Recombinant humanized type xiii collagen and application thereof

Abstract

The invention belongs to the technical field of synthetic biology, and particularly relates to recombinant XIII type humanized collagen and application thereof. According to the invention, a natural human XIII type collagen core functional region is obtained through a large number of screening researches. Based on the core functional area, the recombinant XIII type humanized collagen is successfully expressed and prepared for the first time. The invention relates to the field of biomedical materials, in particular to novel biomedical materials, which have good biological activity, including cell proliferation promoting activity and cell adhesion promoting activity, particularly have good proliferation promoting activity and adhesion promoting activity for skin fibroblasts and keratinocytes, and are suitable for various medical or non-medical applications, such as tissue repair / filling / compatibilization scenarios.

Description

(19) State Intellectual Property Office (12) Invention Patent Application (10) Application Publication Number (43) Application Publication Date (21) Application Number 202610162170.2 (22) Application Date 2026.02.04 (71) Applicant Shanxi Jinbo Biomedical Co., Ltd. Address 030032 No. 18 Jinbo Street, Taiyuan Tanghuai Park, Shanxi Comprehensive Reform Demonstration Zone, Taiyuan City, Shanxi Province (72) Inventors Zhang Xiaobo, Liu Xin, Deng Pengjun, Yang Xia, Yang Jingbo, Liu Zengyao, Song Haihong, Cui Yuxin, Wang Ying, Li Yuan, Zhou Wenrong, Lan Xiaobin, Wang Lingling, Zhang Yongjian, Yin Lilan, Wang Yajun (74) Patent Agency Beijing Linda Liu Intellectual Property Agency (General Partnership) 11277 Patent Attorney Li Maojia, Yan Junping (51) Int.Cl. C07K 14 / 78 (2006.01) C07K 19 / 00 (2006.01) C12N A23L 33 / 17(2016.01) A23L 33 / 13(2016.01) A61K 47 / 42(2017.01) A61L 27 / 24(2006.01) A61L 27 / 50(2006.01) A61K 8 / 65(2006.01) A61Q 19 / 00(2006.01) A61L 15 / 32 (2006.01) A61L 31 / 04 (2006.01) C12R 1 / 19 (2006.01) (54) Invention Title: Recombinant Type XIII Humanized Collagen and Its Applications (57) Abstract: This invention belongs to the field of synthetic biology technology, specifically involving recombinant type XIII humanized collagen and its applications. Through extensive screening studies, this invention obtained the core functional region of natural human type XIII collagen. Based on this core functional region, this invention successfully expressed and prepared recombinant type XIII humanized collagen for the first time. It has good biological activities, including cell proliferation and cell adhesion promotion activities, especially for skin fibroblasts and keratinocytes, and is suitable for various medical or non-medical applications, such as tissue repair / filling / volume enhancement. Claims (3 pages), Description (20 pages), Sequence List (electronic publication), Drawings (7 pages) CN 122036921 A 2026.05.15 CN 1 22 03 69 21 A1. A recombinant type XIII humanized collagen, the amino acid sequence of which comprises n repeating units, where n is an integer greater than or equal to 1, and when n is an integer greater than or equal to 2, the repeating units are directly linked or linked by linking peptides; wherein the amino acid sequence of the repeating units comprises any one of the following (a)-(c): (a) the sequence shown in SEQ ID NO. 1 or 3; (b) a sequence in which one or more amino acid residues are added, substituted, and / or deleted in the sequence shown in SEQ ID NO. 1 or SEQ ID NO. 3, and the biological activity is retained; (c) a sequence having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence shown in SEQ ID NO. 1 or SEQ ID NO. 3, and the biological activity is retained. 2. The recombinant type XIII humanized collagen according to claim 1, characterized in that the amino acid sequence of the repeating unit comprises a sequence as shown in SEQ ID NO.1 with the addition of 1-20, substitution of 1-20, and / or deletion of 1-20 amino acid residues while retaining biological activity; preferably, the amino acid sequence of the repeating unit comprises a sequence as shown in SEQ ID NO.1 with the addition of 6 or 18, substitution of 6 or 18, and / or deletion of 6 or 18 amino acid residues while retaining biological activity; more preferably, the amino acid sequence of the repeating unit comprises a sequence as shown in SEQ ID NO.1 with the addition of 6 or 18, substitution of 6 or 18, and / or deletion of 6 or 18 amino acid residues while retaining the portion shown in SEQ ID NO.14 and retaining biological activity; even more preferably, the amino acid sequence of the repeating unit comprises a sequence as shown in SEQ ID NO.2, or has at least 50% or 60% of the sequence as shown in SEQ ID NO.2. The repeating unit contains sequences with 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity and retains biological activity; or, the amino acid sequence of the repeating unit comprises a sequence as shown in SEQ ID NO. 3 with the addition of 1-15, substitution of 1-15, and / or deletion of 1-15 amino acid residues while retaining biological activity; preferably, the amino acid sequence of the repeating unit comprises a sequence as shown in SEQ ID NO. 3 with the addition of 12, substitution of 12, and / or deletion of 12 amino acid residues while retaining biological activity; more preferably, the amino acid sequence of the repeating unit comprises a sequence as shown in SEQ ID NO. 3 with the addition of 12, substitution of 12, and / or deletion of 12 amino acid residues while retaining biological activity.The portion shown in NO.15 simultaneously retains the biologically active sequence; even more preferably, the amino acid sequence of the repeating unit comprises the sequence shown in SEQ ID NO.4, or a sequence having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence shown in SEQ ID NO.4 and retaining the biologically active sequence. 3. The recombinant type XIII humanized collagen according to claim 1 or 2, characterized in that n is an integer between 1 and 20, and when n is an integer greater than or equal to 2, the repeating units are directly connected; preferably, n is an integer between 8 and 12; more preferably, the amino acid sequence of the recombinant type XIII humanized collagen comprises the sequence shown in any one of SEQ ID NO.5-8. 4. A fusion protein, characterized in that the fusion protein is obtained by fusing the recombinant type XIII humanized collagen according to any one of claims 1-3 with other polypeptides. 5. A polynucleotide, characterized in that the polynucleotide encodes the recombinant type XIII humanized collagen of any one of claims 1-3 or the fusion protein of claim 4; preferably, the nucleotide sequence of the polynucleotide comprises a sequence as shown in any one of SEQ ID NO. 9-12, or a sequence that hybridizes under stringent conditions with a sequence as shown in any one of SEQ ID NO. 9-12 and encodes a protein having cell adhesion or cell proliferation-promoting activity having a sequence as shown in any one of SEQ ID NO. 5-8; more preferably, the nucleotide sequence of the polynucleotide further comprises a sequence encoding a tag and / or signal peptide; optionally, the tag is selected from His tags, GST tags, MBP tags, SUMO tags, and NusA tags. 6. An expression cassette, characterized in that the expression cassette comprises the polynucleotide of claim 5; preferably, the expression cassette comprises a control element operatively linked to the polynucleotide; more preferably, the control element is a promoter, a terminator, and / or an enhancer. 7. A recombinant vector, characterized in that the recombinant vector comprises the polynucleotide of claim 5; preferably, the recombinant vector comprises a control element operatively linked to the polynucleotide; more preferably, the control element is a promoter, a terminator, and / or an enhancer; even more preferably, the recombinant vector is pET-28a-Trx-His comprising the polynucleotide. 8. A recombinant host cell, characterized in that the recombinant host cell comprises the expression cassette of claim 6 or the recombinant vector of claim 7; preferably, the recombinant host cell is a bacterium, fungus, or animal cell;More preferably, the bacteria include *Escherichia coli*; the fungus includes yeast. 9. A method for preparing the recombinant type XIII humanized collagen or the fusion protein of claim 4 according to any one of claims 1-3, characterized in that the method comprises the following steps: fermenting and culturing the recombinant host cell of claim 8, inducing expression, and collecting the recombinant host cell and / or the culture medium of the recombinant host cell containing the recombinant type XIII humanized collagen or fusion protein, and isolating the recombinant type XIII humanized collagen or fusion protein therefrom. 10. A composition, characterized in that the composition comprises any one of the recombinant type XIII humanized collagen of claims 1-3, the fusion protein of claim 4, the polynucleotide of claim 5, the expression cassette of claim 6, the recombinant vector of claim 7, and / or the recombinant host cell of claim 8; preferably, the composition is a biological dressing, a human biomimetic material, a plastic and cosmetic material, an organoid culture material, a cardiovascular stent material, a coating material, a tissue filler / volume enhancer, an ophthalmic material, an obstetric and gynecological biomaterial, a nerve repair and regeneration material, a skin wound repair material, a skin barrier repair material, a muscle or bone or cartilage or ligament regeneration material, a liver tissue material, a vascular repair and regeneration material, a 3D printed artificial organ biomaterial, a cosmetic raw material, a pharmaceutical excipient, a drug, or a food additive; preferably, the composition is a topical composition, an injectable composition, or an oral composition; preferably, the composition is in the form of a liquid, a lyophilized powder, a gel, a sponge, or a fiber. 11. The use of any one of claims 1-3, the fusion protein of claim 4, the polynucleotide of claim 5, the expression cassette of claim 6, the recombinant vector of claim 7, the recombinant host cell of claim 8, and / or the composition of claim 10 in the preparation of bio-dressings, human biomimetic materials, plastic and cosmetic materials, organoid culture materials, cardiovascular stent materials, coating materials, tissue filling / volume-enhancing materials, ophthalmic materials, obstetric and gynecological biomaterials, nerve repair and regeneration materials, skin wound repair materials, skin barrier repair materials, muscle or bone or cartilage or ligament regeneration materials, liver tissue materials, vascular repair and regeneration materials, 3D printed artificial organ biomaterials, cosmetic raw materials, pharmaceutical excipients, pharmaceutical or food additives. 12. The use of any one of claims 1-3, the fusion protein of claim 4, the polynucleotide of claim 5, the expression cassette of claim 6, the recombinant vector of claim 7, the recombinant host cell of claim 8, and / or the composition of claim 10 in the preparation of products for use in any one or more of the following: promoting cell adhesion, promoting cell proliferation, promoting extracellular matrix generation or reconstruction, and tissue repair.Recombinant, tissue filling or volume enhancement. Claims 2 / 3 pages 3 CN 122036921 A 13. The use of any one of claims 1-3, the fusion protein of claim 4, the polynucleotide of claim 5, the expression cassette of claim 6, the recombinant vector of claim 7, the recombinant host cell of claim 8, and / or the composition of claim 10 in the preparation of a medicament for the prevention and / or treatment of diseases or conditions related to type XIII collagen deficiency or for the supplementation of type XIII collagen. 14. A method for promoting cell adhesion and / or promoting cell proliferation and / or promoting extracellular matrix generation or reconstruction, characterized in that the method comprises contacting a cell with the recombinant humanized type XIII collagen of any one of claims 1-3, the fusion protein of claim 4, the polynucleotide of claim 5, the expression cassette of claim 6, the recombinant vector of claim 7, the recombinant host cell of claim 8, and / or the composition of claim 10; preferably, the cell is an animal cell; more preferably, the cell is a mammalian cell; even more preferably, the cell is a human cell; preferably, the promotion of cell adhesion and / or promotion of cell proliferation and / or promotion of extracellular matrix generation or reconstruction is performed in vivo or in vitro. Claims 3 / 3 Page 4 CN 122036921 A Recombinant humanized type XIII collagen and its application technology field

[0001] This invention belongs to the field of synthetic biology technology, specifically relating to recombinant humanized type XIII collagen and its application. Background Art

[0002] Collagen is a type of protein widely distributed in human connective tissues and is also the most abundant protein in the human body, accounting for 25% to 35% of the total protein. Currently, at least 28 collagen subtypes have been discovered in the human body, located in different tissues and organs.

[0003] Type XIII collagen is a transmembrane collagen belonging to the non-fibrous collagen family. It plays a crucial role in physiological processes such as cell adhesion, tissue development, and repair. As one of the few transmembrane collagens in the human body, its molecule consists of three parts: an extracellular domain, a transmembrane domain, and an intracellular domain, directly connecting the intracellular and extracellular spaces in human tissues. Type XIII collagen is precisely distributed in areas requiring cell adhesion or dynamic tissue repair, including: epithelial tissues, such as the basal layer of the skin's epidermis (connecting epidermal cells to the dermal matrix and maintaining the skin's layered structure), and the surface of intestinal epithelial cells (preventing epithelial cell shedding and ensuring intestinal barrier function); the vascular system, such as the surface of vascular endothelial cells (participating in maintaining the stability of the blood vessel wall and assisting in angiogenesis); and connective tissues, such as tendons and ligaments.Cell surfaces (assisting in the connection between muscle fibers and tendons, enhancing mechanical endurance during exercise), around chondrocytes (regulating the metabolic balance of the cartilage matrix); embryonic and developing tissues, such as placental chorionic villi cells (assisting embryo implantation into the mother), developing bones (guiding osteoblast attachment, promoting trabecular bone formation) and muscles (participating in muscle fiber differentiation and the construction of the muscle-tendon junction); tissues undergoing repair, such as fibroblasts in the wound healing area, and the surface of macrophages (during the wound inflammation phase and granulation tissue formation phase).

[0004] Studies have shown that "Type XIII collagen deficiency" (a rare disease) caused by mutations in the COL13A1 gene can lead to fragile and easily cracked skin, slow wound healing, abnormal tooth development (such as enamel defects), and joint laxity in some patients. In January 2025, a study on PubMed pointed out that Type XIII collagen is a key molecule in neurovascular connections in the neuroendocrine system. Studies have found that in the posterior pituitary of rats, type XIII collagen is secreted by NG2-positive pericytes and located in the extracapillary basement membrane, possibly participating in the connection between capillaries and axonal terminals. Its expression is regulated by dehydration and the arginine vasopressin signaling pathway.

[0005] Due to the above-mentioned important functions and effects, recombinant type XIII collagen has a wide range of applications. It can be used as a wound dressing to absorb tissue exudate and provide a scaffold for the migration and proliferation of epidermal cells. It is suitable for superficial minor traumas and abrasions in the superficial dermis and above caused by accidental injury, surgery, ulcers, etc., and promotes wound healing. It can also be used to prepare tissue engineering materials such as subcutaneous fillers, artificial bone, artificial skin, oral absorbable biomembranes, bone implants, vascular scaffolds, intercellular matrix scaffolds, and collagen sponges, providing support for tissue repair and regeneration. In the chemical industry, recombinant type XIII collagen can be added as a raw material to skin care products such as serums, lotions, and creams. It has the effects of repairing the skin barrier, moisturizing, firming and reducing wrinkles. It can not only promote the expression of subcutaneous tight junction proteins, accelerate protein synthesis, and promote the regeneration of basal cells, but also further enhance the ability of the stratum corneum to absorb and store water, and maintain the water-oil balance of the skin. Therefore, there is an urgent need to develop a recombinant type XIII collagen with good biological activity, and at the same time, there is a need for a method for the preparation and expression of recombinant type XIII collagen with high efficiency and large yield. Specification 1 / 20 pages 5 CN 122036921 A Summary of the Invention

[0006] Problems to be Solved by the Invention

[0007] In view of the wide market demand for recombinant type XIII collagen with good biological activity, the present invention provides a recombinant type XIII humanized collagen obtained from research on human type XIII collagen, and provides its biosynthetic preparation method and its use in the biomedical field, providing new possibilities for the production and application of type XIII collagen.

[0008] Solution to the problem

[0009] [1]. A recombinant type XIII humanized collagen, the amino acid sequence of which contains n repeating units, where n is an integer greater than or equal to 1, and when n is an integer greater than or equal to 2, the repeating units are directly connected or connected by linking peptides; wherein, the amino acid sequence of the repeating unit contains any one of the following (a)-(c):

[0010] (a) the sequence shown in SEQ ID NO. 1 or 3;

[0011] (b) a sequence in which one or more amino acid residues are added, substituted and / or deleted in the sequence shown in SEQ ID NO. 1 or SEQ ID NO. 3 and the biological activity is retained;

[0012] (c) a sequence that has at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with the sequence shown in SEQ ID NO. 1 or SEQ ID NO. 3 and retains the biological activity.

[0013] [2]. The recombinant type XIII humanized collagen according to [1], wherein the amino acid sequence of the repeating unit comprises a sequence in which 1-20 amino acid residues are added, substituted, and / or deleted as shown in SEQ ID NO.1, and biological activity is retained; preferably, the amino acid sequence of the repeating unit comprises a sequence in which 6 or 18 amino acid residues are added, substituted, and / or deleted as shown in SEQ ID NO.1, and biological activity is retained; more preferably, the amino acid sequence of the repeating unit comprises a sequence in which 6 or 18 amino acid residues are added, substituted, and / or deleted as shown in SEQ ID NO.1, and biological activity is retained; even more preferably, the amino acid sequence of the repeating unit comprises a sequence in which 6 or 18 amino acid residues are added, substituted, and / or deleted as shown in SEQ ID NO.1, and biological activity is retained; even more preferably, the amino acid sequence of the repeating unit comprises a sequence in which 50% or 60% of the sequence in which SEQ ID NO.2 is added, substituted, and / or deleted, and biological activity is retained as shown in SEQ ID NO.14; 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity and retaining biological activity;

[0014] or,

[0015] the amino acid sequence of the repeating unit comprises a sequence as shown in SEQ ID NO. 3 with 1-15 amino acid residues added, substituted, and / or deleted, and retaining biological activity; preferably, the amino acid sequence of the repeating unit comprises a sequence as shown in SEQ ID NO. 3 with 12 amino acid residues added, substituted, and / or deleted, and retaining biological activity; more preferably, the amino acid sequence of the repeating unit comprises a sequence as shown in SEQ ID NO. 3 with 12 amino acid residues added, substituted, and / or deleted, and retaining biological activity; more preferably, the amino acid sequence of the repeating unit comprises a sequence as shown in SEQ ID NO. 3 with 12 amino acid residues added, substituted, and / or deleted, and retaining biological activity.The sequence shown in SEQ ID NO. 3 is modified by adding 12, substituting 12, and / or deleting 12 amino acid residues while retaining the portion shown in SEQ ID NO. 15 and retaining biological activity; even more preferably, the amino acid sequence of the repeating unit comprises the sequence shown in SEQ ID NO. 4, or has at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence shown in SEQ ID NO. 4 and retains biological activity.

[0016] [3]. The recombinant type XIII humanized collagen according to [1] or [2], wherein n is an integer between 1 and 20, and when n is an integer greater than or equal to 2, the repeating units are directly connected;

[0017] Preferably, n is an integer between 8 and 12;

[0018] More preferably, the amino acid sequence of the recombinant type XIII humanized collagen comprises the sequence shown in any one of SEQ ID NO. 5-8.

[0019] [4]. A fusion protein, wherein the fusion protein is obtained by fusing recombinant humanized type XIII collagen as described in any one of [1]-[3] with other polypeptides. Specification 2 / 20 pages 6 CN 122036921 A

[0020] [5]. A polynucleotide, wherein the polynucleotide encodes recombinant humanized type XIII collagen as described in any one of [1]-[3] or the fusion protein described in [4];

[0021] Preferably, the nucleotide sequence of the polynucleotide comprises a sequence as shown in any one of SEQ ID NO. 9-12, or comprises a sequence that hybridizes under stringent conditions with a sequence as shown in any one of SEQ ID NO. 9-12 and encodes a protein having cell adhesion or cell proliferation-promoting activity having a sequence as shown in any one of SEQ ID NO. 5-8;

[0022] More preferably, the nucleotide sequence of the polynucleotide further comprises a sequence encoding a tag and / or signal peptide; optionally, the tag is selected from His tag, GST tag, MBP tag, SUMO tag and NusA tag.

[0023] [6]. An expression cassette, wherein the expression cassette comprises the polynucleotide of [5];

[0024] Preferably, the expression cassette comprises a control element operatively linked to the polynucleotide;

[0025] More preferably, the control element is a promoter, a terminator, and / or an enhancer.

[0026] [7]. A recombinant vector, wherein the recombinant vector comprises the polynucleotide of [5];

[0027] Preferably, the recombinant vector comprises a control element operatively linked to the polynucleotide;

[0028] More preferably, the control element is a promoter, a terminator, and / or an enhancer;

[0029] Even more preferably, the recombinant vector is pET-28a-Trx-His containing the polynucleotide.

[0030] [8]. A recombinant host cell, wherein the recombinant host cell contains the expression cassette of [6] or the recombinant vector of [7];

[0031] Preferably, the recombinant host cell is a bacterium, fungus or animal cell;

[0032] More preferably, the bacterium includes Escherichia coli; the fungus includes yeast.

[0033] [9]. A method for preparing the recombinant type XIII humanized collagen or the fusion protein of [4] as described in any one of [1]-[3], wherein the method comprises the following steps:

[0034] fermenting and culturing the recombinant host cell of [8], inducing expression, and collecting the recombinant host cell and / or the culture medium of the recombinant host cell containing the recombinant type XIII humanized collagen or fusion protein, and isolating the recombinant type XIII humanized collagen or fusion protein therefrom.

[0035]

[10] . A composition comprising, as described in any one of [1]-[3], the fusion protein of [4], the polynucleotide of [5], the expression cassette of [6], the recombinant vector of [7], and / or the recombinant host cell of [8];

[0036] Preferably, the composition is a biological dressing, a human biomimetic material, a plastic surgery material, an organoid culture material, a cardiovascular stent material, a coating material, a tissue filling / volume-enhancing material, an ophthalmic material, a gynecological biomaterial, a nerve repair and regeneration material, a skin wound repair material, a skin barrier repair material, a muscle or bone or cartilage or ligament regeneration material, a liver tissue material, a vascular repair and regeneration material, a 3D printed artificial organ biomaterial, a cosmetic raw material, a pharmaceutical excipient, a drug, or a food additive;

[0037] Preferably, the composition is a topical composition, an injectable composition, or an oral composition;

[0038] Preferably, the composition is in the form of a liquid, a lyophilized powder, a gel, a sponge, or a fiber.

[0039] 11. The recombinant type XIII humanized collagen as described in any one of [1]-[3], the fusion protein as described in [4], the polynucleotide as described in [5], the expression cassette as described in [6], the recombinant vector as described in [7], the recombinant host cell as described in [8], and / or the composition as described in

[10] in the preparation of biological dressings, human biomimetic materials, plastic and cosmetic materials, organoid culture materials, cardiovascular stent materials, coating materials, tissue filling / volume enhancement materials, ophthalmic materials, obstetric and gynecological biomaterials, nerve repair and regeneration materials, skin wound repair materials, skin barrier repair materials, muscle or bone or cartilage or ligament regeneration materials, liver tissue materials, vascular repair and regeneration materials, 3D printed artificial organ biomaterials, cosmetic raw materials, pharmaceutical excipients, drug or food additives. (Instructions for use 3 / 20 pages 7)CN 122036921 A Application in additives.

[0040] 12. The use of any one of the recombinant type XIII humanized collagen, [4] the fusion protein, [5] the polynucleotide, [6] the expression cassette, [7] the recombinant vector, [8] the recombinant host cell and / or

[10] the composition in the preparation of products for any one or more of the following: promoting cell adhesion, promoting cell proliferation, promoting extracellular matrix generation or reconstruction, tissue repair, tissue filling or volume enhancement.

[0041]

[13] . The use of any one of the recombinant type XIII humanized collagen, [4] the fusion protein, [5] the polynucleotide, [6] the expression cassette, [7] the recombinant vector, [8] the recombinant host cell and / or

[10] the composition in the preparation of medicaments for the prevention and / or treatment of diseases or conditions related to type XIII collagen deficiency or for supplementing type XIII collagen.

[0042]

[14] . A method for promoting cell adhesion and / or promoting cell proliferation and / or promoting extracellular matrix generation or reconstruction, wherein the method comprises the step of contacting cells with any of the recombinant humanized type XIII collagen described in any one of [1]-[3], the fusion protein described in [4], the polynucleotide described in [5], the expression cassette described in [6], the recombinant vector described in [7], the recombinant host cell described in [8], and / or the composition described in

[10] ;

[0043] Preferably, the cells are animal cells;

[0044] More preferably, the cells are mammalian cells;

[0045] Even more preferably, the cells are human cells;

[0046] Preferably, the promotion of cell adhesion and / or promotion of cell proliferation and / or promotion of extracellular matrix generation or reconstruction is performed in vivo or in vitro.

[0047] Effects of the Invention

[0048] First, through extensive screening studies, the present invention has obtained the core functional region of natural human type XIII collagen. Furthermore, based on the aforementioned core functional areas, this invention has for the first time successfully constructed, expressed, and prepared recombinant type XIII humanized collagen. It can serve as a novel biomaterial derived from the human body and can be used for medical or non-medical purposes in multiple tissues and organs, such as tissue repair / filling / volume enhancement.

[0049] The amino acid composition of the recombinant type XIII humanized collagen provided by this invention is 100% identical to the corresponding portion of the amino acid sequence of natural human collagen, and its application in the human body will not produce immune rejection or allergic reactions.

[0050] The recombinant type XIII humanized collagen provided by this invention has good biological activity, including cell proliferation promotion activity and cell adhesion promotion activity, especially for skin fibroblasts and keratinocytes.It exhibits proliferative and adhesion-promoting activities, making it suitable for various medical and non-medical applications.

[0051] Secondly, the present invention provides a method for preparing the recombinant XIII type humanized collagen, which can be produced on a large scale with high yields using synthetic biology technology. Furthermore, the preparation method provided by the present invention is easy to scale up for industrial production. Brief Description of the Drawings

[0052] Figure 1: Electrophoretic detection results of purified recombinant XIII type humanized collagen rhXIII-1.

[0053] Figure 2: Electrophoretic detection results of purified recombinant XIII type humanized collagen rhXIII-2.

[0054] Figure 3: Electrophoretic detection results of purified recombinant XIII type humanized collagen rhXIII-3.

[0055] Figure 4: Electrophoretic detection results of purified recombinant XIII type humanized collagen rhXIII-4.

[0056] Figure 5: Peptide coverage detection results of recombinant XIII type humanized collagen rhXIII-1.

[0057] Figure 6: Peptide coverage detection results of recombinant humanized collagen rhXIII-2. Specification 4 / 20 pages 8 CN 122036921 A

[0058] Figure 7: Peptide coverage detection results of recombinant humanized collagen rhXIII-3.

[0059] Figure 8: Peptide coverage detection results of recombinant humanized collagen rhXIII-4.

[0060] Figure 9: HFB cell adhesion activity detection results of recombinant humanized collagen rhXIII-1, rhXIII-2, rhXIII-3 and rhXIII-4.

[0061] Figure 10: Hacat cell proliferation and toxicity detection results of recombinant humanized collagen rhXIII-1, rhXIII-2, rhXIII-3 and rhXIII-4.

[0062] Figure 11: Results of HFB cell proliferation and toxicity detection of recombinant humanized collagen rhXIII-3.

[0063] Figure 12: Results of HFB cell proliferation and toxicity detection of recombinant humanized collagen rhXIII-4. Detailed Embodiments

[0064] Embodiments of the present invention will be described below, but the present invention is not limited thereto. The present invention is not limited to the various components described below, and various modifications can be made within the scope of the claims of the invention. Embodiments and examples obtained by appropriately combining the technical means disclosed in different embodiments and examples are also included in the technical scope of the present invention.

[0065] In the present invention, the terms "comprising," "having," "including," or "containing" can refer to inclusion or open-ended, and do not exclude additional, uncited elements or method steps. At the same time, "comprising," "having," "including," or "containing""Yes" can also indicate a closed loop, excluding additional, uncited elements or method steps.

[0066] In this invention, the meaning of "may" includes both performing a certain process and not performing a certain process.

[0067] In this invention, "optional" or "optionally" indicates the use or non-use of certain substances, components, execution steps, application conditions, etc.

[0068] In this invention, the numerical range expressed as "numerical value A ~ numerical value B", "numerical value A - numerical value B", "numerical value A and below" refers to the range including the endpoints numerical values ​​A and B.

[0069] In this invention, the term "about" is used to define that the numerical ranges and parameters of this invention are approximate values, and the relevant values ​​in the specific embodiments have been presented as precisely as possible. Unless otherwise explicitly stated, it should be understood that all ranges, quantities, values ​​and percentages used in this invention are modified by "about". Here, "about" generally means that the actual value is within ±5%, ±3%, ±1% or ±0.5% of a certain value or range. Furthermore, the values ​​and numerical ranges appearing in this invention should be understood to include systematic errors that are unavoidable in industrial production.

[0070] In this invention, the terms "some specific / preferred embodiments", "other specific / preferred embodiments", "implementation", etc., refer to specific elements (e.g., features, structures, properties and / or characteristics) related to the described embodiment, which are included in at least one embodiment described herein and may or may not exist in other embodiments. In addition, it should be understood that the elements can be combined in any suitable manner in various embodiments.

[0071] In this invention, "polypeptide" refers to a string of at least two amino acid residues linked together by covalent bonds (e.g., peptide bonds), which can be recombinant polypeptides, natural polypeptides, or synthetic polypeptides. It may contain modified amino acids and may be separated by non-amino acid barriers. The term also includes amino acid polymers that have been modified (e.g., disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other operation, such as conjugation with labeled components). Polypeptides typically have only a primary structure (linear amino acid sequence) and may have a simple secondary structure. In some embodiments, the polypeptides described in this invention are linear.

[0072] In this invention, "protein" refers to a macromolecule composed of one or more polypeptide chains that may have a higher-order structure and specific biological function. Proteins can typically have a complete tertiary or quaternary structure. The maintenance of its conformation depends on various forces such as hydrogen bonds, hydrophobic interactions, disulfide bonds, etc.

[0073] In this invention, "polynucleotide" refers to a polymeric form of nucleotides of any length, whether deoxyribonucleoside or polynucleotide.Acids or ribonucleotides, or analogues thereof. Polynucleotides may have any three-dimensional structure and may perform any known or unknown function. Nucleic acid molecules may be linear or circular.

[0074] In this invention, "vector" refers to a nucleic acid delivery vehicle into which a polynucleotide may be inserted. When a vector enables the expression of a protein encoded by the inserted polynucleotide, the vector is called an expression vector. The vector may be introduced into a host cell by transformation, transduction, or transfection, so that the genetic material elements it carries are expressed in the host cell. Vectors are known to those skilled in the art and include, but are not limited to: plasmids, viruses, bacteriophages, Cos plasmids, transposons, artificial chromosomes, etc.

[0075] In this invention, "host cell" refers to a cell into which the above-described vector may be introduced. Host cells may include bacterial, fungal, plant, or animal cells. For example, suitable bacteria include, but are not limited to, members of the family Enterobacteriaceae, such as strains of Escherichia coli. For example, suitable fungi include, but are not limited to, Saccharomyces cerevisiae and Pichia pastoris. For example, suitable animal host cell lines include, but are not limited to, CHO (Chinese hamster ovary cell line) and NSO cells.

[0076] In this invention, "codon optimization" means that the nucleotide sequence encoding a polypeptide has been configured to contain codons preferred by the host cell or organism to improve gene expression and translation efficiency in the host cell or organism.

[0077] In this invention, "linking peptide" refers to a short peptide used to link two molecules (e.g., protein, polypeptide), such a short peptide consisting of one or more amino acid residues.

[0078] In this invention, "tag" refers to such a short peptide that is fused or linked to a target protein, thereby facilitating the soluble expression, detection, and / or purification of the recombinant protein. The tag may be fused or linked to the N-terminus and / or C-terminus of the target protein (optionally linked via a linking sequence or protease cleavage site).

[0079] In this invention, "signal peptide" refers to such a short peptide that, when fused with a target protein, is capable of facilitating the secretion of the target protein expressed by the cell onto the cell membrane or extracellularly. Signal peptides are typically located at the N-terminus of the target protein, and various signal peptides are known to those skilled in the art, such as, but not limited to, erythropoietin signal sequences, human insulin signal sequences, human interleukin-2 signal sequences, albumin signal sequences, etc.

[0080] In this invention, the term "identity" refers to the percentage of identical amino acids between two or more polypeptides. Sequence identity between two or more polypeptides can be determined by aligning the amino acid sequences of the polypeptides and...The number of positions containing the same amino acid residues in the aligned polypeptide is scored and compared with the number of positions containing different amino acid residues in the aligned polypeptide. Sequence identity can be calculated by dividing the number of positions containing the same amino acid residues by the total number of amino acid residues in the polypeptide.

[0081] In this invention, amino acid addition can refer to the addition of 1, 2, 3 or more amino acids at any position of the C-terminus, N-terminus or between the C-terminus and N-terminus of the amino acid sequence, as long as the altered sequence completely or partially retains the activity of the original amino acid sequence.

[0082] In this invention, amino acid deletion can refer to the deletion of 1, 2, 3 or more amino acids from the amino acid sequence, as long as the altered sequence completely or partially retains the activity of the original amino acid sequence.

[0083] In this invention, amino acid substitution can refer to the substitution of amino acids at 1, 2, 3 or more positions of the amino acid sequence by other amino acids, as long as the altered sequence completely or partially retains the activity of the original amino acid sequence.

[0084] Amino acid substitution can be conserved amino acid substitution, which refers to the substitution of several amino acids with amino acids of similar or related properties compared to the original amino acid sequence to form a peptide (conserved variant peptide). For example, these conserved variant peptides, as described on page 6 / 20 of CN 122036921 A, can be generated based on the following amino acid substitutions: substitution of Ala with Val, Leu, or Ile; substitution of Arg with Lys, Gln, Asn, or His; substitution of Asn with Gln, His, Lys, or Arg; substitution of Asp with Glu or Asn; substitution of Cys with Ser or Ala; and substitution of Asn with... This can include substitutions such as Glu for Gln, Asp or Gln for Glu, Ala for Gly, Asn, Lys, Gln, or Arg for His, Leu, Met, Ala, Val, Phe, or leucine for Ile, Ile, Met, Ala, Val, Phe, or leucine for Leu, Asn, Gln, or Arg for Lys, Ile, Leu, or Phe for Met, Leu, Val, Ile, Ala, or Tyr for Phe, Ala for Pro, Thr for Ser, Ser or Val for Thr, Phe or Tyr for Trp, Trp, Phe, Thr, or Ser for Tyr, and Phe, Ala, Met, Ile, Leu, or leucine for Val. Amino acid substitutions can also be non-conserved.

[0085] In this invention, "hybridization" refers to the ability of a polynucleotide to bind to a substantially complementary sequence under stringent conditions, without non-specific binding to non-complementary sequences. The stringent conditions described in this invention are selected from […].Equally stringent conditions, medium-to-high stringent conditions, high stringent conditions, and very high stringent conditions. As used in this invention, the terms "medium stringent conditions," "medium-to-high stringent conditions," "high stringent conditions," or "very high stringent conditions" describe the conditions for nucleic acid hybridization and washing. For example, specific hybridization conditions are as follows: (1) Low-toughness hybridization conditions: 6× sodium chloride / sodium citrate (SSC) at about 45°C, then at least 50°C, washed twice in 0.2×SSC, 0.1% SDS (for low-toughness conditions, the washing temperature can be increased to 55°C); (2) Medium-toughness hybridization conditions: 6×SSC at about 45°C, then at 60°C, washed once or more in 0.2×SSC, 0.1% SDS; (3) High-toughness hybridization conditions: 6×SSC at about 45°C, then at 65°C, washed once or more in 0.2×SSC, 0.1% SDS, preferably; (4) Very high-toughness hybridization conditions: 0.5M sodium phosphate, 7% SDS at 65°C, then at 65°C, washed once or more in 0.2×SSC, 1% SDS.

[0086] Unless otherwise defined, other technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0087] I. Recombinant Type XIII Humanized Collagen

[0088] This invention provides a recombinant type XIII humanized collagen, which was obtained by the inventors of this invention based on natural human type XIII collagen (UniProt: Q5TAT6).

[0089] In some embodiments, the amino acid sequence of the recombinant type XIII humanized collagen comprises n repeating units, where n is an integer greater than or equal to 1. When n is an integer greater than or equal to 2, the repeating units are directly linked or linked by linking peptides; wherein the amino acid sequence of the repeating unit comprises any one of the following (a)-(c):

[0090] (a) the sequence shown in SEQ ID NO. 1 or 3;

[0091] (b) a sequence in which one or more amino acid residues are added, substituted, and / or deleted in the sequence shown in SEQ ID NO. 1 or SEQ ID NO. 3 while retaining biological activity;

[0092] (c) a sequence having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence shown in SEQ ID NO. 1 or SEQ ID NO. 3 while retaining biological activity.

[0093] In some embodiments, the amino acid sequence of the repeating unit comprises a sequence in which 1-20 amino acid residues are added, replaced, and / or deleted, as shown in SEQ ID NO.1, while retaining biological activity.

[0094] In some embodiments, the amino acid sequence of the repeating unit comprises a sequence as shown in SEQ ID NO. 1, in which 6 or 18 amino acid residues are added, substituted, and / or deleted, while retaining biological activity.

[0095] In some embodiments, the amino acid sequence of the repeating unit comprises a sequence as shown in SEQ ID NO. 1, in which 6 amino acid residues are added and 18 amino acid residues are deleted, while retaining biological activity.

[0096] In some embodiments, the amino acid sequence of the repeating unit comprises a sequence as shown in SEQ ID NO. 1, in which 6 or 18 amino acid residues are added, substituted, and / or deleted, while retaining the portion shown in SEQ ID NO. 14, while retaining biological activity.

[0097] In some embodiments, the amino acid sequence of the repeating unit comprises a sequence as shown in SEQ ID NO.1 with the addition of 6 amino acid residues and the deletion of 18 amino acid residues, while retaining the portion shown in SEQ ID NO.14 and retaining biological activity.

[0098] SEQ ID NO.14: GQVGPPGQPGDKGERGAA.

[0099] In some embodiments, the amino acid sequence of the repeating unit comprises a sequence as shown in SEQ ID NO.2.

[0100] In some embodiments, the amino acid sequence of the repeating unit comprises a sequence having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence shown in SEQ ID NO.2 and retaining biological activity.

[0101] In some embodiments, the amino acid sequence of the repeating unit is the sequence shown in SEQ ID NO.1 or SEQ ID NO.2.

[0102] In some embodiments, the amino acid sequence of the repeating unit comprises a sequence in which 1-15 amino acid residues are added, substituted, and / or deleted as shown in SEQ ID NO. 3, while retaining biological activity.

[0103] In some embodiments, the amino acid sequence of the repeating unit comprises a sequence in which 12 amino acid residues are added, substituted, and / or deleted as shown in SEQ ID NO. 3, while retaining biological activity.

[0104] In some embodiments, the amino acid sequence of the repeating unit comprises a sequence in which 12 amino acid residues are added and simultaneously deleted as shown in SEQ ID NO. 3, while retaining biological activity.

[0105] In some embodiments, the amino acid sequence of the repeating unit comprises a sequence in which 12 amino acid residues are added, 12 amino acid residues are substituted, and / or 12 amino acid residues are deleted from the sequence shown in SEQ ID NO. 3, while retaining the portion shown in SEQ ID NO. 15 and retaining the biological activity function.

[0106] In some embodiments, the amino acid sequence of the repeating unit comprises a sequence in which 12 amino acid residues are added or deleted from the sequence shown in SEQ ID NO. 3, while retaining the portion shown in SEQ ID NO. 15 and retaining the biological activity function.

[0107] SEQ ID NO. 15: GFPGFPGPIGLDGKPGHP.

[0108] In some embodiments, the amino acid sequence of the repeating unit comprises a sequence in which at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence shown in SEQ ID NO. 4 is retained and the biological activity function is retained.

[0110] In some embodiments, the amino acid sequence of the repeating unit is as shown in SEQ ID NO. 3 or SEQ ID NO. 4.

[0111] In some embodiments, n is an integer between 1 and 20, and when n is an integer greater than or equal to 2, the repeating units are directly connected.

[0112] In some embodiments, n is an integer between 1 and 20; for example, it can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.

[0113] In some embodiments, n is an integer between 8 and 12, for example, it can be 8, 9, 10, 11, or 12.

[0114] In some specific embodiments, n is 8, 10, or 12.

[0115] In some embodiments, the amino acid sequence of the recombinant type XIII humanized collagen comprises the sequence shown in any one of SEQ ID NO. 5-8. Specification 8 / 20 pages 12 CN 122036921 A

[0116] In some specific embodiments, the amino acid sequence of the recombinant type XIII humanized collagen includes 1-43 additions, substitutions or deletions (e.g. 1-43, 1-40, 1-35, 1-30, 1-25, 1-20, 1-15, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, 1-2) of the sequence shown in SEQ ID NO. 5.(more specifically, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40 or 43) amino acid residues and retaining sequences that promote cell adhesion and / or cell proliferation activity.

[0117] In some specific embodiments, the amino acid sequence of the recombinant type XIII humanized collagen includes the addition, substitution or deletion of 1-43 (e.g., 1-43, 1-40, 1-35, 1-30, 1-25, 1-20, 1-15, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, 1-2, more specifically, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40 or 43) amino acid residues in the sequence shown in SEQ ID NO. 6, and retains sequences that promote cell adhesion and / or cell proliferation activity.

[0118] In some specific embodiments, the amino acid sequence of the recombinant type XIII humanized collagen includes the addition, substitution or deletion of 1-45 (e.g., 1-45, 1-40, 1-35, 1-30, 1-25, 1-20, 1-15, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, 1-2, more specifically, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40 or 45) amino acid residues in the sequence shown in SEQ ID NO.7, and retains sequences that promote cell adhesion and / or cell proliferation activity.

[0119] In some specific embodiments, the amino acid sequence of the recombinant type XIII humanized collagen includes the addition, substitution or deletion of 1-45 (e.g., 1-45, 1-40, 1-35, 1-30, 1-25, 1-20, 1-15, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, 1-2, more specifically, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40 or 45) amino acid residues in the sequence shown in SEQ ID NO. 8, while retaining sequences that promote cell adhesion and / or cell proliferation activity.

[0120] In some embodiments, the amino acid sequence of the recombinant type XIII humanized collagen comprises having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, or 94% of the sequence shown in any one of SEQ ID NO. 5-8.

[0121] In some embodiments, the amino acid sequence of the recombinant type XIII humanized collagen contains at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence shown in SEQ ID NO. 5, and retains eight portions shown in SEQ ID NO. 14 while retaining sequences that promote cell adhesion and / or cell proliferation.

[0122] In some embodiments, the amino acid sequence of the recombinant type XIII humanized collagen is the sequence shown in any one of SEQ ID NO. 5-8.

[0123] The recombinant type XIII humanized collagen provided by the present invention has good cell adhesion activity and / or cell proliferation activity.

[0124] II. Fusion Protein

[0125] The present invention provides a fusion protein obtained by fusing other polypeptides of the recombinant type XIII humanized collagen described in Part I.

[0126] In some embodiments, the other polypeptides refer to polypeptides that are not the recombinant type XIII humanized collagen. In some embodiments, the other polypeptides include, but are not limited to, other collagen peptides; preferably, the other collagen peptides are derived from truncated amino acid sequences of human collagen, such as truncated fragments of the amino acid sequence of human collagen, recombinant humanized collagen peptides composed of repeated truncated fragments of the amino acid sequence of human collagen, etc. Specification 9 / 20 pages 13 CN 122036921 A

[0127] III. Polynucleotide

[0128] The present invention provides a polynucleotide that encodes the recombinant type XIII humanized collagen described in Part I or the fusion protein described in Part II.

[0129] In some embodiments, the nucleotide sequence of the polynucleotide comprises a sequence as shown in any one of SEQ ID NO. 9-12.

[0130] In some embodiments, the nucleotide sequence of the polynucleotide comprises a sequence as shown in any one of SEQ ID NO. 9-12 after codon optimization.

[0131] In some embodiments, the nucleotide sequence of the polynucleotide comprises a sequence that hybridizes under stringent conditions to a sequence as shown in any one of SEQ ID NO. 9-12 and encodes a protein having cell adhesion or cell proliferation-promoting activity having a sequence as shown in any one of SEQ ID NO. 5-8.

[0132] In some embodiments, the nucleotide sequence of the polynucleotide further comprises encoding a tag and / or signal peptide.Sequence; optionally, the tag is selected from His tag, GST tag, MBP tag, SUMO tag and NusA tag.

[0133] In some embodiments, the nucleotide sequence of the polynucleotide is the sequence shown in any one of SEQ ID NO. 9-12.

[0134] IV. Expression cassette

[0135] The present invention provides an expression cassette comprising the polynucleotide described in Part III.

[0136] In some embodiments, the expression cassette comprises a control element operatively linked to the polynucleotide.

[0137] In some preferred embodiments, the control element is a promoter, terminator and / or enhancer.

[0138] V. Recombinant vector

[0139] The present invention provides a recombinant vector comprising the polynucleotide described in Part III.

[0140] In some embodiments, the recombinant vector comprises a control element operatively linked to the polynucleotide.

[0141] In some preferred embodiments, the control element is a promoter, terminator and / or enhancer.

[0142] In some embodiments, the recombinant vector is a plasmid vector, viral vector, transposon, or artificial chromosome containing the polynucleotide.

[0143] The recombinant vector provided by the present invention may be a recombinant vector or a recombinant integrative vector.

[0144] In some preferred embodiments, the recombinant vector is a recombinant expression vector.

[0145] VI. Recombinant Host Cell

[0146] The present invention provides a recombinant host cell, which contains the expression cassette described in Part IV or the recombinant vector described in Part V.

[0147] In some embodiments, the recombinant host cell is a bacterium, fungus, or animal cell.

[0148] In some preferred embodiments, the bacterium is Escherichia coli.

[0149] In some preferred embodiments, the fungus is yeast; more preferably, it is Saccharomyces cerevisiae or Pichia pastoris.

[0150] VII. Preparation method of the recombinant type XIII humanized collagen described in Part I or the fusion protein described in Part II

[0151] The present invention provides a method for preparing the recombinant type XIII humanized collagen described in Part I or the fusion protein described in Part II, the method comprising the following steps: fermenting and culturing the recombinant host cells described in Part VI, inducing expression, and collecting the recombinant host cells and / or the culture medium of the recombinant host cells containing the recombinant type XIII humanized collagen or fusion protein, and isolating the recombinant type XIII humanized collagen or fusion protein therefrom.

[0152] In some embodiments, before fermenting and culturing the recombinant host cells described in Part VI, the preparation method is described in the specification 10 / 20 pages 14 CN 122036921 AIt may also include the steps of screening the functional regions of human natural type XIII collagen, constructing the recombinant vector, and constructing the recombinant host cell; specifically, by repeatedly linking the amino acid sequences of the functional regions of the screened human natural type XIII collagen and optionally adding amino acid sequences that can be cleaved by collagen tool enzymes (e.g., TEV protease), the amino acid sequence of the recombinant type XIII humanized collagen as described in Part I of the present invention is obtained. Subsequently, the polynucleotide sequence of the coding gene of the above protein can be artificially designed and optimized according to the codon preference of the target organism, thereby obtaining the nucleotide sequence as described in Part III of the present invention, which is cloned into a vector to construct the recombinant vector as described in Part V of the present invention, and the above vector is transformed into a host cell to obtain the recombinant host cell as described in Part VI of the present invention.

[0153] In some embodiments, the fermentation culture includes: inoculating the screened positive genetically engineered bacteria into a shake flask containing a culture medium containing antibiotics and culturing it in a constant temperature shaker at 220 rpm and 37°C.

[0154] In some embodiments, the induced expression includes: (1) cooling the cultured shake flask to 16-30°C; (2) adding IPTG stock solution to induce expression; (3) collecting the bacterial cells after induced expression in a centrifuge bottle and centrifuging at 6000 rpm and 4°C for 12 min.

[0155] In some embodiments, the recombinant type XIII humanized collagen or fusion protein is isolated from the recombinant host cells and / or the culture medium of the recombinant host cells using a Ni affinity chromatography column.

[0156] In some embodiments, the preparation method further includes an optional step of enzymatic digestion using a collagen tool enzyme (e.g., TEV protease); preferably, the digestion is performed after purification using a Ni affinity chromatography column; preferably, after digestion, purification can be performed again using a Ni affinity chromatography column.

[0157] VIII. Composition

[0158] The present invention provides a composition comprising the recombinant type XIII humanized collagen described in Part I, the fusion protein described in Part II, the polynucleotide described in Part III, the expression cassette described in Part IV, the recombinant vector described in Part V, and / or the recombinant host cell described in Part VI.

[0159] In some embodiments, the composition is a topical composition, an injectable composition, or an oral composition.

[0160] In some embodiments, the composition is in the form of a liquid, lyophilized powder, gel, sponge, or fiber.

[0161] In some embodiments, the composition is a bio-dressing, a human biomimetic material, a plastic and cosmetic material, an organoid culture material, a cardiovascular stent material, a coating material, a tissue filler / volume enhancer, an ophthalmic material, or a gynecological and obstetric biomaterial.Nerve repair and regeneration materials, skin wound repair materials, skin barrier repair materials, muscle, bone, cartilage, or ligament regeneration materials, liver tissue materials, vascular repair and regeneration materials, 3D printed artificial organ biomaterials, cosmetic raw materials, pharmaceutical excipients, drugs, or food additives.

[0162] The “biological dressing” described in this invention refers to an artificial material used to cover wounds to promote wound healing, which may have hemostatic, anti-infection, and tissue regeneration promotion functions. The “human biomimetic material” described in this invention refers to a material that simulates the structure and function of natural tissues. The “plastic and cosmetic material” described in this invention refers to a material used to repair defects or beautify appearance, which may have biological inertness, plasticity, and long-term stability. The “organoid culture material” described in this invention refers to a three-dimensional matrix material that supports the growth of organoids, providing a microenvironment close to that in vivo to promote cell self-organization. The “cardiovascular stent material” described in this invention refers to a device material used to support narrowed / occluded blood vessels, which has both mechanical strength and endothelialization promotion capabilities. The “coating material” described in this invention refers to a functional material that covers the surface of a medical device to improve the biocompatibility or durability of the substrate. The "tissue injection filling material" described in this invention refers to a material that fills soft tissue depressions or wrinkles through injection, possessing injectability and low immunogenicity. The "ophthalmic material" described in this invention refers to a material used for intraocular or ocular surface repair. The "gynecological and obstetric biomaterial" described in this invention refers to a material applied to the female reproductive system, which may possess tissue flexibility and anti-infective properties. The "nerve repair and regeneration material" described in this invention refers to a scaffold material that promotes nerve regeneration, often loaded with neurotrophic factors to guide the directional growth of nerve cells. The "skin wound repair material" described in this invention refers to a class of functional biomaterials specifically designed for treating skin wounds, whose main functions include providing a physical barrier, managing exudate, anti-infection, and / or actively promoting healing. The "skin barrier repair material" described in this invention refers to functional materials that, for example, accelerate the repair, strengthening, or reconstruction of damaged skin barriers by promoting keratinocyte proliferation and enhancing the stratum corneum's renewal capacity. These materials possess bioactivity that actively promotes epidermal regeneration, aiming to restore the integrity of skin structure and enhance the barrier's self-repair ability. Such materials typically possess biocompatibility or skin affinity. The "muscle, bone, cartilage, or ligament regeneration material" described in this invention is a class of biomaterials designed to guide or induce the structural and functional reconstruction of damaged muscle, bone, cartilage, or ligament tissues. These materials possess biocompatibility and biodegradability, and have suitable mechanical properties. The "liver tissue material" described in this invention refers to materials used for liver injury repair or in vitro liver model construction, simulating the liver's unique metabolic functions. The "vascular repair and regeneration material" described in this invention refers to materials used for vascular replacement or regeneration, possessing anticoagulant and...Dynamic compliance. The "3D-printed artificial organ biomaterials" described in this invention refer to materials used to construct organ substitutes through 3D printing technology. The "cosmetic raw materials" described in this invention refer to active or matrix components in skincare or makeup products. The "pharmaceutical excipients" described in this invention refer to inactive ingredients in pharmaceutical preparations. The "drugs" described in this invention refer to compositions used for the prevention, treatment, or diagnosis of human diseases, purposefully regulating human physiological functions, and specifying indications or therapeutic functions, usage, and dosage. The "food additives" described in this invention are artificially synthesized substances added to food to improve its quality, color, aroma, and taste, as well as for preservation, freshness, and processing needs.

[0163] IX. Uses

[0164] The present invention provides the use of the recombinant type XIII humanized collagen described in Part I, the fusion protein described in Part II, the polynucleotide described in Part III, the expression cassette described in Part IV, the recombinant vector described in Part V, the recombinant host cell described in Part VI, and / or the composition described in Part VIII in the preparation of bio-dressings, human biomimetic materials, plastic and cosmetic materials, organoid culture materials, cardiovascular stent materials, coating materials, tissue filling / volume-enhancing materials, ophthalmic materials, obstetric and gynecological biomaterials, nerve repair and regeneration materials, skin wound repair materials, skin barrier repair materials, muscle or bone or cartilage or ligament regeneration materials, liver tissue materials, vascular repair and regeneration materials, 3D printed artificial organ biomaterials, cosmetic raw materials, pharmaceutical excipients, pharmaceutical or food additives.

[0165] The present invention provides the use of the recombinant type XIII humanized collagen described in Part I, the fusion protein described in Part II, the polynucleotide described in Part III, the expression cassette described in Part IV, the recombinant vector described in Part V, the recombinant host cell described in Part VI, and / or the composition described in Part VIII in the preparation of products for any one or more of the following: promoting cell adhesion, promoting cell proliferation, promoting extracellular matrix generation or reconstruction, tissue repair, tissue filling or volume enhancement; preferably, the cells are skin fibroblasts and / or keratinocytes; preferably, the tissue is bone tissue or connective tissue.

[0166] The present invention provides the use of the recombinant type XIII humanized collagen described in Part I, the fusion protein described in Part II, the polynucleotide described in Part III, the expression cassette described in Part IV, the recombinant vector described in Part V, the recombinant host cell described in Part VI, and / or the composition described in Part VIII in the preparation of a medicament for the prevention and / or treatment of diseases or conditions associated with type XIII collagen deficiency or for the supplementation of type XIII collagen; preferably, the diseases or conditions include type XIII collagen deficiency.

[0167] The present invention also provides a method for promoting cell adhesion and / or promoting cell proliferation and / or promoting extracellular matrix generation or reconstruction, the method comprising the step of contacting cells with the recombinant type XIII humanized collagen described in Part I, the fusion protein described in Part II, the polynucleotide described in Part III, the expression cassette described in Part IV, the recombinant host cell described in Part V, and / or the composition described in Part VIII; preferably, the cells are animal cells; more preferably, the cells are mammalian cells; even more preferably, the cells are human cells; preferably, the cells are skin fibroblasts and / or keratinocytes.

[0168] In some embodiments, the promotion of cell adhesion and / or promotion of cell proliferation and / or promotion of extracellular matrix generation or reconstruction is performed in vivo or in vitro.

[0169] Examples

[0170] The embodiments of the present invention will be described in detail below with reference to examples, but those skilled in the art will understand that the following examples are only for illustrating the present invention and should not be regarded as limiting the scope of the present invention. Unless otherwise specified in the examples, the conditions shall be performed in accordance with conventional conditions or the conditions recommended by the manufacturer. Unless otherwise specified, all materials or instruments used shall be conventional products that can be obtained commercially.

[0171] Example 1: Construction and expression of recombinant humanized type XIII collagen

[0172] 1.1 Construction of recombinant humanized type XIII collagen

[0173] (1) The following different protein functional regions and their amino acid sequences were obtained by large-scale functional region screening of natural human type XIII collagen (UniProt: Q5TAT6):

[0174] 406GQVGPPGQPGDKGERGAAGEQGPDGPKGSKGEPGKG441 (SEQ ID NO.1);

[0175] 169GFPGFPGPIGLDGKPGHPGPKGDMGLTGPP198 (SEQ ID NO.3).

[0176] Further investigation was conducted into variant sequences of the above sequences. Based on SEQ ID NO.1 and SEQ ID NO.3, further screening yielded variant protein functional regions and their amino acid sequences containing partial fragments of SEQ ID NO.1 and SEQ ID NO.3:

[0177] 400GEAGVDGQVGPPGQPGDKGERGAA423 (SEQ ID NO.2);

[0178] 157GPRGPPGQPGTRGFPGFPGPIGLDGKPGHP186 (SEQ ID NO.4).

[0179] To ensure the purification and stability of recombinant type XIII humanized collagen, the functional regions of the above proteins were used as repeating units and optimized by n repetitions and direct ligation, resulting in recombinant collagen rhXIII-1, rhXIII-2, rhXIII-3, and rhXIII-4, with corresponding amino acid sequences as shown in SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, and SEQ ID NO.8, respectively.

[0180] The amino acid sequence of recombinant collagen rhXIII-1 (8 repeats of SEQ ID NO.1):

[0181] GQVGPPGQPGDKGERGAAGEQGPDGPKGSKGEPGKGGQVGPPGQPGDKGERGAAGEQGPDGPKGSKGE PGKGGQVGPPGQPGDKGERGAAGEQGPDGPKGSKGEPGKGGQVGPPGQPGDKGERGAAGEQGPDGPKGSKGEPGKGGQVGPPGQPGDKGERGAAGEQGPDGPKGSKGEPGKG GQVGPPGQPGDKGERGAAGEQGPDGPKGSKGEPGKG GQVGPPGQPGDKGERGAAGEQGPDGPKGSKGEPGKGGQVGPPGQPGDKGERGAAGEQGPDGPKGSKGEPGKG (SEQ ID NO.5).

[0182] The amino acid sequence of recombinant collagen rhXIII-2 (12 repetitions of SEQ ID NO.2):

[0183] GEAGVDGQVGPPGQPGDKGERGAAGEAGVDGQVGPPGQPGDKGERGAAGEAGVDGQVGPPGQPGDKGERGAA GEAGVDGQVGPPGQPGDKGERGAAGEAGVDGQVGPPGQPGDKGERGAAGEAGVDGQVGPPGQPGDKGERGAAGEAGVDGQVGPPGQPGDKGERGAA GEAGVDGQVGPPGQPGDKGERGAAGEAGVDGQVGPPGQPGDKGERGAAGEAGVDGQVGPPGQPGDKGERGAAGEAGVDGQVGPPGQPGDKGERGAAGEAGVDGQVGPPGQPGDKGERGAAGEAGVDGQVGPPGQPGDKGERGAAGEAGVDGQVGPPGQPGDKGERGAA (SEQ ID NO.6).

[0184] The amino acid sequence of recombinant collagen rhXIII-3 (10 repeats of SEQ ID NO.3):

[0185] A GLTGPPGFPGFPGPIGLDGKPGHPGPKGDMGLTGPPGFPGFPGPIGLDGKPGHPGPKGDMGLTGPPGFPGFPGPIG LDGKPGHPGPKGDMGLTGPPGFPGFPGPIGLDGKPGHPGPKGDMGLTGPPGFPGFPGPIGLDGKPGHPGPKGDMGL TGPP (SEQ ID NO. 7). Amino acid sequence of recombinant collagen rhXIII-4 (10 repeats of SEQ ID NO. 4): GPRGPPGQPGTRGFPGFPGPIGLDGKPGHPGPRGPPGQPGTRGFPGFPGPIGLDGKPGHPGPRGPPGQ PGTRGFPGFPGPIGLDGKPGHPGPRGPPGQPGTRGFPGFPGPIGLDGKPGHPGPRGPPGQPGTRGFPGFPGPIGLD GKPGHPGPRGPPGQPGTRGFPGFPGPIGLDGKPGHPGPRGPPGQPGTRGFPGFPGPIGLDGKPGHPGPRGPPGQPG TRGFPGFPGPIGLDGKPGHPGPRGPPGQPGTRGFPGFPGPIGLDGKPGHPGPRGPPGQPGTRGFPGFPGPIGLDGK PGHP (SEQ ID NO. 8).

[0188] (2) Codon optimization was performed according to the E. coli expression system, and the nucleotide sequences encoding recombinant collagen rhXIII-1~rhXIII-4 are shown in SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, and SEQ ID NO.12, respectively.

[0189] Nucleotide sequence encoding recombinant collagen rhXIII-1:

[0190] GGACAAGTAGGGCCGCCGGGCCAACCGGGTGATAAAGGCGAACGCGGCGCGGCCGGTGAACAAGGTCCGGATGGTCCGAAGGGCAGCAAAGGCGAACCGGGTAAAGGAGGTCAAGTGGGCCCACCGGGCCAGCCCGGGGACAAG GGTGAACGTGGCGCTGCGGGTGAACAGGGTCCGGATGGTCCGAAGGGCAGCAAGGGTGAACCGGGTAAAGGTGGCC AAGTTGGTCCGCCAGGTCAACCGGGTGACAAAGGCGAGCGTGGTGCGGCGGGTGAACAGGGTCCGGACGGTCCGAA GGGCTCCAAGGGCGAGCCGGGCAAAGGAGGCCAAGTGGGCCCGCCGGGCCAGCCGGGTGACAAGGGCGAACGTGGT GCGGCTGGCGAGCAAGGCCCAGATGGTCCGAAAGGTAGCAAAGGTGAGCCGGGTAAGGGCGGTCAGGTGGGTCCTC CGGGTCAGCCGGGAGACAAGGGCGAGCGTGGTGCAGCGGGTGAGCAGGGTCCGGATGGTCCGAAGGGCTCGAAGGG CGAACCGGGCAAAGGCGGTCAGGTTGGTCCGCCTGGCCAACCGGGCGACAAGGGCGAGCGCGGTGCCGCTGGCGAG CAAGGTCCGGACGGTCCGAAGGGTTCCAAAGGCGAACCTGGCAAAGGCGGTCAGGTTGGTCCGCCAGGCCAACCGG GCGACAAAGGCGAACGTGGTGCGGCAGGCGAGCAGGGTCCGGACGGTCCGAAAGGCAGCAAGGGCGAGCCGGGTAA GGGTGGTCAGGTCGGTCCACCGGGCCAGCCGGGTGATAAAGGTGAGCGCGGTGCAGCGGGTGAGCAGGGCCCGGAT GGCCCGAAAGGTTCTAAGGGCGAGCCTGGTAAAGGC (SEQ ID NO.9).

[0191] Nucleotide sequence encoding recombinant collagen rhXIII-2:

[0192] GGAGAAGCTGGGGTGGACGGCCAGGTTGGTCCGCCTGGCCAGCCGGGCGATAAAGGCGAACGCGGTGCCGCGGGCGAGGCGGGTGTAGATGGTCAGGTTGGTCCGCCTGGTCAACCGGGGGATAAAGGCGAGCGTGGTGCCGCT GGTGAAGCGGGTGTGGACGGCCAAGTGGGCCCGCCGGGTCAGCCGGGTGACAAGGGTGAACGTGGCGCGGCTGGCG AAGCTGGCGTGGACGGTCAGGTTGGTCCGCCTGGTCAACCGGGTGATAAAGGTGAACGTGGTGCGGCGGGCGAAGC GGGCGTCGACGGTCAGGTGGGCCCACCGGGCCAACCGGGTGACAAGGGTGAGCGCGGTGCGGCGGGAGAGGCCGGC GTCGACGGCCAGGTTGGCCCACCGGGTCAGCCGGGCGATAAAGGCGAGCGTGGTGCGGCAGGCGAAGCCGGCGTGG ACGGCCAAGTTGGTCCGCCGGGTCAACCGGGCGATAAGGGCGAGCGTGGTGCTGCTGGTGAGGCAGGCGTCGATGG CCAAGTGGGTCCGCCGGGCCAGCCGGGCGACAAAGGTGAACGTGGTGCTGCGGGTGAAGCCGGTGTTGACGGCCAA GTGGGTCCGCCGGGCCAACCGGGTGATAAGGGCGAAAGAGGTGCAGCGGGTGAGGCAGGCGTTGACGGTCAGGTTG GTCCGCCGGGTCAGCCGGGCGATAAGGGCGAACGCGGTGCTGCGGGTGAGGCAGGCGTGGATGGTCAGGTGGGCCC ACCGGGTCAACCGGGCGACAAAGGCGAGCGTGGTGCAGCGGGGGAGGCGGGCGTTGACGGTCAGGTTGGTCCGCCA GGCCAGCCGGGGGATAAGGGTGAGCGCGGTGCAGCG (SEQ ID NO.10). Description 14 / 20 pages 18 CN 122036921 A

[0193] Nucleotide sequence encoding recombinant collagen rhXIII-3:

[0194] GGATTTCCCGGGTTCCCGGGTCCCATCGGCTTGGACGGCAAGCCGGGTCACCCGGGCCCAAAGGGTGACATGGGCCTGACGGGTCCACCGGGCTTCCCGGGTTTTCCGGGTCCGATTGGCTTAGACGGCAAGCCGGGTCATCCG GGTCCGAAAGGTGACATGGGATTGACGGGCCCACCGGGTTTTCCGGGCTTTCCGGGTCCGATCGGCCTGGATGGCA AACCGGGTCACCCTGGCCCGAAGGGTGATATGGGTTTGACCGGTCCACCGGGTTTCCCGGGCTTTCCGGGTCCGAT TGGTCTGGATGGTAAACCGGGCCACCCGGGCCCGAAAGGCGATATGGGTCTGACCGGTCCGCCTGGATTCCCGGGT TTTCCGGGTCCGATCGGCCTGGACGGCAAACCGGGGCACCCGGGTCCGAAAGGCGACATGGGTCTTACCGGTCCTC CGGGCTTTCCGGGCTTCCCGGGCCCCATCGGCCTGGATGGTAAACCGGGCCATCCGGGTCCGAAGGGCGACATGGG TTTGACCGGCCCACCGGGATTCCCGGGTTTTCCGGGTCCTATCGGTCTGGACGGCAAGCCGGGCCATCCGGGCCCA AAAGGTGATATGGGTCTGACCGGTCCGCCTGGCTTCCCGGGTTTCCCGGGGCCGATCGGTCTGGACGGCAAACCGG GTCATCCGGGTCCCAAGGGTGATATGGGCCTGACTGGTCCACCGGGCTTTCCGGGCTTCCCGGGTCCGATTGGCCT CGACGGCAAGCCAGGCCACCCGGGTCCGAAAGGTGATATGGGTCTGACCGGTCCGCCAGGCTTTCCGGGATTCCCG GGTCCGATTGGTCTGGATGGTAAGCCGGGCCACCCGGGTCCGAAGGGCGACATGGGTTTGACCGGTCCTCCG (SEQ ID NO.11).

[0195] Nucleotide sequence encoding recombinant collagen rhXIII-4:

[0196] GGACCCAGGGGGCCGCCGGGTCAACCGGGTACGCGCGGTTTCCCGGGCTTCCCGGGTCCCATCGGTCTGGATGGTAAACCAGGCCACCCGGGTCCGCGTGGTCCACCGGGCCAACCGGGCACTCGCGGTTTTCCGGGCTTTCCG GGACCTATTGGTCTGGACGGCAAACCGGGCCATCCGGGACCACGTGGCCCACCGGGTCAGCCGGGAACCCGTGGTT TTCCTGGCTTCCCGGGTCCGATTGGCCTGGATGGCAAGCCGGGCCATCCGGGTCCGCGTGGCCCACCGGGCCAGCC GGGCACCCGCGGTTTTCCGGGCTTTCCGGGGCCGATCGGTTTAGACGGCAAACCGGGCCACCCTGGCCCGCGTGGT CCACCGGGTCAACCGGGCACCAGAGGTTTCCCGGGCTTCCCTGGCCCCATCGGCCTGGATGGTAAACCGGGTCACC CGGGTCCGCGTGGCCCACCGGGTCAGCCGGGAACCCGCGGTTTTCCAGGATTCCCGGGTCCTATCGGTCTGGATGG TAAGCCGGGCCATCCGGGTCCCAGAGGTCCGCCTGGCCAGCCTGGCACGCGCGGTTTCCCGGGTTTCCCTGGTCCG ATTGGTTTGGACGGCAAGCCGGGTCACCCGGGGCCGCGTGGTCCGCCTGGTCAGCCAGGCACCCGTGGTTTTCCGG GCTTCCCGGGTCCGATCGGCTTGGACGGTAAACCGGGTCACCCGGGTCCTCGCGGTCCGCCAGGACAACCGGGCAC CCGTGGCTTCCCGGGATTCCCGGGTCCGATCGGCCTGGATGGCAAGCCGGGTCATCCGGGCCCACGTGGTCCGCCT GGCCAGCCGGGAACCCGTGGTTTTCCGGGCTTTCCGGGTCCGATTGGTCTTGACGGCAAGCCGGGTCACCCG (SEQ ID NO.12).

[0197] 1.2 Expression of Recombinant Humanized Collagen Type XIII

[0198] After adding the collagen tool enzyme digestion sequence "GAAAACCTGTATTTCCAG (SEQ ID NO.13)" to the 5' end of the nucleotide fragments encoding different recombinant humanized collagen type XIII synthesized in the above 1.1, they were respectively inserted into pET-28a-Trx-The corresponding recombinant expression plasmid was obtained from the His expression vector.

[0199] The successfully constructed recombinant expression plasmid was transformed into Escherichia coli competent cells BL21(DE3). The specific process is as follows: (1) Take out Escherichia coli competent cells BL21(DE3) from the ultra-low temperature freezer and place them on ice. When they are half-thawed, take 2 μL of the recombinant expression plasmid to be transformed and add it to Escherichia coli competent cells BL21(DE3), and mix it slightly 2-3 times. (2) Place the mixture on ice for 30 min, and then heat shock it in a water bath at 42℃ for 45-90 s. After taking it out, place it on ice for 2 min. (3) Transfer it to a biosafety cabinet and add 500 μL of liquid Luria-Bertani medium (LB). Then, culture it at 37℃ and 220 rpm for 60 min. (4) Take 200 μL of bacterial solution and spread it evenly on an LB plate containing kanamycin sulfate. (5) Incubate the plate in a 37°C incubator for 15-17 hours until uniformly sized colonies grow. Instructions 15 / 20 pages 19 CN 122036921 A

[0200] Pick 5-6 single colonies from the transformed LB plate and place them in a shake flask containing antibiotic stock solution (50 mg / L kanamycin sulfate). Incubate at 220 rpm and 37°C in a constant temperature shaker for a certain period of time until they appear as a mist. Then cool the shake flask to 16-30°C, add isopropylthio-β-D-galactoside (IPTG) (working concentration 0.5 mmol / L) to induce expression for a period of time, then aliquot the bacterial solution into centrifuge bottles and centrifuge at 6000 rpm and 4°C for 12 min. Collect the bacterial cells containing recombinant type XIII humanized collagen and record the bacterial cell weight.

[0201] The collected bacterial cells were resuspended in equilibration working solution (200 mmol / L sodium chloride, 25 mmol / L Tris, 20 mmol / L imidazole), the bacterial solution was cooled to below 15°C, and the bacterial cells were homogenized twice to break them. The bacterial solution after breaking the bacterial cells was dispensed into centrifuge bottles and centrifuged at 17000 rpm and 4°C for 30 min. The supernatant and precipitate were collected separately and subjected to electrophoresis detection.

[0202] Recombinant type XIII humanized collagen was purified and enzymatically digested using Ni affinity chromatography. The specific process is as follows:

[0203] (1) Crude purification: a. Equilibration of column material: The column material was equilibrated using equilibration solution (200 mmol / L sodium chloride, 25 mmol / L Tris, 20 mmol / L imidazole) at a flow rate of 10 mL / min. b. Sample loading: The sample loading flow rate was controlled at 5 mL / min, and the supernatant after homogenization and centrifugation was added to the column material. c. Wash away contaminating proteins: Use 100 mL of washing solution (200 mmol / L sodium chloride, 25 mmol / L Tris),d. Collect the target protein: Elute the target protein with 20 mL of elution buffer (200 mmol / L sodium chloride, 25 mmol / L Tris, 250 mmol / L imidazole) at a flow rate of 10 mL / min. Collect the protein in the flow-through liquid, which is the target protein containing the His tag. Detect the concentration of the eluted target protein using a UV spectrophotometer. e. Wash the column with 1 mol / L imidazole working solution at a flow rate of 10 mL / min.

[0204] (2) Enzyme digestion: Add collagen tool enzyme at a ratio of 20:1 (total protein to total collagen tool enzyme), and digest at 16℃ for 2 h to separate the target protein from the His tag. Place the digested protein solution into a dialysis bag and dialyze at 4℃ for 2 h. Then transfer it to a new dialysis buffer (20 mmol / L sodium chloride, 20 mmol / L Tris) and dialyze overnight at 4℃. Detect the liquid in the dialysis bag by electrophoresis.

[0205] (3) Purification: a. Equilibrate the column: Equilibrate the column with solution A (20 mmol / L Tris, 20 mmol / L sodium chloride) at a flow rate of 10 mL / min. b. Load the sample: Load the dialysis sample at a flow rate of 5 mL / min and collect the flow-through sample, which is the target protein. Use a UV spectrophotometer to detect the concentration of the eluted target protein and calculate the protein yield. Take the sample as QFL (Quaternary Fractionation Liquid) and perform electrophoresis detection. Store the protein at 4°C. c. Wash the column: Wash the column with solution B (1 mol / L sodium chloride, 20 mmol / L Tris) for 5 column volumes (CV). Perform electrophoresis detection on the flow-through liquid.

[0206] The purified recombinant type XIII humanized collagen was detected by SDS-PAGE. The electrophoresis detection results are shown in Figures 1 to 4. As shown in Figures 1-4, recombinant collagen rhXIII-1 to rhXIII-4 were successfully expressed and prepared.

[0207] The protein expression and purification data are shown in Table 1 below, where protein yield = (purified protein amount ÷ cell weight) × 100%.

[0208] Table 1 Expression and purification data of recombinant XIII type humanized collagen rhXIII

[0209] Specification 16 / 20 pages 20 CN 122036921 A

[0210] The theoretical molecular weights of the target proteins rhXIII-1, rhXIII-2, rhXIII-3, and rhXIII-4 are 26.61 kDa, 26.28 kDa, 28.39 kDa, and 28.89 kDa, respectively. As shown in the electrophoresis diagram, the apparent molecular weight of the purified recombinant type XIII humanized collagen rhXIII-1, rhXIII-2, rhXIII-3, and rhXIII-4 proteins is close to the theoretical molecular weight.The protein expression levels were consistent, and the protein could be expressed and purified normally. After purification, the protein expression levels were rhXIII-3 > rhXIII-4 > rhXIII-2 > rhXIII-1, and the protein yield was rhXIII-2 > rhXIII-4 > rhXIII-3 > rhXIII-1.

[0211] Example 2: Peptide coverage of recombinant XIII type humanized collagen

[0212] Detecting the peptide coverage of recombinant XIII type humanized collagen can verify the consistency between the product and the target sequence, confirm whether it is the target protein; assess its structural integrity, and determine whether it has been degraded or has lost a sequence; ensure the stability of protein function. It is a key indicator to ensure the correctness and qualification of the product in research and development and quality control. High coverage (such as 94%~100%) reflects the reliability of quality.

[0213] (1) Protein sample preparation: Take the purified humanized collagen sample, add an appropriate amount of denaturing buffer (containing urea or guanidine hydrochloride), and denature it at high temperature (e.g., 95°C) to fully unfold the protein; then add dithiothreitol (DTT) to reduce the disulfide bond, and then use iodoacetamide (IAA) for alkylation treatment to block free thiol groups and prevent protein renaturation.

[0214] (2) Enzymatic digestion reaction: Dilute the treated protein solution with ammonium bicarbonate buffer to a denaturant concentration of less than 1M, add sequencing grade trypsin (or other specific protease, such as Lys-C), mix at an enzyme:protein ratio of 1:50~1:100, and incubate at 37°C for 12~16 hours to allow the protein to be enzymatically digested into small molecule peptides.

[0215] (3) Peptide extraction and desalting: After the enzymatic hydrolysis reaction, formic acid was added to terminate the reaction (final concentration approximately 0.1% (v / v)), and the supernatant was collected by centrifugation; the peptides were desalted using a C18 solid-phase extraction column to remove buffer salts and impurities, and then reconstituted with 0.1% (v / v) formic acid aqueous solution after vacuum drying.

[0216] (4) LC-MS / MS analysis: The reconstituted peptide sample was injected into a high-performance liquid chromatography-tandem mass spectrometry (LC-MS / MS) system. The peptides were separated by a reversed-phase chromatography column (such as a C18 column), and the primary and secondary mass spectrometry data of each peptide were obtained by mass spectrometry detection.

[0217] (5) Data analysis and coverage calculation: The mass spectrometry data were matched with the theoretical amino acid sequence database of the target collagen (using software such as MaxQuant and Proteome Discoverer), and the proportion of the detected peptide sequence in the full-length sequence of the target protein was calculated, i.e., peptide coverage (calculation formula: coverage = number of detected amino acid residues / total number of amino acid residues in the protein × 100%).

[0218] (6) Experimental results and analysis: The peptide coverage results of rhXIII-1, rhXIII-2, rhXIII-3 and rhXIII-4 are shown in Figures 5 to 8.

[0219] Example 3: HFB cell adhesion activity assay of recombinant type XIII humanized collagen

[0220] In this experimental system, the negative control was set as D-PBS, and the positive control was bovine type I collagen, an international standard for collagen. The values ​​between the negative and positive controls were analyzed to determine whether the detection system was working properly. D-PBS is mainly composed of PBS buffer with added calcium ions (Ca2+) and magnesium ions (Mg2+). This buffer can chelate non-specific adhesion molecules.

[0221] Collagen can provide a high-quality extracellular matrix environment for cells, helping cells to adhere to cell culture plates. The higher the adhesion of the protein, the faster it can help cells adhere to the plate in a short time. After washing, the number of cells remaining in the wells is greater.

[0222] The CCK8 assay kit (purchased from Nanjing Novizan Biotechnology Co., Ltd.) showed that after cells adhered to the matrix surface, dehydrogenases (such as succinate dehydrogenase) in the living cells reduced WST-8 to water-soluble orange formazan. The amount of formazan produced was linearly positively correlated with the number of living cells. By detecting the absorbance (OD value) of formazan at 450 nm (optimal absorption peak) using a microplate reader, the number of adherent cells could be indirectly quantified, thereby evaluating the promoting / inhibiting effect of recombinant collagen on cell adhesion. The adhesiveness of recombinant collagen can help cells adhere quickly to the cell wall, resulting in a larger number of cells in the pores. By comparing the results of recombinant collagen and bovine type I collagen, the relative cell adhesion activity of recombinant collagen can be evaluated.

[0223] (1) Sample preparation:

[0224] Collagen adhesion layer was prepared in a 96-well plate, and then human skin fibroblasts (HFB cells) were seeded in the 96-well plate;

[0225] Negative control (NC) group: D-PBS buffer (Dulbecco's Phosphate-Buffered Saline D-PBS);

[0226] Positive control (PC) group: Bovine collagen type I (B COL I) was diluted to 1 mg / mL with D-PBS buffer;

[0227] Experimental group: Recombinant collagen was diluted to a final concentration of 1 mg / mL with D-PBS buffer;

[0228] Human collagen control group: Human placental isolated type III collagen (Advanced BioMatrix, ABM-5021-10MG) was diluted to a final concentration of 1 mg / mL with D-PBS buffer.

[0229] (2) Coating: Add collagen experimental samples, positive controls and negative controls to the microplate, 100 μL per well, with 5 replicates per group, and incubate overnight at 4°C.

[0230] (3) Blocking: Discard the supernatant and add 100 μL of the supernatant.1% bovine serum albumin (BSA) (heat inactivated at 56℃ for 30 min), incubated at 37℃ for 60 min. Discard the supernatant and wash 3 times with D-PBS solution.

[0231] (4) Cell seeding: Add 105 cells in good culture condition resuspended in D-PBS to each well and incubate at 37℃ for 120 min. Wash each well 3 times with D-PBS solution.

[0232] (5) Detection: Add 100 μL of serum-free medium containing 5 μL of CCK8 reaction solution to each well and incubate at 37℃ for 120 min. Detect using an enzyme-linked immunosorbent assay (ELISA) reader at a wavelength of 450 nm. At the same time, set up a blank control well containing 5 μL of CCK8 reaction solution but without cells.

[0233] (6) Calculate the cell adhesion degree according to the following formula. The cell adhesion rate can reflect the cell adhesion force of collagen. The higher the cell adhesion force, the better the external environment can be provided to the cells in a short time, which helps the cells adhere.

[0234]

[0235] Wherein:

[0236] P: relative cell adhesion ratio;

[0237] OD1: average UV absorbance of each replicate well of the test sample at 450 nm;

[0238] OD2: average UV absorbance of each replicate well of the negative control sample at 450 nm;

[0239] OD0: average UV absorbance of each replicate well of the blank control group at 450 nm.

[0240] (7) Statistical analysis: The statistical difference between the target recombinant humanized collagen and the negative control was analyzed using a two-tailed t-test, where *, P < 0.05; **, P < 0.01; ***, P < 0.001.

[0241] The results are shown in Figure 9. Compared with the D-PBS group, bovine type I collagen has a significant cell adhesion promoting effect. Recombinant type XIII humanized collagen rhXIII-1~rhXIII-4 also have a cell adhesion promoting effect. In particular, rhXIII-1 and rhXIII-2 showed higher cell adhesion activity than the PC group and the human placental isolated type III collagen control group, with adhesion activity as high as 275% and 268% respectively compared to the NC group.

[0242] Example 4: Hacat cell proliferation activity detection of recombinant type XIII humanized collagen 18 / 20 pages 22 CN 122036921 A

[0243] Hacat cells are immortalized keratinocytes (major functional cells of the epidermis) of the human epidermis, which maintain the repair and renewal of the skin epidermis. The good condition of keratinocytes represents the maintenance of a healthy skin barrier, rapid healing of damaged skin epidermis, and can also promote the metabolic renewal of the skin surface, improve rough and dull skin, and enhance the translucency and smoothness of the epidermis.

[0244] In order to explore the biocompatibility of recombinant type XIII humanized collagen in the human skin surface and its ability to promote skin repair.Potential for the above-mentioned collagen with good biological activity was evaluated using CCK-8 assay for cell viability in Hacat cells (human immortalized keratinocytes).

[0245] Experimental reagents: CCK-8 kit (Elabscience, catalog number E-CK-A362); DMEM medium (containing 10% fetal bovine serum).

[0246] Three groups were set up as follows: Experimental group - recombinant type XIII humanized collagen was diluted to 10, 25, and 50 μg / mL in medium containing 0.4% (v / v) serum (the concentrations are marked as XIII-1 in the attached figure according to different recombinant type XIII humanized collagen, for example, XIII-1-10, representing 10 μg / mL of rhXIII-1), and sterilized by filtration through a 0.22 µm microporous membrane; NC group - medium containing 0.4% (v / v) serum was used as a negative control; PC group - NaCl was dissolved in medium containing 0.4% (v / v) serum to a final concentration of 8 wt%, and sterilized by filtration. The cell-free complete culture medium was used as the zeroing well.

[0247] HaCaT cells with a confluence of about 90% were collected, digested with trypsin, centrifuged, resuspended in serum-containing medium, and counted. The cell density was adjusted to 5×104 cells / mL, and 100 μL was seeded into each well of a 96-well plate (i.e., 5000 cells / well). 100 µL of PBS was added to the edge wells for blocking. The culture plate was pre-cultured at 37℃ and 5% CO2 for 24 hours to allow the cells to adhere. After cell adhesion, the supernatant was aspirated, and 100 µL of medium containing 0.4% (v / v) serum was added to each well. The cells were cultured for 24 hours. The original medium was aspirated, and the corresponding group solutions were replaced sequentially, with 4 replicates per group. The cells were incubated for another 24 hours.

[0248] CCK-8 assay and cell viability calculation: Add 100 µL (including 5 µL CCK8 solution) of basal culture medium to each well, shake gently to mix; incubate at 37°C in the dark for 2 hours; measure absorbance (OD value) at 450 nm using a microplate reader, with a reference wavelength of 450 nm. Calculate cell viability according to the following formula:

[0249] Cell viability = [(As-Ab) / (Ac-Ab)] × 100%;

[0250] Wherein:

[0251] As: Absorbance of experimental wells (containing cells, culture medium, CCK8 solution, and drug solution);

[0252] Ac: Absorbance of control wells (containing cells, culture medium, and CCK8 solution, but excluding drug);

[0253] Ab: Absorbance of blank control group (containing culture medium and CCK8 solution, but excluding cells and drug).

[0254] Statistical analysis: ANOVA was used to analyze the statistical differences between the samples and the negative control, where *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001.

[0255] This experiment used samples containing 8wt%The 0.4% (v / v) serum medium containing NaCl served as a positive control (PC group, cell viability 0%). After verifying the effectiveness of the experimental system, the effects of four recombinant type XIII humanized collagens at concentrations of 10, 25, and 50 μg / mL on the viability of HaCaT cells were evaluated using the CCK8 assay.

[0256] The experimental results are shown in Table 2 and Figure 10. At 10 μg / mL, only rhXIII-1 viability (127.3%) was significantly higher than that of the NC group; at 25 μg / mL, rhXIII-1 (142.8%) still had significant proliferative activity; at 50 μg / mL, the viability of XIII-1 (142.1%), rhXIII-2 (121.7%), and rhXIII-3 (122.0%) were all significantly increased, while rhXIII-4 was close to that of the NC group.

[0257] In summary, rhXIII-1 showed the most significant effect in promoting HaCaT cell proliferation, with a stronger effect at 25 μg / mL; rhXIII-2, rhXIII-3, and rhXIII-4 showed effects at 50 μg / mL.

[0258] Table 2 Data on the detection of recombinant XIII type humanized collagen rhXIII cell proliferation activity 19 / 20 pages 23 CN 122036921 A

[0259]

[0260] Example 5: HFB cell cytotoxicity detection of recombinant XIII type humanized collagen

[0261] The proliferation and cytotoxicity of rhXIII-3 and rhXIII-4 were analyzed using CCK8 reagent. The method was the same as in Example 4. The experimental group included recombinant humanized XIII type collagen rhXIII-3 and rhXIII-4 diluted with culture medium containing 0.4% (v / v) serum at concentrations of 3000, 1000, 333, 111, 37, 12, 4, 1.4, and 0.46 μg / mL. CCK8 detection reagent was added to each well. The absorbance at OD450 nm was read by the microplate reader.

[0262] Figures 11 and 12 show that the two recombinant humanized XIII type collagen rhXIII-3 and rhXIII-4 in the experimental group were non-cytotoxic in the concentration range of 0.46 µg / mL to 3000 µg / mL and showed a certain dose-dependent effect. With the increase of dose, the cell proliferation-promoting activity became more obvious.

[0263] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention. Specification 20 / 20 pages 24 CN 122036921 AFigure 1. Appendix 1 / 7, Page 25, CN 122036921 A; Figure 2. Appendix 2 / 7, Page 26, CN 122036921 A; Figure 4. Appendix 3 / 7, Page 27, CN 122036921 A; Figure 6. Appendix 7. Appendix 8, Page 4 / 7, Page 28, CN 122036921 A; Figure 9. Appendix 10, Page 5 / 7, Page 29, CN 122036921 A; Figure 11. Appendix 6 / 7, Page 30, CN 122036921 A; Figure 12. Appendix 7 / 7, Page 31, CN 122036921 A. Abstract: This invention belongs to the field of synthetic biology technology, specifically relating to recombinant humanized type XIII collagen and its applications. Through extensive screening studies, this invention has obtained the core functional region of natural human type XIII collagen. Based on this core functional region, this invention has successfully expressed and prepared recombinant humanized Type XIII collagen for the first time. It exhibits excellent biological activities, including cell proliferation and cell adhesion promotion, particularly for skin fibroblasts and keratinocytes, making it suitable for various medical and non-medical applications, such as tissue repair / filling / volume enhancement. Recombinant Humanized Type XIII Collagen and Application Thereof Abstract The present invention belongs to the field of synthetic biology technology, and specifically relates to recombinant humanized Type XIII collagen and its applications. Through extensive screening research, the present invention has identified the core functional region of natural human Type XIII collagen. Based on this core functional region, the present invention has successfully expressed and prepared recombinant humanized Type XIII collagen for the first time.expressed and prepared recombinant humanized Type XIII collagen for the first time. The recombinant humanized Type XIII collagen has good biological activities, including promoting cell proliferation activity and promoting cell adhesion activity, and particularly has good proliferation-promoting and adhesion-promoting activities on skin fibroblasts and keratinocytes. The recombinant humanized Type XIII collagen is suitable for a variety of medical or non-medical applications, for example, for use in tissue repair / filling / augmentation scenarios.

Claims

1. A recombinant type XIII humanized collagen, wherein its amino acid sequence contains n repeating units, where n is an integer greater than or equal to 1, and when n is an integer greater than or equal to 2, the repeating units are directly linked or linked through linker peptides; wherein, The amino acid sequence of the repeating unit includes any one of the following (a)-(c): (a) A sequence as shown in SEQ ID NO.1 or 3; (b) A sequence in which one or more amino acid residues are added, substituted, and / or deleted, as shown in SEQ ID NO.1 or SEQ ID NO.3, while retaining biological activity; (c) A sequence having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with the sequence shown in SEQ ID NO.1 or SEQ ID NO.3 and retaining biological activity.

2. The recombinant type XIII humanized collagen according to claim 1, characterized in that, The amino acid sequence of the repeating unit comprises a sequence as shown in SEQ ID NO.1 with the addition of 1-20, substitution of 1-20, and / or deletion of 1-20 amino acid residues while retaining biological activity; preferably, the amino acid sequence of the repeating unit comprises a sequence as shown in SEQ ID NO.1 with the addition of 6 or 18, substitution of 6 or 18, and / or deletion of 6 or 18 amino acid residues while retaining biological activity; more preferably, the amino acid sequence of the repeating unit comprises a sequence as shown in SEQ ID NO.1 with the addition of 6 or 18, substitution of 6 or 18, and / or deletion of 6 or 18 amino acid residues while retaining the portion shown in SEQ ID NO.14 and retaining biological activity; even more preferably, the amino acid sequence of the repeating unit comprises a sequence as shown in SEQ ID NO.2, or a sequence having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence as shown in SEQ ID NO.2 and retaining biological activity; or, The amino acid sequence of the repeating unit comprises a sequence as shown in SEQ ID NO. 3 with the addition of 1-15, substitution of 1-15, and / or deletion of 1-15 amino acid residues while retaining biological activity; preferably, the amino acid sequence of the repeating unit comprises a sequence as shown in SEQ ID NO. 3 with the addition of 12, substitution of 12, and / or deletion of 12 amino acid residues while retaining biological activity; more preferably, the amino acid sequence of the repeating unit comprises a sequence as shown in SEQ ID NO. 3 with the addition of 12, substitution of 12, and / or deletion of 12 amino acid residues while retaining the portion shown in SEQ ID NO. 15 and retaining biological activity; even more preferably, the amino acid sequence of the repeating unit comprises a sequence as shown in SEQ ID NO. 4, or a sequence having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence as shown in SEQ ID NO. 4 and retaining biological activity.

3. The recombinant type XIII humanized collagen according to claim 1 or 2, characterized in that, The n is an integer between 1 and 20, and when n is an integer greater than or equal to 2, the repeating units are directly connected; Preferably, n is an integer between 8 and 12; More preferably, the amino acid sequence of the recombinant type XIII humanized collagen includes the sequence shown in any one of SEQ ID NO. 5-8.

4. A fusion protein, characterized in that, The fusion protein is obtained by fusing recombinant type XIII humanized collagen and other peptides as described in any one of claims 1-3.

5. A polynucleotide, characterized in that, The polynucleotide encodes the recombinant type XIII humanized collagen of any one of claims 1-3 or the fusion protein of claim 4; Preferably, the nucleotide sequence of the polynucleotide comprises a sequence as shown in any one of SEQ ID NO. 9-12, or a sequence that hybridizes under stringent conditions with a sequence as shown in any one of SEQ ID NO. 9-12 and encodes a protein having a sequence as shown in any one of SEQ ID NO. 5-8 that has cell adhesion or cell proliferation-promoting activity. More preferably, the nucleotide sequence of the polynucleotide further includes a sequence encoding a tag and / or a signal peptide; optionally, the tag is selected from His tag, GST tag, MBP tag, SUMO tag and NusA tag.

6. An expression box, characterized in that, The expression cassette comprises the polynucleotide of claim 5; Preferably, the expression cassette includes a control element operatively connected to the polynucleotide; More preferably, the control element is a starter, a terminator, and / or an enhancer.

7. A recombinant vector, characterized in that, The recombinant vector comprises the polynucleotide of claim 5; Preferably, the recombinant vector includes a control element operatively linked to the polynucleotide; More preferably, the control element is a starter, a terminator, and / or an enhancer; Even more preferably, the recombinant vector is pET-28a-Trx-His containing the polynucleotide.

8. A recombinant host cell, characterized in that, The recombinant host cell comprises the expression cassette of claim 6 or the recombinant vector of claim 7; Preferably, the recombinant host cell is a bacterium, fungus, or animal cell; More preferably, the bacteria include Escherichia coli; the fungus includes yeast.

9. A method for preparing the recombinant type XIII humanized collagen according to any one of claims 1-3 or the fusion protein according to claim 4, characterized in that, The method includes the following steps: The recombinant host cell of claim 8 is fermented and cultured to induce expression, and the recombinant host cell and / or the culture medium containing the recombinant type XIII humanized collagen or fusion protein are collected to isolate the recombinant type XIII humanized collagen or fusion protein.

10. A composition, characterized in that, The composition comprises the recombinant type XIII humanized collagen of any one of claims 1-3, the fusion protein of claim 4, the polynucleotide of claim 5, the expression cassette of claim 6, the recombinant vector of claim 7, and / or the recombinant host cell of claim 8; Preferably, the composition is a biological dressing, a human biomimetic material, a plastic and cosmetic material, an organoid culture material, a cardiovascular stent material, a coating material, a tissue filler / volume enhancer, an ophthalmic material, an obstetric and gynecological biomaterial, a nerve repair and regeneration material, a skin wound repair material, a skin barrier repair material, a muscle, bone, cartilage, or ligament regeneration material, a liver tissue material, a vascular repair and regeneration material, a 3D printed artificial organ biomaterial, a cosmetic raw material, a pharmaceutical excipient, a drug, or a food additive; Preferably, the composition is a topical composition, an injectable composition, or an oral composition; Preferably, the composition is in the form of a liquid, lyophilized powder, gel, sponge, or fiber.

11. The use of any one of claims 1-3, the fusion protein of claim 4, the polynucleotide of claim 5, the expression cassette of claim 6, the recombinant vector of claim 7, the recombinant host cell of claim 8, and / or the composition of claim 10 in the preparation of bio-dressings, human biomimetic materials, plastic and cosmetic materials, organoid culture materials, cardiovascular stent materials, coating materials, tissue filling / volume-enhancing materials, ophthalmic materials, obstetric and gynecological biomaterials, nerve repair and regeneration materials, skin wound repair materials, skin barrier repair materials, muscle or bone or cartilage or ligament regeneration materials, liver tissue materials, vascular repair and regeneration materials, 3D printed artificial organ biomaterials, cosmetic raw materials, pharmaceutical excipients, drugs, or food additives.

12. The use of any one of the recombinant type XIII humanized collagen of claims 1-3, the fusion protein of claim 4, the polynucleotide of claim 5, the expression cassette of claim 6, the recombinant vector of claim 7, the recombinant host cell of claim 8, and / or the composition of claim 10 in the preparation of products for use in any one or more of the following: promoting cell adhesion, promoting cell proliferation, promoting extracellular matrix generation or reconstruction, tissue repair, tissue filling or volume enhancement.

13. The use of the recombinant type XIII humanized collagen of any one of claims 1-3, the fusion protein of claim 4, the polynucleotide of claim 5, the expression cassette of claim 6, the recombinant vector of claim 7, the recombinant host cell of claim 8, and / or the composition of claim 10 in the preparation of a medicament for the prevention and / or treatment of diseases or conditions related to type XIII collagen deficiency or for the supplementation of type XIII collagen.

14. A method for promoting cell adhesion and / or promoting cell proliferation and / or promoting extracellular matrix generation or reconstruction, characterized in that, The method includes the steps of contacting the recombinant type XIII humanized collagen of any one of claims 1-3, the fusion protein of claim 4, the polynucleotide of claim 5, the expression cassette of claim 6, the recombinant vector of claim 7, the recombinant host cell of claim 8, and / or the composition of claim 10 with cells; Preferably, the cells are animal cells; More preferably, the cell is a mammalian cell; Even more preferably, the cells are human cells; Preferably, the promotion of cell adhesion and / or promotion of cell proliferation and / or promotion of extracellular matrix generation or reconstruction is performed in vivo or in vitro.

Images