A targeted integration cell and use thereof

Abstract

The invention provides a cell genome site capable of being used for targeted integration of exogenous nucleic acid molecules. The site is located in a nucleic acid sequence corresponding to a cell genome NC048595.1: 454997734-455024715 of a Chinese hamster ovary CHO-K1. The cell genome sites can integrate foreign protein genes and perform stable expression. The invention also provides stable and high-yield targeted integrated cells, such as host cells derived from Chinese Hamster Ovary (CHO), methods for their production and uses thereof.

Description

(19) State Intellectual Property Office (12) Invention Patent Application (10) Application Publication Number CN 121931118 A (43) Application Publication Date 2026.04.28 (21) Application Number 202511809099.4 (22) Application Date 2025.12.03 (71) Applicant Kangyuan Bochuang Biotechnology (Beijing) Co., Ltd. Address Room 101, 1st Floor, Unit 2, Building 5, Yizhuang Biomedical Park, No. 88, Kechuang Sixth Street, East District, Yizhuang Economic and Technological Development Zone, Daxing District, Beijing 101111, China (72) Inventors Ning Jinying, Hao Feng, Zhai Yunpeng, Peng Hao (74) Patent Agency Beijing Ruiheng Xinda Intellectual Property Agency (General Partnership) 11382 Patent Attorney Zhang Wei (51) Int.CI. C12N / 5 / / 2(2006.01) C12N / 5 / / / (2006.01) C12N 5 / / 0 (2006.01) C12N / 5 / 90 (2006.01) Claims 1 page Description 17 pages Sequence Listing (Electronic Publication) Drawings 3 pages (54) Invention Title A Targeted Integration Cell and Its Application (57) Abstract This invention provides a cellular genomic locus that can be used for the targeted integration of exogenous nucleic acid molecules. The locus is located in the nucleic acid sequence of the corresponding Chinese hamster ovary CHO K1 cell genome NC_048595.1: 454997734-455024715. The cellular genomic locus can integrate exogenous protein genes and achieve stable expression. This invention also provides stable and high-yield targeted integration cells, such as host cells derived from Chinese hamster ovaries (CHO), their production methods, and their uses. V 8 IIIS 6 IZI 8 CN 121931118 A Claims 1 / 1 page 1. A cellular genomic site for targeted integration of exogenous nucleic acid molecules, said site being located in the nucleic acid sequence corresponding to the genome of Chinese hamster egg MCH0-K1 cells NC_048595.1: 454997734-455024715. 2. The cellular genomic site according to claim 1, characterized in that the cellular genomic site is located in the nucleic acid sequence corresponding to the nucleotide sequence shown in SEQ ID NO: 1; preferably, the cellular genomic site is located in the nucleic acid sequence corresponding to the nucleotide sequence shown in SEQ ID NO: 2; more preferably, the cellular genomic site is located in the nucleic acid sequence corresponding to the nucleotide sequence shown in SEQ ID NO: 3; more preferably, the cellular genomic site is located in the nucleic acid sequence corresponding to the nucleotide sequence shown in SEQ ID NO: 4. 3. The application of the cellular genomic site according to claim 1 or 2 in targeted integration of exogenous nucleic acid molecules. 45. The application according to claim 3, characterized in that the targeted integration is achieved through homology-directed repair (HDR); preferably, the exogenous nucleic acid molecule is a DNA molecule, such as a single-stranded DNA molecule or a double-stranded DNA molecule, for expressing one or more exogenous proteins; preferably, the application further comprises expressing one or more exogenous proteins in cells. 6. The application according to claim 3 or 4, characterized in that the exogenous nucleic acid molecule comprises: a first recombinant recognition sequence and a second recombinant recognition sequence recognized by a recombinase, one or more expression cassettes located between the first recombinant recognition sequence and the second recombinant recognition sequence, the expression cassette comprising the exogenous nucleic acid sequence and a promoter driving its expression; preferably, the exogenous nucleic acid sequence is a nucleic acid sequence or gene encoding a target protein (POI), a selection marker, and / or a reporter protein; more preferably, the exogenous nucleic acid molecule further comprises a 5' homology arm and a 3' homology arm, each comprising a nucleotide sequence homologous to the nucleic acid sequence surrounding the cellular genomic site according to claim 1 or 2. 6. A nucleic acid molecule comprising: a first recombinant recognition sequence and a second recombinant recognition sequence recognized by a recombinase, and one or more expression cassettes located between the first recombinant recognition sequence and the second recombinant recognition sequence, the expression cassettes comprising a foreign nucleic acid sequence and a promoter driving its expression. 7. The nucleic acid molecule of claim 6, wherein the nucleic acid molecule is a DNA molecule, such as a single-stranded DNA molecule or a double-stranded DNA molecule; preferably, the foreign nucleic acid sequence is a nucleic acid sequence or gene encoding a target protein (POI), a selection marker, and / or a reporter protein; more preferably, the nucleic acid molecule further comprises a 5' homology arm and a 3' homology arm, each comprising a nucleotide sequence homologous to a sequence surrounding a cellular genomic site as described in claim 1 or 2. 8. A targeted integration cell comprising the nucleic acid molecule of claim 6 or 7. 9. A method for preparing the targeted integration cell of claim 8, the method comprising: targeting the integration of the nucleic acid molecule into a host cell via homology-directed repair (HDR). 10. A protein production method comprising: culturing the targeted integration cell of claim 8 and collecting the protein expressed by the nucleic acid molecule. 2 CN 121931118 A Specification 1 / 17 pages A Targeted Integrating Cell and Its Application Technical Field

[0001] This invention belongs to the fields of biotechnology and genetic engineering, specifically involving specific sites in the cell genome and their application in constructing targeted integrating cells. Background Art

[0002] In the field of biopharmaceuticals, Chinese hamster ovary (CHO) cells are the mainstream host cells for producing recombinant protein drugs (such as monoclonal antibody drugs). In traditional cell line development, the target gene mainly enters through random integration.Host genome. Due to the "position effect" of the genome, exogenous target genes are very likely to be inserted into heterochromatin regions or transcriptionally silent regions, resulting in low and unstable protein expression levels. In addition, the clonal heterogeneity caused by random integration makes the process of screening high-yield and stable-yield cell lines highly unpredictable, often requiring months of large-scale screening, and it is difficult to ensure batch consistency of the production process.

[0003] To overcome the limitations of random integration, site-specific integration (SSI) technology has emerged. SSI integrates the transgene encoding the target recombinant protein into a pre-set genomic site, which is an effective way to produce clones with higher consistency and shorten the cell line development cycle. SSI has become a very promising strategy for developing exogenous expression host cells (such as CHO cell lines), which allows research teams to repeatedly target preferred genomic sites that have been proven to have high activity and stable expression characteristics.

[0004] Currently, various technologies, such as Cre / LoxP, Flp / FRT recombinase systems, and CRISPR / Cas9 gene editing technology, have been used to achieve site-specific integration, and multiple sites that can be used to integrate exogenous target genes to stably express target proteins have been reported in the art. Compared with random integration, site-specific integration using highly active genomic sites significantly improves the efficiency and accuracy of integration.

[0005] However, providing more universal, efficient, and long-term stable highly active genomic sites for achieving site-specific integration remains a core task in the art. Summary of the Invention

[0006] To solve the above-mentioned technical problems, one object of the present invention is to provide a cell genomic site. The cell genomic site allows the insertion of exogenous genes, supports high-level transcription of exogenous genes and maintains the genetic stability of exogenous genes during cell passage, and when exogenous genes are integrated into the site, the normal function of the cell is not disrupted, and the phenotype and growth stability of the cell can be maintained.

[0007] Another object of the present invention is to provide the application of the cell genomic site for targeted integration of exogenous nucleic acid molecules. [ooos] Another object of the present invention is to provide a nucleic acid molecule for gene-targeted integration based on the site and a recombinant cell obtained by integration, as well as the application of said nucleic acid molecule and recombinant cell in the production of recombinant proteins, particularly antibody drugs.

[0009] The technical solution of the present invention is as follows.

[0010] First aspect

[0011] Provides a cellular genomic site that can be used for targeted integration of exogenous nucleic acid molecules, said site being located in the nucleic acid sequence corresponding to the genome NC_048595.1: 454997734-455024715 of the Chinese hamster ovary CHO-K1 cell on page 2 / 17 of the specification of 3 CN 121931118 A.

[0012] Further, the cell genomic site is preferably located in the nucleic acid sequence corresponding to the nucleotide sequence shown in SEQ ID NO: 1; the nucleotide sequence shown in SEQ ID NO: 1 is CHO cell genome NC_048595.1: 455009789-455017197. More preferably, the cell genomic site is located in the nucleic acid sequence corresponding to the nucleotide sequence shown in SEQ ID NO: 2; the nucleotide sequence shown in SEQ ID NO: 2 is CHO cell genome NC_048595.1: 455012801-455016320. Further preferably, the cell genomic site is located in the nucleic acid sequence corresponding to the nucleotide sequence shown in SEQ ID NO: 3; the nucleotide sequence shown in SEQ ID NO: 3 is CHO cell genome NC_048595.1: 455014081-455014880». Particularly preferably, the cell genomic site is located in the nucleic acid sequence corresponding to the nucleotide sequence shown in SEQ ID NO: 4; the nucleotide sequence shown in SEQ ID NO: 4 is CHO cell genome NC_048595.1: 455014170-455014757.

[0013] Further, the nucleic acid sequence may be a nucleic acid sequence contained in a eukaryotic cell genome. The eukaryotic cells can be mammalian cells, preferably Chinese hamster ovary (CHO) cells, including but not limited to CHO-K1, CHO-S, CHO-DG44, CHO_DXB11 (DUXB11), CHO_GS knockout cell lines (such as CHO-K1SV GS-KO), ExpiCHO cell lines; human embryonic kidney cells, including but not limited to HEK293, HEK293T, HEK293F, HEK293E, Expi293; human retinal cells (such as PER.C6); human amniotic fluid cells (such as CAP-T); mouse myeloma cells, such as NSO, Sp2 / O; African green monkey kidney cells (Vero); young hamster kidney cells (BHK), etc.

[0014] Second aspect

[0015] The present invention provides the application of the cell genomic sites described in the first aspect in the targeted integration of exogenous nucleic acid molecules, wherein the application is to target the integration of exogenous nucleic acid molecules into the cell genomic sites. The targeted integration can be achieved through homology-directed repair (HDR).

[0016] The exogenous nucleic acid molecule can be a DNA molecule, such as a single-stranded DNA molecule or a double-stranded DNA molecule, used to express one or more exogenous proteins. Further, the application described in this aspect further includes the expression of one or more exogenous proteins in cells.

[0017] According to a specific embodiment of the present invention, the exogenous nucleic acid molecule may comprise: a first recombinant recognition sequence and a second recombinant recognition sequence recognized by a recombinase, and one or more expression cassettes located between the first recombinant recognition sequence and the second recombinant recognition sequence, the expression cassette comprising the exogenous nucleic acid sequence and a promoter driving its expression.

[0018] The first recombinant recognition sequence and the second recombinant recognition sequence may be generated by a recombinase. Optionally, the recombinase may be a tyrosine recombinase or a serine recombinase. For example, the tyrosine recombinase is Cre recombinase or FLP recombinase; the serine recombinase is Bxbl integrase or OC31 integrase.

[0019] Accordingly, the first recombinant recognition sequence and the second recombinant recognition sequence may comprise sites that can be recognized by a tyrosine recombinase (e.g., FRT sites or Lox sites, such as LoxP, Lox71, Lox66, etc.), or sites that can be recognized by a serine recombinase (e.g., att sites, such as attB, attP, attL, attR, etc.).

[0020] According to a specific embodiment of the present invention, the first recombination identification sequence and the second recombination identification sequence may independently include the following sequences: LoxP sequence, LoxPL3 sequence, LoxP 2L sequence, LoxFas sequence, Lox511 sequence, Lox2272 sequence, Lox2372 sequence, Lox5171 sequence, Loxm2 sequence > Lox71 sequence > Lox66 sequence, FRT sequence, Bxbl attP sequence, Bxbl attB sequence, attP sequence, attB sequence, attL sequence, and attR sequence.

[0021] Preferably, the first recombination identification sequence and the second recombination identification sequence may independently include the following sequences: LoxP sequence, LoxPL3 sequence, LoxP 2L sequence, LoxFas sequence > Lox511 sequence > Lox2272 sequence > Lox2372 sequence, Lox5171 sequence, Loxm2 sequence, Lox71 sequence, and Lox66 sequence. For example, the first recombination recognition sequence contains the lox71 sequence (see page 3 / 17 of CN 121931118 A specification), and the second recombination recognition site contains the lox2272 sequence; or vice versa.

[0022] The exogenous nucleic acid sequence may be a nucleic acid sequence or gene encoding a target protein (POI), a selection marker, and / or a reporter protein.

[0023] For example, the exogenous nucleic acid sequence may be a nucleic acid sequence or gene encoding one or more proteins selected from: antibodies (such as the heavy chain and / or light chain of immunoglobulins or any fragment thereof, single-chain antibodies, bispecific antibodies, nanobodies), antigen-binding fragments, fusion proteins, cytokines, growth factors, hormones, coagulation factors, enzymes, receptor proteins (such as...Chimeric antigen receptors (CARs, T-cell receptors (TCRs)), structural proteins, or functional fragments thereof.

[0024] For example, the exogenous nucleic acid sequence may be a nucleic acid sequence or gene encoding a selection marker and / or a reporter protein, such as antibiotic resistance genes (e.g., resistance genes against genistein, puromycin, neomycin, hygromycin, bleomycin), metabolic selection marker genes (e.g., glutamine synthetase GS gene, dihydrofolate reductase DHFR gene, thymidine kinase gene), and fluorescent protein or luminescent protein genes (e.g., GFP, RFP, luciferase gene).

[0025] Depending on the purpose, the exogenous nucleic acid sequence may be any one or more of the above-mentioned nucleic acid sequences or genes.

[0026] According to a specific embodiment of the present invention, the exogenous nucleic acid sequence is a nucleic acid sequence or gene encoding a selection marker and / or a reporter protein, that is, the expression cassette may contain a nucleic acid sequence or gene encoding a selection marker and / or a reporter protein, and optionally a promoter driving its expression.

[0027] According to a specific embodiment of the present invention, the exogenous nucleic acid sequence is a nucleic acid sequence or gene encoding a target protein (POI), that is, the expression cassette may contain a nucleic acid sequence or gene encoding a target protein (POI) and optionally a promoter driving its expression.

[0028] The expression cassette may contain one or more promoters driving the expression of the exogenous nucleic acid sequence, and the promoter may be selected from one or more of the following: CMV promoter, SV40 promoter, RSV promoter, p-globin promoter, UBC promoter, EFi promoter, ubiquitin promoter, p-actin promoter, PGK1 promoter, Rosa26 promoter, HSP70 promoter, GAPDH promoter, Eif4A1 promoter, Egr1 promoter, FerH promoter, SM22a promoter, or Endothelin-1 promoter.

[0029] Further, the exogenous nucleic acid molecule can be a vector, such as a lentiviral vector, adenovirus vector, adeno-associated virus vector, herpesvirus vector, poxvirus vector, baculovirus vector, papillomavirus vector, papillomavirus vector, integrative phage vector, A-virus vector, transposon and / or transposase, integrase substrate, or plasmid.

[0030] Preferably, the nucleic acid molecule is a donor vector or a targeting plasmid. More preferably, the nucleic acid molecule is a homologous recombination donor plasmid or a donor plasmid for recombinase-mediated cassette exchange; the plasmid can be supercoiled circular DNA, relaxed circular DNA, or linearized DNA.

[0031] Further, the exogenous nucleic acid molecule may also include a 5' homology arm (HA) and a 3' homology arm, thereby having from the 5' to the 3' end [5' homology arm] - [first recombination recognition sequence] - [one or more][Expression cassette] - [Second recombination recognition sequence] - [3' homologous arm] structure.

[0032] The 5' homologous arm and 3' homologous arm each contain nucleotide sequences homologous to the nucleic acid sequences surrounding the cellular genomic sites described in the first aspect of the invention.

[0033] Further, the 5' homologous arm and 3' homologous arm each contain nucleotide sequences of 15-10000 bases in length. Preferably, the 5' homologous arm and 3' homologous arm each contain nucleotide sequences of 100-5000 bases in length, more preferably 300-4000 bases in length, more preferably 500-3000 bases in length, further preferably 600-2000 bases in length, and particularly preferably 800-1500 bases in length.

[0034] Further, the 5' homologous arm comprises a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher, or even 100%, sequence identity with the nucleotide sequence shown in SEQ ID NO: 13; and / or, the 3' homologous arm comprises a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher, or even 100%, sequence identity with the nucleotide sequence shown in SEQ ID NO: 14.

[0035] Third aspect

[0036] The present invention provides a nucleic acid molecule comprising: a first recombination recognition sequence and a second recombination recognition sequence recognized by a recombinase, and one or more expression cassettes located between the first recombination recognition sequence and the second recombination recognition sequence, the expression cassette comprising a foreign nucleic acid sequence and a promoter driving its expression.

[0037] The nucleic acid molecule may be a DNA molecule, such as a single-stranded DNA molecule or a double-stranded DNA molecule.

[0038] The first recombination recognition sequence and the second recombination recognition sequence may be generated by a recombinase. Optionally, the recombinase may be a tyrosine recombinase or a serine recombinase. For example, the tyrosine recombinase is Cre recombinase or FLP recombinase; the serine recombinase is Bxb1 integrase or ①C31 integrase.

[0039] Accordingly, the first recombination recognition sequence and the second recombination recognition sequence may contain sites that can be recognized by a tyrosine recombinase (e.g., FRT sites or Lox sites, such as LoxP, Lox71, Lox66, etc.), or sites that can be recognized by a serine recombinase (e.g., att sites, such as attB, attP, attL, attR, etc.).

[0040] According to a specific embodiment of the present invention, the first recombination identification sequence and the second recombination identification sequence may independently include the following sequences: LoxP sequence, LoxPL3 sequence, LoxP 2L sequence, LoxFas sequence, Lox511 sequence, Lox2272 sequence, Lox2372 sequence, Lox5171 sequence, Loxm2 sequence, Lox71 sequence, Lox66 sequence, FRT sequence, Bxbl attP sequence, Bxbl attB sequence, attP sequence, attB sequence, attL sequence, and attR sequence.

[0041] Preferably, the first recombination identification sequence and the second recombination identification sequence may independently include the following sequences: LoxP sequence, LoxPL3 sequence, LoxP 2L sequence, LoxFas sequence, Lox511 sequence, Lox2272 sequence, Lox2372 sequence, Lox5171 sequence, Loxm2 sequence, Lox71 sequence, and Lox66 sequence. For example, the first recombination recognition sequence contains the lox71 sequence, and the second recombination recognition site contains the lox2272 sequence; or vice versa.

[0042] The exogenous nucleic acid sequence may be a nucleic acid sequence or gene encoding a target protein (POI), a selection marker, and / or a reporter protein.

[0043] For example, the exogenous nucleic acid sequence may be a nucleic acid sequence or gene encoding one or more proteins selected from: antibodies (such as the heavy chain and / or light chain of immunoglobulins or any fragment thereof, single-chain antibodies, bispecific antibodies, nanobodies), antigen-binding fragments, fusion proteins, cytokines, growth factors, hormones, coagulation factors, enzymes, receptor proteins (such as chimeric antigen receptors CAR, T-cell receptors TCR), structural proteins or functional fragments thereof.

[0044] For example, the exogenous nucleic acid sequence may be a nucleic acid sequence or gene encoding a selection marker and / or a reporter protein, such as antibiotic resistance genes (e.g., resistance genes against genistein, puromycin, neomycin, hygromycin, bleomycin), metabolic selection marker genes (e.g., glutamine synthase GS gene, dihydrofolate reductase DHFR gene, thymidine kinase gene), and fluorescent protein or luminescent protein genes (e.g., GFP, RFP, luciferase gene).

[0045] Depending on the purpose, the exogenous nucleic acid sequence may be any one or more of the above-mentioned nucleic acid sequences or genes.

[0046] According to a specific embodiment of the present invention, the exogenous nucleic acid sequence is a nucleic acid sequence encoding a selection marker and / or a reporter protein, that is, the expression cassette may contain a nucleic acid sequence or gene encoding a selection marker and / or a reporter protein and optionally a promoter driving its expression.

[0047] According to a specific embodiment of the present invention, the exogenous nucleic acid sequence is a nucleic acid sequence encoding a target protein (roi).The expression cassette may contain a nucleic acid sequence or gene encoding a target protein (POI) and optionally a promoter to drive its expression.

[0048] The expression cassette may contain one or more promoters to drive the expression of the transgene, which may be selected from one or more of the following: CMV promoter, SV40 promoter, RSV promoter, p-globin promoter, UBC promoter, EF1a promoter, ubiquitin promoter, P-actin promoter, PGK1 promoter, Rosa26 promoter, HSP70 promoter, GAPDH promoter, Eif4A1 promoter, Egr1 promoter, FerH promoter, SM22a promoter, or Endothelin-1 promoter.

[0049] The nucleic acid molecule may be a recombinant DNA vector, such as a lentiviral vector, adenovirus vector, adeno-associated virus vector, herpesvirus vector, poxvirus vector, baculovirus vector, papillomavirus vector, papillomavirus vector, integrative phage vector, non-viral vector, transposon and / or transposase, integrase substrate, or plasmid.

[0050] Preferably, the nucleic acid molecule is a donor vector or a targeting plasmid. More preferably, the nucleic acid molecule is a homologous recombination donor plasmid or a donor plasmid for recombinase-mediated cassette exchange; the plasmid may be supercoiled circular DNA, relaxed circular DNA, or linearized DNA.

[0051] Further, the nucleic acid molecule also includes a 5' homologous arm and a 3' homologous arm, thereby having a structure from the 5' to the 3' end: [5' homologous arm] - [first recombination recognition sequence] - [one or more expression cassettes] - [second recombination recognition sequence] - [3' homologous arm].

[0052] The 5' homologous arm and the 3' homologous arm each comprise a nucleotide sequence homologous to the nucleotide sequence surrounding the cellular genomic site described in the first aspect of the invention.

[0053] Further, the 5' homologous arm and the 3' homologous arm each comprise a nucleotide sequence of 15-10000 bases in length. Preferably, the 5' homologous arm and the 3' homologous arm each comprise a nucleotide sequence of 100-5000 bases in length, more preferably 300-4000 bases in length, more preferably 500-3000 bases in length, further preferably 600-2000 bases in length, and particularly preferably 800-1500 bases in length.

[0054] Further, the 5' homologous arm contains at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher, or even 100%, sequence homology with the nucleotide sequence shown in SEQ ID NO: 13.The nucleotide sequence is homologous; and / or, the 3' homologous arm comprises a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher, or even 100%, sequence identity with the nucleotide sequence shown in SEQ ID NO: 14.

[0055] Fourth aspect

[0056] A targeted integration cell is provided, the targeted integration cell comprising the nucleic acid molecule described in the third aspect of the invention. The targeted integration cell can be obtained by targeted integration of the nucleic acid molecule into a host cell. The targeted integration can be achieved by homology-directed repair (HDR) and optionally recombinase-mediated cassette exchange (RMCE).

[0057] The host cell may be a eukaryotic cell. The eukaryotic cells may be mammalian cells, preferably Chinese hamster ovary (CHO) cells, including but not limited to CHO-KI, CHO-S, CHO-DG44, CHO-DXB11 (DUXB11), CHO-GS knockout cell lines (such as CHO-K1SV GS-KO), ExpiCHO cell lines; human embryonic kidney cells, including but not limited to HEK293, HEK293T, HEK293F, HEK293E, Expi293; human retinal cells (such as PER. C6); human amniotic fluid cells (such as CAP-T); mouse myeloma cells, such as NSO, Sp2 / O; African green monkey kidney cells (Vero); young hamster kidney cells (BHK), etc.

[0058] Preferably, the host cell is a Chinese hamster ovary (CHO) cell, such as CHOK1, CHO-S, CHO-DG44, CHO-DXB11 (DUXB11), CHO_GS knockout cell line (such as CHO-K1SV GS-KO), ExpiCHO cell line; more preferably, the host cell is a CHO-K1 cell. 7 CN 121931118 A Specification 6 / 17 pages

[0059] Fifth aspect

[0060] The present invention also provides a method for preparing the targeted integrated cell described in the fourth aspect, the method comprising: targeting and integrating the nucleic acid molecule into the host cell through homology-directed repair (HDR).

[0061] Further, the homology-directed repair can be mediated by a CRISPR / Cas9 system.

[0062] In the CRISPR / Cas9 system, the sgRNA sequence can target the nucleotide sequence shown in SEQ ID NO: 3.

[0063] Preferably, the CRISPR / Cas9 system contains the following sgRNA sequences: -

[0064] GGACAGGCATTTCCTACGGG (SEQ ID NO: 5);

[0065] TGGGACAGGCATTTCCTACG (SEQ ID NO: 6);

[0066] CATCGAAGTCCAAGTTTTAT (SEQ ID NO: 7) □

[0067] According to a specific embodiment of the present invention, the preparation method includes the following steps: introducing the nucleic acid molecule, the sgRNA, and the Cas enzyme into the host cell to induce genetic damage and achieve homologous targeted repair using the nucleic acid molecule as a template; and then screening to obtain targeted integration cells.

[0068] In the above steps, preferably, the nucleic acid molecule and the co-expression plasmid of the sgRNA and the Cas enzyme are introduced into the host cell. More preferably, the nucleic acid molecule and the co-expression plasmid of the sgRNA and the Cas enzyme are introduced into the host cell by electrotransfection.

[0069] Optionally, the preparation method further includes the following steps: replacing the exogenous nucleic acid sequence of the targeted integrated nucleic acid molecule in the obtained cell with other target genes by recombinase-mediated cassette exchange (RMCE). For example, in the case where the nucleic acid molecule contains a selectable marker gene and a reporter gene, the selectable marker gene and the reporter gene are replaced with antibody heavy chain and / or light chain encoding genes.

[0070] Sixth aspect

[0071] The present invention also provides a protein production method, the method comprising: culturing the targeted integrated cells described in the fourth aspect of the present invention, and collecting the protein expressed by the nucleic acid molecule.

[0072] Compared with the prior art, the inventors of the present invention have discovered a genomic site in the genome of Chinese hamster ovary (CHO) cells. Numerous experiments have shown that this site allows the insertion of exogenous nucleic acid sequences, supports high-level transcription of exogenous nucleic acid sequences and maintains the genetic stability of exogenous nucleic acid sequences during cell passage. Furthermore, when exogenous nucleic acid sequences are integrated into this site, the normal function of the cell is not disrupted, and the phenotype and growth stability of the cell can be maintained.

[0073] Based on the above findings, the present invention provides the application of the genomic site in the targeted integration of exogenous nucleic acid molecules and a targeted integration cell, which is constructed by targeted integration of exogenous nucleic acid molecules into the specific site. Experiments have shown that this targeted integration cell has the advantages of high expression of exogenous nucleic acid molecules and stable passage. Furthermore, due to its robust and high-yield characteristics, this cell has low requirements for subsequent culture processes (e.g., culture conditions, culture medium formulation, etc.) and exhibits good performance.Adaptability. Furthermore, because the exogenous nucleic acid molecule insertion site provided by this invention is determined, compared to traditional random integration cell construction methods, the construction process required for the targeted integration cells of this invention is simpler, significantly shortening development time. While improving efficiency and reducing costs, it greatly reduces the uncertainty of the development process, exhibiting excellent reproducibility and controllability.

[0074] Moreover, the targeted integration cell line provided by this invention can serve as a platform cell, laying the foundation for the subsequent development of recombinant protein expression cells. For example, when the purpose is antibody expression or production, the recombinase recognition site contained in the targeted integration cell line provided by this invention can serve as a "landing pad," used to efficiently and accurately replace the integrated exogenous nucleic acid molecule with antibody light and heavy chain coding genes through recombinase-mediated cassette exchange (RMCE) technology, thereby rapidly constructing antibody expression cell lines. 7 / 17 pages of accompanying drawings

[0075] The embodiments of the present invention will be described in detail below with reference to the accompanying drawings, wherein:

[0076] Figure 1: Plasmid map of the donor repair plasmid in Example 1.

[0077] Figure 2: Statistical graph of EGFP expression level in the targeted integration cell line in Example 1.

[0078] Figure 3: Statistical graph of the stability verification of the targeted integration cell line after continuous passage in Example 1.

[0079] Figure 4: Plasmid map of the target product used for expression in Example 2 of the present invention.

[0080] Figure 5: Statistical graph of antibody expression level in the targeted integration cell line after RMCE in Example 2 of the present invention. Detailed Description of Embodiments

[0081] In order to make the purpose, technical solution, embodiments and beneficial effects of the present invention clearer, the present invention will be further described in detail below with reference to the accompanying drawings.

[0082] It should be understood that the specific embodiments and embodiments described herein are only used to illustrate the present invention and are not intended to constitute any form of limitation on the scope of protection of the present invention. The fundamental purpose of providing these embodiments is to enable those skilled in the art to more thoroughly understand the contents disclosed in this application.

[0083] This invention can be implemented in various specific forms and should not be limited to the embodiments described herein. Any modifications, equivalent substitutions, or improvements made by those skilled in the art based on the core ideas disclosed in this application without departing from the spirit and scope of this invention should be considered to fall within the protection scope of this application. Furthermore, for ease of understanding, the following description may contain numerous specific details; however, those skilled in the art should understand that the implementation of this invention does not necessarily depend on all of these specific details.

[0084] Unless the context otherwise requires, all technical and scientific terms used herein have the same meaning as those to which this invention pertains.The terms used in this specification are generally understood and agreed upon by those skilled in the art. They are intended only to describe specific embodiments and are not intended to limit the invention.

[0085] Unless otherwise specified, ordinal numbers such as “first” and “second” used in the context of this invention are used only to distinguish different technical features and do not represent any limitation in order, relative importance, or quantity.

[0086] Numerical ranges mentioned in the context of this invention should be understood to include both endpoints and all consecutive values ​​and subranges within that range. For example, the numerical range “1 to 10” includes 1 and 10 and all values ​​in between; if it refers to integers within that range, it includes 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10.

[0087] The use of “about” or “approximately” to modify numerical values ​​in the context of this invention indicates that the value is within an acceptable error range that can be determined by those skilled in the art, which depends in part on the measurement method or limitations of the system. For example, "about" or "approximately" can refer to a range of ±10%, preferably ±5%, more preferably ±1% of the given modified value; in biological systems or processes, "about" or "approximately" can also refer to a range of one order of magnitude, 5 times, or 2 times.

[0088] Regarding the percentages (%) used in the context of this invention, unless otherwise specified, % (w / w) or wt% refers to weight percentage, % (v / v) refers to volume percentage, and % (w / v) refers to mass-volume percentage.

[0089] The term "antibody" as used in the context of this invention is used in its broadest sense, covering a variety of structures, including but not limited to monoclonal antibodies, polyclonal antibodies, multispecific antibodies (such as bispecific antibodies), and antibody fragments, as long as they retain the desired antigen-binding activity. The term "antibody fragment" as used in the context of this invention refers to a molecule containing a portion of the antigen-binding region of an antibody, such as Fv, Fab, Fab', F(ab')2, scFv, biantibodies, and linear antibodies, etc. 9 CN 121931118 A Specification 8 / 17 pages

[0090] In the context of this invention, the term "targeted integration cell" is used interchangeably with the term "site-specific integration," both referring to cells in which exogenous nucleic acid molecules, exogenous nucleotide sequences, or exogenous genes have been introduced. This term also includes the progeny of such cells, regardless of how many generations they have undergone. It should be understood that the nucleic acid content of the progeny may not be entirely consistent with the parent due to mutations, but as long as it retains the same function or biological activity as the initially transformed cell, it is covered by this term.

[0091] In the context of this invention, the term "vector" (or "recombinant vector") refers to a nucleic acid tool capable of carrying another nucleic acid molecule linked to it into a host cell and amplifying it. The vector can be a self-replicating, independently existing...The structure, such as a plasmid, can also be a sequence integrated into the host cell genome. If the vector contains a regulatory element (such as a promoter) that drives the expression of the nucleic acid it is linked to, it is called an "expression vector".

[0092] In the context of this invention, the term "homologous" (or "homologous sequence") refers to nucleic acid or protein sequences that show significant sequence similarity after alignment. The similarity or identity of two sequences can be about 70%, 80%, 90%, 95%, 99% or higher. Alignment can be performed using standard algorithms and programs such as BLAST and FASTA.

[0093] In the context of this invention, the term "integration site" refers to a specific nucleic acid location in the cell genome for inserting a foreign nucleotide sequence. This location can be between two adjacent nucleotides or any point in a nucleotide sequence.

[0094] Compared with the prior art, this invention identifies a site-specific insertion or targeted integration site in the cell genome that can highly express foreign nucleic acid molecules and has high stability. The site can be located in the genome of Chinese hamster ovary CHO-K1 cells NC_048595.1:454997734-455024715; further located in the following sequence:

[0095] SEQ ID NO: 1:

[0096] AAAAAGCAACTACTAGTCTCAAATATTTTTCACTGATATGGCTTTTTATATATTGATACAAATTTAAGG TTATTTTTGTTAGAGTGATATATAGTTTAAGGTATTGTACCTATGCAACTCATTTAAAAATGTAACGTTATGGTGGC GCACGCCTTTAATCCCAGCACTCAGGAGGCTGAGGCAGGCGGATCTCTGAGTTCGAGGCCAGCCTGGTCTACAAA GTGAGTTCCAGGATAGGCTCCAAAGCTACACAGAGAAACCCTGTCTCGAAAAACCTAAAAAACCCAATTAAACTTGT AAGGGTATAGGTAGAGACAGAAGTAAGCTTTATTATTTAGCCTCATGTATATATGTTTTCAAGGTTCAACATATATT TTAATTAGCTAGATGGTCTTCAAACATGTCAGAGATCTACAGAATATGTCATTTAAGATGTTTTAGTATCAGGGCTT CTCATAACAGTGAGACAGACCAGCTTACTGGCAGCACCAATCTACTGCAAAGAAGATGATGGGCATCGAAGAACCTCCATATGGAGTTTGCTTTAAATGTGGCAAAGCTAGCCACTGGGCAGGAAACTGCCCTTGCCTCAACTCCTGACAGTAT GCTGTCCAAATTAGATAAGCAGGACACAAGAGAAGTTTGAACTTGGCTGAACTTTGCCAAGACGGGGAAGGCCAGGC CTTCAAAATTCCTGCTTCACAGAAAAGTCTGTCAGATATGCTAGGCCTATAAGCTGAAGATGGATGCCTCAGTGTTG CAGCAGAACCTTGGGGTGACTGTCCGGGGAGCCAGCTACCTCTGCCGTTTCTATAGTTTTGGAAGCTGCTTGCCCTG TACTTCCTGTTTACTCTGGTAATACTTTATCCTTCTCAAGTCTCTGATGGGGGTTTGAGATAGTTACAGTTTTCCTT GTTATCAAATTCAGAAAAGAAACTCACAAAAGAGATGTAAAGTTTATGAAGGTTGGGAGATATAAAAGCTTAAGTTT ATCTAAGAAAATGTTTCAAGGTCTAAAAGGTATCTTTAAGTTGCTAATACAAGTTATGAAAGAAAGTGATTTAGGTA CAGAGCTTGGGCTCACCAATAGAGTACTTTCTCCAAAGTTGCCAAATCAAACTGGACTGGACATTGTGACTATAATT CTTACCTGGTAATTGTTCTTATTGTATATAGTTTATTGATGTTAGAGAAAGAGCCTTTTGTTGAAGTAAAATGGGGA GATGTAACAGACAGATATTGGGGTTCAAGCTTCAAACTGAAGATCAGAAAAGCAAAGTAGCCAAGCCAGTAGATCTT ACCTCTACCCAGCTGAATGGCTGTCCTCTCTCTCCACAAACCTTCAGAGGCAAAGTTGTCAGTTCCTGTCTAACCAAGC CTCAGACTGCTGCCTCTCCCAGCATGGCTGGAGAATCAATACTTTCTATCCTCACTGTGGCTGGAGAATGAATGCCACCTCTGAGACCCTGTTCCTGTCTTAAATACCTCTCATGAGTCCTGGGATTAAAGGCGTGAGTTCTGTTACTCTTTTA GACTGATTCAATGCTCCGGTACAAGTGCCCGCCACCTTGGGCTTTTAGCACTCTGTTTTCTTGTGTGTCTCCTGTGC 10 CN 121931118 A Specification Page 9 / 17 CCATCCCTGTCCTTCCGCTATAATAAAATTGTGAATAGTTAATGGAATTTTGACAACAGTATGAAGATTCTGAAAGG TTATCCCTCATGATTTTTTTTTAAAGTTAATATAATTCATTGCAACCTGTGTGGATCATATTCTATAAATTATTCCA TTCAAGAGATAGCATTTCCAACCAATGATAACAAATGCCTTGGTTCCCATTGCATTATCTTCAGTATTAGTTTGGTA TTTCTCAGTTTACTTTAGTACCTCCCTTTAAAAGAAAAGTATGGATCTCTGTGAGTTCGAGGCCAGCCTGGTCTACA GAGCGAGTGCCAGGATAGGCTCCAAAGCTACACAGAGAAACCCTGTCTCGAAAAACCAAAAAAATAAAATAAAATAA AAGTATAATCCAGGCCTCAATGTTGATTTATTGTGTGTCTCAAACTCACCATAGCTAAAACTGTTCTTGAACTCGTG ACCTTAATGCCACTACCTCCCAAGAATTCACCAGCAAACCTGGTGAATATATATAGTTGATATAACATTTATATTTA TACACATAATTCTTTTTTATTTAATTAATTTACTTTGCATCCTGACTGTCGTTTCCCCTCCCTCCCCTCCTCCTACT CCCTCCCCCTAGCAGGCCCCCTCCCCCAGTCCACTCTTCTGTTTCTGTTCAGGTCTCCCATGAGTATCAACAAAGCA TGGTTTATCAAGTTGCAGTAAGACTAAACACCTCCCCTTGTATTAAGGCTGGGCAGCGCAACCCAGTAGGAGGAATAGGTTCCCATGAGCCAGCCAAAGAATCAGGGACAGCCCTGCTCCCATTGTTAGGAGTCCCACAAGTAGACCAAGCTAC ACAGCCGTTACACCTGGGTAGTGCCTAGGACGGTCCCCATAAGGTAATTCTTACATAGCTATAATCATGTTACAAAT TAAAAGAAACAGCTGAGCATTGGTGGCACACGCCTTTAATCCCAGCACTCGGAAGGCAGAGGCAGGCGGATCTCTGT GAGTTCGAGGCCAGCCTGGTCCTCAGAGCGAGTGCCAGGATAGCCTCCAGAGCTACACAGAGAAACCCTGTCTCGAA AAACAAAATAAAATAAAATAAAAAATAAAAAATTAAAAGAAACAAACTAAATGGATGATATTGATATTGCGTGGATT TTTGAAATGTGGTTTCATGTATTAATTAGGGCTTTCCCTGACCTAGTCCAGGTTTGTCGTCAAGGCGCCTCAACAAT ACGCCTGCCTCCACTTCTACTCTAGTTGCCACCAGCTTATCACCTCTGTGCGGAAAGAACTTCCCATTTTCTTTGAT TTAGCTTCTTGCACTATACTCAGCATAAGAAAGGCACCCAACAAATCTTTTAGCGAACGAAAACCTTTTGTGTAATG CCAATAGTTTGCCTACTCAGTCTCTGGTTGGAACTATGATATTATGTATCAATGAAAGCACTTTTTGCTCCAAGTAA CAGGAGACTTAAGTAGATTAAACAATGTCAGGTTTACTGTGTCACATGAAAACCATCAATGACTCCAGTTCCAGGGG ATCTGATGCCCCCTTCTGACCTCTGTGGGCACCAGAGATGAGCACGGTGAACATACATTCGGGGAGAACACTCATAC ACATAAATAAATCTAACTTTTTAAAGGCCTTTTTAGGACTGGCAAGGTGACTGAGCAGGTAAGGGTACTTGAACCAAACCTGAAGACCTGATTTTGATCCTAGATGATGGCAGGAGACAACAGACTCCCCCAAACTGTACTCTGACCTCCACAA GGGTGCCATGGTGTACAAATGCCCATAACAAACGTGTGAGCATGAACACACACACACACACACACACACAGTTTAAAAGGG GCCTTTAAACAGGTTTAAGTATAATATAGTTAATAAAGAGATTGTTTGGGGCTGGGAAAAGGTGGCTCAGCGGTTAAAGAG CACTGATTGTTCTCCAGAGGTCCTGAGTTCAATTCTCGGCAATCACATGGTGGCTCCAAACCATCTTGCATGAGAT CTGGTGCCCCCTGCTGGCGTGCAGGAAGACTGTATACATAATAAATAAATAAAATCTTTTAAAAAATTCAAAAAATCCAAAAGTATGGGTGTGTTTCTCAAAGGAGAGTTGCTTCATTTG TGTATTCTGTGGCCAAACATACAGTTTTGGTGAATTCTGAAAATTTTTTCAAATGGTTGCTATGTAATTTAAATG GGAACTAGAGAGTTGGTTCAGTGGTTAAGAGCACTGGTTGCTCTAGCAGAGGATATAGTTACATTTCTCTGCACCTA CAGGAGAGCTCACAGCCATCCTTAGCTCCAGTTCCAGGGGACCTGATGCCCTCTTCTGGCCTCTCCAGGCACCAGGC AGGCAAGTAATATACAAACATGTATGCAGGTATAACACCCATACACGTAAAATTTTAAAATAATTTTTCAAAGGGCT CCCTTTGTTTTTGTTTTAAAGAGTAAAAGACCTCGGGTTAAGCCTGACTCTAGACTCCAAAGTCAGGAAAA CTACTGGTAGAACTGAGTTCAACGGCAGGTGGTTGGTGCCACAGCTTTAACGTCAGCACTCGGGAGGAGGCAGGCAGATCTCTGTGAGTTCAAGACCAGCCTGGTCTACAAGAATTAGTTCCAGGACAGCCTCCAAAGCCACAGAGAAA CCCTGTCTCGAAAAATAAAATAAAATAAATAAATAAATACAGTTTTAGGTGCAAAGCAGATAAAGTGGCTGGGGTTG CCCGCCCCCCCCCCCCCCGTAGGAAATGCCTGTCCCAGATTAAAATCTTAGTCAGTGCCCCAGTGAGAGGCTAAGAG GGTCAGGTATATGTCCCAGCCTGCTAACCCTTATTCCAGCTAGGTCTGTGGTTCAGGCCTCCAGATCCACAGTCATC TGCTCTGCAATGGGTTGATGTGAGCTCCAGGTCCCAGCCACAAGTTTCCATGACTACCCACCCTTCCTGCTTTAGGC 11 CN 121931118 A Specification Page 10 / 17 TGAGCTTCCACCCAAAGGATGCTTCTTTCTTTCTTGGTTCTCTGTGTTTTATCAAGCCCATGCCCTGCTGGAAGCAT TCCCCATATCTAGAAAGATCTTTTTTATCATCCTACTTATTCCTCAACCTGGTGGTGTTCCTGCCTCTTTCTGCCCA GGGACTCCAATGCTCCAAGTTCTGTTGTCATCATGACAGAGAGGGGGTTCAGGTCTCTTCAGGGGGACAAGTGTGAC AAGACTTTTCCTGGGGAGATGCAACCTAAGCCTACTCACCCCAGACAGGGAGCCCATGACAGACCAAAGTAGGACAC CATCGAAGTCCAAGTTTTATTGGGATTACTTACAAGAATGGGGTGAGGGCTACTTAGAGTAGCAGAATGACTCATAG ACAGCTGCATCACCACAATCTGAAGAGTCCTAGTGTAGACAGACCAGCTGAGCTGCCTGAGTCACTGGAAGTGGTAC TTCCAGCCTGTTGAACTGCAGGCCGGCTGTGCAGTGTGCTCCCGGCTCCCAGAGCACAAATAAGTGTGAGCTGTCACTGTGCTGGGGTAGGTTTTGGCAAATTTGTATTGCTTTCACATCATGATAAACTTAAAAGGCTGTAAACCAAAGCCCT GGAAGTCTGGGATTGTAACATAAGGACGAGCTCTTCTACTACAGGCCAGCTGGCTCAGGCTTTGCCATTGACGGAGA AGGAGCGCCTCCTGGTGGAGAAGAGGAGCTCAGGCCTAGAGGGAGATTTAATCTTGCATGGACTGGACAGTTTTAAT ACCCAGAACTTTTGTGTGGTGATATTTTGTTTGTAATCTAATAAAGCTTGCCTGAAGATCAGAATGCAAAGCTGAGT CCTAGTTAGCCACACACCTAGTTAAGAGCTAAGCCACGAGCTAATCACACACACACACACACACACACACACACACA CACACACACACACACACACACAGAGAGCAAGCCACTAATTCGCTGCACACCTAAGCCACTACTTAGCTACAGAGGAC AGGCAGTGGTGACCACACCTTTTATTCCAGAACTCGGGAGACAGAGACAGATGGATCTCTGTGAGTTCCAGGCCAGC CTGGGTTACATGAGAGTGAGTCAGTCTAAAAAAGAAACAGAGCTCACATTTTTGATCCCAGCACTTGGGATGACACC ACACAAGTCATGGAAACTTGTGGCTGGGACCTGGCACTAGAGAGGACAACCTGGTCTACAGAGCTAGTTCCAGGATA GCCAGGGCTACACAAGAAACCCTGTCTCAAACAAAAACAACAACAAAAACAACTATGCCCTTGAGAACAGAAGGGAG AACAAACCTAGGCATTTTCTCGGCTACTAACTGGAGATGTTCTGCTTAGGGTACTCTCTTTCAATTGTGGGCTTCAG CCACTTCTCAGCTGTTCTAGTATTTTTCTGCTACCTGCTAAACTTGCACATTTAAAAGCTAAGCCAGGGCTAGTATGGATCATTCCTCAGATGGAACACCAACTGTTCAGATTCGGGTCCTAACTTAAGTTACTCCATATGCCCAGGTGATGAT TTTGCATGTCTGGGTGTACACTTCCCATTTCCGTAACTATGAAAATAGCTGCAGACAATAGGCTTACTTGGTTCCAT CTGAAGAGTGGGTTTGGTGGCACTCGGGTGGCAGAGGCAGGCAAATCTCTGTGAGCTTGAGGCCAGCCTGGTCTACT AAATGAGTTCTGGGGCAGGCTCCAAAGTAATACAGAGTTACCCTGTCTTGAAAAACCAAAAAAAAAAAAAAAAAAAT GGCTTTGGGTTGGGAAGAAAGTCTATGCCAATTTATCATGGGGTAGCTTATTAGCAGAAATTCCATCTCTTAATTAG AGAGGAGGGCTAAGAGAAACTCATTTGGCTCCTGGAGATGACAAAGGGAACAGCCATGGATGTGTTTCCCATTGCTT AACTCAGGACAGAATTTCTTCAGAATTTCCAACAAAATTGTAGTGGCGCCCAAGGGAACAACAGCCACATCCAACTT TGACACATACAGATTAGTCTCAATGACTTGGTAGCTCCATACCAACATTCTAGGAACACACATCTCCCAGAAAAATG TCACAACATATCAGTGTGTATGTGTTACCAGACTTAAGTCAATAAAATAAACTCCATATGCTAATATAGAAACTTAA ACATAGCTCAATGTGGAGGTACATACCTGTAAACCCAGGACTCGGAGAACAAAGGCAGGTGGATCTCTATGAGCTTG AGACCAGGCTCATCTATTGTCTAATTTAGTGAGTTCCAGGTCAGCCAGGGCTACATAGTATGATTGTTTCAAAAAGC AAAACAAGCATTAAACCTTTTGAACTTGGAGCCCGAGGAAAGCAATGAATGAAGGACGCCACCACCAATAGAAATTTTCCCTTTGTTGCTGTAGTTTTCTTGTCCCTCCAGGTTCCGCTGCCCCTCTCAGCCCCAATTAAACACACAGATACTA TATTAATTATTGAACTGTTGGCCGATGGCTAGGGCTTCTTATTGGCTAGCTCTCTCTTAATTATTATCCCATTTCTA GTAATCTAAGTACTTTCATGTGGTCTTGGCTTACCAGAGAATACCTGGACCTATTACTCCTTTGGCGTCTACATGGC GTCTCTTTGCCGCACCTCTGCCTGTCTTTCCCAGATTTCTCCTCCTCTCCTAGCCCGCCTATCTTCTGGCCTCTATT GGCCAAACAGTGTTTAGTTTATCAACCAATAAGAGAAGCACATGTGCAGAGAAACCTCTCCCATCACACCTTGTCAA CTGCAGAGGTCCTAAAGCAGCCGTC

[0097] SEQ ID NO: 2:

[0098] CAGTCTCTGGTTGGAACTATGATATTATGTATCAATGAAAGCACTTTTTGCTCCAAGTAACAGGAGACT 12 CN 121931118 A Specification Page 11 / 17 TAAGTAGATTAAACAATGTCAGGTTTACTGTGTCACATGAAAACCATCAATGACTCCAGTTCCAGGGGATCTGATGC CCCCTTCTGACCTCTGTGGGCACCAGAGATGAGCACGGTGAACATACATTCGGGGAGAACACTCATACACATAAATA AATCTAACTTTTTAAAGGCCTTTTTAGGACTGGCAAGGTGACTGAGCAGGTAAGGGTACTTGAACCAAACCTGAAGA CCTGATTTTGATCCTAGATGATGGCAGGAGACAACAGACTCCCCCAAACTGTACTCTGACCTCCACAAGGGTGCCAT GGTGTACAAATGCCCATAACAAACGTGTGAGCATGAACACACACACACACACACACAGTTTAAAAGGGGCCTTTAAACAGGTTTTAAGTATAATAGTTAATAAAGAGATTGTTTGGGGCTGGAAAGGTGGCTCAGCGGTTAAGAGCACTGATTG TTCTTCCAGAGGTCCTGAGTTCAATTCTCGGCAATCACATGGTGGCTCACAACCATCTTGCATGAGATCTGGTGCCC CCTGCTGGCGTGCAGGCAGAAGACTGTATACATAATAAATAAATAAAATCTTTTAAAAATTCAAAAAATATAGACTG TTCAGGGAAAGAGTAAAGCACACTAAAAGTATGGGGTGTGTTTCTCAAAGGAGAGTTGCACTTCATTGTGTATTCTG TGGCCAAACATACAGTTTTGGTGAATTCTGAAATTATTTTCAAATGGTTGCTATGTAATTTAAATGAGGGAACTAGA GAGTTGGTTCAGTGGTTAAGAGCACTGGTTGCTCTAGCAGAGGATAGTAGTTACATTCTCTGCACCTACAGGAGAGC TCACAGCCATCCTTAGCTCCAGTTCCAGGGGACCTGATGCCCTCTTCTGGCCTCTCCAGGCACCAGGCAGGCAAGTA ATATACAAACATGTATGCAGGTATAACACCCATACACGTAAAATTTTAAAATAATTTTTCAAAGGGCTCCCTTTGTT TTTGTTTTTAAAGAGTAAAAGACCTCGGGTTAAGCCTGACTCTAGACTGAACTCCAAAGTCAGGAAAACTACTGGTA GAACTGAGTTCAACGGCAGGTGGTTGGTGCCACACGCTTTTAACGTCAGCACTCGGGAGGCAGAGGCAGGCAGATCT CTGTGAGTTCAAGACCAGCCTGGTCTACAAGAATTAGTTCCAGGACAGCCTCCAAAGCCACAGAGAAACCCTGTCTC GAAAAATAAAATAAAATAAATAAATAAATACAGTTTTAGGTGCAAAGCAGATAAAGTGGCTGGGGTTGCCCGCCCCCCCCCCCCCCGTAGGAAATGCCTGTCCCAGATTAAAATCTTAGTCAGTGCCCCAGTGAGAGGCTAAGAGGGTCAGGTA TATGTCCCAGCCTGCTAACCCTTATTCCAGCTAGGTCTGTGGTTCAGGCCTCCAGATCCACAGTCATCTGCTCTGCA ATGGGTTGATGTGAGCTCCAGGTCCCAGCCACAAGTTTCCATGACTACCCACCCTTCCTGCTTTAGGCTGAGCTTCC ACCCAAAGGATGCTTCTTTCTTTCTTGGTTCTCTGTGTTTTATCAAGCCCATGCCCTGCTGGAAGCATTCCCCATAT CTAGAAAGATCTTTTTTATCATCCTACTTATTCCTCAACCTGGTGGTGTTCCTGCCTCTTTCTGCCCAGGGACTCCA ATGCTCCAAGTTCTGTTGTCATCATGACAGAGAGGGGGTTCAGGTCTCTTCAGGGGGACAAGTGTGACAAGACTTTT CCTGGGGAGATGCAACCTAAGCCTACTCACCCCAGACAGGGAGCCCATGACAGACCAAAGTAGGACACCATCGAAGT CCAAGTTTTATTGGGATTACTTACAAGAATGGGGTGAGGGCTACTTAGAGTAGCAGAATGACTCATAGACAGCTGCA TCACCACAATCTGAAGAGTCCTAGTGTAGACAGACCAGCTGAGCTGCCTGAGTCACTGGAAGTGGTACTTCCAGCCT GTTGAACTGCAGGCCGGCTGTGCAGTGTGCTCCCGGCTCCCAGAGCACAAATAAGTGTGAGCTGTCACTGTGCTGGG GTAGGTTTTGGCAAATTTGTATTGCTTTCACATCATGATAAACTTAAAAGGCTGTAAACCAAAGCCCTGGAAGTCTG GGATTGTAACATAAGGACGAGCTCTTCTACTACAGGCCAGCTGGCTCAGGCTTTGCCATTGACGGAGAAGGAGCGCCTCCTGGTGGAGAAGAGGAGCTCAGGCCTAGAGGGAGATTTAATCTTGCATGGACTGGACAGTTTTAATACCCAGAAC TTTTGTGTGGTGATATTTTGTTTGTAATCTAATAAAGCTTGCCTGAAGATCAGAATGCAAAGCTGAGTCCTAGTTAG CCACACACCTAGTTAAGAGCTAAGCCACGAGCTAATCACACACACACACACACACACACACACACACACACACACAC ACACACACACACAGAGAGCAAGCCACTAATTCGCTGCACACCTAAGCCACTACTTAGCTACAGAGGACAGGCAGTGG TGACCACACCTTTTATTCCAGAACTCGGGAGACAGAGACAGATGGATCTCTGTGAGTTCCAGGCCAGCCTGGGTTAC ATGAGAGTGAGTCAGTCTAAAAAAGAAACAGAGCTCACATTTTTGATCCCAGCACTTGGGATGACACCACACAAGTC ATGGAAACTTGTGGCTGGGACCTGGCACTAGAGAGGACAACCTGGTCTACAGAGCTAGTTCCAGGATAGCCAGGGCT ACACAAGAAACCCTGTCTCAAACAAAAACAACAACAAAAACAACTATGCCCTTGAGAACAGAAGGGAGAACAAACCT AGGCATTTTCTCGGCTACTAACTGGAGATGTTCTGCTTAGGGTACTCTCTTTCAATTGTGGGCTTCAGCCACTTCTC AGCTGTTCTAGTATTTTTCTGCTACCTGCTAAACTTGCACATTTAAAAGCTAAGCCAGGGCTAGTATGGATCATTCC 13 CN 121931118 A Description Page 12 / 17 TCAGATGGAACACCAACTGTTCAGATTCGGGTCCTAACTTAAGTTACTCCATATGCCCAGGTGATGATTTTGCATGT CTGGGTGTACACTTCCCATTTCCGTAACTATGAAAATAGCTGCAGACAATAGGCTTACTTGGTTCCATCTGAAGAGTGGGTTTGGTGGCACTCGGGTGGCAGAGGCAGGCAAATCTCTGTGAGCTTGAGGCCAGCCTGGTCTACTAAATGAGTT CTGGGGCAGGCTCCAAAGTAATACAGAGTTACCCTGTCTTGAAAAACCAAAAAAAAAAAAAAAAAAATGGCTTTGGG TTGGGAAGAAAGTCTATGCCAATTTATCATGGGGTAGCTTATTAGCAGAAATTCCATCTCTTAATTAGAGAGGAGGG CTAAGAGAAACTCATTTGGCTCCTGGAGATGACAAAGGGAACAGCCATGGATGTGTTTCCCAT

[0099] SEQ ID NO: 3:

[0100] GCCACAGAGAAACCCTGTCTCGAAAAATAAAATAAAATAAATAAATAAATACAGTTTTAGGTGCAAAGC AGATAAAGTGGCTGGGGTTGCCCGCCCCCCCCCCCCCCGTAGGAAATGCCTGTCCCAGATTAAAATCTTAGTCAGTG CCCCAGTGAGAGGCTAAGAGGGTCAGGTATATGTCCCAGCCTGCTAACCCTTATTCCAGCTAGGTCTGTGGTTCAGG CCTCCAGATCCACAGTCATCTGCTCTGCAATGGGTTGATGTGAGCTCCAGGTCCCAGCCACAAGTTTCCATGACTAC CCACCCTTCCTGCTTTAGGCTGAGCTTCCACCCAAAGGATGCTTCTTTCTTTCTTGGTTCTCTGTGTTTTATCAAGC CCATGCCCTGCTGGAAGCATTCCCCATATCTAGAAAGATCTTTTTTATCATCCTACTTATTCCTCAACCTGGTGGTG TTCCTGCCTCTTTCTGCCCAGGGACTCCAATGCTCCAAGTTCTGTTGTCATCATGACAGAGAGGGGGTTCAGGTCTC TTCAGGGGGACAAGTGTGACAAGACTTTTCCTGGGGAGATGCAACCTAAGCCTACTCACCCCAGACAGGGAGCCCATGACAGACCAAAGTAGGACACCATCGAAGTCCAAGTTTTATTGGGATTACTTACAAGAATGGGGTGAGGGCTACTTAG AGTAGCAGAATGACTCATAGACAGCTGCATCACCACAATCTGAAGAGTCCTAGTGTAGACAGACCAGCTGAGCTGCC TGAGTCACTGGAAGTGGTACTTCCAGCCTGTTGAACTG

[0101] SEQ ID NO: 4:

[0102] CCCGCCCCCCCCCCCCCCGTAGGAAATGCCTGTCCCAGATTAAAATCTTAGTCAGTGCCCCAGTGAGAGGCTAAGAGGGTCAGGTATATGTCCCAGCCTGCTAACCCTTATTCCAGCTAGGTCTGTGGTTCAGGCCTCCAGATCCA CAGTCATCTGCTCTGCAATGGGTTGATGTGAGCTCCAGGTCCCAGCCACAAGTTTCCATGACTACCCACCCTTCCTG CTTTAGGCTGAGCTTCCACCCAAAGGATGCTTCTTTCTTTCTTGGTTCTCTGTGTTTTATCAAGCCCATGCCCTGCT GGAAGCATTCCCCATATCTAGAAAGATCTTTTTTATCATCCTACTTATTCCTCAACCTGGTGGTGTTCCTGCCTCTT TCTGCCCAGGGACTCCAATGCTCCAAGTTCTGTTGTCATCATGACAGAGAGGGGGTTCAGGTCTCTTCAGGGGGACA AGTGTGACAAGACTTTTCCTGGGGAGATGCAACCTAAGCCTACTCACCCCAGACAGGGAGCCCATGACAGACCAAAG TAGGACACCATCGAAGTCCAAGTTTTATTGGGATTACTTACAAGAATGGGGTGAGGG

[0103] The present invention will be described below with reference to specific embodiments. Those skilled in the art will understand that these embodiments are only for illustrating the present invention and do not limit the scope of the present invention in any way.

[0104] Unless otherwise specified, the experimental methods in the following examples are conventional methods. Unless otherwise specified, the raw materials and reagents used in the following examples are commercially available products.

[0105] Example 1: Establishment of a site-specific integration host cell line

[0106] This embodiment provides a process for establishing a CHO host cell line with site-directed integration. Its technical principle is based on the CRISPR / Cas9-mediated homology-directed repair (HDR) mechanism.

[0107] Specifically, by co-transfecting CHO cells with sgRNA, Cas9 expression plasmid, and donor repair plasmid, the Cas9 protein, guided by sgRNA, precisely cleaves the genomic target NC_048595.1 (455014081-455014880) shown in SEQ ID NO: 3, generating a double-strand break (DSB). Subsequently, the cell's HDR repair mechanism is activated, and using the donor repair plasmid as a repair template, the exogenous nucleotide sequence cassette located between the homologous arms (HAs) carried on the donor repair plasmid, which are homologous to the sequences flanking the genomic break site, is precisely inserted into the genomic site. 14 CN 121931118 A Specification 13 / 17 pages

[0108] In this embodiment, the non-coding region between the Ndufv2 gene and the Washcl gene shown in SEQ ID NO: 2 is selected as the integration "safe harbor" (named "N2W1"), which aims to maintain the normal function of endogenous genes in the cell (e.g., protein translation) without disrupting the phenotype and growth stability of the cell. The inserted exogenous nucleotide sequence cassette includes a fluorescent reporter gene (EGFP), an resistance selection gene (PuroR), and two recombinase recognition sites (lox sites). The finally obtained fluorescent protein site-labeled host cell line can be identified and screened by flow cytometry (FACS) and polymerase chain reaction (PCR).

[0109] In this embodiment, the insertion of the exogenous nucleotide sequence cassette into N2H as described above is compared with the insertion of the same exogenous nucleotide sequence cassette into the FerlL4 target gene (see patent publication WO2013190032). [01101 The specific process is as follows.

[0111] 1. Plasmid Construction

[0112] First, the following two types of plasmids were constructed:

[0113] a) sgRNA and Cas9 co-expression plasmid:

[0114] Commercially available plasmids were used to construct a co-expression plasmid of sgRNA and Cas9 targeting N2W1 and a co-expression plasmid of sgRNA and Cas9 targeting FerlL4 (control).

[0115] The sgRNA sequence targeting N2W1 is as follows:

[0116] (1) GGACAGGCATTTCCTACGGG (SEQ ID NO: 5);

[0117] (2) TGGGACAGGCATTTCCTACG (SEQ ID NO: 6);

[0118] (3) CATCGAAGTCCAAGTTTTAT (SEQ ID NO: 7).

[0119] The sgRNA sequences that recognize the FerlL4 target gene are as follows:

[0120] (1) ACAGGGATTGATCCAGTGCA (SEQ ID NO: 8);

[0121] (2) CACCTCTCCAGTGAGCACCT (SEQ ID NO: 9);

[0122] (3) AGTCTCATGTTGGTATAAGC (SEQ ID NO: 10).

[0123] b) Donor repair plasmid: See Figure 1 for a schematic diagram.

[0124] As shown in Figure 1, the donor repair plasmid contains two homologous arms that target transcription hotspots. Between the two homologous arms is an expression cassette flanked by recombinase recognition site 1 (lox71) and recombinase recognition site 2 (lox2272). The expression cassette contains a fluorescent reporter gene (EGFP) driven by a promoter and a eukaryotic resistance selection gene (PuroR) expressed in tandem with a 2A peptide.

[0125] Commercially available plasmids were used to construct and synthesize donor repair plasmids targeting N2H and FerlL4 (see figure).

[0126] The recombinase recognition sites 1 and 2 in the two plasmids are the same, and the sequences are as follows:

[0127] Sequence of Lox71 recognition site:

[0128] ATAACTTCGTATAATGTATGCTATACGAACGGTA (SEQ ID NO: 11);

[0129] Sequence of Lox2272 recognition site:

[0130] ATAACTTCGTATAAAGTATCCTATACGAAGTTAT (SEQ ID NO: 12).

[0131] The sequence of the inserted homologous arms in N2W1 of the present invention is as follows:

[0132] N2W1-5' homologous arms:

[0133] CAGAGGTCCTGAGTTCAATTCTCGGCAATCACATGGTGGCTCACAACCATCTTGCATGAGATCTGGTG CCCCCTGCTGGCGTGCAGGCAGAAGACTGTATACATAATAAATAAATAAAATCTTTTAAAAATTCAAAAAATATAG ACTGTTCAGGGAAAGAGTAAAGCACACTAAAAGTATGGGGTGTGTTTCTCAAAGGAGAGTTGCACTTCATTGTGTA 15 CN 121931118 A Specification 14 / 17 pages TTCTGTGGCCAAACATACAGTTTTGGTGAATTCTGAAATTATTTTCAAATGGTTGCTATGTAATTTAAATGAGGGAACTAGAGAGTTGGTTCAGTGGTTAAGAGCACTGGTTGCTCTAGCAGAGGATAGTAGTTACATTCTCTGCACCTACA GGAGAGCTCACAGCCATCCTTAGCTCCAGTTCCAGGGGACCTGATGCCCTCTTCTGGCCTCTCCAGGCACCAGGCA GGCAAGTAATATACAAACATGTATGCAGGTATAACACCCATACACGTAAAATTTTAAAATAATTTTTCAAAGGGCT CCCTTTGTTTTTGTTTTTAAAGAGTAAAAGACCTCGGGTTAAGCCTGACTCTAGACTGAACTCCAAAGTCAGGAAA ACTACTGGTAGAACTGAGTTCAACGGCAGGTGGTTGGTGCCACACGCTTTTAACGTCAGCACTCGGGAGGCAGAGG CAGGCAGATCTCTGTGAGTTCAAGACCAGCCTGGTCTACAAGAATTAGTTCCAGGACAGCCTCCAAAGCCACAGAG AAACCCTGTCTCGAAAAATAAAATAAAATAAATAAATAAATACAGTTTTAGGTGCAAAGCAGATAAAGTGGCTGGG GTTGCCCGCCCCCCCCCCCCCC(SEQ ID NO: 13)

[0134] N2W1 - 3' homologous arm:

[0135] TATTGGGATTACTTACAAGAATGGGGTGAGGGCTACTTAGAGTAGCAGAATGACTCATAGACAGCTGC ATCACCACAATCTGAAGAGTCCTAGTGTAGACAGACCAGCTGAGCTGCCTGAGTCACTGGAAGTGGTACTTCCAGC CTGTTGAACTGCAGGCCGGCTGTGCAGTGTGCTCCCGGCTCCCAGAGCACAAATAAGTGTGAGCTGTCACTGTGCT GGGGTAGGTTTTGGCAAATTTGTATTGCTTTCACATCATGATAAACTTAAAAGGCTGTAAACCAAAGCCCTGGAAG TCTGGGATTGTAACATAAGGACGAGCTCTTCTACTACAGGCCAGCTGGCTCAGGCTTTGCCATTGACGGAGAAGGAGCGCCTCCTGGTGGAGAAGAGGAGCTCAGGCCTAGAGGGAGATTTAATCTTGCATGGACTGGACAGTTTTAATACC CAGAACTTTTGTGTGGTGATATTTTGTTTGTAATCTAATAAAGCTTGCCTGAAGATCAGAATGCAAAGCTGAGTCC TAGTTAGCCACACACCTAGTTAAGAGCTAAGCCACGAGCTAATCACACACACACACACACACACACACACACACAC ACACACACACACACACACACAGAGAGCAAGCCACTAATTCGCTGCACACCTAAGCCACTACTTAGCTACAGAGGAC AGGCAGTGGTGACCACACCTTTTATTCCAGAACTCGGGAGACAGAGACAGATGGATCTCTGTGAGTTCCAGGCCAG CCTGGGTTACATGAGAGTGAGTCAGTCTAAAAAAGAAACAGAGCTCACATTTTTGATCCCAGCACTTGGGATGACA CCACACAAGTCATGGAAACTTG(SEQ ID NO: 14)

[0136] The insertion homologous arm sequence on the FerlL4 gene is as follows:

[0137] FerlL4-5, homologous arm:

[0138] CTGGCCTAAACTCATGGAATAACTTCCCTACTTCCAGGAGAGCAGTCTGGGGACCCCTTCGTGGCTAA AGCAGGACAATCCAGCCGGCTCCTGAAGGTGATGGGGTGTTCCTGAGGCTGGAGAGGGGGATGTCAGGGTTTGTGG TGGTGCTGACTGAGAGCAACAAGGTCCTCTCTGCCTCAGGCTCCTCTGAAGAAGCTCACCTTAGGGCTCCTGGGTC AAGGTCCTGAGCTGGAGGAGGACATCCCAGACCCAGAAGAGATGGACTGGTGGTCCAAGTACTATGCCTCACTGCA GGAGCTCCAGGGGCAGGTGGGTGGAGCTCCAGGGGCAGGTGGATGGAGCTCCAGGGGCAGGTGGATGGAGCTCCAGGGGCAGGTGGGCACAGCACAACCTAGGGCAGGAACTGGGGGAGGAAAGGCAAGAAGGTGGGGAGTCTCATCAAACA AGACCACTGTGTGTCCCAGAGCTCTTTATTGCGGACATCTTTTCTCCTCTATACCACAATTTTAGTAGTTGGACAT TAGTACTTCTGCCTCCCAACACTCTGTTGCTCTAATAAAATAGAACATGAGGGGCTGGAGAGATGGCTCAGAGGTT AAGAGCACTGGCTGTTCTTCCAGAGTTTCTGAGTTCAATTCCCAGCAACCACATAGTGGTTCACAGCCATCTATAA TGAGATCTGGTGCTCTCTTCTGGTGTGCAGGCATACATGCAGGCAGAACATTGTATACATAATAAACAATAAATCC TTAAAAAAAAAAAAAAAGAACATGAGGCCAGCATGGTGGTGCACAGCCTTAATCCCTGCACTGGATCAATCCCTGT GAGTTCGAGGCCAGCCTGGTCTATATAACAGGCAGTGAGACCTGTCTCTGAAACAAAAAACATGAGTGTAGAATTT TAGCTCTTAAACTTGGGTATGGTGACACACACCTCTCCAGTGAGCA (SEQ ID NO: 15)

[0139] FerlL4-3, homologous arm:

[0140] TATACCAACATGAGACTCTGTCTCAAATTTTTTTTATTTTAATTTTTGTTAATAGCCACATTTAAAAA 16 CN 121931118 A Description Page 15 / 17 GTGAAAGGGAACAAATGAGAATAATTTTTGGTACTGTTTTATTAATGTATACAAAATATTGTTCCAACCAGTGATT ATCATAAAAATTAGTAATATGCTATTTTACATTCTCACAGTAAGTCTGCTGTGTGTCCCACTCACACCACCTCACA GTGCAGACTGACCTCACTTCAAGGGCTCAGTGACCGTGGGTGGGTGGTGGTGACTGAAGTCAACAGCATAGGTTTAGACAATAGAGGGGACTTTAAAAAGAAGTGACTGTGGCTGAAGAAGAGGGGTGGGCCAAGGGGGGCAGTGGGAGGGG CTACCTCCGACCTGTCTTTTGATTTCAGTCCGGCTTTGATGAGGATGATGGAGGACGCTGGGGACCCAGGTGAG AGTCCTGACTTTTGTTCTTGCTCCATCTCTCCACCCATCCCTGTCCCCACATTCTTACCTGGACCATTTCTGCTGT TTCCAGACGGGACCCACCTCATTTCTGGGGACAGGGAGGCTCAGGAGCAGGGAAGAACTGATATCAAAGTGTCTGG ACCTCAGAAGAAAGCAATCGCCACCTTGAAGGTGACAAGGTGTTGGGGAGAAGGGTGCCCCTTGGATTTGGGGAAC AGAGTTGTCACTGAGACCCCTCACCTTTCAGATCTACAACAGCTCCCTAGAGGAGGAGTTTAACCACTTTGAGGAC TGGCTGAATGTGTTCCCCCTGTACAGAGGGCAAGGCGGCCAGGCTGGAGATGGCGAGGAAGGTTCTGGACACTTGG TGGGCAAATTCAAGGTATACTTGGGGGAAGAATGGGAGACTGACAAGGGACA (SEQ ID NO: 16)

[0141] The two plasmids were linearized using Pvul restriction endonuclease, and the linear DNA was purified and recovered.

[0142] 2. Cell transfection (site-directed integration construction)

[0143] 2 x 10⁷ CHO-K1 cells in logarithmic growth phase were taken, centrifuged, and resuspended in an appropriate amount of electroporation buffer. This embodiment sets up two parallel experiments:

[0144] Experimental group (T2507): The constructed sgRNA / Cas9 co-expression plasmid targeting the site in SEQ ID NO: 3 and the linearized donor repair plasmid (total mass 20 μL) were mixed at a mass ratio of 1:1;

[0145] Control group (FerlL4): The constructed sgRNA / Cas9 co-expression plasmid targeting the FerlL4 site and the linearized donor repair plasmid (total mass 20 μL) were mixed at a mass ratio of 1:1.

[0146] The above plasmid mixture was co-transfected into CHO-K1 cells.

[0147] 3. Screening and identification of stable cell pool [(H48) The cells after electroporation were immediately transferred to basal culture medium and incubated at 37°C >5%(Under the condition of 02, the cells were allowed to stand overnight to recover. After 24 hours, the culture medium was replaced with pressure selection medium 1 containing puromycin for pressure selection. After about 1 week of culture, both groups obtained fluorescent cell pools with stable resistance.

[0149] The obtained cell pools were analyzed by flow cytometry. The results showed that the average fluorescence intensity of the experimental group (T2507) cell pool was comparable to that of the control group (FerlL4) cell pool (see Figure 2), indicating that the site-specific integration efficiency and expression level of the site in SEQ ID NO: 3 were comparable to those of the verified FerlL4 site.

[0150] 4. Screening and stability evaluation of monoclonal cell lines

[0151] The above-mentioned experimental group and control group Pool cells in good condition were taken and subjected to limiting dilution. They were cultured in cloning medium to isolate monoclonal cells. After 14 days, fluorescent monoclonal cells were selected and transferred to basal medium for expansion culture. Subsequently, the cells were cultured in fed-batch culture mode using fed-batch medium, during which cell growth curves and fluorescence intensity were monitored. Based on growth and expression data, single-clonal cell lines with good growth curves and high fluorescence intensity were selected and named as follows: T2507-54 (fluorescent protein is site-specifically integrated into the gene site in SEQ ID NO: 3, more specifically in SEQ ID NO: 4); and FerlL4-02 (fluorescent protein is site-specifically integrated into the FerlL4 gene site, as a positive control).

[0152] 5. Passage stability study

[01] The T2507-M cell line and the FerlL4-02 cell line were continuously passaged in basal medium to a doubling time of 60 generations (PDL60), and fluorescence stability was detected. The results are shown in Figure 3: During long-term passage, the fluorescence intensity of the T2507-54 cell line fluctuated very little and the cell growth was stable. Its stability and expression level were highly comparable to the control cell line FerlL4_02. The results confirmed that SEQ ID NO: 3. The lox site is suitable for constructing high-yield and stable cell lines. 17 CN 121931118 A Specification 16 / 17 pages

[0154] Example 2 Establishment of antibody expression cell line

[0155] In this example, the lox site contained in the T2507-54 cell line established in Example 1 is used as the "landing pad". Using the target exchange plasmid containing the antibody light and heavy chain coding genes, the EGFP reporter gene and the resistance selection gene PuroR are replaced with the antibody light and heavy chain coding genes by recombinase-mediated cassette exchange, and the antibody expression cell line is established. The specific process is as follows.

[0156] 1. Construction of target exchange plasmid: See Figure 4 for schematic diagram.

[0157] As shown in Figure 4, the target exchange plasmid contains an antibody B heavy light chain expression cassette flanking recombinase recognition site 1 (lox66) and recombinase recognition site 2 (lox2272).

[0158] A commercially available plasmid was used to construct the target exchange vector (containing the MSX resistance gene); this vector will also serve as a control vector for random integration.

[0159] The sequence of recombinase recognition site 1 (lox66) contained in the plasmid is as follows:

[0160] Lox66 recognition site:

[0161] TACCGTTCGTATAATGTATGCTATACGAAGTTAT (SEQ ID NO: 17)

[0162] The target exchange plasmid was linearized using Pvul enzyme, and the DNA was purified and recovered.

[0163] 2. Construction of Gene Exchange (RMCE) and Control Group

[0164] This experiment established an experimental group (site-specific integration) and a control group (random integration). The specific operation is as follows:

[0165] Experimental group (T2507-RMCE): T2507-54 cells (logarithmic growth phase, total amount 2 x 107 cells) constructed in Example 1 were taken and resuspended in electroporation buffer. 15 pg of linearized antibody expression exchange plasmid and 5 g of Cre enzyme expression plasmid were mixed at a mass ratio of 3:1 (total DNA 20 μg) and co-transfected into the cells.

[0166] Control group (Random): Wild-type CHO-K1 cells (logarithmic growth phase, total amount 2 x 107 cells) were taken and resuspended in electroporation buffer. 20 μg of linearized antibody expression exchange plasmid (without Cre enzyme plasmid) was transfected into the cells to construct a random integration control.

[0167] 3. Screening and Monoclonalization:

[0168] 24 hours after transfection, the two groups of cells were seeded to construct bulkpools. Subsequently, they were screened under pressure using pressure screening medium 2 containing 25 μM MSX.

[0169] Obtaining Bulkpools: After culturing for about 7-10 days, when the cells recovered growth and their viability stabilized, stable transfection cell pools (Bulkpools) were obtained. Cells in the experimental group that underwent correct exchange showed no fluorescence and had MSX resistance. They were designated as T2507-Bulkpool (site-specific integration pool) and Random-Bulkpool (random integration pool), respectively.

[0170] Obtaining Monoclonals: The two types of Bulkpool cells were expanded and cultured, and then monoclonalized using the limiting dilution method. After screening and identification (no fluorescent clones were screened in the experimental group), high-expressing monoclonal cell lines were obtained, designated as T2507-54-11 (site-specific integration monoclonal) and Random-10 (random integration monoclonal).

[0171] Once the cell lines have been expanded to the shake flask stage and the cell viability, growth rate and density have returned to normal, they are uniformly fed-batch culture for evaluation.

[0172] 4. Fed-batch culture and expression level assessment:

[0173] The above four cell lines (two pool groups and two monoclonal groups) were seeded at a density of 1 x 10⁶ cells / mL in 125mL shake flasks (inoculation volume 25mL) and cultured using fed-batch medium. All cell lines adopted the same fed-batch strategy: on days 4, 7, 9, and 11 of culture, fed-batch medium was added according to the plan (addition amounts of 4%, 4%, 5%, and 4%, respectively); on days 3, 5, 7, 9, 11, and 13 of culture, glucose was added to maintain the glucose level according to the glucose consumption of the cells.

[0174] Detection point: Samples were collected on day 14 of culture and the antibody expression level was detected. 18 CN 121931118 A Specification 17 / 17 pages

[0175] Figure 5 shows the final antibody yield of each cell line on day 14. The results showed that, at the pool level, the antibody expression level of the site-specific integration cell pool (T2507-Bulkpool) using the method of the present invention was significantly better than that of the random integration control pool (Random-Bulkpool); while at the monoclonal level, the expression level of the site-specific integration monoclonal cell line (T2507-54-11) was significantly higher than that of the random integration monoclonal cell line (Random-Clone).

[0176] The results confirm that the site-specific integration system provided by the present invention can significantly improve the integration efficiency and expression level of exogenous genes, and is superior to the traditional random integration method.

[0177] The above description of the specific embodiments of the present invention does not limit the present invention. Those skilled in the art can make various changes or modifications according to the present invention, as long as they do not depart from the spirit of the present invention, they should all fall within the scope of the appended claims. 19 CN 121931118 A Instruction Manual, Figure 1 / 3 page 2 5' Homologous Recombinase Identification SIJ Site 1 Promoter 2 Random Integration Marker Gene Anti-resistance Promoter 3 Promoter 1 Prokaryotic Resistance 3 Homologous Back MB 2 Figure 1 Figure 2 MISC 9 IUI a>ocs Q s 9 J onl u. QJ 0 20 CN 121931118 A Instruction Manual, Figure 2 / 3 page Figure 3 Figure 4 - Promoter 2 Light Chain MISCvull duuaosdjonl u. QJ 0 ULJ 21 CN 121931118 A Instruction Manual, Figure 3 / 3 page 15000- 10000- 5000- 5 Figure 22 Our Ref: LC25110073-HK CN Application No.: 202511809099.4 Targeted Integration Cell and Uses Thereof TheThis invention provides a cellular genomic locus for targeted integration of exogenous nucleic acid molecules. The locus is located within the nucleic acid sequence corresponding to the Chinese hamster ovary CHO-K1 cell genome NC_048595.1: 454997734-455024715. Exogenous protein-encoding genes can be integrated into this cellular genomic locus and stably expressed. This invention also provides stable and highly productive targeted integration cells, such as host cells derived from Chinese hamster ovary (CHO), as well as methods for producing the same and their applications. This invention also provides stable and high-yield targeted integration cells, such as host cells derived from the ovary of the Chinese hamster (CHO), their production methods, and their uses. Abstract

Claims

1. A cellular genomic locus for targeted integration of exogenous nucleic acid molecules, wherein the locus is located in the nucleic acid sequence of the corresponding Chinese hamster ovary CHO-K1 cell genome NC_048595.1: 454997734-455024715.

2. The cell genomic locus according to claim 1, characterized in that, The cell genomic site is located in the nucleic acid sequence corresponding to the nucleotide sequence shown in SEQ ID NO: 1; Preferably, the cellular genomic site is located in the nucleic acid sequence corresponding to the nucleotide sequence shown in SEQ ID NO: 2; More preferably, the cell genomic site is located in the nucleic acid sequence corresponding to the nucleotide sequence shown in SEQ ID NO: 3; More preferably, the cell genomic site is located in the nucleic acid sequence corresponding to the nucleotide sequence shown in SEQ ID NO:

4.

3. The application of the cell genomic site described in claim 1 or 2 in the targeted integration of exogenous nucleic acid molecules.

4. The application according to claim 3, characterized in that, The targeted integration is achieved through homologous targeted repair (HDR); Preferably, the exogenous nucleic acid molecule is a DNA molecule, such as a single-stranded DNA molecule or a double-stranded DNA molecule, used to express one or more exogenous proteins; Preferably, the application further involves expressing one or more exogenous proteins in cells.

5. The application according to claim 3 or 4, characterized in that, The exogenous nucleic acid molecule comprises: a first recombinant recognition sequence and a second recombinant recognition sequence recognized by a recombinase, and one or more expression cassettes located between the first recombinant recognition sequence and the second recombinant recognition sequence, the expression cassettes comprising the exogenous nucleic acid sequence and a promoter driving its expression; Preferably, the exogenous nucleic acid sequence is a nucleic acid sequence or gene encoding a target protein (POI), a selection marker, and / or a reporter protein; More preferably, the exogenous nucleic acid molecule further comprises a 5' homologous arm and a 3' homologous arm, each comprising a nucleotide sequence homologous to the nucleic acid sequence surrounding the cellular genomic site as described in claim 1 or 2.

6. A nucleic acid molecule comprising: a first recombinant recognition sequence and a second recombinant recognition sequence recognized by a recombinase, and one or more expression cassettes located between the first recombinant recognition sequence and the second recombinant recognition sequence, the expression cassettes comprising a foreign nucleic acid sequence and a promoter driving its expression.

7. The nucleic acid molecule according to claim 6, characterized in that, The nucleic acid molecule is a DNA molecule, such as a single-stranded DNA molecule or a double-stranded DNA molecule; Preferably, the exogenous nucleic acid sequence is a nucleic acid sequence or gene encoding a target protein (POI), a selection marker, and / or a reporter protein; More preferably, the nucleic acid molecule further comprises a 5' homologous arm and a 3' homologous arm, each comprising a nucleotide sequence homologous to the sequence surrounding the cellular genomic site as described in claim 1 or 2.

8. A targeted integration cell, said targeted integration cell comprising the nucleic acid molecule of claim 6 or 7.

9. The method for preparing targeted integrated cells according to claim 8, wherein the preparation method comprises: The nucleic acid molecules are targeted and integrated into the host cell through homology-directed repair (HDR).

10. A method for producing protein, the method comprising: Culturing the targeted integration cells as described in claim 8, and collecting the proteins expressed by the nucleic acid molecules.

Images