucleotide sequence selected from the group SEQ ID NO: 6‑10.

[0111] Optionally, each nucleic acid encodes a first crRNA, second crRNA, third crRNA, fourth crRNA and fifth cRNA, wherein the cRNAs are different from each other and each crRNA targets a B2 phylogroup E coli gene. Optionally, each nucleic acid encodes a first crRNA, second crRNA, third crRNA, fourth crRNA and fifth cRNA, wherein the cRNAs are different from each other and each crRNA is complementary to a B2 phylogroupE coli gene. Optionally, each nucleic acid encodes a first crRNA, second crRNA, third crRNA, fourth crRNA and fifth cRNA, wherein the cRNAs comprise respectively SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10. Optionally, each nucleic 14 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 acid encodes a first crRNA, second crRNA, third crRNA, fourth crRNA and fifth cRNA, wherein the cRNAs comprise respectively a nucleotide sequence that is at least 80% identical to SEQ ID NO: 6, a nucleotide sequence that is at least 80% identical toSEQIDNO:7,anucleotidesequence that isat least 80% identical toSEQIDNO:8,anucleotidesequence that is at least 80% identical to SEQ ID NO: 9 and a nucleotide sequence that is at least 80% identical to SEQ ID NO: 10. Optionally, eachnucleic acid encodesa first crRNA, second crRNA, third crRNA, fourth crRNAandfifth cRNA,wherein the cRNAscomprise respectively anucleotide sequence that is at least 90% identical toSEQ IDNO: 6, a nucleotide sequence that is at least 90% identical to SEQ ID NO: 7, a nucleotide sequence that is at least 90% identical to SEQ ID NO: 8, a nucleotide sequence that is at least 90% identical to SEQ IDNO: 9 anda nucleotide sequence that is at least 90% identical to SEQ IDNO: 10. Optionally, each nucleic acid encodes a first crRNA, second crRNA, third crRNA, fourth crRNAand fifth cRNA, wherein the cRNAs comprise respectively a nucleotide sequence that is at least 95, 96, 97, 98 or 99% identical to SEQIDNO:6,anucleotidesequence that is at least 95, 96,97, 98or99% identical toSEQIDNO:7,anucleotidesequence that is at least 95, 96, 97, 98 or 99% identical to SEQ IDNO: 8, a nucleotide sequence that is at least 95, 96, 97, 98 or 99% identical to SEQ ID NO: 9 and a nucleotide sequence that is at least 95, 96, 97, 98 or 99% identical to SEQ ID NO: 10.

[0112] 23. Themethod of Embodiment 22,wherein themethod is according to any one of Embodiments 1‑20, optionally except that the nuclease is an endogenous nuclease of the cells and is not encoded by the nucleic acid comprised by the particles.

[0113] 24. A composition comprising a plurality of transduction particles for use in amethod of treating or preventing an infection by E coli cells in a human or animal subject according to Embodiment 22 or 23, wherein (a) each particle comprises a nucleic acid encoding a crRNA or guide RNA that is operable with a Cas nuclease for chromosomal targeting in the cells, wherein the said administered particles contact the cells and introduce therein the nucleic acid, wherein the crRNA or guide RNA is expressed and guides the Cas nuclease wherein the nuclease cuts the chromosomes of the cells, thereby killing the cells or reducing growth or proliferation of the cells in the subject: (b) the E coli cells are cells of E coli phylogroup B2; and (c) each particle comprises an adhesionmoiety for recognising and binding to a cognatemoiety selected from a LPS, LamB and Tsx displayed on the surface of the phylogroup B2 E coli cells.

[0114] 25. Amethod of detecting the presence of a B2 phylogroupE coli in a sample, themethod comprising contacting the sample comprising B2 phylogroup E coli with a composition comprising a plurality of transduction particles, wherein (a) each particle comprises a nucleic acid encoding a nuclease for targeting the genomes of saidE coli cells, wherein the said administered particles contact the cells and introduce therein the nucleic acid, wherein the nuclease is expressed in the cells and cuts genomicDNAof the cells, thereby killing the cells or reducing growth or proliferation of the cells in the subject: (b) each particle comprises an adhesionmoiety for recognising and binding to a cognatemoiety selected from a LPS, LamB and Tsx displayed on the surface of the phylogroup B2 E coli cells; and (c) the method comprises detecting that B2 phylogroup E coli cells have been killed or the growth or proliferation thereof has been reduced.

[0115] 26. Amethod of detecting the presence of a B2 phylogroupE coli in a sample, themethod comprising contacting the sample comprising B2 phylogroup E coli with a composition comprising a plurality of transduction particles, wherein (a) each particle comprises a nucleic acid comprising or encoding a detectable label, wherein the said administered particles contact the cells and introduce therein the nucleic acid, wherein optionally the label is expressed in the cells; (b) each particle comprises an adhesionmoiety for recognising and binding to a cognatemoiety selected from a LPS, LamB and Tsx displayed on the surface of the phylogroup B2 E coli cells; and (c) the method comprises detecting B2 phylogroup E coli cells comprising the label.

[0116] 27. Themethod of Embodiment 26 or 27, wherein the composition comprises the features of the composition of any one of Embodiments 1, 2‑21 24 and 25.

[0117] 28.Themethodof anyoneofEmbodiments26‑28,wherein theE colicompriseoneormoreE colistrains selected from the group ST131, ST1193, ST648, ST315, ST405, ST361, ST88 and ST453.

[0118] 29.Themethodof anyoneofEmbodiments 26‑29,wherein the sample is a patient sample (eg, blood, urine, stool or saliva sample), wherein the subject is a transplant or cancer patient (optionally a haematological cancer patient), or wherein the patient is suffering from or at risk of a urinary tract infection (UTI); and optionally wherein the transplant is a solid organ or stem cell transplant (optionally a haematopoietic cell transplant).

[0119] 30. The method of any one of Embodiments 26‑30, wherein the nucleic acid of each particle comprises a nucleotide sequence (N1) encoding said nuclease, or comprising or encoding the labelwherein eachparticle is a synthetic 15 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 T-even phage (optionally a T4 phage) comprising an insertion of N1 into the genome of the phage, wherein the region is between the pin (protease inhibitor) gene and the iPII (internal protein) gene.

[0120] 31.Themethodof anyoneofEmbodiments26‑31,whereinat least 1 x107PFUofparticlesarecontactedwith the sample.

[0121] 32. Themethodof anyoneofEmbodiments 26‑32,wherein theparticles are contactedwith the sample at anMOI (multiplicity of infection) of at least 0.01. Labelling for detectionmethods is routine for the skilled addressee. The labelmay, for example, be a fluorescence label, eg, GFP. The sample may be a blood, spit, sputum or cell sample. CONCEPTS

[0122] The invention also provides the followingConcepts, which are fully supported byExample 2. All Concepts canbe combined with any other features disclosed herein.

[0123] Patients with hematological malignancies frequently develop bloodstream infections due to translocation of E. coli and other bacteria from the gut. Antibiotic treatment to prevent these infections has detrimental effects on the microbiome and immune tonus and is further hampered by increasing antibiotic resistance, in particular towards fluroquinolones. As described in Example 2, compositions of the Concepts may target bacteria in biofilms, reduce the emergenceof phage-tolerantE. coliandout-compete their ancestralWTphages in co-culture experiments.Compositions are provided with broad host-range across the E. coli phylogeny, including multi-drug resistant strains (B2 phylogroup). Compositions comprising different particles as per the Concepts may surprisingly reduce E. coli load in the murine gut better than individual constituent particles. The compositions,methods anddoses of theConcepts find utility to selectively killE. coliwhichmaycause fatal infections in hematological cancer, transplant orUTI patients. Thecompositions,methods and doses also find utility for treating or preventing E coli blood stream infection.

[0124] To this end, there is provided:- Concept A:

[0125] A composition comprising a plurality of different types of transduction particles, wherein each of said particles comprises a nucleic acid and said particles are capable of contacting E coli cells and introducing therein the nucleic acid, wherein (a) said nucleic acid of each particle comprises a nucleotide sequence encoding a product of interest (POI), wherein the nucleic acid is capable of expressing the POI in an E coli cell; (b) each particle comprises an adhesionmoiety for recognising and binding to a cognatemoiety selected from a LPS, LamB and Tsx (optionally selected from LPS and Tsx) displayed on the surface of E coli cells; and (c) said plurality of different types of transduction particles comprises (i) a first type of particles that comprise a LPS adhesion moiety; and (ii) a second type of particles that comprise a Tsx adhesion moiety. Concept B:

[0126] A composition comprising a plurality of transduction particles for use in a method of treating or preventing an infection by E coli cells in a human or animal subject, wherein the method comprises administering the particles to the subject, wherein (a) each particle comprises a nucleic acid encoding a nuclease for targeting the genomes of E coli cells, wherein the said administeredparticles contact the cells and introduce therein thenucleic acid,wherein thenuclease is expressed in the cells and cuts genomic DNAof the cells, thereby killing the cells or reducing growth or proliferation of the cells in the subject; (b) the E coli cells are cells of E coli phylogroup B2; and (c) each particle comprises an adhesionmoiety for recognising and binding to a cognatemoiety selected from a LPS, LamB and Tsx (optionally selected from LPS and Tsx) displayed on the surface of the phylogroup B2 E coli cells. Concept C:

[0127] A composition comprising a plurality of transduction particles for use in a method of treating or preventing an infection byE coli cells (optionally B2 phylogroupE coli cells)in a human or animal subject, wherein themethod comprises administering the particles to the subject, wherein (a) each particle comprises a nucleic acid encoding a nuclease for targeting the genomes of E coli cells, wherein the said administered particles contact the cells and introduce therein the nucleic acid, wherein the nuclease is expressed in the cells and cuts genomic DNA of the cells, thereby killing the cells or 16 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 reducing growth or proliferation of the cells in the subject; and (b) each particle comprised by the composition is aT-evenphage capsid; optionally a capsid of a T2 phage, T2-like phage, RB69 phage or a RB69-like phage.

[0128] The following features are optional features that are combinable with the Concepts above or any other Configuration, example, embodiment or option herein. Optionally,

[0129] A: each particle of the first type comprises a LPS adhesion moiety and a LamB adhesion moiety; B: each particle of the first type comprises a LPS adhesion moiety and a Tsx adhesion moiety; or C: each particle of the second type comprises a Tsx adhesion moiety but is devoid of LamB and LPS adhesion moieties.

[0130] Optionally, the composition comprises particles according to A, B and C.

[0131] Optionally, each particle comprises a phage capsid containing the nucleic acid. In an embodiment, the capsid comprises capsid proteins of a T-even (optionally T2) or lambda phage.

[0132] Optionally, thecapsidofeachparticle comprisedby thecomposition isaT-evenphagecapsid; optionally acapsid of a T2 phage, T2-like phage, RB69 phage or a RB69-like phage.

[0133] Optionally, each particle is a phage (optionally a lytic phage) or packaged phagemid.

[0134] Optionally, the composition comprises at least 3 or 4 different types of transduction particles. In an embodiment the composition has 4 (but no more than 4) different types of transduction particles.

[0135] Optionally, the nucleic acid of each particle comprises at least one nucleotide sequence (N1) encoding said POI, wherein each particle is a synthetic T-even phage comprising an insertion of N1 into a Modification Permissive Region (MPR) of the genome of the phage, wherein the MPR is immediately after gene 49 and to gene E when compared to a referencewild-typeT2phage.Thenucleic acidmaycompriseaDNAdeletionof phageDNA in theMPR.The insertionmay comprise up to 5000, 6000, 7000 or 8000bp of DNA and / or the deletion comprises up to 5000, 6000, 7000 or 8000bp of DNA. TheMPRmay comprise contiguousDNAbetween said gene 49 and gene E,wherein the contiguousDNA is at least 1000bp in length; or wherein the MPR comprises at least 100bp of DNA between said gene 49 and gene E.

[0136] Optionally a T-even phage herein is a phage selected fromT2, T4 or T6 phage; or comprises a genome that is at least 95% identical to the genome of a said selected phage. This percentage may be at least 96, 97, 98 or 99%.

[0137] The composition of any one of claims 8‑11, wherein the synthetic phage genome comprises said insertion between coordinates 9000 and 21000, wherein the coordinates are the nucleotide positions counted from the nucleotide (coordinate number 1) immediately after gene 49 towards gene E when compared to a reference wild-type T2 phage. Optionally, the insertion is between coordinates 10300 and 19800, eg, between 10359 and 19810with reference to the T2 genome.

[0138] Optionally, the insertion is in a window selected from the following windows (numbers being coordinates with reference to the T2 genome):‑ 9000‑21000; 10000‑21000, 10100‑21000, 10200‑21000, 10300‑21000, 10400‑21000, 10500‑21000, 11000‑21000, 15000‑21000; 9000‑20000; 10000‑20000, 10100‑20000, 10200‑20000, 10300‑20000, 10400‑20000, 10500‑20000, 11000‑20000, 15000‑20000; 9000‑19500; 10000‑19500, 10100‑19500, 10200‑19500, 10300‑19500, 10400‑19500, 10500‑19500, 11000‑19500, 15000‑19500; 9000‑19000: 10000‑19000, 10100‑19000, 10200‑19000, 10300‑19000, 10400‑19000, 10500‑19000, 11000‑19000, 15000‑19000; 9000‑18000: 10000‑18000, 10100‑18000, 10200‑18000, 10300‑18000, 10400‑18000, 10500‑18000, 11000‑18000 and 15000‑18000.

[0139] Optionally, the nuclease is a dsDNA nuclease, ie, is capable of cutting dsDNA. Optionally, the nuclease is a nickase, eg, a Cas9 nickase.

[0140] In an embodiment, the POI is a protein. In an embodiment, the POI is an RNA, eg, a crRNA.

[0141] Optionally, the POI comprises (a) a nuclease for targeting theDNAof anE coli cell, wherein the nuclease is capable of being expressed in the cell for cutting the DNA of the cell, thereby modifying or killing the cell; or 17 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 (b) a deadCas (dCas) for targeting theDNAof anE coli cell, wherein thedCas is capable of being expressed in the cell and targeting the DNA of the cell, thereby modifying the cell.

[0142] Optionally, when (a) applies, said nuclease is a guided nuclease, optionally a Cas, meganuclease, zinc finger nuclease or TALEN; or when (b) applies, the dCas is a dCas9.

[0143] The nuclease may be a Type I, II, III, IV, V or VI Cas nuclease, optionally a Cas9 or a Cas3.

[0144] In a preferred embodiment, the nucleic acid comprises (optionally in 5’ to 3’ order) a cas3 gene (ygcB) and a cognate cascadegenecomplex comprising casA (ygcL, cas8e), casB (ygck, cas11),casC (ygcJ, cas7), casD (ygcI. cas5), and casE (ygcH, cas6), and optionally a CRISPR array or nucleotide sequence encoding a guide RNA that targets an E. coli genome.

[0145] In a preferred embodiment, POI comprises at least one crRNA or guide RNA that is operable with a Cas for DNA targeting inE coli cells.Optionally, each crRNAor guideRNAcomprises a spacer sequence that is complementary to anE coli protospacer sequence; optionally a protospacer of a B2 phylogroupE coli cell or anE coli cell of a strain selected from the group ST131, ST1193, ST648, ST315, ST405, ST361, ST88 and ST453.

[0146] Each nucleic acid preferably encodes a plurality of different cRNAs comprising spacer sequences that target E coli chromosomal genes. For example, Each nucleic acid preferably encodes a plurality of different cRNAs comprising spacer sequences that target 2, 3 or 4 E coli chromosomal genes selected from fimH, bolA, rpoH, lptA and murA. In an embodiment, thecompositionof the inventioncomprisesa typeof transductionparticle that targetsE coligenesbolA, rpoH and fimH. Additionally or alternatively, the composition of the invention comprises a type of transduction particle that targetsE coligenes lptAandmurA.Optionally, the composition comprises a first type of transduction particle that targetsE coli genes bolA, rpoH and fimH; and a second type of transduction particle that targets E coli genes lptA and murA. Optionally, the first type of particle is according any other first type of particle herein which comprises a LPS adhesion moiety (eg, comprises LPS and Tsx adhesionmoieties). Optionally, the second type of particle is according any other first type of particle herein which comprises a Tsx adhesion moiety. Optionally, the second type of particle comprises a LPS adhesion moiety (eg, comprises LPS and LamB adhesion moieties).

[0147] Theprotospacer sequencemaycomprisedbyageneselected fromE coligenesfimH, bolA, rpoH, lptAandmurA.

[0148] In an embodiment, the particles of the composition target all of E coli genes fimH, bolA, rpoH, lptA and murA.

[0149] The nucleotide sequence encoding the POImay comprise a stress-phase active (SPA) promoter for expression of the POI in E coli cells. The promoter may be an E coli bolA promoter. The promoter may comprise SEQ ID NO: 13.

[0150] In an embodiment, the E coli cells comprise a strain of E coli that causes sepsis, septicaemia or diarrhoea in humans or animals.

[0151] Optionally, the E coli cells are GI tract cells. Optionally, the E coli cells are comprised by a gut microbiome. Optionally, theE coli cells are comprised by bloodof the subject.Optionally, theE coli cells are comprised by a urinary tract of the subject. Optionally, the E coli cells are comprised by a microbiome selected from a GI tract (eg, stomach), blood, urinary tract, mouth, nose, eye, ear, skin, anus or hair microbiome.

[0152] In an embodiment, the composition is for use in a method of treating or preventing infection of by E coli cells in a human or animal subject, wherein the method comprises administering the particles to the subject.

[0153] Optionally, the method is for preventing the translocation of B2 phylogroup E coli from the gastrointestinal or urinary tract to the blood stream of the subject, thereby preventing or reducing bacteriaemia in the subject.

[0154] Optionally, themethod is for preventingE coli infection in a subject at risk of febrile neutropenia. The subjectmay be a cancer patient, such as a haematological cancer patient. The infectionmay be a bloodstream infection in the subject. Thus, in an embodiment, the method is for preventing a bloodstream E coli infection in a subject at risk of febrile neutropenia, wherein the subject is a human cancer patient, such as a haematological cancer patient.

[0155] There is provided:‑ Amethod of treating or preventing sepsis, septicaemia or diarrhoea in a human or animal subject, themethod comprising administering to thesubject thecompositiondescribedherein (eg, thecompositionofConceptA,BorC),wherein theE coli cells comprise a strain of E coli that causes sepsis, septicaemia or diarrhoea in humans or animals.

[0156] A method of treating or preventing infection of by E coli cells in a human or animal subject, wherein themethod comprises administering the composition described herein (eg, the composition ofConcept A, B orC) to the subject, wherein the infection is treated or prevented.

[0157] The infectionmay be reduced or eliminated. The infectionmay be reduced by at least 20, 30, 40, 50, 60l 70, 80 or 90%.

[0158] The subject may be a transplant or cancer patient (optionally a haematological cancer patient), or wherein the patient is suffering from or at risk of a urinary tract infection (UTI). Optionally, the transplant is a solid organ or stem cell transplant (optionally a haematopoietic cell transplant) or wherein the transplant is a transplant of a medical device. The subject may be suffering from a haematological cancer, eg, leukaemia. The subject (eg, cancer patient) may be at risk of neutropenia or may be suffering from neutropenia. Preferably, the subject is suffering from a haematological cancer, eg, leukaemia, and is at risk of neutropenia or suffering from neutropenia. 18 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55

[0159] Optionally, the method is carried out prior to the subject receiving a or said transplant. The transplant may be a stem cell transplant, eg, when the subject is a cancer patient.

[0160] The composition or method may be for preventing haemolytic uremic syndrome (HUS), a UTI infection, sepsis, septicaemia or diarrhoea in a human subject.

[0161] In the composition for use in a method, or any method described herein, at least 1 x 107 PFU of particles are administered to the subject. Also provided is a dose of a composition described herein, wherein the dose is a dose of at least 1 x 107PFUof said particles. For example, the dose is at least 1 x 107 , 1 x 108, 1 x 109, 1 x 1010 or 1 x 1011PFUof said particles.Forexample, thedose is1x107, 2x109or2x1011PFUof saidparticles.Forexample, thedose is from1x107 to2 x 1011PFUof said particles. For example, the dose is is 1 x 107 to 2 x 1011PFUof said particles per grambodyweight of the subject. In the method, E coli may be reduced by at least a 3 or 4 log10 CFU / g of body weight of the subject.

[0162] The dose may be comprised by a medical device or container, eg, for oral or intravenous administration. The device may be an IV device, syringe or comprise an injection needle. The device or container may be sterile.

[0163] Optionally, the particles are administered to the subject at an MOI (multiplicity of infection) of at least 0.01. For example, the MOI is at least 0.1 or 1.

[0164] Preferably, theE coli cells comprise at least one strain that is an antibiotic-resistant orMDRstrain: and / or at least one B2-I strain. Optionally, the antibiotic is fluoroquinolone (optionally levofloxacin), carbapenem or vancomycin: and / or wherein the E coli cells comprise beta-lactamase (ESBL)‑producing E coli.

[0165] In an embodiment, (i) the composition comprises first and second types of particles according to A, B and C A: each particle of the first type comprises a LPS adhesion moiety and a LamB adhesion moiety; B: each particle of the first type comprises a LPS adhesion moiety and a Tsx adhesion moiety; or C: each particle of the second type comprises a Tsx adhesion moiety but is devoid of LamB and LPS adhesion moieties; (ii) the POI comprises a guided nuclease for targeting the DNA of an E coli cell, wherein the nuclease is capable of being expressed in the cell for cutting the DNA of the cell, thereby modifying or killing the cell; (iii) each particle comprises a phage capsid containing the nucleic acid; and (iv) the particles of the composition target a plurality of different E coli genes, optionally selected from essential and virulence genes.

[0166] There is provided:‑ A method of detecting the presence of E coli (optionally B2 phylogroup E coli cells) in a sample, the method comprising (a) contacting the sample with a composition described herein (eg, according to Concept A, B or C); and (b) detecting that E coli cells have been killed or the growth or proliferation thereof has been reduced.

[0167] A method of detecting the presence of E coli (optionally B2 phylogroup E coli cells) in a sample, the method comprising (a) contacting thesamplewithaacompositiondescribedherein (eg,according toConceptA,BorC):whereinparticles of the composition comprise a nucleic acid comprising or encoding a detectable label, wherein the said particles contact the cells and introduce therein the nucleic acid, wherein optionally the label is expressed in the cells; and (b) detecting that E coli cells comprising the label.

[0168] Amethod formodifying thegenomesofE colicells, themethodcomprisingcontacting thecellswithacomposition described herein (eg, according to Concept A, B or C), wherein nucleic acid encoding the POI is introduced into the cells thereby modifying the genomes of the cells.

[0169] Where the POI is a nuclease, the nuclease is expressed in the cells and cuts genomic DNA of the cells, thereby killing the cells or reducing growth or proliferation of the cells in the subject.

[0170] A method for treating or preventing an infection by E coli cells in a human or animal subject, the method comprising administering to the subject a composition described herein (eg, according to Concept A, B or C).

[0171] Optionally, the sample is a patient sample (eg, blood, urine, stool or saliva sample), wherein the subject is a transplant or cancer patient (optionally ahaematological cancer patient), orwherein thepatient is suffering fromorat risk of a urinary tract infection (UTI); and optionally wherein the transplant is a solid organ or stem cell transplant (optionally a haematopoietic cell transplant).

[0172] A method herein, in an embodiment, may be carried out in vitro. A method herein, in an embodiment, may be 19 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 carried out ex vivo.

[0173] Optionally, at least 1 x 107 PFU of particles are contacted with the sample. Optionally the PFU of particles described above is contacted with the sample.

[0174] Optionally, the particles are contacted with the sample at an MOI (multiplicity of infection) of at least 0.01.

[0175] Optionally, eachparticle comprisedby thecompositioncomprisesaT-evenphagecapsid; optionally a capsidof a T2 phage, T2-like phage, RB69 phage or a RB69-like phage. Each particle may comprise a capsid of a Tevenvirinae phage.EachparticlemaybeamodifiedTevenvirinaephage that comprisesagenominc insertionof anucleotidesequence encoding POI or said nuclease (and optionally a cognate crRNA when the nuclease is a Cas).

[0176] Each particle may be a phage or packaged phagemid. Preferably, the phage is a lytic phage. In another embodiment, the phage may be a non-lytic phage.. In another embodiment, the phage may be a temperate phage.

[0177] Optionally the phage is a modified T2 phage, T2-like phage, RB69 phage or a RB69-like phage. Preferably the phage isaT2‑orRB69-likephage.Preferably, eachparticle is amodifiedfirst phage,wherein thegenomeof thefirst phage is at least 95, 96, 97, 98 or 99 % identical (by nucleotide sequence identity) to the genome of wild-type T2 or RB69. Preferably, said percentage is at least 95%. Preferably, percentage identity between phage genomes is determined by Mash analysis using a kmer size of 17 and 1000.

[0178] Optionally, the composition comprises at least 3 or 4 different types of transduction particles, wherein the types have different adhesion moieties for recognising and binding to a cognate moieties comprised by E coli cells.

[0179] Optionally the cells comprise B2 phylogroup E coli. The cells are preferably pathogenic cells. The cells are preferably pathogenic to the subject. The cells may mediate a disease or condition in the subject.

[0180] In an embodiment, (i) the nuclease is a guided nuclease for targeting the DNA of an E coli cell, wherein the nuclease is capable of being expressed in the cell for cutting the DNA of the cell, thereby killing the cell; (ii) each particle comprises a phage capsid containing the nucleic acid; and (iii) the particles of the composition target a plurality of different E coli genes, optionally selected from essential and virulence genes; and (iv) optionally the composition comprises A: particles which comprise a LPS adhesion moiety and a LamB adhesion moiety (and is devoid of Tsx); B: particles which comprise a LPS adhesion moiety and a Tsx adhesion moiety; or C: : particles which comprise a Tsx adhesion moiety but is devoid of LamB and LPS adhesion moieties.

[0181] The nuclease may be a Cas nuclease and the nucleic acid encodes at least one crRNA or guide RNA that is operable with theCas for DNA targeting inE coli cells. Each crRNAor guideRNAmay comprise a spacer sequence that is complementary to anE coliprotospacer sequence; optionally aprotospacer of aB2phylogroupE coli cell or anE coli cell of a strain selected from the group ST131, ST1193, ST648, ST315, ST405, ST361, ST88 and ST453. Each protospacer sequence may be comprised by a gene selected from E coli genes fimH, bolA, rpoH, lptA and murA.

[0182] Optionally, the particles of the composition target at least one virulence gene and at least one essential gene. Optionally, the particles of the composition targets at least three genes selected from virulence and essential genes. Optionally, the particles of the composition target all of E coli genes fimH, bolA, rpoH, lptA and murA.

[0183] Expression of the POI or nuclease or crRNAmay be under the control of a stress-phase active (SPA) promoter. Optionally, the promoter is anE coli bolApromoter or comprisesSEQ IDNO:13.Additionally or alternatively, expression of the POI or nuclease or crRNA may be under the control of an E. coli promoter PJ23100 (SEQ ID NO: 14), for example a promoter having a nucleotide sequence that is at least 80, 90, 95, 96, 97, 98 or 99% identical to SEQ ID NO: 14. For example, the promoter has the nucleotide sequence of SEQ ID NO: 16.

[0184] A spacer herein may be adjacent a direct repeat sequences in the nucleic acid comprised by the particles. For example, the repeat has the sequence of SEQ ID NO: 15 (or said sequence with up to 5, 4, 3, or 2 nucleotide changes compared with SEQ ID NO: 15).

[0185] In an embodiment, expression of the POI or nuclease or crRNAmay be under the control of a first promoter and expression of the adhesion moiety / ies is under the control of a second promoter that is different from the first promoter.

[0186] An adhesion moiety herein is on the outer surface of the cognate particle. In an embodiment, the moiety is comprised by a tail fibre, spike or capsid of the particle, preferably a tail fibre.

[0187] There is provided the following Paragraphs. PARAGRAPHS:

[0188] 20 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 1. A composition comprising a plurality of transduction particles for use in a method of treating or preventing an infection byE coli cells in a human or animal subject, wherein themethod comprises administering the particles to the subject, wherein (a) each particle comprises a nucleic acid encoding a nuclease for targeting the genomes ofE coli cells, wherein the said administered particles contact the cells and introduce therein the nucleic acid, wherein the nuclease is expressed in the cells and cuts genomic DNA of the cells, thereby killing the cells or reducing growth or proliferation of the cells in the subject: (b) the E coli cells are cells of E coli phylogroup B2; and (c) each particle comprises an adhesion moiety for recognising and binding to a cognate moiety selected from a LPS, LamB and Tsx displayed on the surface of the phylogroup B2 E coli cells. 2. Amethod for treating or preventing an infection byE coli cells in a human or animal subject, themethod comprising administering to the subject a plurality of transduction particles, wherein the method comprises administering the particles to the subject, wherein (a) each particle comprises a nucleic acid encoding a nuclease for targeting the genomes ofE coli cells, wherein the said administered particles contact the cells and introduce therein the nucleic acid, wherein the nuclease is expressed in the cells and cuts genomic DNA of the cells, thereby killing the cells or reducing growth or proliferation of the cells in the subject; (b) the E coli cells are cells of E coli phylogroup B2; and (c) each particle comprises an adhesion moiety for recognising and binding to a cognate moiety selected from a LPS, LamB and Tsx displayed on the surface of the phylogroup B2 E coli cells. 3. The composition or method of Paragraph 1 or 2 respectively, wherein the method is for treating or preventing infection of the subject by an E coli strain selected from the group ST131, ST1193, ST648, ST315, ST405, ST361, ST88 and ST453. 4.ThecompositionormethodofanyprecedingParagraph,wherein themethod is for treatingorpreventing infectionof the subject by a plurality of different phylogroup B2 strains of E coli; optionally wherein the plurality comprises E coli ST131 and ST1193 cells. 5. The composition or method of any preceding Paragraph, wherein the subject is a transplant or cancer patient (optionally a haematological cancer patient), orwherein thepatient is suffering fromorat risk of aurinary tract infection (UTI); and optionally wherein the transplant is a solid organ or stem cell transplant (optionally a haematopoietic cell transplant) or wherein the transplant is a transplant of a medical device. 6. The composition or method of any preceding Paragraph, wherein the method is carried out prior to the subject receiving a transplant. 7. The composition or method of any preceding Paragraph, wherein the B2E coli cells comprise a strain ofE coli that causes sepsis, septicaemia or diarrhoea in humans. 8. The composition or method of any preceding Paragraph for preventing haemolytic uremic syndrome (HUS), a UTI infection, sepsis, septicaemia or diarrhoea in the subject. 9. The composition or method of any preceding Paragraph, wherein each particle comprises a phage capsid containing the nucleic acid; optionally wherein the capsid comprises capsid proteins of a T-even (optionally T4) or lambda phage. 10. Thecompositionormethodof anyprecedingParagraph,whereineachparticle is aphage (optionally a lytic phage) or packaged phagemid. 11. The composition or method of any preceding Paragraph, wherein at least 2, 3 or 4 different types of transduction particle are administered to the subject. 12. The composition ormethod of any precedingParagraph, wherein a first type of transduction particle and a second typeof transductionparticleareadministered to thesubject,wherein thefirst typeofparticle comprisesafirst adhesion 21 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 moiety that is capable of recognising andbinding to a first cognatemoiety selected from thegroupLPS, LamBandTsx displayed on B2 E coli, and the second type of particle comprises a second adhesion moiety that is capable of recognising and binding to a second cognatemoiety selected from said group, wherein the first and second adhesion moieties different from each other. 13.ThecompositionormethodofParagraph12,wherein thefirst andsecondcognatemoietiesaredifferent fromeach other. 14. The composition or method of any preceding Paragraph, wherein the nucleic acid of each particle comprises a nucleotide sequence (N1) encoding said nuclease, wherein each particle is a synthetic T-even phage (optionally a T4 phage) comprising an insertion of N1 into the genome of the phage, wherein the region is between the pin (protease inhibitor) gene and the iPII (internal protein) gene. 15. The composition ormethod of any precedingParagraph, wherein said nuclease is a guided nuclease, optionally a Cas, meganuclease, zinc finger nuclease or TALEN. 16. The composition or method of any preceding Paragraph, wherein the nuclease is a Type I, II, III, IV, V or VI nuclease, optionally a Cas9 or a Cas3. 17.Thecompositionormethodof anyprecedingParagraph,whereinat least 1 x107PFUofparticlesareadministered to the subject. 18. The composition or method of any preceding Paragraph, wherein the particles are administered to the subject at an MOI (multiplicity of infection) of at least 0.01. 19. The composition or method of any preceding Paragraph, wherein the strain or at least one strain is an antibiotic- resistant or MDR strain: and / or wherein the strain or at least one strain is a B2-I strain. 20. The composition or method of Paragraph 19, wherein the antibiotic is fluoroquinolone (optionally levofloxacin), carbapenem or vancomycin; and / or wherein the E coli are beta-lactamase (ESBL)‑producing E coli. 21. The composition or method of any preceding Paragraph, wherein (i) the nuclease is a Cas, (ii) each particle comprises a phage capsid containing the nucleic acid; and (iii) wherein a first type of transduction particle and a second type of transduction particle are administered to the subject, wherein the first type of particle comprises a first adhesion moiety that is capable of recognising and binding to a first cognatemoiety selected from thegroupLPS, LamBandTsxdisplayedonB2 strainE coli,and the second type of particle comprises a second adhesion moiety that is capable of recognising and binding to a second cognate moiety selected from said group, wherein the first and second adhesion moieties different from each other. 22. Amethod for treating or preventing an infection byE coli cells in a humanor animal subject, themethodcomprising administering to the subject a plurality of transduction particles, wherein (a) eachparticle comprisesanucleic acidencodingacrRNAorguideRNA that is operablewithaCasnuclease for chromosomal targeting in thecells,wherein the saidadministeredparticlescontact the cells and introduce therein the nucleic acid, wherein the crRNA or guide RNA is expressed and guides the Cas nuclease wherein the nuclease cuts the chromosomesof the cells, thereby killing the cells or reducinggrowth or proliferationof the cells in the subject; (b) the E coli cells are cells of E coli phylogroup B2; and (c) each particle comprises an adhesion moiety for recognising and binding to a cognate moiety selected from a LPS, LamB and Tsx displayed on the surface of the phylogroup B2 E coli cells. 23. The method of Paragraph 22, wherein the method is according to any one of Paragraphs 1‑20, optionally except that the nuclease is an endogenous nuclease of the cells and is not encoded by the nucleic acid comprised by the particles. 22 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 24. A composition comprising a plurality of transduction particles for use in a method of treating or preventing an infection by E coli cells in a human or animal subject according to Paragraph 22 or 23, wherein (a) eachparticle comprisesanucleic acidencodingacrRNAorguideRNA that is operablewithaCasnuclease for chromosomal targeting in thecells,wherein the saidadministeredparticlescontact the cells and introduce therein the nucleic acid, wherein the crRNA or guide RNA is expressed and guides the Cas nuclease wherein the nuclease cuts the chromosomesof the cells, thereby killing the cells or reducinggrowth or proliferationof the cells in the subject: (b) the E coli cells are cells of E coli phylogroup B2; and (c) each particle comprises an adhesion moiety for recognising and binding to a cognate moiety selected from a LPS, LamB and Tsx displayed on the surface of the phylogroup B2 E coli cells. 25. The composition or method of any preceding Paragraph for preventing the translocation of B2 phylogroup E coli from the gastrointestinal or urinary tract to the blood stream of the subject, thereby preventing or reducing bacteriaemia in the patient. 26. A method of detecting the presence of a B2 phylogroup E coli in a sample, the method comprising contacting the sample comprising B2 phylogroup E coli with a composition comprising a plurality of transduction particles, wherein (a) each particle comprises a nucleic acid encoding a nuclease for targeting the genomes of said E coli cells, wherein the said administered particles contact the cells and introduce therein the nucleic acid, wherein the nuclease isexpressed in thecells andcutsgenomicDNAof thecells, therebykilling thecells or reducinggrowthor proliferation of the cells in the subject; (b) each particle comprises an adhesion moiety for recognising and binding to a cognate moiety selected from a LPS, LamB and Tsx displayed on the surface of the phylogroup B2 E coli cells; and (c) themethod comprises detecting that B2 phylogroupE coli cells have been killed or the growth or proliferation thereof has been reduced. 27. A method of detecting the presence of a B2 phylogroup E coli in a sample, the method comprising contacting the sample comprising B2 phylogroup E coli with a composition comprising a plurality of transduction particles, wherein (a) each particle comprises a nucleic acid comprising or encoding a detectable label, wherein the said administered particles contact the cells and introduce therein the nucleic acid, wherein optionally the label is expressed in the cells; (b) each particle comprises an adhesion moiety for recognising and binding to a cognate moiety selected from a LPS, LamB and Tsx displayed on the surface of the phylogroup B2 E coli cells; and (c) the method comprises detecting B2 phylogroup E coli cells comprising the label. 28. Themethod of Paragraph 26 or 27, wherein the composition comprises the features of the composition of any one of Paragraphs 1, 2‑21 24 and 25. 29. Themethod of any one of Paragraphs 26‑28, wherein theE coli comprise one ormoreE coli strains selected from the group ST131, ST1193, ST648, ST315, ST405, ST361, ST88 and ST453. 30. The method of any one of Paragraphs 26‑29, wherein the sample is a patient sample (eg, blood, urine, stool or saliva sample), wherein the subject is a transplant or cancer patient (optionally a haematological cancer patient), or wherein thepatient is suffering fromor at risk of a urinary tract infection (UTI); andoptionallywherein the transplant is a solid organ or stem cell transplant (optionally a haematopoietic cell transplant). 31. The method of any one of Paragraphs 26‑30, wherein the nucleic acid of each particle comprises a nucleotide sequence (N1) encoding said nuclease, or comprising or encoding the label wherein each particle is a synthetic T- even phage (optionally a T4 phage) comprising an insertion of N1 into the genome of the phage, wherein the region is between the pin (protease inhibitor) gene and the iPII (internal protein) gene. 32. The method of any one of Paragraphs 26‑31, wherein at least 1 x 107 PFU of particles are contacted with the sample. 33. The method of any one of Paragraphs 26‑32, wherein the particles are contacted with the sample at an MOI 23 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 (multiplicity of infection) of at least 0.01.

[0189] It will be understood that particular embodiments described herein are shown by way of illustration and not as limitations of the invention. The principal features of this invention can be employed in various embodiments without departing from the scope of the invention. Those skilled in the art will recognize, or be able to ascertain using nomore than routine study, numerous equivalents to the specific procedures described herein. Such equivalents are considered to be within the scope of this invention and are covered by the claims. All publications and patent applicationsmentioned in the specification are indicative of the level of skill of those skilled in the art to which this invention pertains. All publications and patent applicationsandallUSequivalent patent applicationsandpatents areherein incorporatedby reference to the same extentas if each individual publicationorpatentapplicationwasspecificallyand individually indicated tobe incorporatedby reference. Reference is made to the publications mentioned herein and equivalent publications by the US Patent and Trademark Office (USPTO) or WIPO, the disclosures of which are incorporated herein by reference for providing disclosure that may be used in the present invention and / or to provide one or more features (eg, of a vector) that may be included in one or more claims herein.

[0190] The use of the word "a" or "an" when used in conjunction with the term "comprising" in the claims and / or the specificationmaymean "one," but it is also consistent with themeaning of "one or more," "at least one," and "one or more than one." The use of the term "or" in the claims is used tomean "and / or" unless explicitly indicated to refer to alternatives only or the alternatives aremutually exclusive, although the disclosure supports a definition that refers to only alternatives and "and / or." Throughout this application, the term "about" is used to indicate that a value includes the inherent variation of error for the device, the method being employed to determine the value, or the variation that exists among the study subjects.

[0191] As used in this specification and claim(s), the words "comprising" (and any form of comprising, such as "comprise" and "comprises"), "having" (and any form of having, such as "have" and "has"), "including" (and any form of including, such as "includes" and "include") or "containing" (and any form of containing, such as "contains" and "contain") are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.

[0192] The term "or combinations thereof" or similar as used herein refers to all permutations and combinations of the listed itemspreceding the term.Forexample, "A,B,C,or combinations thereof is intended to includeat least oneof:A,B,C, AB, AC, BC, or ABC, and if order is important in a particular context, also BA, CA, CB, CBA, BCA, ACB, BAC, or CAB. Continuing with this example, expressly included are combinations that contain repeats of one or more item or term, such as BB, AAA, MB, BBC, AAABCCCC, CBBAAA, CABABB, and so forth. The skilled artisan will understand that typically there is no limit on the number of items or terms in any combination, unless otherwise apparent from the context.

[0193] Any part of this disclosure may be read in combination with any other part of the disclosure, unless otherwise apparent from the context.

[0194] All of the compositions and / or methods disclosed and claimed herein can bemade and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variationsmay be applied to the compositions and / or methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.

[0195] The present invention is described in more detail in the following non-limiting Examples. EXAMPLES EXAMPLE 1: Particle Composition for surprisingly targeting a plurality of different E coli strains, including B2 phylogroup Overview

[0196] Patient samples containing various different E coli strains were challenged with a particle composition. The composition comprisedaplurality of transductionparticlesbearingadhesionmoieties that areable tobind toLPS,LamBor Tsxpresent onE coli cells. Theparticles comprised capsids comprising phagecapsid proteins,with the capsids containing nucleic acids encodingCRISPR / Cas systems for chromosomal targeting inE coli.Eachnucleic acid encodeda plurality of different cRNAs comprising spacer sequences that targetE coli chromosomal genes. The ability to kill or reduce growth of E coli in the samples was determined using a plaque assay as described below.Whole genome sequencing and genome assemblywere used to assign susceptibleE coli strains to phylogroups. It was surprisingly seen that use of such a particle composition was able to very effectively and extensively target a plurality of different E coli strains (these strains being clinically relevant from actual patient samples). Furthermore, advantageously a large number of different strains of the B2 24 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 phylogroup were targeted and killed. This is significant, because B2E coli strains often display antibiotic resistance (such as MDR), eg, resistance to fluoroquinolone, that causes potentially life-threating infections in patients, such as in cancer, transplant and UTI patients. In addition to the B2 group, we surprisingly also were able to successfully kill or inhibit the growth of multiple strains of E coli phylo groups B1, D, F and G. Patient Sampling

[0197] The samples tested (n=71)were obtained from twoprospective observational studies enrolling adult (≥18 years) patients who were admitted to hospital for an autologous or allogenic hematopoietic cell transplantation (HCT) and who received levofloxacin (a fluoroquinolone, FQ) prophylaxis starting the day before the transplantation (Day ‑1) (Satlin 2021 and Satlin 2018). Trimethoprim-sulfamethoxazole (TMP-SMX) was administered to allogenic HCT recipients from 2 to 4 days prior to the HCT. The antibiotic treatments do not eradicate all E coli in the patients: for example, fluoroquinolone- resistantE coliwould persist and thus sampling obtainedE coli from patients.E coli isolates were derived from either anal swabs or fecal samples obtained upon admission for transplantation. The timing of sampling varied from Day ‑7 (7 days before transplantation) to Day 0 (the day of transplantation). General Plaque Assay: Spotting for Coverage

[0198] This procedure describes the method to assess the coverage of phage particle lysates on a panel of bacterial strains. Section Procedure Step 1 Prepare bacterial indicator strains by inoculating 5µl of a frozen stock into 250µl of LB broth on a 96 well plate. Incubate overnight at 37°C and 250 rpm. This step is done the day before the assay is performed. Step 2 Pre-acclimatize the LB plates to room temperature. Melt and acclimatize the top agar to 55°C and add CaCl2 and MgSO4 to a final concentration of 5 mM. Step 3 In a culture tube mix 100 ml of the overnight indicator strain with 3 ml of pre-warmed top agar. When working with many strains, the top agar can be distributed to culture tubes and kept at 60 °C before use. Step 4 Pour the mixture on top of the room temperature LB plate and distribute evenly by swirling. Let plates solidify in a biosafety cabinet or lab bench for 5‑10 minutes. Keep the lids closed. While soli- difying avoid stacking plates to keep the layer of the top agar even across the plate surface Step 5 In the meantime, dilute the sample(s) or the stock of phage to the required dilutions (10-fold dilutions). Use PBS for dilutions. Step 6 Spot dilutions 0 to ‑9, 5µl of each on top of your overlays and let them dry for 20 minutes (or until the spots are completely absorbed by the agar) on a bench with the lids open. Incubate plates upside down at 37°C overnight. Step 7 Evaluation of the results: 1. If visible plaques appear, they are counted, and phage concentration is calculated. The result is recorded as YES. Calculation of phage concentration: number of plaques x 200 (to make it into ml) x dilution where you counted. i.e: If counted 5 plaques on dilution - 6: 5 x 200 x 1e6 = 1e9 pfu / ml 2. If there are no visible plaques, but inhibition of growth is observed the result is recorded as LZ (lysis zone) and the lowest dilution of inhi- bition is noted. 25 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Section Procedure 3. If no plaques or inhibition is observed, the result is recorded as NO

[0199] Spotting was performed according to the above general plaque assay. Bacterial strains were prepared by inoculating 5µl of a frozen stock into 250µl of LB broth in a 96 well plate. The plate was incubated at 37°C and 250 rpm overnight. Next day, in a culture tube 100ml of the overnight strain was mixed with 3 ml of pre-warmed top agar (at 55°C) containing 5mM CaCl2 and 5mM MgSO4. The mixture was poured on top of pre-acclimatized LB plate and distributed evenly by swirling. The plates were left on the lab bench for 5‑10 minutes to solidify. In the meantime, the particle composition was diluted in PBS buffer from 100 to 10‑9 and 5µL of each serial dilution were spotted on top of the overlays. Plates were left on the bench with the lid open for 20 minutes or until the spots are completely absorbed by the agar, and then incubated upside down at 37°C overnight. Evaluation of the results:

[0200] If visible plaques appeared, the results were recorded as positive, plaques were counted, and phage concen- tration was calculated. Calculation of phage concentration: number of plaques x 200 x dilution where plaques were observed. i.e: If counted 5 plaques on dilution - 6: 5 x 200 x 1e6 = 1e9 pfu / ml

[0201] If there were no visible plaques, but inhibition of growth was observed, the result was recorded as lysis zone and the lowest dilution of inhibition is noted.

[0202] If no plaques or inhibition was observed, the results were recorded as negative. Whole genome sequencing

[0203] DNAextractionwasperformedusingOmegaBio-tek,Mag-BindBacterialDNA96Kit. Theprotocolwas followed, and samples were eluted in 100µL Elution Buffer.

[0204] Sequencing libraries were generated using Illumina Nextera XT, and sequencing was performed with paired ends on an IlluminaMiSeq instrument with a V2 flow cell (300 cycles). The average sequencing depth for all samples was 48x (range: 31‑72x) Genome assembly and phylogenetic tree reconstruction

[0205] Raw data was trimmed for adaptor sequences and low-quality bases using fastp 0.22.0 (Chen et al 2018). Genomes were assembled using SKESA 2.4.0 (Souvorov et al 2018). The phylogroup of each sample was determined using EzClermont 0.7.0 (https: / / github.com / nickp60 / EzClermont). Genomic distances were estimated using Mash 1.1 (Ondov et al 2016) with a kmer size of 17 and 1000 sketches. A neighbour joining treewas constructed using rapidnj 2.3.2 (Simonsenet al 2008). Thefinal tree visualizationwasgenerated in InteractiveTreeOf Life (iTOL) version 6.5.3 (Letunic et al 2021).Strainphylotypingwascarriedout in silicousing themethoddisclosed inMicrobGenom.2018Jul; 4(7): e000192, Published online 2018 Jun 19. doi: 10.1099 / mgen.0.000192, PMCID: PMC6113867, PMID: 29916797, "ClermonTyping: an easy-to-use and accurate in silico method for Escherichia genus strain phylotyping, Johann Beghain et al. The set of primer sequences described in Table S1 of that reference (available in the online version of this article) was used. Results

[0206] It was surprisingly seen that use of such a particle compositionwas able to very effectively and extensively target a plurality of different E coli strains (these strains being clinically relevant from actual patient samples), see Figure 1. Furthermore (see Figure 2), advantageously a large number of different strains of the B2 phylogroup were targeted and killed. This is significant, because B2 E coli strains often display antibiotic resistance (such as MDR), eg, resistance to fluoroquinolone, that causes potentially life-threating infections in patients, such as in cancer, transplant andUTI patients. More than 10 different ST131 strains were killed (plaques formed) and more than 10 different ST1193 strains were killed (plaques formed). Sequence type 1193 has recently emerged as a new, virulent and resistant lineage among fluoroqui- nolone resistantE coli.EscherichiacoliST131 isaglobally dominantmultidrug resistant cloneassociatedwithhigh ratesof rUTI. Uropathogenic E coli (UPEC) are the primary cause of urinary tract infection (UTI), being responsible of ~90% of all cases. UPEC strains largely belong to theE coli phylogenetic groups B2 or D and are often clonal, with themost common sequence types (STs) isolated worldwide being ST69, ST73, ST95 and ST1312. The recently emerged and globally disseminated ST131 clone is a major contributor to hospital‑ and community-acquired UTI, as well as bloodstream 26 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 infections and infections in companion animals and poultry. Originally identified in 2008, ST131 is associated with the worldwide spreadof theCTX-M‑15extendedspectrumβ-lactamase (ESBL) resistancegene.MostST131strains arenow strongly associated with multidrug resistance (MDR), including resistance to fluoroquinolones. Recent reports have also identified strains that are resistant to last-line carbapenems.

[0207] Significantly, we included clinical samples from patients that went on to developE coli bacteraemia (despite pre- treatment with FQ / TMP-SMX). The composition could kill or reduce growth of E coli strains in these samples (and this is indicative of the possibility of using the composition for prophylaxis of bacteraemia in subjects). This includedstrains of the following Multi-Locus Sequence Typing (MLST) types (see Figure 2): ST648, ST315, ST405, ST361, ST88, ST453, ST1193 and ST131.

[0208] In addition to the B2 group, we surprisingly also were able to successfully kill or inhibit the growth of multiple strains of E coli phylo groups B1, D, F and G. References

[0209] • Shifu Chen, Yanqing Zhou, Yaru Chen, Jia Gu; fastp: an ultra-fast all-in-one FASTQ preprocessor, Bioinformatics, Volume 34, Issue 17, 1 September 2018, Pages i884-i890, https: / / doi.org / 10.1093 / bioinformatics / bty560 • Alexandre Souvorov, Richa Agarwala and David J. Lipman. SKESA: strategic k-mer extension for scrupulous assemblies. Genome Biology 2018 19:153. doi.org / 10.1186 / s13059‑018‑1540-z • Ondov, B.D., Treangen, T.J., Melsted, P. et al. Mash: fast genome and metagenome distance estimation using MinHash. Genome Biol 17, 132 (2016). https: / / doi.org / 10.1186 / s13059-016-0997-x • Martin Simonsen, Thomas Mailund and Christian N. S. Pedersen. Rapid Neighbour Joining. Proceedings of the 8th Workshop in Algorithms in Bioinformatics (WABI), LNBI 5251, 113‑122, Springer Verlag, October 2008. doi:10.1007 / 978‑3‑540‑87361‑7_10 • Letunic I and Bork P (2021) Nucleic Acids Res doi: 10.1093 / nar / gkab301 Interactive TreeOf Life (iTOL) v5: an online tool for phylogenetic tree display and annotation • Michael J. Satlin et al, Colonization with Fluoroquinolone-resistant Enterobacterales decreases the effectiveness of fluoroquinolone prophylaxis in hematopoietic cell transplant recipients. Clinical Infectious Diseases 2021. • Michael J. Satlin et al, Colonization with Levofloxacin-resistant extended-spectrum β-lactamase-producing Enter- obacteriaceae and risk of bacteremia in hematopoietic cell transplant recipients. Clinical Infectious Diseases 2018. EXAMPLE 2: Phage-derived CRISPR therapeutic designed to reduce E. coli in hematological cancer patients ABSTRACT

[0210] Patients with hematological malignancies frequently develop bloodstream infections due to translocation of E. coli and other bacteria from the gut. Antibiotic treatment to prevent these infections has detrimental effects on the microbiome and immune tonus and is further hampered by increasing antibiotic resistance, in particular towards fluroquinolones. We screened a library of 162 wild-type (WT) phages identifying 8 phages with broad coverage of E. coli.Selected phages were engineered with novel tail fibers and a CRISPR-Casmachinery targeting clinically relevantE. coli.Engineered phages target bacteria in biofilms, reduce the emergence of phage-tolerantE. coli and out-compete their ancestral WT phages in co-culture experiments. SNIPR001 comprises four engineered bacteriophages with broad host- range across the E. coli phylogeny, including multi-drug resistant strains. SNIPR001 is well-tolerated in animals and reducesE. coli load in themurine gut better than its constituent components. SNIPR001 represents a novelCRISPR-Cas- therapeutic designed to selectively target E. coli which may cause fatal infections in hematological cancer patients. INTRODUCTION

[0211] Cancer treatment continues to advance and survival rates for people with hematological malignancies are increasing1. However, the chemotherapeutic regimens that are frequently used in this immunocompromised population cause bone marrow suppression and gastrointestinal mucositis with associated increased intestinal permeability2‑4. 27 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 Translocation of gut bacteria, including E. coli, from the gastrointestinal tract is a frequent cause of bloodstream infections5.

[0212] The mortality related to bloodstream infections caused by enteric bacteria such as E. coli is 15‑20%6; thus, antimicrobial prophylaxis is applied in people at risk of febrile neutropenia7. There are no approved therapies for the prevention of bloodstream infections in patients with hematological cancers, yet fluoroquinolones are used off-label in the United States based on two randomized trials that demonstrated that they decrease bacterial infections during neu- tropenia7,8,9. Beyond the side effects of fluoroquinolones, including safety warnings and precautions, bacterial resistance is rising in oncologypatients andapproaching60% inE. colibloodstream infections in theUSA10. In immunocompromised patients with hematological malignancies who develop chemotherapy-induced neutropenia, E. coli is responsible for 25.1‑30%ofall bacteremia cases11,12.Moreover, up to65%ofE. coli isolatedas thecausativepathogen frombloodstream infections5 in patients with hematological cancers undergoing hematopoietic stem cell transplantation were resistant to fluoroquinolones13. Accordingly, novel narrow-spectrum prophylactic options that would also cover fluroquinolone resistant E. coli are needed to prevent infections in these vulnerable patients.

[0213] Bacteriophage therapy has been used prior to the broad availability of antibiotics14, but has now re-gained interest15 due to the rise in bacterial antimicrobial resistance combined with several successful individual case re- ports16‑18. Still, few clinical trials with wild-type (WT) phages have been conducted19‑22 and, although several have been directed towardsE. coli, these have failed to produce convincing results in larger randomized controlled trials likely due to incomplete coverage of the target strains by the phage cocktail23. Recent efforts have involved more extensive characterization of phages (n = 41) targeting Klebsiella pneumoniae strains (n = 17)24 and phages (n = 248) targeting Vibrio strains (n = 294)25 suggesting that better coverage of target strains can be achieved with large scale systematic screening. Synthetic biology has also been used to engineer T3 phage tailfibers augmenting the spectrum of strains targeted by the engineered phage26. Finally, clustered regularly interspaced short palindromic repeats (CRISPR)‑Cas systems can contribute to efficacy as a complementary killing modality to the lytic activity of the phage. CRISPR- associated nucleases (Cas) and a CRISPR-RNA form a complex, which, in some CRISPR-Cas systems, can bind to a homologous DNA target sequence and result in DNA degradation27,28. Since prokaryotes lack error-prone non-homo- logous end-joining and rely solely on homologous recombination to repair DNA damage, they are prone to cell death following DNA degradation. This vulnerability has been exploited by using CRISPR-Cas as an antimicrobial modality for several bacteria, including Staphylococcus aureus, E. coli or Clostridium difficile 29‑35.

[0214] To address the significant unmet medical need for new prophylactic agents for patients with hematological malignancies we report on the development of SNIPR001. Our research process for designing SNIPR001 includes several steps (Fig. 3). In short, a library (n=162)ofWTphageswere tested in vitroonapanel of phylogenetically diverseE. coli strains representing the biology of the target bacteriumE. coli.WTphageswith thebroadest andmost complementary target strain coverage were selected for further engineering. Selected WT phages were subjected to both tail fiber engineering and CRISPR-Cas-arming to create a library of CRISPR-Cas-Armed Phages (CAPs). The CAP library was assessed formanufacturability, in vitrostability, spectrumofefficacy, in vivopharmacokinetics, andefficacy.Acombination of four CAPs was selected to create the development candidate SNIPR001, which has now entered clinical development (ClinicalTrials.gov ID NCT05277350). RESULTS

[0215] Wild-type lytic phages α15, α17, α20, α48 and α51 (all members of Tevenvirinae) were the starting point for phage engineering to produce synthetic phage types (CRISPR-armed phage; CAPs) α15.2, a20.4, α48.4 or α51.5. Tail fibre specificities for cognate E coli surface ligands TSX, LPS and LamB were as follows:‑ α15.2 binds LPS and Tsx α20.4 binds LPS and LamB α48.4 binds Tsx α51.5 binds Tsx

[0216] A cocktail comprising these phage types targeting LPS, LamB and Tsx was made (herein the cocktail termed SNR001). CRISPR-Cas-arming of phages to target E. coli

[0217] ToCRISPR-Cas-arm the selected lytic phages and generate a library of CAPs, the type I-ECRISPR-Cas system 28 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 of E. coli39 was engineered to target phylogenetically diverse E. coli strains. A CRISPR-Guided Vector (CGV™) was generated, containing the cas3 gene (ygcB) and a downstream cascade gene complex composed of casA (ygcL, cas8e), casB (ygcK, cas11), casC (ygcJ, cas7), casD (ygcI, cas5),and casE (ygcH, cas6),andaCRISPRarray targetingaplurality of different genes of the E. coli genome (CGV-EcCas). To evaluate the killing efficiency of the CRISPR-Cas system, the CGV-EcCas was conjugated to E. coli strain b52, showing an average reduction of 3.5 log10 CFU / mL, compared to the empty vector. As expected, no effect was observed after conjugating the CGV-EcCas to a non-target E. coli strain. The killing efficiency of CGV-EcCaswas further assessed on an abbreviated panel of 82E. coli strains. Conjugative delivery of the empty vector was accomplished in 75% of the isolates. For all strains where the CGV-EcCas was delivered, bacterial counts were reduced below the limit of detection (LOD, 200 CFU / mL) corresponding to a reduction of 1‑6 log10, highlighting the potent CRISPR-Cas-mediated killing (Fig. 3A).

[0218] In addition to promoter PbolA, the CRISPR-Cas systems was engineered to express from a synthetic consti- tutively expressedE. colipromoter (PJ23100).CRISPRarraysweredesigned to targetmultiple virulence (spacer 1, 2and3) or essential genes (spacer 4 and 5) (SEQ ID NOs: 6‑10), as targeting multiple regions has been shown to prevent resistance evolution43. To confirm the CRISPR-Cas activity in the CAPs, we measured the cas3 transcripts in samples obtainedat 5‑, 15‑and30-min followingasynchronized infectionwith theequalMoIofCAPα15.2 in comparison toWTα15 usingRT-qPCRandobserved increasing levels of cas3RNAonly uponCAPα15.2 infection.Next,weextended this assay to all four CAPs (α15.2, α20.4, α48.4, α51.5) and demonstrated increasing levels of cas3 transcripts highlighting that the CAPs expressed the CRISPR-Cas system during infection of a target strain.

[0219] To demonstrate the competitive superiority of the CAPs, we performed competition experiments in which CAPs (α20.4 and α15.2) and their WT ancestral phages were co-cultured with E. coli strain b230, serving as target for both competing phages. Approximate initial ratios of 1CAP to 9WTphageswere co-cultured and passaged four times on fresh target cells in liquid cultures. After each passage, the relative abundance of CAP andWT phage particles was evaluated. BothCAPsoutcompeted theirWTswithin four rounds:CAPα20.4 reached68%after four rounds, andCAPα15.2 reached 86% after two rounds (Fig. 3B-C), demonstrating an improved fitness compared to the WT phages. CAP cocktail SNIPR001

[0220] The activity of CAPs was tested against the E. coli panel (n = 429) using the growth kinetics assay. To maximize our coverage,wecombinedCAPs, resulting in a composition (SNR001) comprisingphage typesα15.2,α20.4,α48.4, and α51.5.

[0221] The ancestors of CAPs α15.2, α20.4, α48.4, and α51.5 are classified under the Tevenvirinae subfamily. Specifically, ancestors α15, α48, α20 and α51 have sequence similarity to E. coli phage T2, T4 and RB69 phages as shown below (as determined by Mash analysis). In silico analyses of the genomes of SNIPR001 showed that the CAPs encode no known transposase or integrase genes, indicating that the phages are not temperate, and thus not predicted to be capable of inserting their DNA in bacterial cells. Similarity Matrix:

[0222] T2 T4 RB69 a15 96.56% 96.41% 82.60% a20 82.60% 83.20% 96.70% a48 96.74% 96.57% 81.82% a51 96.23% 96.13% 81.86%

[0223] This similaritywascalculatedwherein thedistancebetweengenomeswascalculatedusingMash (v1.1)with ak- mer size of 21 and a sketch size of 10 000.

[0224] See Ondov, B.D., Treangen, T.J., Melsted, P. et al., "Mash: fast genome and metagenome distance estimation using MinHash", Genome Biol 17, 132 (2016). https: / / doi.org / 10.1186 / s13059-016-0997-x for further discussion of Mash SNIPR001 does not affect other gut associated bacteria

[0225] Ideally, a phage-based therapy shouldnot disturb thenon-targetedgeneraof themicrobiome, thus the specificity of SNIPR001 towards E. coli was assessed by investigating its effects on a panel of strain which includes non‑E. coli specieswhich areE. coli relatives, aswell as a rangeof families associatedwith the commensal bacterial community in the gut bacteria (and E. coli as a positive control). The bacteria were cultured without CAPs, with the SNIPR001 cocktail, or 29 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 with individual SNIPR001 CAPs (n = 4). The growth in CFU / mL was evaluated over a 4-hour period (DCFU / mL4h‑0h). In parallel,E. colib2480wasgrownunder thesameconditionsasapositive control (Fig. 4).Weobservednosignificant effect (p>0.05, Student’s t-test, FDR-correctedwith Holm’smethod) of the SNIPR001 cocktail or any of the SNIPR001CAPs on non‑E. coli strains, while the growth of E. coli was significantly inhibited (p<0.05, Student’s t-test, FDR-corrected with Holm’s method). Thus, SNIPR001 is not expected to impact the gut microbiome beyond the target E. coli. In vitro host-range of SNIPR001 in clinical target population

[0226] Tounderstand the potential effect in strains relevant to hematological cancer patients the coverage ofSNIPR001 was tested against our internal E. coli panel (429 strains) and a set of 382 clinical E. coli strains (JMI Laboratories, North Liberty, IA, USA). These JMI strains originated frompatientswith bloodstream infections hospitalized in hemato-oncology units across four different regions from 2018‑2020 (Asia-Pacific 54 isolates, Europe 161 isolates, Latin America 26 isolates, and North America 141 isolates). The genotypic distribution of E. coli strains in the patient population was determined using whole genome sequencing and was found to be diverse, representing nine phylogroups and 118multi- locus sequence types (MLSTs) (Fig. 5A). Using a spotting assay, we recorded phage infectivity against the panel of JMI strains. Visible single plaques were differentiated from lysis zones in cases where single plaques could not be verified. All spotting assayswere run in duplicates.Weobserved overall coverages of 90.4± 1.6%of SNIPR001 in the 382 JMIE. coli panel, and of 95.6± 0.3% of SNIPR001 on the internal E. coli panel (429 strains). Furthermore, we observed plaques in 53.1±7.7%and lysis zones in37.3±6.1%of theJMIpanel strains, andsimilarly plaques in60.5±6.6%and lysis zones in 35.1± 6.3%of the internal panel strains (Fig. 5B). SNIPR001 showed100%coverage in theB2phylogroup, representing 53% of the JMI panel. This phylogroup is correlated with multi-drug resistance and virulence. Additionally, we observed that SNIPR001 covered 91.7% (n = 55) of strains classified asmulti-drug resistant. 100% (n = 5) of carbapenem-resistant strains, 92.2% (n = 95) of extended-spectrum β-lactamases producing strains, and 88.9% (n = 176) of strains that are resistant to fluroquinolones, such as ciprofloxacin and levofloxacin (Fig. 5C).

[0227] Finally, we validated SNIPR001 on a clinical panel (n = 72) of fluroquinolones-resistant E. coli strains that were isolated from either a fecal sample or a perianal swab from hematological cancer patients. This population represents the expectedclinical target patient populationbeingpursued (SNIPR001hasbeendesignated fast-trackstatusby theFDA).A subset of these strains gave rise to a bloodstream infection (Fig. 5D).82%of theE. coli strains (n =72)were susceptible to at least two or more of the CAPs in SNIPR001, and 93% of the strains were susceptible to the whole SNIPR001 cocktail (Fig. 5E).This data demonstrates the benefit of SNIPR001 compared to the individual CAPswith regards to improving the spectrum of efficacy. Tolerability and gastrointestinal recovery of SNIPR001 in minipigs

[0228] The tolerability and gastrointestinal recovery of SNIPR001 were evaluated in Göttingen minipigs. Blood and feces were sampled over 7 days following oral administration of 2 x 1012 PFU of SNIPR001 or vehicle. No CAPs were recovered from plasma, indicating no systemic exposure, while CAPs were recovered in the feces up to 7 days after SNIPR001 administration with a peak of 2 x 107 PFU 24h post-dosing (Fig. 6A). The minipigs exhibited no clinical signs andno significant changeswereobserved in hematology or biochemistry parameters, in particular, no changeswere seen inany immunecells, compared tovehicle treatment, supporting thatSNIPR001waswell tolerated.Similar recoverieswere obtained with the individual CAPs (Fig. 6B). In conclusion, SNIPR001 appears to be well tolerated in Göttingen minipigs with gastrointestinal recovery. Efficacy of SNIPR001 and constituent CAPs in a mouse colonization model

[0229] To assess the in vivo efficacy of the four selected CAPs in reducingE. coli,we adapted amouse gut colonization model from Galtier et al.44 for E. coli strain b17. Streptomycin was administered for 3 days to reduce Gram-negative bacteria from the mouse gastrointestinal tract, after which streptomycin administration was stopped and animals were inoculated once perorally with E. coli b17 (1 x 107 CFU). This allowed stable colonization for 3 to 4 days. Aiming at assessing theefficacyofCAPsonanestablishedcolonization, treatmentwasstarted2daysafter inoculationand thestudy was terminated on day 4 after inoculation, as the colonization starts to drop. To ensuremaximumexposure of CAPs,mice were treated with 3 daily doses, administered 8h apart, for a total of 6 doses over 2 days.

[0230] Mice were treated by oral gavage with a high, medium, or low dose (2 x 1011 PFU, 2 x 109 PFU, 1 x 107 PFU, respectively) of SNIPR001, vehicle (negative control), or gentamicin (positive control). CAP recovery in the feces ranged from 3 x 107 PFU / g in the low dose to 1 x 1010 PFU / g in the high dose, confirming successful GI passage (Fig. 6C). These levels of CAPs were associated with a significant (p<0.05, Mann-Whitney U test, FDR corrected) dose-dependent reduction in the targetE. coli population compared to vehicle treatedmice, after 24h of treatment (Day 3). At the high dose, SNIPR001 led to a 4 log10 CFU / g reduction (Fig. 6D). Despite an increased variability in bacterial recovery on day 4, 30 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 possibly due to clearance of the colonizing strain as illustrated in the vehicle group, similar reductionswere observed after 2 days of treatment (Day 4). While the medium dose did not reach statistical significance (p<0.05, Mann-Whitney U test), there was nevertheless a numerical reduction in comparison to the vehicle group. Subsequently, the efficacies of the individual CAPs were compared to the SNIPR001 cocktail in this model. In this experiment a greater reduction in the colonizationof the target strainwasobservedwithSNIPR001compared toanysingleCAP (whichshowedanumerical, but not statistically significant reduction) highlighting a benefit in efficacy from the combination (Fig. 6E).Wealso assayed the resistance profile of randomly sampled surviving bacteria and found no isolates that were resistant to the SNIPR001 cocktail. Overall, this data demonstrates the ability of SNIPR001 to decrease the target E. coli in the GI tract of colonized mice. DISCUSSION

[0231] Here we describe the development of SNIPR001 designed to target gut E. coli that frequently translocate in the bloodstream to cause bloodstream infections in patients with hematological cancers who are neutropenic. While fluoroquinolones are being used off-label, these patients continue to have a high morbidity and mortality. The use of traditional antibiotics has yielded important health benefits over the past century. However, in parallel we are now experiencing significant bacterial resistancedevelopment, and thenumber of deaths attributable to bacterial antimicrobial resistance in2019hasbeenestimated to1.27million,withE.colibeing the leadingpathogen45.Accordingly, newantibiotic modalities are needed to address both the unmet medical need of antimicrobial resistant infections in this vulnerable population. In this study we describe the development of SNIPR001 a novel development candidate with the potential to address these challenges.

[0232] Confirmation of the efficacy of SNIPR001 on a large and clinically relevant strain panels supports the clinical potential of the SNIPR001. The observed 4 log10 reduction of E. coli in our in vivomodel is a clear improvement over the previous studies4950.

[0233] SNIPR001 is an orthogonal antimicrobial approach as it has shown activity in multi-drug resistant strains. In addition, there isemergingevidence thatmaintaininganormalmicrobiome is important for upholding immunological tonus and potentially benefiting the outcome of oncology treatments51, and this has also been recognized in the most recent guidance on prophylactic management of patients at risk of febrile neutropenia7. In this context in vitro studies with SNIPR001 have shown specificity towards E. coli with no off-target effects toward any of the tested non‑E. coli strains, thereby having a less detrimental effect on themicrobiome. In the future, individualized combinations of narrow-spectrum antibiotics such as SNIPR001 may be used first line rather than use in addition to broad-spectrum antibiotics such as fluoroquinolones.

[0234] A clinical study to evaluate the ability of SNIPR001 to ascertain safety and its ability to reduce E. coli in the gut without perturbing the overall gut microbiome is currently ongoing in the US (NCT05277350). We believe that SNIPR001 exemplifies a potentially significant therapeutic advance in the field of antimicrobials for high-risk patient populations and can serve as a blueprint for narrow-spectrum therapies for other life-threatening antimicrobial resistant pathogens in high- risk patient populations. Table 1a: Overview of the four CAPs making up SNIPR001. The E. coli genes targeted by the five individual spacers and the sequence are listed in Table 1b. α15.2 comprises spacers 1, 2, 3 α20.4 comprises spacers 4, 5 α48.4 comprises spacers 4, 5 α51.5 comprises spacers 4, 5 Table 1b: The E. coli genes targeted by the five individual spacers comprised by SNR001 CAPs, and the spacer sequences used in the CAPs. spacer Target gene Spacer Sequence 1 bolA AGTGGGAAGGGTTGCAGGACACCGTCTTTGCC 2 rpoH CCGATGTTACCTTCCTGAATCAAATCCGCCTG 3 fimH CGAATGACCAGGCATTTACCGACCAGCCCATC 4 lptA TGATTGACGGCTACGGTAAACCGGCAACGTTC 5 murA GCTGTTAACGTACGTACCGCGCCGCATCCGGC 31 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 METHODS

[0235] Phage isolationwas carried out by usingE. coli strain panels. In brief, 100µL of overnight cultures of eachE. coli strainweremixedwith 100µL of each phage cocktail or wastewater samples. Following 6minutes incubation atRT (in this period infection should occur), 3 mL of pre-warmed top agar containing Ca2+ were added to the E. coli / phage or wastewater mixtures and poured immediately on a LB plate. Alternatively, 10-fold dilutions of each cocktail were spotted on lawns preparedwith isolation strains. After drying, plateswere incubated at 37 °C overnight. Plaqueswere picked from each plate and resuspended in 500 µL of SM buffer, vortexed and stored at 4 °C. Ten-fold dilutions were spotted on the isolation strain which the plaquewas originally picked from. To increase the likelihood of obtaining plaques corresponding to single phages, the procedure was repeated at least three times. Lysates were prepared from single plaques picked at the previous round of propagation, DNA was extracted, and their genomes were sequenced. E. coli panels and isolation procedures

[0236] Three E. coli panels, one in-house panel and two clinically relevant panels were included in this study. The in- house panel consisted of 429 phylogenetically diverseE. coli strains, isolated from the blood of patients with bloodstream infections and urinary tract infections, from feces of humans with no known disease, from animals and the environment. The strains cover seven different phylogroups (A, B1, B2, C, D, E, F), 114 multi-locus sequence typing (MLST) groups, serotypes (K‑ and O-type), antibiotic resistance profiles, and different geographical locations of isolation.

[0237] The JMI panel comprises of 382 strainE. coli clinical collection obtained fromJMI Laboratories (North Liberty, IA, USA). These strains were isolated from patients with bloodstream infections hospitalized in hematology and oncology units across four different regions (Asia-Pacific 54 isolates, Europe 161 isolates, Latin America 26 isolates, and North America 141 isolates), sourced through the SENTRY Antimicrobial Surveillance Program (2018‑2020), which is com- posed of a network of more than 150 medical centers in more than 28 countries worldwide (https: / / www.jmilabs.com / sentry-surveillance-program).

[0238] Finally, the panel comprising of 72 fluoroquinolone-resistantE. coli strains are isolated fromeither fecal samples or perianal swabs of hematological cancer patients hospitalized for hematopoietic cell transplantation53,54.

[0239] E. coli strains were cultivated at 37 °C in lysogeny broth (LB) at 250 rpm in liquid media or on agar plates containing 1.5% (w / v) agar. When necessary, cultures were supplemented with ampicillin (100 µg / mL), kanamycin (50 µg / mL), gentamicin (15µg / mL)or amikacin (50µg / mL).Allmedia for thegrowthof conjugationdonorE. coliJKE20155and its derivatives were supplemented with 1,6-diaminopimelic acid (DAP) (80 µg / mL) to complement their auxotrophy.

[0240] Both E. coli strain b52, which was used to produce α15.2, α48.4 and α51.5, and E. coli strain b2479, which was selected to produce α20.4, belong to phylogroup A. Strain E. coli b17 was used as colonizing strain in the in vivo efficacy models as the strain is susceptible to all SNIPR001 CAPs and is part of the SNIPR Biome strain bank. Phage screening by growth kinetics

[0241] In vitro susceptibility of the intin-houseE. colipanel (n=429) to the162WTphageswasevaluated usingagrowth kinetics assay. The assay measures the metabolic activity of a bacteria by tracking the reduction of a tetrazolium dye to a purple compound that aggregatesduringbacterial growth.Thecolorimetric readingwas recordedevery15minovera24-h period by using theOmniLog® (Biolog, Hayward, CA, USA) - adapted fromHenry et al., 201256. The inhibitory area under the curve (iAUC) was calculated from the kinetic curves over the course of the experiment and was defined as the ratio between the normalizedAUCof the phage-treated bacterial growth curve and thebacteria-only control. Susceptibility was defined at iAUC values ≥0.2. Calculation of bacterial growth inhibition using iAUC

[0242] The growth inhibitory effect of SNIPR001 was determined using growth kinetic curves constructed using the OmniLog® apparatus. To limit technical variability inmeasurement between timepoints, a cubic smoothing spline function was applied to the data in Scala using the "umontreal.ssj.functionfit" package. To identify appropriate ρ and weight variables, everycombinationofρandweight 0.1and0.5wasapplied in0.1 increments (i.e., 0.1, 0.2, ... 0.5). Thesplinewith the lowest mean absolute error was chosen for AUC calculation. The initial cumulative amount of fluorescent dye at the initial timepoint varies slightly from well to well, leading to an artificial inflation of the AUC of certain wells. Using the best smoothed square spline, the mean signal for the first 1.5 h, prior to any measurable growth, was removed from all growth curves to approximate a zero-growth signal intercept. The total incremental AUC (iAUC) was calculated as the sum of the Riemannmidpoint sums for each timepoint along the smoothed square spline. Lastly, we calculated the iAUCas iAUC=1- AUCsample / AUCControl, where AUCSample is the AUC of the spline created by a given bacteria and SNIPR001, while AUCControl refers to the AUC of the spline created with a given bacteria without a given phage or CAP, or a combination of 32 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 those. Thus, iAUC values usually lie between 0 and 1, where 0 indicates no growth inhibition and 1 indicates complete growth inhibition. Some biological and technical noise does result in iAUC values outside these bounds on occasion but is considered negligible.

[0243] Host-range was calculated as the fraction of a panel that had an 1AUC<0.2 for each repeat. Reported standard deviations were calculated as the deviance in the number of strains with an 1AUC<0.2, and then normalized to the size of the panel, by dividing the standard deviation with the size of the panel. CRISPR-Cas-arming phages to target E. coli

[0244] Phages were CRISPR-Cas-armed by using homologous recombination. We inserted the payload in the region immediately aftergene 49and togene Ewhen compared to a referencewild-typeT2phage. Thus, the the synthetic phage genomes comprised the insertion between coordinates 9000 and 21000, wherein the coordinates are the nucleotide positionscounted from thenucleotide (coordinatenumber1) immediately aftergene 49 towardsgene Ewhencompared to a referencewild-typeT2phage.Recombinationwascarriedout in bacterial cells duringphagepropagation.Cells carrieda plasmid that served as a recombination template. Recombination template plasmids carried the sequences that were aimed tobe inserted into thephagegenomebetween~200‑700bpflankingsequences thatwerehomologous to thephage sequences at the insertion site. For each phage, we inserted the Type-I-E CRISPR-Cas system endogenous to E. coli (Genbank CP032679.1), i.e., the cas3 gene (ygcB) and the downstream genes encoding the cascade complex, casA (ygcL), casB (ygcK), casC (ygcJ), casD (ygcI) and casE (ygcH), as well as a CRISPR array targeting selected E. coli sequences.ForallCAPsselected, thecasgenesoriginating fromE.coliare identical. Insertionof theCRISPR-Cassystem resulted in deletion of ~7 kbp deletion of phage DNA in the gene 49 - gene E. The sequences of the resulting CAPs were verified by NGS (BaseClear, Leiden, The Netherlands). Transduction of CGVs in biofilms

[0245] E. coli b52 cells were grown in 96-well plates, and biofilms were allowed to develop on peg lids. Each well contained 180 µL M9 medium (Sigma, M6030) supplemented with 20 mMGlucose, 2 mMMgSO4, 0.1 mM CaCl2, 0.1% Amicase (Sigma), and 0.1%mannitol. Wells were inoculated with 1µL of overnight b52 culture. The peg lid was inserted, and themicrotiter platewas incubatedstatic for 24hoursat 37 °C.Next, thepeg lidwas transferred toanewplatewith fresh mediawithoutwashing, and theplatewas incubated for anadditional 24 hours. After incubation, a newplatewasprepared with 100µLmedia and 100µL of CGV transducing particles (~108 particles) in each well (3 replicates). Biofilms grown on thepegswere rinsed3 times in sterileH20 (200µl) before transferring them to thenewplate. Theplatewas incubatedstatic for 5 hours at 37 °C.

[0246] To assay the metabolic activity of cells in the biofilms, lids were rinsed three times in sterile H20 (200 µL) before placing them in a plate with 20µLAlamarblue stain (ThermoFisher) and 180µl media in eachwell. Plates were incubated for 1.5 hours at 37 °Candmoved to amicroplate reader (SynergyH1, Biotek). Fluorescence (excitation: 560 nm; emission 590 nm) and absorbance (600 nm) was recorded for each well.

[0247] Themetabolic activitiesof thebiofilms treatedwithCGVscarrying thepromoterPbolAwere reported relative to the metabolic activities of biofilms treated with a CGV not carrying a promoter transcribing the cas genes. Plasmid and strain construction

[0248] Plasmids were constructed by InFusion HD cloning using PCR-generated DNA fragments. To construct CGV- EcCas, cas3 and cascade genes fromE. coliwere amplified and cloned into aColE1-type plasmid, pZE2157. Additionally, a3-spacerarray targetinggenes inE. coliwas included in thevectorunder thecontrol of constitutivepromoter J23100.The array contains nucleotides from the genomeofE. coli per target locus separated by direct repeats (repeat sequence, SEQ IDNO:15). Theprotospacer adjacentmotif (PAM) is locatedadjacent to the selected target sequences in thegenomeofE. coli. Transformation assays

[0249] Overnight cultures were diluted (1:100) in fresh LBmedium and grown to mid-exponential phase (OD600 ≈ 0.6). Subsequently, cells were prepared for electroporation and concentrated 50-fold in ice-cold MilliQ water. Cells were then electroporatedwithappropriateplasmids, allowed to recover for 1hat37 °C insuperoptimal broth (SOB), andplatedonLB plates supplemented with antibiotics. 33 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 Conjugation assays

[0250] Conjugation experiments assessing the transfer and killing efficiency of CGV-EcCas were established using E. coli JKE201 as the donor and E. coli clinical isolates as recipients (including target and non-target and E. coli strains as controls). Plasmidswere conjugated intoE. coli recipients by liquidmating. Briefly, overnight cultures were diluted (1:100) in freshLBmedium,grown toOD600≈0.4,washed, andsuspended in freshLB toOD600≈0.25. 125µl of donor and25µl of recipient cell suspensions were mixed for 5:1 mating in a 96-well microplate and incubated for 16 h at 37°C. The conjugationefficiencywasdeterminedbyplatingadilutionseriesof conjugation reactionsontoLBagar supplementedwith antibiotics (to select for the transconjugants). The specific killing efficiency was quantified by plating 90 µL of the conjugation reactions on selective plates. The CGV-EcCas plasmid encodes kanamycin, gentamycin, and amikacin resistance to enable selection for transconjugants. Viabilitywas calculated by countingCFUson theplates, and datawere recorded as viable cell concentration (CFU / mL). Synchronized CAP infection and cas3 expression assay

[0251] An overnight culture of the test strain in LBwas 100-fold diluted and incubated to stationary phase in LB at 37 °C with shaking, and 10-mL aliquots were subsequently separated into 50-mL falcon tubes. Each aliquot was then seeded with 50 µL of high-titer lysate of the individual CAPs, and incubation was continued under the same conditions. Additionally, a mock 10 mL LB volume for each CAPs were also seeded with 50 µL of CAP lysates and used for 0 min phage enumeration. At 5 min, 15 min and 30 min post-seeding, aliquots were collected for total RNA extraction and phage enumeration. Phage enumeration aliquots were syringe filtered (0.2 µm, Sartorious, Göttingen, Germany) and subjected to anefficiency of plating assay. For totalRNAextraction, 1mLaliquots of individual cultureswere centrifugedat 13.3k × g using a table-top centrifuge for 15s, and supernatants were discarded. Then, pellets were immediately resuspended in cold RNA Later (Thermo Fischer Scientific, AM7020) and stored at ‑20 °C until extraction. Total RNAwas extracted using a GeneElute Total RNA kit (Sigma-Aldrich, St. Louis, MO, USA) following the manufacture’s protocol for extraction of RNA from bacteria. After first elution, 1 µL of Dnase I (1U / µL) was added and incubated overnight at 37°C. The reactionwas terminatedby incubationat 70 °C for 15min. TheRNAwas re-purifiedonaGeneElute columnandeluted in 35 µL of kit elution buffer. Total RNA concentration was estimated on a NanoDrop instrument (Thermo Scientific, One / OneC), and 0.5 to 2 µg of RNA was added to a cDNA synthesis reaction containing SuperScriptIII RT enzyme (Thermo Fisher, Waltham, MA, USA) and random decamers to prime synthesis in a 20-µL reaction volume. The cDNA reactionwas diluted to 100µL inwater. Real-TimePCRwas conducted in triplicate using 5µL of cDNAas template, 10µL of Power SYBRGreenPCRMastermix (ThermoFisher) and 0.2µMof eachPCRprimer. PCRswere performedon anAB QuantStudio5 system (Applied Biosystems, Foster City, CA, USA) using the standard two-step thermocycling protocol for Power SYBR Green PCR Master Mix with 60 °C annealing / extension. The forward and reverse primers for gapA (reference gene) were 5’-cgctaacttcgacaaatatgctggc‑3’ (SEQ ID NO: 17), and 5’-aggacgggatgatgttctgggaa‑3’ (SEQ ID NO: 18), and for cas3 were 5’-caagtatgctaccaacggctaaag‑3’ (SEQ ID NO: 19) and 5’‑ ccaatcaaaatcaacgtcgagtga‑3’ (SEQ IDNO: 20). Single PCR products were confirmed for these primer pairs bymelting curve analysis. Relative levels of transcripts were estimated using 10-fold dilutions of purified PCR products as standards, and values were expressed as the ratio of cas3 to gapA transcripts. Phage competition assay

[0252] Lysates of the two phages were mixed at 9:1 (WT:CAP) ratio and the phagemixtures were added to 10ml 2xYT medium containing 10mMCaCl2 and 20mMMgCl2, and 100µL overnight ofE. coli strain b230, serving as target for both competing phages. After 2h incubation in a 37 °C shaking incubator, the cultures were centrifuged and 1 µL of the supernatant was added to a new b230 culture. The same steps were repeated twice.

[0253] The ratio of phages was assessed by PCRwith three primers, resulting in two specific products, one for theWT phage and one for the CAP. PCR products were separated on a 1% agarose gel and DNA bands were stained by SYBRsafe and visualized and quantified by the ChemiDoc XRS+ System (Model 1708265, Biorad). The background- corrected intensity of the band corresponding to theWT phage was divided by the intensity of the band corresponding to the CAP in the same lane, to obtain the ratio of the two band intensities (WT / CAP). The fraction of CAP compared to the total phagecontent (WT+CAP)weredeterminedbasedon thecalibration curve,whichwasmadebyusinga set of different mixtures of the two phages, and fitting a curve to themeasured band intensity ratios (WT / CAP). The estimated error of the reported values is less than 20%. Lawn killing assay

[0254] An overnight culture of the test strain in LB was adjusted to 109 CFU / mL. Hundred µL aliquots of CFU / mL 34 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 adjusted strain was mixed with 100 µL of 109 PFU / mL to achieve a multiplicity of infection of 1 of either CAP α15.2 or WT α15 in15mL falcon tubes,mixedwith3mLofmoltenandpre-tempered topagar andspreadonLBplates.After lawnswere solidified, plateswere incubatedat 37 °Covernight, and the total numberof surviving colonieswere counted forCAPα15.2 or WT α15 groups the next day. Assays were performed as independent biological duplicates where each experiment comprised often technical replicates. Statistical significancewas established using both replicates using aMann-Whitney U test. Generalized transduction assay

[0255] The transduction ability of each CAPwas evaluated via the generalized transduction assay. Briefly, transducing lysates were prepared by propagating each CAP on E. coli MG1655 lamB::Cm. This strain was modified from the WT MG1655 (Catalog number 700926, American Type Culture Collection, Manassas, VA, USA) to carry a chloramphenicol selectionmarker.Experimentswereconducted inparallelwith thewell characterized lyticT4phage (negative control), and its transducing mutant T4GT758 (positive control). Following this step, the WT E. coli MG1655 strain was infected at an OD600 of 0.3 with each transducing lysate at a MoI of 0.5, 0.1 and 0.01, and spread on LB plates containing chlor- amphenicol. Next day, the number of transductant colonies were recorded for eachCAP, controls and differentMOIs. The frequency of transduction was calculated as the number of transductants divided by the titer of the transducing lysate. Sequence analysis of CAPs

[0256] Sequences of the individual SNIPR001 CAPs were analyzed for the presence of antibiotic resistance, virulence genes and lysogeny associates genes (transposases and integrases) using databases (Table 2). Furthermore, phage samples were analyzed using whole genome sequencing. This typically results in >1000x coverage of the whole phage genome.Assemblies are constructed by down-sampling the data to 1000x average coverage for the phageand assemble using SKESA. To detect differences between samples and to detect non-majority mutations the raw reads were mapped back to the assembly using BWA (version 0.7.17). Table 2: List of databases used for the analysis of SNIPR001 CAP sequences Database Source Analysis ResFinder 4.1 https: / / cge.cbs.dtu.dk / service s / Re- sFinder Identification of acquired genes and / or chromosomal mutations mediating antimi- crobial resistance VirulenceFinder‑2.0 https: / / cge.cbs.dtu.dk / service s / Virulen- ceFinder / Detection of virulence genes including exotoxins PHASTER Prophage / Virus DB https: / / phaster.cal Detection of potential transposases and integrases Phage specificity assay using liquid killing assay

[0257] SNIPR001 CAPs (α15.2, α20.4, α48.4 and α51.5) and SNIPR001 killing specificity was evaluated via a biopotency assay against a panel of human-relevant, aerobic (n = 6) and anaerobic (n = 3) bacterial strains. An E. coli strain b2480, was included as positive control for phage-mediated killing (Table 3).

[0258] In brief, overnight cultures were adjusted to 106 CFU / mL in LB broth. SNIPR001 CAPs or SNIPR001 (in which each CAP was combined in equal ratio) were added at a MOI of 1 prior to incubation for 4 h. Untreated bacteria were cultured in parallel as controls for bacterial growth.CFUcountswere recordedat 0and4hpost phage-treatment, anddata are represented as Δlog10 CFU / mL by subtracting the initial inoculum (0 h) from the assay end point CFU / mL (4 h). Table 3: Panel of bacterial strains (Aerobic: n = 6, Anaerobic: n = 3, Aerobic / Anaerobic: n = 1) tested via a biopotency assay, showing Gram-type classification, growth conditions and source / ID Strain / name Gram type Growth condition Source / ID Acinetobacter baylyi Negative Aerobic ATCC 33304 Klebsiella pneumonia Negative Aerobic SNIPR Biome ID b2951 35 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Strain / name Gram type Growth condition Source / ID Enterococcus faecalis (Andrewes and Horder) Schleifer and Kipper-Balz Positive Aerobic ATCC 47077 Streptococcus thermophilus Orla-Jensen Positive Aerobic ATCC 19258 Bacillus coagulans Hammer Positive Aerobic ATCC 7050 Staphylococcus aureus subsp. Aureus Rosenbach Positive Aerobic ATCC 12600 Eubacterium limosum Eggerth Positive Anaerobic ATCC 8486 Bacteroides vulgatus Eggerth and Gagnon Negative Anaerobic ATCC 8482 Bacteroides thetaiotaomicron (Distaso) Castellani and Chalmers Negative Anaerobic ATCC 29148 E. coli Negative Aerobic / Anaerobi c Takara Cat. #636763 Spotting assay and efficiency of plating (EoP)

[0259] For counting of phage titers, phage lysates or the equal volumemix of SNIPR001CAPswere serially diluted 10- fold inSMbuffer orPBS, respectively.Bacterial lawnswerepreparedbyadding100or 300µLof bacterial overnight culture to 3 or 10mL of 0.5% top agar (containing Ca2+ andMg2+), which was vortexed briefly and poured onto a round or square LB plate. Fiveµl of the dilution series of test phages were then spotted onto lawns and left to dry at room temperature with an open lid prior to incubation at 37°C overnight. The strains b52, b2479 and b17 were used as controls of the assay and included in each round of assays.

[0260] The next day, results were assessed (Table 4). In this assay, a susceptible strain is defined as one producing plaques that are countable in PFU / mL as well as one without visible plaques but demonstrating impairment of bacterial growth (i.e., lysis zones). Coverage defines the percentage of the total number of susceptible strains. Images of all plates were recorded. Figures illustrating efficiency of plating results first had titers log10 transformed and then standard deviances and averages were calculated subsequently. The clinical panels and control strains were tested in two independent experiments. Table 4 Criteria used to evaluate results of the spot assay and define strain susceptibility following standards4659 Spot assay categories Observation Strain susceptibility to SNIPR001 Plaques Visible plaques were counted, and PFU / mL was cal- culated by multiplying with volume and dilution Susceptible strain Lysis zone Impairment of bacterial growth observed as lysis zones. No plaques are visible; the highest dilution of visible zones is recorded Susceptible strain Negative Neither plaques nor lysis zones are detected Non-susceptible strain Animals and housing

[0261] Mouse studies were performedwith female CD‑1® IGSmice (approximately 6‑7weeks of age upon arrival) from CharlesRiver (Freiburg,Germany). The animalswere housed in groups of 3 to 5mice per cagewithin a climate-controlled room (temperature 20‑23°C; relative humidity 30‑70%) under a 12:12 h light-dark cycle (illuminated 07:00‑19:00). Standard pelleted chow and tap water were available ad libitum. Animals were allowed an acclimatization period of at least 7 d before the start of the experimental procedures. 30 female Göttingenminipigs (approximately 4‑7months of age upon arrival) from Ellegaard Göttingenminipigs A / S, Denmark was used for tolerability and kinetic studies. Animals were allowed an acclimatization period of at least 14 days before the start of experiments. Pigs were housed in groups of 2 to 3 animals and given standard pig diet twice daily and tap water was available ad libitum. All procedures were conducted in accordance with guidelines from the Danish Animal Experiments Inspectorate, Ministry of Environment and Food of Denmark and in accordance with the institutional license (BioAdvice, animal license no. 2015‑15‑0201‑00540). 36 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 Mouse gut colonization model

[0262] The mouse gut colonization model was adapted from Galtier et al. (2016)44. Briefly, pre-treatment with streptomycin (5 g / L) in the drinking water was given 3 days prior inoculation with E. coli b17 to decrease the level of native bacteria. On day 0, an inoculum of 3 x 107 CFU of E. coli b17 was prepared from a frozen glycerol stock and administered to all mice in 0.25mL by oral gavage.

[0263] Treatment was administered three times daily for 2 days starting 2 days after inoculation. Right before each administration, the 4 CAPs were mixed in a 1:1:1:1 ratio to form SNIPR001 at a high, medium, or low concentration resulting in dose levels of 2 x 1011, 2 x 109 and1x107PFU.At the timeof treatment,micewereadministered0.1mLof 10% sodium bicarbonate by oral gavage followed by the oral administration of 0.3 mL of SNIPR001, saline (vehicle) or 43.5 mg / kg gentamicin. CAP recovery and tolerability studies

[0264] Göttingenminipigswere first given a cocktail of antibiotic comprising neomycin (60mg / kg, orally, once daily for 4 days) and cefquinome (2 mg / kg, intramuscular once daily for 3 days) before SNIPR001 or single CAP administration to decrease the level of Gram-negative bacteria in the GI tract and therefore limiting phage replication. Animals were then fasted overnight and lightly sedated before administration of a single CAP, or SNIPR001 cocktail, once orally at 2 x 1012 PFU in 100mL, following an oral administration of 50mL of 10% sodium bicarbonate. Fecal samples were collected daily forCAPsquantificationbyplaqueassay. In addition, for the tolerability study, blood sampleswere collected for hematology and blood chemistry analysis, including C-reactive protein, and plaque assay. Animals were closely monitored following SNIPR001 administration, and their body temperature was recorded regularly. Quantification of E. coli b17 and CAPs in feces

[0265] Fecal sampleswere homogenized and serially diluted in SMbuffer. Triplicates of 10µl of each dilution were then spottedonMcConkeyagarplates (Sigma,M7408) supplementedwith streptomycin (1mg / mL)and incubated for 12 to16h at 37 °C for E. coli enumeration.

[0266] Plaque assays were performed for enumeration of CAPs in feces samples. Briefly, homogenized samples were centrifugedat 10,000g for 10min, and the supernatantwas serially diluted. Triplicatesof 10µl of eachdilutionwere spotted on an E. coli b17 overlay and incubated for 12 to 16h at 37°C.

[0267] To quantify the presence of in vivo resistors, three colonies from each mice fecal sample in the medium dose groupat 3 different timepointswere picked from theMcConkeyagar plates.Colonieswere incubated for 12 to 16hat 37 °C in LBbrothandused tomake topagar overlays onLBagar plates. Then, platesweredried for 15minutes in theLAFbench. TheSNIPR001 cocktail, aswell as the 4 individual CAPs,were spotted as a dilution series from1 x 105PUF / mLstocks. As a control, a top agar overlay of colonization strainE. coli b17was spotted in the sameway. Plateswere left to dry in the LAF bench with the lid on and subsequently incubated upside down for 12 to 16h at 37°C. Whole Genome Sequencing of E. coli strains from JMI

[0268] Total genomic DNAwas extracted and purified using the KingFisher Cell and Tissue DNA kit (Thermo Scientific, Waltham, MA, USA) in a robotic KingFisher™ Flex Magnetic Particle Processor (Thermo Scientific) workstation.

[0269] Total genomic DNA was used as input material for library construction. DNA libraries were prepared using the Nextera XT™ library construction protocol and index kit (Illumina, San Diego, CA, USA) and sequenced on a MiSeq Sequencer (Illumina) using MiSeq Reagent Kits v3 (600 cycle). Resistance Phenotype Definitions

[0270] The extended-spectrum β-lactamase (ESBL)‑phenotype was defined for Escherichia coli as a minimum inhibitory concentration (MIC) value ≥2 mg / L for ceftriaxone, ceftazidime and / or aztreonam (https: / / clsi.org / ).

[0271] Carbapenem-resistant Enterobacterales (CRE) was defined as any isolate displaying imipenem, doripenem, and / or meropenem resistance with MIC > 2 mg / L (https: / / clsi.org / ). Assembly of whole genome sequencing data

[0272] Raw sequencing reads were trimmed using Trimmomatic60 (version 0.39) with the settings "LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36". Trimmed reads were assembled using SPAdes61 (version 3.14.1) with default settings. Contigs shorter than 500 bp or with a sequencing depth below 2x were removed from the final 37 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 assemblies. Comparative genomic methods for clinical E. coli strains

[0273] Multi-locus sequence typing (MLST) was performed using MLST262 on the assembled genomes of the E. coli bacteria using default settings, with the MLST database downloaded on July 1, 2021, from theMLST2 repository (https: / / bitbucket.org / genomicepidemiology / mlst db / src / master / ). Phylogroup classification was conducted using ClermonTyp- ing63 on the assembledE. coli genomes using default settings. Distancematrices for phylogenetic tree construction were generated using MASH64 with a k-mer size of 21 and 10,000 sketches per genome. Sketches were then compared to create the MASH-distance in a pairwise manner to create a distance matrix of E. coli genomes. Phage synteny analysis

[0274] To generate the synteny plot, wild type sequences of the four phages included in the final cocktail, plus the two closely related and well-known reference phages (RB69 AY303349.1, and T2 NC_054931.1) were annotated with RAST toextract predictedprotein sequences.All protein sequences for eachphagewerequeriedagain all other phagegenomes using tblastn (v 2.12.0), with anE-value cutoff of 1e‑10. The synteny plot was then generated using a customPython script (see Data Availability), using the drawSvg library (v 1.9.0). The plot shows the phage genomes in order of similarity and displays all tblastn hits as synteny blocks shaded by their protein identity. The proteins of the two reference phages were manually classified as belonging to each of the functional groups "DNA metabolism", "Structure" or "Other", and colored accordingly. Data processing and visualization

[0275] Figures and key statistics were generated using R version 4.1.0. For figure generation the following packages were used: RcolorBrewer v. 1.1‑2, ape v. 5.5, ggsignif v. 0.6.2, ggpubr v. 0.4.0, matrixStats 0.59, reshape2 v. 1.4.4, ggimagev. 0.3.0, herev.1.0.1, purr v. 0.3.4, ggtree65 v.3.0.2, systemfontsv. 1.0.2,Cairov. 1.5‑12.2, cowplot v. 1.1.1, reaxxl v. 1.3.1, and ggplot2 v.3.3.3. Averages and standard deviations are calculated after transforming the values to the scale shown on a given figure, e.g. when a log10 scale is used, the averages and standard deviations are calculated after log10 transformation. DATA AVAILABILITY

[0276] Data and results that were generated during this study is deposited at https: / / github.com / sniprbiome / SNIPR001_paper. Phage genome sequences are deposited at Genbank under access numbers OQ067373 - 76 CODE AVAILABILITY

[0277] All code needed to produce this study is available at https: / / github.com / sniprbiome / SNIPR001_paper. REFERENCES

[0278] 1. Pulte, D., Jansen, L. & Brenner, H. Changes in long term survival after diagnosis with common hematologic malignancies in the early 21st century. Blood Cancer J 10, 56 (2020). 2. Riley,M. et al. Epidemiology andBurden ofMucosal Barrier Injury Laboratory-ConfirmedBloodstream Infections in Bone Marrow Transplant and Hematology-Oncology Units. Am J Infect Control 45, S38 (2017). 3. Dandoy, C. E. et al. Incidence, Risk Factors, and Outcomes of Patients Who Develop Mucosal Barrier Injury- Laboratory Confirmed Bloodstream Infections in the First 100 Days After Allogeneic Hematopoietic Stem Cell Transplant. Jama Netw Open 3, e1918668 (2020). 4. Velden,W. J. F.M.,Herbers, A.H.E.,Netea,M.G.&Blijlevens,N.M.A.Mucosal barrier injury, fever and infection in neutropenic patients with cancer: introducing the paradigm febrile mucositis. Brit J Haematol 167, 441‑452 (2014). 5. Girmenia, C. et al. Incidence, Risk Factors and Outcome of Pre-engraftment Gram-Negative Bacteremia After 38 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 Allogeneic andAutologousHematopoietic StemCell Transplantation: An Italian ProspectiveMulticenter Survey. Clin Infect Dis 65, 1884‑1896 (2017). 6. Klastersky, J. et al. Bacteraemia in febrile neutropenic cancer patients. Int J Antimicrob Ag 30, 51‑59 (2007). 7. Taplitz, R. A. et al. Antimicrobial Prophylaxis for Adult Patients With Cancer-Related Immunosuppression: ASCO and IDSA Clinical Practice Guideline Update. J Clin Oncol 36, JCO.18.00374 (2018). 8. Cullen, M. et al. Antibacterial Prophylaxis after Chemotherapy for Solid Tumors and Lymphomas. New Engl J Med 353, 988‑998 (2005). 9.Bucaneve,G. et al. Levofloxacin toPreventBacterial Infection inPatientswithCancer andNeutropenia.NewEngl J Medicine 353, 977‑987 (2005). 10. See, I., Freifeld, A. G. & Magill, S. S. Causative Organisms and Associated Antimicrobial Resistance in Healthcare-Associated, Central Line-Associated Bloodstream Infections From Oncology Settings, 2009‑2012. Clin Infect Dis 62, 1203‑1209 (2016). 11. Trecarichi, E.M. et al. Current epidemiology and antimicrobial resistance data for bacterial bloodstream infections in patients with hematologic malignancies: an Italianmulticentre prospective survey. ClinMicrobiol Infec 21, 337‑343 (2015). 12. Marin, M. et al. Factors influencing mortality in neutropenic patients with haematologic malignancies or solid tumours with bloodstream infection. Clin Microbiol Infec 21, 583‑590 (2015). 13. Averbuch, D. et al. Antimicrobial Resistance inGram-Negative RodsCausing Bacteremia in Hematopoietic Stem Cell Transplant Recipients: Intercontinental Prospective Study of the Infectious Diseases Working Party of the European Bone Marrow Transplantation Group. Clin Infect Dis 65, 1819‑1828 (2017). 14. Mi dzybrodzki, R. et al. Bacteriophages. 1‑31 (2018) doi:10.1007 / 978‑3‑319‑40598‑8_31‑1. 15. Mi dzybrodzki, R. et al. Bacteriophages. 921‑951 (2021) doi:10.1007 / 978‑3‑319‑41986‑2_31. 16.Schooley,R. T. et al. Development andUseofPersonalizedBacteriophage-BasedTherapeuticCocktails ToTreat a Patient with a Disseminated Resistant Acinetobacter baumannii Infection. Antimicrob Agents Ch 61, (2017). 17. Dedrick, R. M. et al. Engineered bacteriophages for treatment of a patient with a disseminated drug resistant Mycobacterium abscessus. Nat Med 25, 730‑733 (2019). 18. Jennes, S. et al. Use of bacteriophages in the treatment of colistin-only-sensitive Pseudomonas aeruginosa septicaemia in a patient with acute kidney injury-a case report. Crit Care 21, 129 (2017). 19. Jault, P. et al. Efficacy and tolerability of a cocktail of bacteriophages to treat burn wounds infected by Pseudomonas aeruginosa (PhagoBurn): a randomised, controlled, double-blind phase 1 / 2 trial. Lancet Infect Dis 19, 35‑45 (2018). 20. Sarker, S. A. et al. Oral Phage Therapy of Acute Bacterial Diarrhea With Two Coliphage Preparations: A Randomized Trial in Children From Bangladesh. Ebiomedicine 4, 124‑137 (2016). 21. Leitner, L. et al. Intravesical bacteriophages for treatingurinary tract infections inpatientsundergoing transurethral resection of the prostate: a randomised, placebo-controlled, double-blind clinical trial. Lancet Infect Dis 21, 427‑436 (2020). 22. Sabino, J., Hirten, R. P. &Colombel, J. Review article: bacteriophages in gastroenterology-from biology to clinical applications. Aliment Pharm Therap 51, 53‑63 (2020). 23. Górski, A., Borysowski, J. &Mi dzybrodzki, R. Phage Therapy: Towards a Successful Clinical Trial.Antibiotics 9, 39 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 827 (2020). 24. Federici, S. et al. Targeted suppression of human IBD-associated gutmicrobiota commensals by phage consortia for treatment of intestinal inflammation. Cell 185, 2879‑2898.e24 (2022). 25. Kauffman, K.M. et al. Resolving the structure of phage-bacteria interactions in the context of natural diversity. Nat Commun 13, 372 (2022). 26. Yehl, K. et al. Engineering Phage Host-Range and Suppressing Bacterial Resistance through Phage Tail Fiber Mutagenesis. Cell 179, 459‑469.e9 (2019). 27. Westra, E. R. et al. CRISPR Immunity Relies on the Consecutive Binding and Degradation of Negatively Supercoiled Invader DNA by Cascade and Cas3. Mol Cell 46, 595‑605 (2012). 28. Sinkunas, T. et al. Cas3 is a single-stranded DNA nuclease and ATP-dependent helicase in the CRISPR / Cas immune system. Embo J 30, 1335‑1342 (2011). 29. Bikard, D. et al. Development of sequence-specific antimicrobials based on programmable CRISPR-Cas nucleases. Nat Biotechnol 32, 1146‑1150 (2014). 30. Citorik, R. J., Mimee, M. & Lu, T. K. Sequence-specific antimicrobials using efficiently delivered RNA-guided nucleases. Nat Biotechnol 32, 1141‑1145 (2014). 31. Selle, K. et al. In Vivo Targeting of Clostridioides difficile Using Phage-Delivered CRISPR-Cas3 Antimicrobials. Mbio 11, e00019‑20 (2020). 32. Neil, K. et al. High-efficiency delivery of CRISPR-Cas9 by engineered probiotics enables precise microbiome editing. Mol Syst Biol 17, e10335 (2021). 33. Edgar, R. & Qimron, U. The Escherichia coli CRISPR system protects from λ lysogenization, lysogens, and prophage induction. J Bacteriol 192, 6291‑4 (2010). 34. Hsu, B. B. et al. In situ reprogramming of gut bacteria by oral delivery. Nat Commun 11, 5030 (2020). 35. Yosef, I., Manor, M., Kiro, R. & Qimron, U. Temperate and lytic bacteriophages programmed to sensitize and kill antibiotic-resistant bacteria. Proc National Acad Sci 112, 7267‑7272 (2015). 36. Ochman, H. & Selander, R. K. Standard reference strains of Escherichia coli from natural populations. J Bacteriol 157, 690‑3 (1984). 37. Oechslin, F. Resistance Development to Bacteriophages Occurring during Bacteriophage Therapy. Viruses 10, 351 (2018). 38. Dunne, M. et al. Salmonella Phage S16 Tail Fiber Adhesin Features a Rare Polyglycine Rich Domain for Host Recognition. Structure 26, 1573‑1582.e4 (2018). 39. Brouns, S. J. J. et al. Small CRISPRRNAsGuide Antiviral Defense in Prokaryotes. Science 321, 960‑964 (2008). 40. Knight, D. & Girling, K. Gut flora in health and disease. Lancet 361, 1831 (2003). 41. Christensen, S. K., Mikkelsen, M., Pedersen, K. & Gerdes, K. RelE, a global inhibitor of translation, is activated during nutritional stress. Proc National Acad Sci 98, 14328‑14333 (2001). 42. Vieira, H. L. A., Freire, P. & Arraiano, C. M. Effect of Escherichia coli Morphogene bolA on Biofilms. Appl Environ Microb 70, 5682‑5684 (2004). 43. Uribe, R. V. et al. Bacterial resistance to CRISPR-Cas antimicrobials. Sci Rep-uk 11, 17267 (2021). 40 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 44. Galtier, M. et al. Bacteriophages to reduce gut carriage of antibiotic resistant uropathogens with low impact on microbiota composition. Environ Microbiol 18, 2237‑2245 (2016). 45. Antimicrobial Resistance Collaborators. Global burden of bacterial antimicrobial resistance in 2019: a systematic analysis. Lancet 399, 629‑655 (2022). 46. Hyman, P. & Abedon, S. T. Bacteriophage host range and bacterial resistance. Adv Appl Microbiol 70, 217‑48 (2010). 47. Lemay, M.‑L., Renaud, A., Rousseau, G. & Moineau, S. Targeted Genome Editing of Virulent Phages Using CRISPR-Cas9. Bio-protocol 8, e2674 (2018). 48. Yehl, K. et al. Engineering Phage Host-Range and Suppressing Bacterial Resistance through Phage Tail Fiber Mutagenesis. Cell 179, 459‑469.e9 (2019). 49. Selle, K. et al. In Vivo Targeting of Clostridioides difficile Using Phage-Delivered CRISPR-Cas3 Antimicrobials. Mbio 11, e00019‑20 (2020). 50. Lam, K. N. et al. Phage-delivered CRISPR-Cas9 for strain-specific depletion and genomic deletions in the gut microbiome. Cell Reports 37, 109930‑109930 (2021). 51. Lee, K. A. et al. The gut microbiome: what the oncologist ought to know. Brit J Cancer 125, 1197‑1209 (2021). 52. Gencay, Y. E., Ayaz, N. D., Copuroglu, G. & Erol, I. Biocontrol of Shiga Toxigenic Escherichia coli O157:H7 in Turkish Raw Meatball by Bacteriophage. J Food Safety 36, 120‑131 (2016). 53. Satlin, M. J. et al. ColonizationWith Fluoroquinolone-Resistant Enterobacterales Decreases the Effectiveness of Fluoroquinolone Prophylaxis in Hematopoietic Cell Transplant Recipients. Clin Infect Dis 73, 1257‑1265 (2021). 54. Satlin, M. J. et al. Colonization With Levofloxacin-resistant Extended-spectrum β-Lactamase-producing Enter- obacteriaceae andRisk of Bacteremia in Hematopoietic StemCell Transplant Recipients. Clin Infect Dis Official Publ Infect Dis Soc Am 67, 1720‑1728 (2018). 55. Harms, A. et al. A bacterial toxin-antitoxin module is the origin of inter-bacterial and inter-kingdom effectors of Bartonella. Plos Genet 13, e1007077 (2017). 56. Henry, M. et al. Development of a high throughput assay for indirectly measuring phage growth using the OmniLogTM system. Bacteriophage 2, 159‑167 (2014). 57. Lutz,R.&Bujard,H. Independent andTightRegulationofTranscriptionalUnits inEscherichiaColi Via theLacR / O, the TetR / O and AraC / I1-I2 Regulatory Elements. Nucleic Acids Res 25, 1203‑1210 (1997). 58.Young,K.K.,Edlin,G. J.&Wilson,G.G.Genetic analysis of bacteriophageT4 transducingbacteriophages. JVirol 41, 345‑347 (1982). 59. Gibson, S. B. et al. Constructing and Characterizing Bacteriophage Libraries for Phage Therapy of Human Infections. Front Microbiol 10, 2537 (2019). 60. Bolger, A. M., Lohse, M. & Usadel, B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30, 2114‑2120 (2014). 61. Bankevich, A. et al. SPAdes: ANewGenomeAssembly Algorithmand Its Applications to Single-Cell Sequencing. J Comput Biol 19, 455‑477 (2012). 62. Larsen, M. V. et al. Multilocus Sequence Typing of Total-Genome-Sequenced Bacteria. J Clin Microbiol 50, 1355‑1361 (2012). 63. Beghain, J., Bridier-Nahmias, A., Nagard, H. L., Denamur, E. & Clennont, O. ClermonTyping: an easy-to-use and 41 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 accurate in silico method for Escherichia genus strain phylotyping. Microb Genom 4, e000192 (2018). 64.Ondov,B.D. et al.Mash: fast genomeandmetagenomedistanceestimationusingMinHash.GenomeBiol 17, 132 (2016). 65. Yu, G. Using ggtree to Visualize Data on Tree-Like Structures. Curr Protoc Bioinform 69, e96 (2020). 66. Datsenko, K. A. &Wanner, B. L. One-step inactivation of chromosomal genes in Escherichia coli K‑12 using PCR products. Proc National Acad Sci 97, 6640‑6645 (2000). 67. Hantke, K. Compilation of Escherichia coli K‑12 outer membrane phage receptors - their function and some historical remarks. Fems Microbiol Lett 367, (2020). SEQUENCES

[0279] Aminoacid sequencesarewritten inN‑ toC-terminal directionandDNAsequencesarewritten in5’ to3’ direction. PROTEIN

[0280] >LamB (SEQ ID NO: 1) >Tsx (SEQ ID NO: 2) DNA

[0281] >LamB (SEQ ID NO: 3) 42 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 >Tsx (SEQ ID NO: 4) 43 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 >NC_000866.4 Enterobacteria phage T4, complete genome (SEQ ID NO: 5) 44 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 45 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 46 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 47 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 48 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 49 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 50 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 51 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 52 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 53 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 54 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 55 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 56 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 57 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 58 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 59 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 60 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 61 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 62 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 63 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 64 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 65 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 66 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 67 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 68 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 69 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 70 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 71 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 72 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 73 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 74 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 75 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 76 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 77 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 78 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 79 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 80 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 81 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 82 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 83 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 84 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 85 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 86 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 87 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 88 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 89 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 90 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 91 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 92 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 93 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 94 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 95 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 96 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 97 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 98 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 99 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 100 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 101 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 102 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 Spacer targeting E coli fimH (SEQ ID NO: 6) CGAATGACCAGGCATTTACCGACCAGCCCATC Spacer targeting E coli bolA (SEQ ID NO: 7) 103 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 AGTGGGAAGGGTTGCAGGACACCGTCTTTGCC Spacer targeting E coli rpoH (SEQ ID NO: 8) CCGATGTTACCTTCCTGAATCAAATCCGCCTG Spacer targeting E coli lptA (SEQ ID NO: 9) TGATTGACGGCTACGGTAAACCGGCAACGTTC Spacer targeting E coli murA (SEQ ID NO: 10) GCTGTTAACGTACGTACCGCGCCGCATCCGGC Escherichia phage T2 DNA, complete sequence (NCBI Reference Sequence: NC_054931.1) (SEQ ID NO: 11) 104 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 105 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 106 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 107 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 108 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 109 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 110 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 111 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 112 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 113 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 114 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 115 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 116 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 117 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 118 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 119 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 120 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 121 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 122 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 123 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 124 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 125 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 126 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 127 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 128 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 129 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 130 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 131 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 132 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 133 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 134 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 135 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 136 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 137 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 138 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 139 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 140 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 141 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 142 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 143 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 144 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 145 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 146 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 147 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 148 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 149 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 150 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 151 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 152 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 153 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 154 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 155 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 156 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 Enterobacteria phage RB69, complete genome (GenBank: AY303349.1) (SEQ ID NO: 12) 157 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 158 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 159 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 160 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 161 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 162 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 163 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 164 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 165 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 166 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 167 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 168 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 169 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 170 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 171 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 172 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 173 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 174 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 175 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 176 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 177 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 178 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 179 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 180 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 181 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 182 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 183 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 184 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 185 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 186 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 187 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 188 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 189 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 190 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 191 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 192 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 193 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 194 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 195 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 196 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 197 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 198 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 199 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 200 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 201 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 202 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 203 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 204 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 205 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 206 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 207 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 208 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 209 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 210 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 211 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 bolA promoter sequence (SEQ ID NO: 13) PJ23100 promoter sequence (SEQ ID NO: 14) TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC Repeat Sequence (SEQ ID NO: 15) CGGTTTATCCCCGCTGGCGCGGGGAACTC Promoter sequence (SEQ ID NO: 16) TTGACGCGTAGCTCAGAGGTAGGTATAATGCTAGAAC

[0282] Aspects of the invention are disclosed in the following numbered clauses: 1. A composition comprising a plurality of different types of transduction particles, wherein each of said particles comprises a nucleic acid and said particles are capable of contacting E coli cells and introducing therein the nucleic acid, wherein (a) said nucleic acid of each particle comprises a nucleotide sequence encoding a product of interest (POI), wherein the nucleic acid is capable of expressing the POI in an E coli cell; (b) each particle comprises an adhesion moiety for recognising and binding to a cognate moiety selected from a LPS and Tsx displayed on the surface of E coli cells; and (c) saidplurality of different typesof transductionparticlescomprises (i) a first typeofparticles that compriseaLPS adhesion moiety; and (ii) a second type of particles that comprise a Tsx adhesion moiety. 2. The composition or clause 1, wherein A: each particle of the first type comprises a LPS adhesion moiety and a LamB adhesion moiety; B: each particle of the first type comprises a LPS adhesion moiety and a Tsx adhesion moiety; or C: each particle of the second type comprises a Tsx adhesion moiety but is devoid of LamB and LPS adhesion moieties. 3. The composition of clause 2, wherein the composition comprises particles according to clauses 2A, 2B and 2C. 4. The composition or method of any preceding clause, wherein each particle comprises a phage capsid containing the nucleic acid. 5. The composition of clause 4, wherein the capsid of each particle comprised by the composition is a T-even phage capsid; optionally a capsid of a T2 phage, T2-like phage, RB69 phage or a RB69-like phage. 6. The composition of any preceding clause, wherein each particle is a phage (optionally a lytic phage) or packaged phagemid. 7. The composition of any preceding clause, wherein the composition comprises at least 3 or 4 different types of transduction particles. 8. The composition of any preceding clause, wherein the nucleic acid of each particle comprises at least one nucleotide sequence (N1) encoding said POI, wherein each particle is a synthetic T-even phage comprising an insertion of N1into a Modification Permissive Region (MPR) of the genome of the phage, wherein the MPR is immediately after gene 49 and to gene E when compared to a reference wild-type T2 phage. 212 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 9. The composition of clause 8, wherein the nucleic acid comprises a DNA deletion of phage DNA in the MPR. 10. The composition of clause 8 or 9, wherein the insertion comprises up to 8000bp of DNA and / or the deletion comprises up to 8000bp of DNA. 11. The composition of any one of clauses 8‑10, wherein theMPR comprises contiguous DNA between said gene 49 andgene E,wherein the contiguousDNA is at least 1000bp in length; or wherein theMPRcomprises at least 100bp of DNA between said gene 49 and gene E. 12. The composition of any one of clauses 8‑11, wherein the synthetic phage genome comprises said insertion between coordinates 9000 and 21000, wherein the coordinates are the nucleotide positions counted from the nucleotide (coordinate number 1) immediately after gene 49 towards gene Ewhen compared to a referencewild-type T2 phage. 13. The composition of any preceding clause, wherein the POI comprises (a) anuclease for targeting theDNAofanE colicell,wherein thenuclease is capableof beingexpressed in thecell for cutting the DNA of the cell, thereby modifying or killing the cell; or (b) adeadCas (dCas) for targeting theDNAofanE coli cell,wherein thedCas is capableof beingexpressed in the cell and targeting the DNA of the cell, thereby modifying the cell. 14. The composition of clause 13(a), wherein said nuclease is a guided nuclease, optionally a Cas, meganuclease, zinc finger nuclease or TALEN; or the composition of clause 13(b) wherein the dCas is a dCas9. 15. The composition of clause 13 or 14, wherein the nuclease is a Type I, II, III, IV, V or VI Cas nuclease, optionally a Cas9 or a Cas3. 16. The composition of any preceding clause, wherein the POI comprises at least one crRNA or guide RNA that is operable with a Cas for DNA targeting in E coli cells. 17. The composition of clause 16, wherein each crRNA or guide RNA comprises a spacer sequence that is complementary to an E coli protospacer sequence; optionally a protospacer of a B2 phylogroup E coli cell or an E coli cell of a strain selected from the group ST131, ST1193, ST648, ST315, ST405, ST361, ST88 and ST453. 18. The composition of clause 17, wherein the protospacer sequence is comprised by a gene selected from E coli genes fimH, bolA, rpoH, lptA and murA. 19. The composition of clause 18, wherein the particles of the composition target all ofE coli genes fimH, bolA, rpoH, lptA and murA. 20. The composition of anypreceding clause,wherein thenucleotide sequenceencoding thePOI comprisesa stress- phase active (SPA) promoter for expression of the POI inE coli cells; optionally wherein the promoter is anE coli bolA promoter or comprises SEQ ID NO: 13. 21. The composition of any preceding clause, wherein the E coli cells comprise a strain of E coli that causes sepsis, septicaemia or diarrhoea in humans or animals. 22. The composition of any preceding clause, wherein the composition is for use in amethod of treating or preventing infection of by E coli cells in a human or animal subject, wherein the method comprises administering the particles to the subject. 23. A method of treating or preventing sepsis, septicaemia or diarrhoea in a human or animal subject, the method comprising administering to the subject the composition of any preceding clause, wherein the E coli cells comprise a strain of E coli that causes sepsis, septicaemia or diarrhoea in humans or animals. 24. A method of treating or preventing infection of by E coli cells in a human or animal subject, wherein the method comprises administering the composition of any one of clauses 1‑21 to the subject, wherein the infection is treated or prevented. 213 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 25. The composition or method of any one of clauses 22‑24, wherein the subject is a transplant or cancer patient (optionally a haematological cancer patient), orwherein thepatient is suffering fromorat risk of aurinary tract infection (UTI); and optionally wherein the transplant is a solid organ or stem cell transplant (optionally a haematopoietic cell transplant) or wherein the transplant is a transplant of a medical device. 26. The composition or method of clause 25, wherein the method is carried out prior to the subject receiving a transplant. 27. The composition or method of any preceding clause for preventing haemolytic uremic syndrome (HUS), a UTI infection, sepsis, septicaemia or diarrhoea in a human subject. 28. The composition ormethod of any one of clauses 22‑27,wherein at least 1x 107PFUof particles are administered to the subject; or a doseof a composition according to anyoneof clauses1‑22and25‑27wherein thedose is a doseof at least 1x 107 PFU of said particles. 29. The compositionormethodof anyoneof clauses22‑28,wherein theparticles areadministered to the subject at an MOI (multiplicity of infection) of at least 0.01. 30. The composition,methodor doseof anypreceding clause,wherein theE coli cells comprise at least onestrain that is an antibiotic-resistant or MDR strain; and / or at least one B2-I strain. 31. The composition, method or dose of clause 30, wherein the antibiotic is fluoroquinolone (optionally levofloxacin), carbapenem or vancomycin; and / or wherein the E coli cells comprise beta-lactamase (ESBL)‑producing E coli. 32. The composition, method or dose of any preceding clause, wherein (i) the composition comprises first and second types of particles according to clauses 2A, 2B and 2C; (ii) thePOI comprises aguided nuclease for targeting theDNAof anE coli cell, wherein thenuclease is capable of being expressed in the cell for cutting the DNA of the cell, thereby modifying or killing the cell; (iii) each particle comprises a phage capsid containing the nucleic acid; and (iv) the particles of the composition target a plurality of different E coli genes, optionally selected from essential and virulence genes. 33. A method of detecting the presence of E coli (optionally B2 phylogroup E coli cells) in a sample, the method comprising (a) contacting the sample with a composition according to any preceding clause; and (b) detecting that E coli cells have been killed or the growth or proliferation thereof has been reduced. 34. A method of detecting the presence of E coli (optionally B2 phylogroup E coli cells) in a sample, the method comprising (a) contacting the sample with a composition according to any preceding clause; wherein particles of the composition comprise a nucleic acid comprising or encoding a detectable label, wherein the said particles contact the cells and introduce therein the nucleic acid, wherein optionally the label is expressed in the cells; and (b) detecting that E coli cells comprising the label. 35. Amethod formodifying the genomes ofE coli cells, themethod comprising contacting the cells with a composition of any preceding clause, wherein nucleic acid encoding the POI is introduced into the cells thereby modifying the genomes of the cells. 36. The method of any one of clauses 33‑35, wherein the sample is a patient sample (eg, blood, urine, stool or saliva sample), wherein the subject is a transplant or cancer patient (optionally a haematological cancer patient), or wherein the patient is suffering from or at risk of a urinary tract infection (UTI); and optionally wherein the transplant is a solid organ or stem cell transplant (optionally a haematopoietic cell transplant). 37. Themethod of any one of clauses 33‑36, wherein at least 1 x 107 PFU of particles are contacted with the sample. 214 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 38.Themethodof anyoneof clauses33‑37,wherein theparticlesare contactedwith thesampleat anMOI (multiplicity of infection) of at least 0.01. 39. A composition comprising a plurality of transduction particles for use in a method of treating or preventing an infection byE coli cells in a human or animal subject, wherein themethod comprises administering the particles to the subject, wherein (a) each particle comprises a nucleic acid encoding a nuclease for targeting the genomes ofE coli cells, wherein the said administered particles contact the cells and introduce therein the nucleic acid, wherein the nuclease is expressed in the cells and cuts genomic DNA of the cells, thereby killing the cells or reducing growth or proliferation of the cells in the subject; (b) the E coli cells are cells of E coli phylogroup B2; and (c) each particle comprises an adhesion moiety for recognising and binding to a cognate moiety selected from a LPS, LamB and Tsx displayed on the surface of the phylogroup B2 E coli cells. 40. The composition of clause 39, wherein each particle comprised by the composition comprises a T-even phage capsid; optionally a capsid of a T2 phage, T2-like phage, RB69 phage or a RB69-like phage. 41. The composition of any clause 39 or 40, wherein each particle is a phage (optionally a lytic phage) or packaged phagemid. 42. A composition comprising a plurality of transduction particles for use in a method of treating or preventing an infection by E coli cells (optionally B2 phylogroup E coli cells)in a human or animal subject, wherein the method comprises administering the particles to the subject, wherein (a) each particle comprises a nucleic acid encoding a nuclease for targeting the genomes ofE coli cells, wherein the said administered particles contact the cells and introduce therein the nucleic acid, wherein the nuclease is expressed in the cells and cuts genomic DNA of the cells, thereby killing the cells or reducing growth or proliferation of the cells in the subject; and (b) each particle comprised by the composition is a T-even phage capsid; optionally a capsid of a T2 phage, T2- like phage, RB69 phage or a RB69-like phage. 43. The composition of any one of clauses 39‑42, wherein the composition comprises at least 3 or 4 different types of transduction particles, wherein the types have different adhesion moieties for recognising and binding to a cognate moieties comprised by E coli (optionally B2 phylogroup E coli) cells. 44. The composition according to any one of clauses 39‑43, wherein (i) the nuclease is a guided nuclease for targeting the DNA of an E coli cell, wherein the nuclease is capable of being expressed in the cell for cutting the DNA of the cell, thereby killing the cell; (ii) each particle comprises a phage capsid containing the nucleic acid; and (iii) the particles of the composition target a plurality of different E coli genes, optionally selected from essential and virulence genes; and (iv) optionally the composition comprises A: particles which comprise a LPS adhesion moiety and a LamB adhesion moiety; B: particles which comprise a LPS adhesion moiety and a Tsx adhesion moiety; or C: : particles which comprise a Tsx adhesion moiety but is devoid of LamB and LPS adhesion moieties. 45. The composition according to any one of clauses 39‑43, wherein the nuclease is a Cas nuclease and the nucleic acid encodes at least one crRNA or guide RNA that is operable with the Cas for DNA targeting in E coli cells. 46. The composition of clause 45, wherein each crRNA or guide RNA comprises a spacer sequence that is complementary to an E coli protospacer sequence; optionally a protospacer of a B2 phylogroup E coli cell or an E coli cell of a strain selected from the group ST131, ST1193, ST648, ST315, ST405, ST361, ST88 and ST453. 47. The composition of clause 46, wherein the protospacer sequence is comprised by a gene selected from E coli genes fimH, bolA, rpoH, lptA and murA. 215 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 48. The composition of clause 47, wherein the particles of the composition target all ofE coli genes fimH, bolA, rpoH, lptA and murA. 49. The composition of any one of clauses 39‑48, wherein the nucleotide sequence encoding comprises a stress- phase active (SPA) promoter for expression of the nuclease inE coli cells; optionally wherein the promoter is anE coli bolA promoter or comprises SEQ ID NO: 13 (or a promoter sequence that is at least 80, 90, 95, 96, 97, 98 or 99% identical to SEQ ID NO: 13). 50. Thecomposition of anyoneof clauses39‑49,wherein theE coli cells comprisea strain ofE coli that causessepsis, septicaemia or diarrhoea in humans or animals. 51. The composition of any preceding clause, wherein the composition is for use in amethod of treating or preventing infection of by E coli cells in a human or animal subject, wherein the method comprises administering the particles to the subject. 52. A method of treating or preventing sepsis, septicaemia or diarrhoea in a human or animal subject, the method comprising administering to the subject the composition of any one of clauses 39‑51, wherein, wherein theE coli cells comprise a strain of E coli that causes sepsis, septicaemia or diarrhoea in humans or animals. 53. A method of treating or preventing infection of by E coli cells in a human or animal subject, wherein the method comprises administering the composition of any oneof clauses 39‑51 to the subject, wherein the infection is treated or prevented. 54. The composition or method of any one of clauses 51‑53, wherein the subject is a transplant or cancer patient (optionally a haematological cancer patient), orwherein thepatient is suffering fromorat risk of aurinary tract infection (UTI); and optionally wherein the transplant is a solid organ or stem cell transplant (optionally a haematopoietic cell transplant) or wherein the transplant is a transplant of a medical device. 55. The composition or method of clause 54, wherein the method is carried out prior to the subject receiving a transplant. 56. Thecompositionormethodof anyof anyoneof clauses39‑55, for preventinghaemolytic uremic syndrome (HUS), a UTI infection, sepsis, septicaemia or diarrhoea in a human subject. 57. The composition ormethodof any oneof clauses 52‑56,wherein at least 1 x 107PFUof particles are administered to the subject; or a doseof a composition according to anyoneof clauses1‑22and25‑27wherein thedose is a doseof at least 1 x 107 PFU of said particles. 58. The compositionormethodof anyoneof clauses52‑57,wherein theparticles areadministered to the subject at an MOI (multiplicity of infection) of at least 0.01. 59. The composition,method or dose of any one of clauses 39‑58, wherein theE coli cells comprise at least one strain that is an antibiotic-resistant or MDR strain; and / or at least one B2-I strain. 60. The composition, method or dose of clause 59, wherein the antibiotic is fluoroquinolone (optionally levofloxacin), carbapenem or vancomycin; and / or wherein the E coli cells comprise beta-lactamase (ESBL)‑producing E coli. Claims 1. A composition comprising a plurality of different types of transduction particles, wherein each of said particles comprises a nucleic acid and said particles are capable of contacting E coli cells and introducing therein the nucleic acid, wherein (a) said nucleic acid of each particle comprises a nucleotide sequence encoding a product of interest (POI), wherein the nucleic acid is capable of expressing the POI in an E coli cell; (b) each particle comprises an adhesion moiety for recognising and binding to a cognate moiety selected from a LPS and Tsx displayed on the surface of E coli cells; and 216 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 (c) saidplurality of different typesof transductionparticlescomprises (i) a first typeofparticles that compriseaLPS adhesion moiety; and (ii) a second type of particles that comprise a Tsx adhesion moiety. 2. The composition of claim 1, wherein a) A: each particle of the first type comprises a LPS adhesion moiety and a LamB adhesion moiety; B: each particle of the first type comprises a LPS adhesion moiety and a Tsx adhesion moiety; or C: eachparticleof the second typecomprisesaTsxadhesionmoiety but is devoidof LamBandLPSadhesion moieties, and optionallywherein the composition comprises particles according to eachofA, B andC; and / or b) wherein each particle comprises a phage capsid containing the nucleic acid, optionally wherein the capsid of each particle comprised by the composition is a T-even phage capsid; optionally a capsid of a T2 phage, T2-like phage, RB69 phage or a RB69-like phage; and / or c) wherein each particle is a phage (optionally a lytic phage) or packaged phagemid; and / or wherein the composition comprises at least 3 or 4 different types of transduction particles; and / or d) wherein the POI comprises (a) a nuclease for targeting the DNA of an E coli cell, wherein the nuclease is capable of being expressed in the cell for cutting theDNAof the cell, therebymodifying or killing the cell (optionally wherein said nuclease is a guided nuclease, optionally a Cas, meganuclease, zinc finger nuclease or TALEN); or (b) a deadCas (dCas) for targeting theDNAof anE coli cell, wherein the dCas is capable of being expressed in the cell and targeting the DNA of the cell, thereby modifying the cell (optionally wherein the dCas is a dCas9); and optionally wherein the nuclease is a Type I, II, III, IV, V or VI Cas nuclease, optionally a Cas9 or a Cas3; and / or e) wherein the POI comprises at least one crRNA or guide RNA that is operable with a Cas for DNA targeting inE coli cells; and optionally wherein each crRNAor guideRNAcomprises a spacer sequence that is complementary toanE coliprotospacer sequence; optionally aprotospacer of aB2phylogroupE colicell or anE coli cell of a strain selected from the groupST131, ST1193, ST648, ST315, ST405, ST361, ST88 andST453; and further optionally wherein the protospacer sequence is comprised by a gene selected fromE coli genes fimH, bolA, rpoH, lptA and murA; and further optionally wherein the particles of the composition target all of E coli genes fimH, bolA, rpoH, lptA and murA; and / or f) wherein the nucleotide sequence encoding the POI comprises a stress-phase active (SPA) promoter for expression of thePOI inE coli cells; optionally wherein the promoter is anE coli bolA promoter or comprises SEQ ID NO: 13; and / or g) wherein the E coli cells comprise a strain of E coli that causes sepsis, septicaemia or diarrhoea in humans or animals. 3. The composition of claim 1 or claim 2, wherein: the nucleic acid of each particle comprises at least one nucleotide sequence (N1) encoding said POI, wherein each particle is a synthetic T-even phage comprising an insertion of N1 into a Modification Permissive Region (MPR) of the genomeof the phage, wherein theMPR is immediately after gene 49 and to gene Ewhen compared to a reference wild-type T2 phage, and optionally wherein the nucleic acid comprises a DNA deletion of phage DNA in the MPR; and further optionally wherein the insertion comprises up to 8000bp of DNA and / or the deletion comprises up to 8000bp of DNA; and further optionally wherein the MPR comprises contiguous DNA between said gene 49 and gene E, wherein the contiguous DNA is at least 1000bp in length; or wherein theMPR comprises at least 100bp of DNA between said gene 49 and gene E; and further optionally wherein the synthetic phage genome comprises said insertion between coordinates 9000 and 21000, wherein the coordinates are the nucleotide positions counted from the nucleotide (coordinate number 1) immediately after gene 49 towards gene E when compared to a reference wild-type T2 phage. 4. The composition of any preceding claim, wherein the composition is for use in: (I) a method of treating or preventing infection by E coli cells in a human or animal subject, wherein the method 217 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 comprises administering the composition to the subject; or (II) amethod of treating or preventing sepsis, septicaemia or diarrhoea in a human or animal subject, themethod comprising administering to the subject the composition, wherein the E coli cells comprise a strain of E coli that causes sepsis, septicaemia or diarrhoea in humans or animals. 5. The composition of claim 4, wherein: a) the subject is a transplant or cancer patient (optionally a haematological cancer patient), or wherein the patient is suffering fromor at risk of a urinary tract infection (UTI); and optionally wherein the transplant is a solid organ or stem cell transplant (optionally a haematopoietic cell transplant) or wherein the transplant is a transplant of a medical device; optionally wherein the method is carried out prior to the subject receiving a transplant; and / or b) the composition or method is for preventing haemolytic uremic syndrome (HUS), a UTI infection, sepsis, septicaemia or diarrhoea in a human subject; and / or c)wherein at least 1 x107PFUofparticles areadministered to the subject; or a doseof a composition according to any one of claims 1‑3 wherein the dose is a dose of at least 1 x 107 PFU of said particles; and / or d) wherein the particles are administered to the subject at an MOI (multiplicity of infection) of at least 0.01; optionally wherein: a) theE coli cells comprise at least one strain that is an antibiotic-resistant or MDR strain; and / or at least one B2-I strain, optionally wherein the antibiotic is fluoroquinolone (optionally levofloxacin), carbapenem or vancomycin; and / or wherein the E coli cells comprise beta-lactamase (ESBL)‑producing E coli; and / or b) wherein (i) the composition comprises first and second types of particles according to claims 2a)A, 2a)B and 2a)C; (ii) the POI comprises a guided nuclease for targeting the DNA of an E coli cell, wherein the nuclease is capable of being expressed in the cell for cutting the DNA of the cell, thereby modifying or killing the cell; (iii) each particle comprises a phage capsid containing the nucleic acid; and (iv) the particles of the composition target a plurality of different E coli genes, optionally selected from essential and virulence genes. 6. A method of detecting the presence of E coli (optionally B2 phylogroup E coli cells) in a sample, the method comprising: A. (a) contacting the sample with a composition according to any preceding claim; and (b) detecting that E coli cells have been killed or the growth or proliferation thereof has been reduced. or B: (a) contacting the sample with a composition according to any preceding claim; wherein particles of the composition comprise a nucleic acid comprising or encoding a detectable label, wherein the said particles contact the cells and introduce therein the nucleic acid, wherein optionally the label is expressed in the cells; and (b) detecting that E coli cells comprising the label. 7. Amethod for modifying the genomes ofE coli cells, the method comprising contacting the cells with a composition of any preceding claim, wherein nucleic acid encoding the POI is introduced into the cells thereby modifying the genomes of the cells. 8. The method of claim 6 or claim 7, wherein: a) the sample is a patient sample (eg, blood, urine, stool or saliva sample), wherein the subject is a transplant or cancer patient (optionally a haematological cancer patient), or wherein the patient is suffering from or at risk of a urinary tract infection (UTI); and optionally wherein the transplant is a solid organ or stem cell transplant (optionally a haematopoietic cell transplant); and / or b) wherein at least 1 x 107 PFU of particles are contacted with the sample; and / or 218 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 c) wherein the particles are contacted with the sample at an MOI (multiplicity of infection) of at least 0.01. 9. A composition comprising a plurality of transduction particles for use in amethod of treating or preventing an infection byE coli cells in a human or animal subject, wherein themethod comprises administering the particles to the subject, wherein (a) each particle comprises a nucleic acid encoding a nuclease for targeting the genomes ofE coli cells, wherein the said administered particles contact the cells and introduce therein the nucleic acid, wherein the nuclease is expressed in the cells and cuts genomic DNA of the cells, thereby killing the cells or reducing growth or proliferation of the cells in the subject; (b) the E coli cells are cells of E coli phylogroup B2; and (c) each particle comprises an adhesion moiety for recognising and binding to a cognate moiety selected from a LPS, LamB and Tsx displayed on the surface of the phylogroup B2 E coli cells, optionally wherein each particle comprised by the composition comprises a T-even phage capsid; optionally a capsid of a T2 phage, T2-like phage, RB69 phage or a RB69-like phage, and further optionally wherein each particle is a phage (optionally a lytic phage) or packaged phagemid. 10. A composition comprising a plurality of transduction particles for use in amethod of treating or preventing an infection by E coli cells (optionally B2 phylogroup E coli cells)in a human or animal subject, wherein the method comprises administering the particles to the subject, wherein (a) each particle comprises a nucleic acid encoding a nuclease for targeting the genomes ofE coli cells, wherein the said administered particles contact the cells and introduce therein the nucleic acid, wherein the nuclease is expressed in the cells and cuts genomic DNA of the cells, thereby killing the cells or reducing growth or proliferation of the cells in the subject; and (b) each particle comprised by the composition is a T-even phage capsid; optionally a capsid of a T2 phage, T2- like phage, RB69 phage or a RB69-like phage. 11. The composition of any one of claims 9 or 10, wherein: a) the composition comprises at least 3 or 4 different types of transduction particles, wherein the types have different adhesion moieties for recognising and binding to a cognate moieties comprised by E coli (optionally B2 phylogroup E coli) cells; and / or b) wherein (i) the nuclease is a guidednuclease for targeting theDNAof anE coli cell, wherein thenuclease is capable of being expressed in the cell for cutting the DNA of the cell, thereby killing the cell; (ii) each particle comprises a phage capsid containing the nucleic acid; and (iii) the particles of the composition target a plurality of different E coli genes, optionally selected from essential and virulence genes; and (iv) optionally the composition comprises A: particles which comprise a LPS adhesion moiety and a LamB adhesion moiety; B: particles which comprise a LPS adhesion moiety and a Tsx adhesion moiety; or C: : particleswhich compriseaTsxadhesionmoietybut is devoidofLamBandLPSadhesionmoieties; and / or c) wherein the nuclease is a Cas nuclease and the nucleic acid encodes at least one crRNA or guide RNA that is operable with the Cas for DNA targeting inE coli cells; optionally wherein each crRNA or guide RNA comprises a spacer sequence that is complementary to an E coli protospacer sequence; optionally a protospacer of a B2 phylogroupE coli cell or anE coli cell of a strain selected from the group ST131, ST1193, ST648, ST315, ST405, ST361, ST88 and ST453; and further optionally wherein the protospacer sequence is comprised by a gene selected fromE coligenesfimH,bolA, rpoH, lptAandmurA; andeven furtheroptionallywherein theparticlesof the composition target all of E coli genes fimH, bolA, rpoH, lptA and murA. 12. The composition of any one of claims 9 to 11, wherein: a) the nucleotide sequence encoding comprises a stress-phase active (SPA) promoter for expression of the nuclease inE coli cells;optionallywherein thepromoter is anE coli bolApromoter or comprisesSEQ IDNO:13 (or a promoter sequence that is at least 80, 90, 95, 96, 97, 98 or 99% identical to SEQ ID NO: 13); and / or 219 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 b) wherein the E coli cells comprise a strain of E coli that causes sepsis, septicaemia or diarrhoea in humans or animals. 13. The composition of any preceding claim, wherein the composition is for use in: (I) amethod of treating or preventing infection of byE coli cells in a human or animal subject, wherein themethod comprises administering the composition to the subject; or (II) amethod of treating or preventing sepsis, septicaemia or diarrhoea in a human or animal subject, themethod comprising administering to the subject the composition, wherein the E coli cells comprise a strain of E coli that causes sepsis, septicaemia or diarrhoea in humans or animals. 14. The composition of claim 13, wherein: a) the subject is a transplant or cancer patient (optionally a haematological cancer patient), or wherein the patient is suffering fromor at risk of a urinary tract infection (UTI); and optionally wherein the transplant is a solid organ or stem cell transplant (optionally a haematopoietic cell transplant) or wherein the transplant is a transplant of a medical device; and further optionallywherein themethod is carried out prior to the subject receiving a transplant; and / or b) the composition or method is for preventing haemolytic uremic syndrome (HUS), a UTI infection, sepsis, septicaemia or diarrhoea in a human subject; and / or c)at least 1 x 107PFUof particles are administered to the subject; or a doseof a composition according to any one of claims 1‑5 wherein the dose is a dose of at least 1 x 107 PFU of said particles; and / or d) the particles are administered to the subject at an MOI (multiplicity of infection) of at least 0.01. 15. Thecomposition,methodordoseof anyoneof claims9 to14wherein theE colicells compriseat least onestrain that is an antibiotic-resistant or MDR strain; and / or at least one B2-I strain; and optionally wherein the antibiotic is fluoroquinolone (optionally levofloxacin), carbapenem or vancomycin; and / or wherein the E coli cells comprise beta-lactamase (ESBL)‑producing E coli. 220 EP 4 660 305 A2 5 10 15 20 25 30 35 40 45 50 55 221 EP 4 660 305 A2 222 EP 4 660 305 A2 223 EP 4 660 305 A2 224 EP 4 660 305 A2 225 EP 4 660 305 A2 226 EP 4 660 305 A2 227 EP 4 660 305 A2 228 EP 4 660 305 A2 229 EP 4 660 305 A2 230 EP 4 660 305 A2 231 EP 4 660 305 A2 232 EP 4 660 305 A2 233 EP 4 660 305 A2 234 EP 4 660 305 A2 235 EP 4 660 305 A2 236 EP 4 660 305 A2 REFERENCES CITED IN THE DESCRIPTION This list of references cited by the applicant is for the reader’s convenience only. It does not form part of the European patent document. Even though great care has been taken in compiling the references, errors or omissions cannot be excluded and the EPO disclaims all liability in this regard. Patent documents cited in the description • WO 0069269 A

[0007] • WO 0193904 A

[0007]

[0009] • US 20020001590 A

[0008] • WO 0207742 A

[0008] • US 20020044922 A

[0009] • US 20020058027 A

[0009] • US 20160333348 A

[0010] Non-patent literature cited in the description • MICHAEL J SATLIN. Colonization With Fluoroqui- nolone-Resistant Enterobacterales Decreases the Effectiveness of Fluoroquinolone Prophylaxis in Hematopoietic Cell Transplant Recipients.Clin Infect Dis., 05 October 2021, vol. 73 (7), 1257-1265

[0100] • SATLIN MJ et al. Colonization With Levofloxacin- resistant Extended-spectrum β-Lactamase-produ- cing Enterobacteriaceae and Risk of Bacteremia in Hematopoietic StemCell Transplant Recipients.Clin Infect Dis., 13 November 2018, vol. 67 (11), 1720- 1728

[0102] • JOHANN BEGHAIN. ClermonTyping: an easy-to- use and accurate in silico method for Escherichia genus strain phylotyping. Microb Genom., 19 June 2018, vol. 4 (7), e000192

[0205] • SHIFUCHEN ;YANQINGZHOU ;YARUCHEN ; JIA GU. fastp: an ultra-fast all-in-one FASTQ preproces- sor.Bioinformatics, 01 September 2018, vol. 34 (17), i884-i890, https: / / doi.org / 10.1093 / bioinforma- tics / bty560

[0209] • ALEXANDRE SOUVOROV ; RICHA AGARWALA ; DAVID J. LIPMAN. SKESA: strategic k-mer exten- sion for scrupulous assemblies. Genome Biology, 2018, vol. 19, 153

[0209] • ONDOV, B.D. ; TREANGEN, T.J. ; MELSTED, P. et al. Mash: fast genome and metagenome distance estimation using MinHash. Genome Biol, 2016, vol. 17, 132, https: / / doi.org / 10.1186 / s13059-016-0997-x

[0209]

[0224] • Rapid Neighbour Joining.. MARTIN SIMONSEN ; THOMAS MAILUND ; CHRISTIAN N. S. PEDER- SEN. Proceedings of the 8thWorkshop in Algorithms in Bioinformatics (WABI), LNBI. Springer Verlag, October 2008, vol. 5251, 113-122

[0209] • LETUNIC I ;BORK P. Interactive Tree Of Life (iTOL) v5: an online tool for phylogenetic tree display and annotation. Nucleic Acids Res, 2021

[0209] • MICHAEL J. SATLIN et al. Colonization with Fluoroquinolone-resistant Enterobacterales de- creases the effectiveness of fluoroquinolone prophy- laxis in hematopoietic cell transplant recipients. Clinical Infectious Diseases, 2021

[0209] • MICHAEL J. SATLIN et al. Colonization with Levo- floxacin-resistant extended-spectrum β-lactamase- producingEnterobacteriaceaeand riskof bacteremia in hematopoietic cell transplant recipients. Clinical Infectious Diseases, 2018

[0209] • PULTE,D. ; JANSEN, L. ;BRENNER,H.Changes in long term survival after diagnosis with common hematologic malignancies in the early 21st century. Blood Cancer J, 2020, vol. 10, 56

[0278] • RILEY,M.etal.EpidemiologyandBurdenofMucosal Barrier Injury Laboratory-Confirmed Bloodstream Infections in Bone Marrow Transplant and Hematol- ogy-Oncology Units. Am J Infect Control, 2017, vol. 45, S38

[0278] • DANDOY, C. E. et al. Incidence, Risk Factors, and Outcomes of Patients Who Develop Mucosal Barrier Injury-Laboratory Confirmed Bloodstream Infections in the First 100 Days After Allogeneic Hematopoietic StemCell Transplant. Jama Netw Open, 2020, vol. 3, e1918668

[0278] • VELDEN,W. J. F. M. ;HERBERS, A. H. E. ;NETEA, M.G. ;BLIJLEVENS, N.M. A.Mucosal barrier injury, fever and infection in neutropenic patients with cancer: introducing the paradigm febrile mucositis. Brit J Haematol, 2014, vol. 167, 441-452

[0278] • GIRMENIA, C. et al. Incidence, Risk Factors and Outcome of Pre-engraftment Gram-Negative Bacter- emia After Allogeneic andAutologousHematopoietic Stem Cell Transplantation: An Italian Prospective Multicenter Survey. Clin Infect Dis, 2017, vol. 65, 1884-1896

[0278] • KLASTERSKY, J. et al. Bacteraemia in febrile neutropenic cancer patients. Int J Antimicrob Ag, 2007, vol. 30, 51-59

[0278] 237 EP 4 660 305 A2 • TAPLITZ, R. A. et al. Antimicrobial Prophylaxis for Adult Patients With Cancer-Related Immunosup- pression:ASCOand IDSAClinicalPracticeGuideline Update.. J Clin Oncol, 2018, vol. 36

[0278] • CULLEN, M. et al. Antibacterial Prophylaxis after Chemotherapy for Solid Tumors and Lymphomas. New Engl J Med, 2005, vol. 353, 988-998

[0278] • BUCANEVE, G. et al. Levofloxacin to Prevent Bacterial Infection in Patients with Cancer and Neutropenia. New Engl J Medicine, 2005, vol. 353, 977-987

[0278] • I., FREIFELD, A. G. ; MAGILL, S. S. Causative Organisms and Associated Antimicrobial Resistance in Healthcare-Associated, Central Line-Associated Bloodstream Infections From Oncology Settings, 2009‑2012. Clin Infect Dis, 2016, vol. 62, 1203- 1209

[0278] • TRECARICHI, E. M. et al.Current epidemiology and antimicrobial resistance data for bacterial blood- stream infections in patients with hematologic malig- nancies: an Italian multicentre prospective survey. Clin Microbiol Infec, 2015, vol. 21, 337-343

[0278] • MARIN, M. et al. Factors influencing mortality in neutropenic patients with haematologic malignan- cies or solid tumours with bloodstream infection. Clin Microbiol Infec, 2015, vol. 21, 583-590

[0278] • AVERBUCH, D. et al. Antimicrobial Resistance in Gram-Negative Rods Causing Bacteremia in Hema- topoietic Stem Cell Transplant Recipients: Intercon- tinental Prospective Study of the Infectious Diseases Working Party of the European Bone Marrow Transplantation Group. Clin Infect Dis, 2017, vol. 65, 1819-1828

[0278] • SCHOOLEY, R. T. et al. Development and Use of Personalized Bacteriophage-Based Therapeutic Cocktails To Treat a Patient with a Disseminated Resistant Acinetobacter baumannii Infection. Anti- microb Agents Ch, 2017, vol. 61

[0278] • DEDRICK, R. M. et al. Engineered bacteriophages for treatment of a patient with a disseminated drug resistantMycobacteriumabscessus..Nat Med, 2019, vol. 25, 730-733

[0278] • JENNES, S. et al. Use of bacteriophages in the treatment of colistin-only-sensitive Pseudomonas aeruginosa septicaemia in apatientwith acute kidney injury-a case report. Crit Care, 2017, vol. 21, 129

[0278] • JAULT,P. et al.Efficacyand tolerability of a cocktail of bacteriophages to treat burn wounds infected by Pseudomonas aeruginosa (PhagoBurn): a rando- mised, controlled, double-blind phase 1 / 2 trial.. Lancet Infect Dis, 2018, vol. 19, 35-45

[0278] • SARKER, S. A. et al. Oral Phage Therapy of Acute Bacterial DiarrheaWithTwoColiphagePreparations: A Randomized Trial in Children From Bangladesh.. Ebiomedicine, 2016, vol. 4, 124-137

[0278] • LEITNER, L. et al. Intravesical bacteriophages for treating urinary tract infections in patients undergoing transurethral resection of the prostate: a randomised, placebo-controlled, double-blind clinical trial.. Lancet Infect Dis, 2020, vol. 21, 427-436

[0278] • SABINO,J. ;HIRTEN,R.P. ;COLOMBEL,J.Review article: bacteriophages in gastroenterology-from biology to clinical applications. Aliment Pharm Therap, 2020, vol. 51, 53-63

[0278] • FEDERICI, S. et al. Targeted suppression of human IBD-associated gut microbiota commensals by phage consortia for treatment of intestinal inflamma- tion.. Cell, 2022, vol. 185, 2879-2898

[0278] • KAUFFMAN, K. M. et al. Resolving the structure of phage-bacteria interactions in the context of natural diversity.. Nat Commun, 2022, vol. 13, 372

[0278] • YEHL, K. et al. Engineering Phage Host-Range and Suppressing Bacterial Resistance through Phage Tail FiberMutagenesis..Cell, 2019, vol. 179, 459-469

[0278] • WESTRA, E. R. et al. CRISPR Immunity Relies on the Consecutive Binding and Degradation of Nega- tively Supercoiled Invader DNA by Cascade and Cas3. Mol Cell, 2012, vol. 46, 595-605

[0278] • SINKUNAS, T. et al. Cas3 is a single-stranded DNA nuclease and ATP-dependent helicase in the CRISPR / Cas immune system.. Embo J, 2011, vol. 30, 1335-1342

[0278] • BIKARD,D. et al.Development of sequence-specific antimicrobials based on programmable CRISPR- Cas nucleases.. Nat Biotechnol, 2014, vol. 32, 1146- 1150

[0278] • CITORIK, R. J. ; MIMEE, M. ; LU, T. K. Sequence- specific antimicrobials using efficiently delivered RNA-guided nucleases.. Nat Biotechnol, 2014, vol. 32, 1141-1145

[0278] • SELLE, K. et al. In Vivo Targeting of Clostridioides difficile Using Phage-Delivered CRISPR-Cas3 Anti- microbials. Mbio, 2020, vol. 11, e00019-20

[0278] • NEIL, K. et al. High-efficiency delivery of CRISPR- Cas9 by engineered probiotics enables precise microbiome editing. Mol Syst Biol, 2021, vol. 17, e10335

[0278] • EDGAR, R. ; QIMRON, U. The Escherichia coli CRISPR system protects from λ lysogenization, lysogens, and prophage induction.. J Bacteriol, 2010, vol. 192, 6291-4

[0278] • HSU,B.B. et al. In situ reprogrammingof gut bacteria by oral delivery.. Nat Commun, 2020, vol. 11, 5030

[0278] • YOSEF, I. ; MANOR, M. ; KIRO, R. ; QIMRON, U. Temperate and lytic bacteriophages programmed to sensitize and kill antibiotic-resistant bacteria.. Proc National Acad Sci, 2015, vol. 112, 7267-7272

[0278] • OCHMAN, H. ; SELANDER, R. K. Standard refer- ence strains of Escherichia coli from natural popula- tions.. J Bacteriol, 1984, vol. 157, 690-3

[0278] 238 EP 4 660 305 A2 • OECHSLIN, F. Resistance Development to Bacter- iophages Occurring during Bacteriophage Therapy. Viruses, 2018, vol. 10, 351

[0278] • DUNNE, M. et al. Salmonella Phage S16 Tail Fiber Adhesin Features a Rare Polyglycine Rich Domain for Host Recognition. Structure, 2018, vol. 26, 1573- 1582

[0278] • BROUNS, S. J. J. et al. Small CRISPR RNAs Guide Antiviral Defense inProkaryotes..Science, 2008, vol. 321, 960-964

[0278] • KNIGHT, D. ; GIRLING, K. Gut flora in health and disease. Lancet, 2003, vol. 361, 1831

[0278] • CHRISTENSEN, S. K. ; MIKKELSEN, M. ; PEDER- SEN, K. ; GERDES, K. RelE, a global inhibitor of translation, is activated during nutritional stress.. Proc National Acad Sci, 2001, vol. 98, 14328-14333

[0278] • VIEIRA, H. L. A. ; FREIRE, P. ; ARRAIANO, C. M. Effect of Escherichia coli Morphogene bolA on Biofilms. Appl Environ Microb, 2004, vol. 70, 5682- 5684

[0278] • URIBE, R. V. et al. Bacterial resistance to CRISPR- Cas antimicrobials. Sci Rep-uk, 2021, vol. 11, 17267

[0278] • GALTIER, M. et al. Bacteriophages to reduce gut carriage of antibiotic resistant uropathogens with low impact on microbiota composition.. Environ Micro- biol, 2016, vol. 18, 2237-2245

[0278] • Global burden of bacterial antimicrobial resistance in 2019: a systematic analysis. Lancet, 2022, vol. 399, 629-655

[0278] • HYMAN, P. ; ABEDON, S. T. Bacteriophage host range and bacterial resistance. Adv Appl Microbiol, 2010, vol. 70, 217-48

[0278] • LEMAY, M.‑L. ; RENAUD, A. ; ROUSSEAU, G. ; MOINEAU, S. Targeted Genome Editing of Virulent Phages Using CRISPR-Cas9.. Bio-protocol, 2018, vol. 8, e2674

[0278] • LAM, K. N. et al. Phage-delivered CRISPR-Cas9 for strain-specific depletion and genomic deletions in the gutmicrobiome..Cell Reports, 2021, vol. 37, 109930- 109930

[0278] • LEE, K. A. et al. The gut microbiome: what the oncologist ought to know. Brit J Cancer, 2021, vol. 125, 1197-1209

[0278] • GENCAY, Y. E. ; AYAZ, N. D. ; COPUROGLU, G ; EROL, I. Biocontrol of Shiga Toxigenic Escherichia coli O157:H7 in Turkish Raw Meatball by Bacter- iophage.. J Food Safety, 2016, vol. 36, 120-131

[0278] • SATLIN, M. J. et al. Colonization With Fluoroquino- lone-Resistant Enterobacterales Decreases the Ef- fectiveness of Fluoroquinolone Prophylaxis in He- matopoietic Cell Transplant Recipients. Clin Infect Dis, 2021, vol. 73, 1257-1265

[0278] • SATLIN, M. J. et al. Colonization With Levofloxacin- resistant Extended-spectrum β-Lactamase-produ- cing Enterobacteriaceae and Risk of Bacteremia in Hematopoietic StemCell Transplant Recipients.Clin Infect Dis Official Publ Infect Dis Soc Am, 2018, vol. 67, 1720-1728

[0278] • HARMS,A. et al.Abacterial toxin-antitoxinmodule is the origin of inter-bacterial and inter-kingdom effec- tors of Bartonella. Plos Genet, 2017, vol. 13, e1007077

[0278] • HENRY, M. et al. Development of a high throughput assay for indirectly measuring phage growth using the OmniLogTM system.. Bacteriophage, 2014, vol. 2, 159-167

[0278] • LUTZ, R. ; BUJARD, H. Independent and Tight Regulation of Transcriptional Units in Escherichia Coli Via the LacR / O, the TetR / O and AraC / I1-I2 Regulatory Elements.. Nucleic Acids Res, 1997, vol. 25, 1203-1210

[0278] • YOUNG, K. K. ; EDLIN, G. J. ; WILSON, G. G. Genetic analysis of bacteriophage T4 transducing bacteriophages.. J Virol, 1982, vol. 41, 345-347

[0278] • GIBSON, S. B. et al. Constructing and Characteriz- ing Bacteriophage Libraries for Phage Therapy of Human Infections. Front Microbiol, 2019, vol. 10, 2537

[0278] • BOLGER, A. M. ; LOHSE, M. ; USADEL, B. Trimmomatic: a flexible trimmer for Illumina se- quence data.. Bioinformatics, 2014, vol. 30, 2114- 2120

[0278] • BANKEVICH, A. et al. SPAdes: A New Genome Assembly Algorithm and Its Applications to Single- Cell Sequencing.. J Comput Biol, 2012, vol. 19, 455- 477

[0278] • LARSEN, M. V. et al.Multilocus Sequence Typing of Total-Genome-Sequenced Bacteria.. J Clin Micro- biol, 2012, vol. 50, 1355-1361

[0278] • BEGHAIN, J. ; BRIDIER-NAHMIAS, A. ; NAGARD, H. L. ;DENAMUR, E. ;CLENNONT, O. ClermonTyp- ing: an easy-to-use and accurate in silico method for Escherichia genus strain phylotyping.. Microb Gen- om, 2018, vol. 4, e000192

[0278] • ONDOV, B. D. et al. Mash: fast genome and metagenome distance estimation using MinHash. Genome Biol, 2016, vol. 17, 132

[0278] • YU, G. Using ggtree to Visualize Data on Tree-Like Structures. Curr Protoc Bioinform, 2020, vol. 69, e96

[0278] • DATSENKO, K. A. ; WANNER, B. L. One-step inactivation of chromosomal genes in Escherichia coli K‑12 using PCR products.. Proc National Acad Sci, 2000, vol. 97, 6640-6645

[0278] • HANTKE, K. Compilation of Escherichia coli K‑12 outer membrane phage receptors - their function and some historical remarks. Fems Microbiol Lett, 2020, vol. 367

[0278] (19) *EP004660305A3* (11) EP 4 660 305 A3 (12) EUROPEAN PATENT APPLICATION (88) Date of publication A3: 18.02.2026 Bulletin 2026 / 08 (43) Date of publication A2: 10.12.2025 Bulletin 2025 / 50 (21) Application number: 25195750.2 (22) Date of filing: 29.06.2023 (51) International Patent Classification (IPC): C12N 7 / 00 (2006.01) A61P 31 / 04 (2006.01) C12N 15 / 10 (2006.01) (52) Cooperative Patent Classification (CPC): C12N 7 / 00; A61P 31 / 04; C12N 15 / 102; C12N 15 / 70; C12N 2310 / 20; C12N 2795 / 10121; C12N 2795 / 10142; C12N 2795 / 10145 (84) Designated Contracting States: AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR (30) Priority: 29.06.2022 GB 202209518 06.03.2023 GB 202303242 (62) Document number(s) of the earlier application(s) in accordance with Art. 76 EPC: 23738642.0 / 4 392 550 (71) Applicant: SNIPR Biome ApS. 2100 Copenhagen (DK) (72) Inventors: • KRAUSE HAABER, Jakob 2100 Copenhagen (DK) • SEMSEY, Szabolcs 2100 Copenhagen (DK) • GROVE, Mette 2100 Copenhagen (DK) • DAMHOLT, Birgitte 2100 Copenhagen (DK) • JASINSKYTE, Dziuginta 2100 Copenhagen (DK) • GENÇAY, Yilmaz Emre 2100 Copenhagen (DK) (74) Representative: CMS Cameron McKenna Nabarro Olswang LLP Cannon Place 78 Cannon Street London EC4N 6AF (GB) (54) TARGETING E COLI CELLS (57) The technology described herein relates to methods and compositions for targeting E coli cells, such as for treating or preventing an infection by E coli cells in human or animal subjects. The method, in an embodi- ment, comprises administering to the subject a particle cocktail comprising a plurality of different transduction particles to E coli cells. The method, in an embodiment, comprises administering to the subject a plurality of transduction particles that encode a nuclease for target- ing the genomes of B2 phylogroup E coli cells. EP 4 66 0 30 5 A 3 Processed by Luminess, 75001 PARIS (FR) 2 EP 4 660 305 A3 5 10 15 20 25 30 35 40 45 50 55 3 EP 4 660 305 A3 5 10 15 20 25 30 35 40 45 50 55 4 EP 4 660 305 A3 5 10 15 20 25 30 35 40 45 50 55 5 EP 4 660 305 A3 5 10 15 20 25 30 35 40 45 50 55 摘要 本文描述的技術涉及用於靶向大腸桿菌細胞的方法和組合物，例如用於治療或預防人或動物 受試者的由大腸桿菌細胞引起的感染的方法和組合物。在一個實施方案中，所述方法包括向 受試者施用顆粒混合物，所述顆粒混合物包含針對大腸桿菌細胞的多個不同轉導顆粒。在一 個實施方案中，所述方法包括向受試者施用多個轉導顆粒，所述轉導顆粒編碼用於靶向 B2 系統發育群大腸桿菌細胞的基因組的核酸酶。

Claims

1. A composition comprising a plurality of different types of transduction particles, wherein each of said particles comprises a nucleic acid and said particles are capable of contacting E coli cells and introducing therein the nucleic acid, wherein (a) said nucleic acid of each particle comprises a nucleotide sequence encoding a product of interest (POI), wherein the nucleic acid is capable of expressing the POI in an E coli cell; (b) each particle comprises an adhesion moiety for recognising and binding to a cognate moiety selected from a LPS and Tsx displayed on the surface of E coli cells; and (c) said plurality of different types of transduction particles comprises (i) a first type of particles that comprise a LPS adhesion moiety; and (ii) a second type of particles that comprise a Tsx adhesion moiety.

2. The composition of claim 1, wherein a) A: each particle of the first type comprises a LPS adhesion moiety and a LamB adhesion moiety; B: each particle of the first type comprises a LPS adhesion moiety and a Tsx adhesion moiety; or C: each particle of the second type comprises a Tsx adhesion moiety but is devoid of LamB and LPS adhesion moieties, and optionally wherein the composition comprises particles according to each of A, B and C; and / or b) wherein each particle comprises a phage capsid containing the nucleic acid, optionally wherein the capsid of each particle comprised by the composition is a T-even phage capsid; optionally a capsid of a T2 phage, T2-like phage, RB69 phage or a RB69-like phage; and / or c) wherein each particle is a phage (optionally a lytic phage) or packaged phagemid; and / or wherein the composition comprises at least 3 or 4 different types of transduction particles; and / or d) wherein the POI comprises (a) a nuclease for targeting the DNA of an E coli cell, wherein the nuclease is capable of being expressed in the cell for cutting the DNA of the cell, thereby modifying or killing the cell (optionally wherein said nuclease is a guided nuclease, optionally a Cas, meganuclease, zinc finger nuclease or TALEN); or (b) a dead Cas (dCas) for targeting the DNA of an E coli cell, wherein the dCas is capable of being expressed in the cell and targeting the DNA of the cell, thereby modifying the cell (optionally wherein the dCas is a dCas9); and optionally wherein the nuclease is a Type I, II, III, IV, V or VI Cas nuclease, optionally a Cas9 or a Cas3; and / or e) wherein the POI comprises at least one crRNA or guide RNA that is operable with a Cas for DNA targeting in E coli cells; and optionally wherein each crRNA or guide RNA comprises a spacer sequence that is complementary to an E coli protospacer sequence; optionally a protospacer of a B2 phylogroup E coli cell or an E coli cell of a strain selected from the group ST131, ST1193, ST648, ST315, ST405, ST361, ST88 and ST453; and further optionally wherein the protospacer sequence is comprised by a gene selected from E coli genes fimH, bolA, rpoH, lptA and murA; and further optionally wherein the particles of the composition target all of E coli genes fimH, bolA, rpoH, lptA and murA; and / or f) wherein the nucleotide sequence encoding the POI comprises a stress-phase active (SPA) promoter for expression of the POI in E coli cells; optionally wherein the promoter is an E coli bolA promoter or comprises SEQ ID NO: 13; and / or g) wherein the E coli cells comprise a strain of E coli that causes sepsis, septicaemia or diarrhoea in humans or animals.

3. The composition of claim 1 or claim 2, wherein: the nucleic acid of each particle comprises at least one nucleotide sequence (N1) encoding said POI, wherein each particle is a synthetic T-even phage comprising an insertion of N1 into a Modification Permissive Region (MPR) of the genome of the phage, wherein the MPR is immediately after gene 49 and to gene E when compared to a reference wild-type T2 phage, and optionally wherein the nucleic acid comprises a DNA deletion of phage DNA in the MPR; and further optionally wherein the insertion comprises up to 8000bp of DNA and / or the deletion comprises up to 8000bp of DNA; and further optionally wherein the MPR comprises contiguous DNA between said gene 49 and gene E, wherein the contiguous DNA is at least 1000bp in length; or wherein the MPR comprises at least 100bp of DNA between said gene 49 and gene E; and further optionally wherein the synthetic phage genome comprises said insertion between coordinates 9000 and 21000, wherein the coordinates are the nucleotide positions counted from the nucleotide (coordinate number 1) immediately after gene 49 towards gene E when compared to a reference wild-type T2 phage.

4. The composition of any preceding claim, wherein the composition is for use in: (I) a method of treating or preventing infection by E coli cells in a human or animal subject, wherein the method comprises administering the composition to the subject; or (II) a method of treating or preventing sepsis, septicaemia or diarrhoea in a human or animal subject, the method comprising administering to the subject the composition, wherein the E coli cells comprise a strain of E coli that causes sepsis, septicaemia or diarrhoea in humans or animals.

5. The composition of claim 4, wherein: a) the subject is a transplant or cancer patient (optionally a haematological cancer patient), or wherein the patient is suffering from or at risk of a urinary tract infection (UTI); and optionally wherein the transplant is a solid organ or stem cell transplant (optionally a haematopoietic cell transplant) or wherein the transplant is a transplant of a medical device; optionally wherein the method is carried out prior to the subject receiving a transplant; and / or b) the composition or method is for preventing haemolytic uremic syndrome (HUS), a UTI infection, sepsis, septicaemia or diarrhoea in a human subject; and / or c) wherein at least 1 x 107 PFU of particles are administered to the subject; or a dose of a composition according to any one of claims 1-3 wherein the dose is a dose of at least 1 x 107 PFU of said particles; and / or d) wherein the particles are administered to the subject at an MOI (multiplicity of infection) of at least 0.01; optionally wherein: a) the E coli cells comprise at least one strain that is an antibiotic-resistant or MDR strain; and / or at least one B2-I strain, optionally wherein the antibiotic is fluoroquinolone (optionally levofloxacin), carbapenem or vancomycin; and / or wherein the E coli cells comprise beta-lactamase (ESBL)-producing E coli; and / or b) wherein (i) the composition comprises first and second types of particles according to claims 2a)A, 2a)B and 2a)C; (ii) the POI comprises a guided nuclease for targeting the DNA of an E coli cell, wherein the nuclease is capable of being expressed in the cell for cutting the DNA of the cell, thereby modifying or killing the cell; (iii) each particle comprises a phage capsid containing the nucleic acid; and (iv) the particles of the composition target a plurality of different E coli genes, optionally selected from essential and virulence genes.

6. A method of detecting the presence of E coli (optionally B2 phylogroup E coli cells) in a sample, the method comprising: A. (a) contacting the sample with a composition according to any preceding claim; and (b) detecting that E coli cells have been killed or the growth or proliferation thereof has been reduced. or B: (a) contacting the sample with a composition according to any preceding claim; wherein particles of the composition comprise a nucleic acid comprising or encoding a detectable label, wherein the said particles contact the cells and introduce therein the nucleic acid, wherein optionally the label is expressed in the cells; and (b) detecting that E coli cells comprising the label.

7. A method for modifying the genomes of E coli cells, the method comprising contacting the cells with a composition of any preceding claim, wherein nucleic acid encoding the POI is introduced into the cells thereby modifying the genomes of the cells.

8. The method of claim 6 or claim 7, wherein: a) the sample is a patient sample (eg, blood, urine, stool or saliva sample), wherein the subject is a transplant or cancer patient (optionally a haematological cancer patient), or wherein the patient is suffering from or at risk of a urinary tract infection (UTI); and optionally wherein the transplant is a solid organ or stem cell transplant (optionally a haematopoietic cell transplant); and / or b) wherein at least 1 x 107 PFU of particles are contacted with the sample; and / or c) wherein the particles are contacted with the sample at an MOI (multiplicity of infection) of at least 0.01.

9. A composition comprising a plurality of transduction particles for use in a method of treating or preventing an infection by E coli cells in a human or animal subject, wherein the method comprises administering the particles to the subject, wherein (a) each particle comprises a nucleic acid encoding a nuclease for targeting the genomes of E coli cells, wherein the said administered particles contact the cells and introduce therein the nucleic acid, wherein the nuclease is expressed in the cells and cuts genomic DNA of the cells, thereby killing the cells or reducing growth or proliferation of the cells in the subject; (b) the E coli cells are cells of E coli phylogroup B2; and (c) each particle comprises an adhesion moiety for recognising and binding to a cognate moiety selected from a LPS, LamB and Tsx displayed on the surface of the phylogroup B2 E coli cells, optionally wherein each particle comprised by the composition comprises a T-even phage capsid; optionally a capsid of a T2 phage, T2-like phage, RB69 phage or a RB69-like phage, and further optionally wherein each particle is a phage (optionally a lytic phage) or packaged phagemid.

10. A composition comprising a plurality of transduction particles for use in a method of treating or preventing an infection by E coli cells (optionally B2 phylogroup E coli cells)in a human or animal subject, wherein the method comprises administering the particles to the subject, wherein (a) each particle comprises a nucleic acid encoding a nuclease for targeting the genomes of E coli cells, wherein the said administered particles contact the cells and introduce therein the nucleic acid, wherein the nuclease is expressed in the cells and cuts genomic DNA of the cells, thereby killing the cells or reducing growth or proliferation of the cells in the subject; and (b) each particle comprised by the composition is a T-even phage capsid; optionally a capsid of a T2 phage, T2-like phage, RB69 phage or a RB69-like phage.

11. The composition of any one of claims 9 or 10, wherein: a) the composition comprises at least 3 or 4 different types of transduction particles, wherein the types have different adhesion moieties for recognising and binding to a cognate moieties comprised by E coli (optionally B2 phylogroup E coli) cells; and / or b) wherein (i) the nuclease is a guided nuclease for targeting the DNA of an E coli cell, wherein the nuclease is capable of being expressed in the cell for cutting the DNA of the cell, thereby killing the cell; (ii) each particle comprises a phage capsid containing the nucleic acid; and (iii) the particles of the composition target a plurality of different E coli genes, optionally selected from essential and virulence genes; and (iv) optionally the composition comprises A: particles which comprise a LPS adhesion moiety and a LamB adhesion moiety; B: particles which comprise a LPS adhesion moiety and a Tsx adhesion moiety; or C: : particles which comprise a Tsx adhesion moiety but is devoid of LamB and LPS adhesion moieties; and / or c) wherein the nuclease is a Cas nuclease and the nucleic acid encodes at least one crRNA or guide RNA that is operable with the Cas for DNA targeting in E coli cells; optionally wherein each crRNA or guide RNA comprises a spacer sequence that is complementary to an E coli protospacer sequence; optionally a protospacer of a B2 phylogroup E coli cell or an E coli cell of a strain selected from the group ST131, ST1193, ST648, ST315, ST405, ST361, ST88 and ST453; and further optionally wherein the protospacer sequence is comprised by a gene selected from E coli genes fimH, bolA, rpoH, lptA and murA; and even further optionally wherein the particles of the composition target all of E coli genes fimH, bolA, rpoH, lptA and murA.

12. The composition of any one of claims 9 to 11, wherein: a) the nucleotide sequence encoding comprises a stress-phase active (SPA) promoter for expression of the nuclease in E coli cells; optionally wherein the promoter is an E coli bolA promoter or comprises SEQ ID NO: 13 (or a promoter sequence that is at least 80, 90, 95, 96, 97, 98 or 99% identical to SEQ ID NO: 13); and / or b) wherein the E coli cells comprise a strain of E coli that causes sepsis, septicaemia or diarrhoea in humans or animals.

13. The composition of any preceding claim, wherein the composition is for use in: (I) a method of treating or preventing infection of by E coli cells in a human or animal subject, wherein the method comprises administering the composition to the subject; or (II) a method of treating or preventing sepsis, septicaemia or diarrhoea in a human or animal subject, the method comprising administering to the subject the composition, wherein the E coli cells comprise a strain of E coli that causes sepsis, septicaemia or diarrhoea in humans or animals.

14. The composition of claim 13, wherein: a) the subject is a transplant or cancer patient (optionally a haematological cancer patient), or wherein the patient is suffering from or at risk of a urinary tract infection (UTI); and optionally wherein the transplant is a solid organ or stem cell transplant (optionally a haematopoietic cell transplant) or wherein the transplant is a transplant of a medical device; and further optionally wherein the method is carried out prior to the subject receiving a transplant; and / or b) the composition or method is for preventing haemolytic uremic syndrome (HUS), a UTI infection, sepsis, septicaemia or diarrhoea in a human subject; and / or c)at least 1 x 107 PFU of particles are administered to the subject; or a dose of a composition according to any one of claims 1-5 wherein the dose is a dose of at least 1 x 107 PFU of said particles; and / or d) the particles are administered to the subject at an MOI (multiplicity of infection) of at least 0.01.

15. The composition, method or dose of any one of claims 9 to 14 wherein the E coli cells comprise at least one strain that is an antibiotic-resistant or MDR strain; and / or at least one B2-I strain; and optionally wherein the antibiotic is fluoroquinolone (optionally levofloxacin), carbapenem or vancomycin; and / or wherein the E coli cells comprise beta-lactamase (ESBL)-producing E coli.

Images