Double-stranded oligonucleotide and conjugate for inhibiting expression of c3 genes, and uses thereof

Abstract

The present application relates to the field of drugs, and in particular to a double-stranded oligonucleotide and conjugate for inhibiting the expression of C3 genes, and uses thereof. The double-stranded oligonucleotide or the conjugate comprising same can obviously inhibit the expression of C3 mRNA in HepG2 cells, can obviously inhibit the expression of C3 mRNA in animal bodies, can obviously reduce the level of C3 protein in the serum of cynomolgus monkeys, the inhibition effect being able to last for 42 days, can obviously inhibit alternative complement pathways of the serum of cynomolgus monkeys, but has no effect on classical complement pathways of the serum, can reduce the levels of C3 mRNA and protein of CFA-IgA mice, can reduce C3 deposition in a renal tissue, and can ameliorate the disease course of a patient with C3 deposition in the renal tissue. Additionally, no obvious abnormality is found in hematology and blood biochemistry of animals. The double-stranded oligonucleotide or the conjugate comprising same is beneficial to alleviating, preventing and / or treating diseases or disorders mediated by C3 genes.

Description

(19) *EP004772631A1* (11) EP 4 772 631 A1 (12) EUROPEAN PATENT APPLICATION published in accordance with Art. 153(4) EPC (43) Date of publication: 08.07.2026 Bulletin 2026 / 28 (21) Application number: 23950295.8 (22) Date of filing: 01.09.2023 (51) International Patent Classification (IPC): C12N 15 / 113 (2010.01) A61K 31 / 713 (2006.01) A61K 48 / 00 (2006.01) A61P 5 / 00 (2006.01) (52) Cooperative Patent Classification (CPC): A61K 31 / 713; A61K 48 / 00; A61P 5 / 00; C12N 15 / 113 (86) International application number: PCT / CN2023 / 116571 (87) International publication number: WO 2025 / 043720 (06.03.2025 Gazette 2025 / 10) (84) Designated Contracting States: AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR Designated Extension States: BA Designated Validation States: KH MA MD TN (71) Applicant: Rigerna Therapeutics Co., Ltd. Suzhou, Jiangsu 215128 (CN) (72) Inventors: • HUANG, Yuanyu Jiangsu 215128 (CN) • FAN, Zhibin Jiangsu 215128 (CN) • KONG, Lina Jiangsu 215128 (CN) (74) Representative: V.O. P.O. Box 87930 2508 DH Den Haag (NL) Remarks: The complete document including Reference Table(s) and the Sequence Listing(s) can be downloaded from the EPO website (54) DOUBLE‑STRANDED OLIGONUCLEOTIDE AND CONJUGATE FOR INHIBITING EXPRESSION OF C3 GENES, AND USES THEREOF (57) The present application relates to the field of drugs, and in particular to a double-stranded oligonucleo- tide and conjugate for inhibiting the expression of C3 genes, and uses thereof. The double-stranded oligonu- cleotide or the conjugate comprising same can obviously inhibit the expression of C3 mRNA in HepG2 cells, can obviously inhibit the expression of C3 mRNA in animal bodies, can obviously reduce the level of C3 protein in the serum of cynomolgus monkeys, the inhibition effect being able to last for 42 days, can obviously inhibit alter- native complement pathways of the serum of cynomol- gus monkeys, but has no effect on classical complement pathways of the serum, can reduce the levels of C3 mRNA and protein of CFA-IgA mice, can reduce C3 deposition in a renal tissue, and can ameliorate the disease course of a patient with C3 deposition in the renal tissue. Additionally, no obvious abnormality is found in hematology and blood biochemistry of animals. The double-stranded oligonucleotide or the conjugate com- prising same is beneficial to alleviating, preventing and / or treating diseases or disorders mediated by C3 genes. EP 4 77 2 63 1 A 1 Processed by Luminess, 75001 PARIS (FR) Description FIELD

[0001] The present disclosure relates to the field of pharmacy, in particular to a double-stranded oligonucleotide for inhibiting expression of C3 gene, conjugates and uses thereof. BACKGROUND

[0002] The complement system is a crucial component of the body’s innate immunity, composed of more than 50 soluble proteins and membrane-bound proteins. The complement system plays a vital role in various life activities, such as defending the body against foreign substances, cell lysis, inflammatory responses, the dissolution of immune complexes, the clearance of apoptotic cells, and the enhancement of humoral immune responses.

[0003] Complement activation occurs through three main pathways: the classical pathway, the alternative pathway, and the mannose-binding lectin (MBL) pathway.

[0004] Given the important role of the complement system in defending against foreign substances, clearing immune complexes within the body, and participating in adaptive immunity, abnormalities in the complement system are closely associated with numerous diseases, such as kidney diseases and autoimmune disorders. For example, atypical hemolytic uremic syndrome (aHUS) is characterized by microangiopathic hemolytic anemia, thrombocytopenia, and acute renal failure. Over 50% of aHUS cases are associated with mutations or polymorphisms in complement regulatory factors such as Factor H, Factor I, MCP, C4BP, Factor B, and C3, as well as the production of autoantibodies against Factor H. These mutations or polymorphisms typically occur in a heterozygous state and affect the secretion and function of these proteins. Another example is type II membranoproliferative glomerulonephritis (MPGN), a severe class of kidney disease typically characterized by electron-dense deposits visible under electron microscopy, accompanied by the proliferation of the glomerular basement membrane and mesangial cells. Individuals with Factor H or C3 deficiency are susceptible to this disease. Furthermore, MPGN is also associated with the body’s production of autoantibodies against the C3 convertase of the alternative pathway (also known as C3 nephritic factor, C3NeF). Glomerulonephritis is a disease characterized by kidney damage caused by excessive complement activation triggered by immune complexes in the renal blood vessels. C3 and its regulatory proteins, Factor I and Factor H, are closely linked to the onset and progression of glomerulonephritis. A deficiency in Factor I and Factor H leads to the dysregulation of C3. In addition, C1q knockout mice can produce autoantibodies, which make the apoptotic cells unable to be effectively cleared, so the mice are susceptible to immune complex-mediated glomerulonephritis.

[0005] Within the classical, lectin, and alternative pathways of the complement system, theuraputic targets currently under development include C1 (C1q, C1r, C1s), MASP, C2, C3, C5, and C6. For targeting the key complement protein C3, several companies are developing peptide drugs (e.g., AMY‑101, APL‑1) or recombinant enzymes (CB2782) for the treatment of diseases such as paroxysmal nocturnal hemoglobinuria (PNH), chronic obstructive pulmonary disease (COPD), and age-related macular degeneration (AMD).However, very few drugs targeting the keycomplement protein C3 are currently being developed for the treatment of kidney diseases.

[0006] Therefore, providing a double-stranded oligonucleotide that inhibits C3 gene expression is of great significance for improving the disease course in patients with C3 deposition in renal tissue, and for the alleviation, prevention, and / or treatment of diseases or conditions mediated by the C3 gene. SUMMARY

[0007] In view of the foregoing, the present disclosure provides a double-stranded oligonucleotide for inhibiting the expression of C3 gene, a conjugate thereof and uses thereof.

[0008] To achieve the foregoing objects, the present disclosure provides the following technical solutions:

[0009] In a first aspect, the present disclosure provides a double-stranded oligonucleotide for inhibiting expression of C3 gene, comprising a sense strand and an antisense strand; from 5’-end to 3’-end, nucleotides of positions 2 to 19 of the antisense strand comprise a complementary region to a C3 RNA transcript, wherein the complementary region comprises at least 17 contiguous nucleotides of any one of the nucleotide sequences as set forth in SEQ ID NOs: 213 to 424 or a nucleotide sequence having 1, 2 or 3 nucleotide differences from the at least 17 contiguous nucleotides; and the sense strandcomprises at least17 nucleotides,and thesense strand and the antisense strandare complementary or substantially complementary to form a duplex region, wherein being substantial complementary means that the sense strand and the antisense strand have no more than 3 nucleotide mismatches in the duplex region. 2 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55

[0010] In some optional embodiments of the present disclosure, the antisense strand comprises a nucleotide sequence having 0, 1, 2 or 3 nucleotide differences from any one of the sequences as set forth in SEQ ID NOs: 213 to 424.

[0011] In some optional embodiments of the present disclosure, the antisense strand comprises a nucleotide sequence having 0 or 1 nucleotide difference from any one of the sequences as set forth in SEQ ID NOs: 213 to 424.

[0012] In some specific embodiments of the present disclosure, the antisense strand is selected from or comprises any one of the nucleotide sequences as set forth in SEQ ID NOs: 213 to 424.

[0013] In some optional embodiments of the present disclosure, the sense strand comprises at least 17 contiguous nucleotides of any one of the nucleotide sequences as set forth in SEQ ID NOs: 1 to 212 or a nucleotide sequence having 1, 2 or 3 nucleotide differences from the at least 17 contiguous nucleotides.

[0014] In some optional embodiments of the present disclosure, the sense strand comprises a nucleotide sequence having 0, 1, 2 or 3 nucleotide differences from any one of the sequences as set forth in SEQ ID NOs: 1 to 212.

[0015] In some optional embodiments of the present disclosure, the sense strand comprises a nucleotide sequence having 0 or 1 nucleotide difference from any one of the nucleotide sequences as set forth in SEQ ID NOs: 1 to 212.

[0016] In some specific embodiments of the present disclosure, the sense strand is selected from or comprises any one of the nucleotide sequences as set forth in SEQ ID NOs: 1 to 212.

[0017] In some specific embodiments of the present disclosure, the antisense strand is selected from or comprises any one of the nucleotide sequences as set forth in SEQID NOs: 213 to 424, and the sense strand is selected from or comprises any one of the nucleotide sequences as set forth in SEQ ID NOs: 1 to 212.

[0018] In some optional embodiments of the present disclosure, the antisense strand comprises a nucleotide sequence having 0 or 1 nucleotide difference from any one of the nucleotide sequences as set forth in SEQ ID NOs: 241, 242, 285, 357 or 403;

[0019] In some specific embodiments of the present disclosure, the antisense strand comprises any one of the nucleotide sequences as set forth in SEQ ID NOs: 241, 242, 285, 357 or 403.

[0020] In some optional embodiments of the present disclosure, the sense strand comprises a nucleotide sequence having 0 or 1 nucleotide difference from any one of the nucleotide sequences as set forth in SEQ ID NOs: 29, 30, 73, 145 or 191.

[0021] In some optional embodiments of the present disclosure, the sense strand comprises any one of the nucleotide sequences as set forth in SEQ ID NOs: 29, 30, 73, 145 or 191.

[0022] In some specific embodiments of the present disclosure, the antisense strand comprises any one of the nucleotide sequences as set forth in SEQ ID NOs: 241, 242, 285, 357 or 403, and the sense strand comprises any one of the nucleotide sequences as set forth in SEQ ID NOs: 29, 30, 73, 145 or 191.

[0023] In some specific embodiments of the present disclosure, the double-stranded oligonucleotide comprises one or more pairs of: an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 241 or a nucleotide sequence having 0 or 1 nucleotide difference therefrom, and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 29 or a nucleotide sequence having 0 or 1 nucleotide difference therefrom; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 242 or a nucleotide sequence having 0 or 1 nucleotide difference therefrom, and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 30 or a nucleotide sequence having 0 or 1 nucleotide difference therefrom; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 285 or a nucleotide sequence having 0 or 1 nucleotide difference therefrom, and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 73 or a nucleotide sequence having 0 or 1 nucleotide difference therefrom; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 357 or a nucleotide sequence having 0 or 1 nucleotide difference therefrom, and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 145 or a nucleotide sequence having 0 or 1 nucleotide difference therefrom; and an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 403 or a nucleotide sequence having 0 or 1 nucleotide difference therefrom, and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 191 or a nucleotide sequence having 0 or 1 nucleotide difference therefrom.

[0024] In some specific embodiments of the present disclosure, the double-stranded oligonucleotide comprises one or more pairs of: an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 241, and a sense strand having a 3 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 nucleotide sequence as set forth in SEQ ID NO: 29; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 242, and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 30; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 285, and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 73; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 357, and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 145; and an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 403, and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 191.

[0025] In some specific embodiments of the present disclosure, the double-stranded oligonucleotide comprises: an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 241 or a nucleotide sequence having 0 or 1 nucleotide difference therefrom, and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 29 or a nucleotide sequence having 0 or 1 nucleotide difference therefrom.

[0026] In some specific embodiments of the present disclosure, the double-stranded oligonucleotide comprises: an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 241, and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 29.

[0027] In some specific embodiments of the present disclosure, each nucleotide of the double-stranded oligonucleotide is independently selected from a modified or unmodified nucleotide.

[0028] In some specific embodiments of the present disclosure, substantially all nucleotides of the double-stranded oligonucleotide are independently selected from modified nucleotides, wherein "substantially all nucleotides of the double-stranded oligonucleotide" means that most but not all of the nucleotides of the double-stranded oligonucleotide are modified nucleotides, and the double-stranded oligonucleotide comprises no more than 5, 4, 3, 2 or 1 unmodified nucleotides.

[0029] In some specific embodiments of the present disclosure, all nucleotides of the double-stranded oligonucleotide are independently selected from modified nucleotides.

[0030] In some specific embodiments of the present disclosure, each nucleotide of the double-stranded oligonucleotide is independently selected from the group consisting of: a 2’-halogen-modified nucleotide, a 2’-deoxy-modified nucleotide, a 2’-O-optionally substituted C1‑6 alkyl-modified nucleotide, a 2’-O‑(CH2)n‑O-R1-modified nucleotide, a 2’-amino-modified nucleotide, an abasic nucleotide or a nucleotide analog, wherein the nucleotide analog is one or more selected from peptide nucleic acid (PNA), Morpholino (MNA), bridged nucleic acid (BNA), locked nucleic acid (LNA), glycol nucleic acid (GNA), threose nucleic acid (TNA) and unlocked nucleic acid (UNA); wherein n is selected from 1 or 2, R1 is selected from an optionally substituted C1‑6 alkyl or an optionally substituted C1‑6 alkoxy; when R1 comprises a substituent, the substituent is selected from a halogen, a C1‑6 alkoxy, a hydroxyl and an amino.

[0031] In some specific embodiments of the present disclosure, each nucleotide of the sense strand and / or the antisense strand is independently selected from a modified or unmodified nucleotide.

[0032] In some optional embodiments of the present disclosure, substantially all nucleotides of the sense strand and / or the antisense strand are selected from modified nucleotides, wherein "substantially all nucleotides are selected from modified nucleotides" means that most but not all of the nucleotides of the strand are modified nucleotides, and the strand comprises no more than 5, 4, 3, 2 or 1 unmodified nucleotides.

[0033] In some specific embodiments of the present disclosure, all nucleotides of the sense strand and / or the antisense strand are independently selected from a modified or unmodified nucleotide.

[0034] In some specific embodiments of the present disclosure, each nucleotide of the sense strand and / or the antisense strand is independently selected from the group consisting of: a 2’-halogen-modified nucleotide, a 2’-deoxy-modified nucleotide, a 2’-O-optionally substituted C1‑6 alkyl-modified nucleotide, a 2’-O‑(CH2)n‑O-R1-modified nucleotide, a 2’-amino-modified nucleotide, an abasic nucleotide or a nucleotide analog, wherein the nucleotide analog is one or more selected from peptide nucleic acid (PNA), Morpholino (MNA), bridged nucleic acid (BNA), locked nucleic acid (LNA), glycol nucleic acid (GNA), threose nucleic acid (TNA) 4 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 and unlocked nucleic acid (UNA); wherein n is selected from 1 and 2; R1 is selected from an optionally substituted C1‑6 alkyl or an optionally substituted C1‑6 alkoxy; when R1 comprises a substituent, the substituent is selected from a halogen, a C1‑6 alkoxy, a hydroxyl and an amino. Wherein, a nucleotide has a structure of: where Base represents a nucleoside base, and the nucleoside base of each nucleotide is selected from Uracil (U), thymine (T), cytosine (C), adenine (A), and guanine (G).

[0035] In the present diclsoure, a 2’-halogen-modified nucleotide is a nucleotide in which the 2’-hydroxyl of the ribosyl is substituted by a halogen, such as a 2’-fluoro-modified nucleotide.

[0036] In some specific embodiments of the present disclosure, the 2’-halogen-modified nucleotide is a 2’-fluoro- modified nucleotide.

[0037] In the present diclsoure, a 2’-deoxy-modified nucleotide is a nucleotide in which the 2’-hydroxyl of the ribosyl is substituted by hydrogen.

[0038] In the present diclsoure, a 2’-O‑(CH2)n‑O-R1-modified nucleotide is a nucleotide in which the hydrogen of the 2’- hydroxyl of the ribosyl is substituted by ‑(CH2)n‑O-R1. Wherein: when n is 1, the 2’-O‑(CH2)n‑O-R1-modified nucleotide is selected from a 2’-O-ethoxymethyl-modified nucleotide and a 2’-O‑2,2,2-trifluoroethoxymethyl-modified nucleotide; when n is 2, the 2’-O‑(CH2)n‑O-R1-modified nucleotide is selected from 2’-O-methoxyethyl-modified nucleotide (also known as a 2’-O-moe modified nucleotide).

[0039] In some optional embodiments of the present disclosure, the 2’-O‑(CH2)n‑O-R1-modified nucleotide is selected from a 2’-O-methoxyethyl-modified nucleotide, a 2’-O-ethoxymethyl-modified nucleotide and a 2’-O‑2,2,2-trifluoroethox- ymethyl-modified nucleotide.

[0040] In some optional embodiments of the present disclosure, the 2’-O‑(CH2)n‑O-R1-modified nucleotide is selected from a 2’-O-methoxyethyl-modified nucleotide.

[0041] Wherein, in the present disclosure, "optionally substituted" is used to define a variable, which may be unsubstituted, and may be substituted.

[0042] In some optional embodiments of the present disclosure, each nucleotide of the sense strand and / or the antisense strand is independently selected from the group consisting of: a 2’-O-methyl-modified nucleotide, a 2’-fluoro-modified nucleotide, a 2’-O-methoxyethyl-modified nucleotide and a 2’- deoxy-modified nucleotide.

[0043] In some specific embodiments of the present disclosure, each nucleotide of the sense strand and / or the antisense strand is independently selected from the group consisting of: a 2’-O-methyl-modified nucleotide, a 2’-fluoro-modified nucleotide and a 2’-O-methoxyethyl-modified nucleotide.

[0044] In some specific embodiments of the present disclosure, each nucleotide of the sense strand and / or the antisense strand is independently selected from the group consisting of: a 2’-O-methyl-modified nucleotide, a 2’-fluoro-modified nucleotide and a 2’-deoxy-modified nucleotide.

[0045] In some specific embodiments of the present disclosure, the double-stranded oligonucleotide comprises at least one 2’-O-methoxyethyl-modified nucleotide.

[0046] In some specific embodiments of the present disclosure, the sense strand has a length selected from 18 to 21 nucleotides, and the antisense strand has a length selected from 19 to 23 nucleotides.

[0047] In some specific embodiments of the present disclosure, the sense strand has a length selected from 17 to 21 nucleotides, and the antisense strand has a length selected from 19 to 23 nucleotides.

[0048] In some specific embodiments of the present disclosure, the sense strand has a length of 19 nucleotides, and the antisense strand has a length 21 nucleotides. 5 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55

[0049] In some specific embodiments of the present disclosure, the antisense strand comprises at least one 2’-O- methoxyethyl-modified nucleotide; and the sense strand comprises no more than one 2’-O-methoxyethyl-modified nucleotide.

[0050] In some specific embodiments of the present disclosure, the sense strand comprises no 2’-O-methoxyethyl- modified nucleotide; and the antisense strand comprises one 2’-O-methoxyethyl-modified nucleotide. Wherein, each nucleotide of the sense strand is independently selected from a 2’-fluoro-modified nucleotide and a 2’-O-methyl-modified nucleotide; and each nucleotide of the antisense strand is independently selected from a 2’-fluoro-modified nucleotide, a 2’-O-methyl-modified nucleotide and a 2’-O-methoxyethyl-modified nucleotide, and the antisense strand comprise one 2’- O-methoxyethyl-modified nucleotide.

[0051] In some specific embodiments of the present disclosure, the sense strand comprises one 2’-O-methoxyethyl- modified nucleotide; and the antisense strand comprises one 2’-O-methoxyethyl-modified nucleotide. Wherein, each nucleotide of the sense strand is independently selected from a 2’-fluoro-modified nucleotide, a 2’-O-methyl-modified nucleotide and a 2’-O-methoxyethyl-modified nucleotide; and each nucleotide of the antisense strand is independently selected from a 2’-fluoro-modified nucleotide, a 2’-O-methyl-modified nucleotide and a 2’-O-methoxyethyl-modified nucleotide.

[0052] In some specific embodiments of the present disclosure, from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, at least 3 nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, and the remaining nucleotides are independently selected from a 2’-O-methyl-modified nucleotide and a 2’-O-methoxyethyl- modified nucleotide.

[0053] In some specific embodiments of the present disclosure, from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, at least 3 nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, no more than 2 nucleotides at positions 5, 12, 13, and 18 are selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are independently selected from a 2’-O-methyl-modified nucleotide.

[0054] In some specific embodiments of the present disclosure, from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, at least 3 nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, no more than 1 nucleotide at positions 5, 12, 13, and 18 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are independently selected from a 2’-O-methyl-modified nucleotide.

[0055] In some specific embodiments of the present disclosure, from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, no more than 1 nucleotide at positions 5, 12, 13, and 18 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are independently selected from a 2’-O-methyl-modified nucleotide.

[0056] In some specific embodiments of the present disclosure, the sense strand has a modification pattern selected from (SS‑1) to (SS‑5): (SS‑1) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, and the remaining nucleotides are independently selected from a 2’-O- methyl-modified nucleotide; (SS‑2) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, nucleotide at position 5 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are independently selected from a 2’-O-methyl-modified nucleotide; (SS‑3) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, nucleotide at position 12 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are independently selected from a 2’-O-methyl-modified nucleotide; (SS‑4) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, nucleotide at position 13 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are independently selected from a 2’-O-methyl-modified nucleotide; (SS‑5) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, nucleotide at position 18 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are independently selected from a 2’-O-methyl-modified nucleotide.

[0057] In some specific embodiments of the present disclosure, from 5’-end to 3’-end, in the nucleotide sequence of the antisense strand, at least 4 nucleotides at positions 2, 6, 9 to 12, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, and the remaining nucleotides are independently selected from a 2’-O-methyl-modified nucleotide and a 2’-O- methoxyethyl-modified nucleotide. 6 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55

[0058] In some specific embodiments of the present disclosure, from 5’-end to 3’-end, in the nucleotide sequence of the antisense strand, at least 4 nucleotides at positions 2, 6, 9 to 12, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, nucleotides at positions 2, 6, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, and the remaining nucleotides are independently selected from a 2’-O-methyl-modified nucleotide and a 2’-O-methoxyethyl-modified nucleotide.

[0059] In some specific embodiments of the present disclosure, from 5’-end to 3’-end, in the nucleotide sequence of the antisense strand, at least 4 nucleotides at positions 2, 6, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, any one of the nucleotides at positions 9 to 12 is selected from a 2’-fluoro-modified nucleotide, and the remaining nucleotides are independently selected from a 2’-O-methyl-modified nucleotide and a 2’-O-methoxyethyl-modified nucleotide.

[0060] In some specific embodiments of the present disclosure, from 5’-end to 3’-end, in the nucleotide sequence of the antisense strand, at least 4 nucleotides at positions 2, 6, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, any one of the nucleotides at positions 9 to 12 is selected from a 2’-fluoro-modified nucleotide, at least one nucleotide at positions 8 and 15 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are independently selected from a 2’-O-methyl-modified nucleotide.

[0061] In some specific embodiments of the present disclosure, from 5’-end to 3’-end, in the nucleotide sequence of the antisense strand, at least 4 nucleotides at positions 2, 6, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, any one of the nucleotides at positions 9 to 12 is selected from a 2’-fluoro-modified nucleotide, nucleotide at position 8 or 15 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are independently selected from a 2’-O-methyl-modified nucleotide.

[0062] In some specific embodiments of the present disclosure, the antisense strand has a modification pattern selected from (AS‑1) to (AS‑8): (AS‑1) from 5’-end to 3’-end, in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 9, 14 and 16 are selected from a 2’-fluoro-modified nucleotide, nucleotide at position 8 is selected from a 2’-O-methox- yethyl-modified nucleotide, and the remaining nucleotides are independently selected from a 2’-O-methyl-modified nucleotide; (AS‑2) from 5’-end to 3’-end, in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 10, 14 and 16 are selected from a 2’-fluoro-modified nucleotide, nucleotide at position 8 is selected from a 2’-O- methoxyethyl-modified nucleotide, and the remaining nucleotides are independently selected from a 2’-O-methyl- modified nucleotide; (AS‑3) from 5’-end to 3’-end, in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 11, 14 and 16 are selected from a 2’-fluoro-modified nucleotide, nucleotide at position 8 is selected from a 2’-O- methoxyethyl-modified nucleotide, and the remaining nucleotides are independently selected from a 2’-O-methyl- modified nucleotide; (AS‑4) from 5’-end to 3’-end, in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 12, 14 and 16 are selected from a 2’-fluoro-modified nucleotide, nucleotide at position 8 is selected from a 2’-O- methoxyethyl-modified nucleotide, and the remaining nucleotides are independently selected from a 2’-O-methyl- modified nucleotide; (AS‑5) from 5’-end to 3’-end, in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 9, 14 and 16 are selected from a 2’-fluoro-modified nucleotide, nucleotide at position 15 is selected from a 2’-O- methoxyethyl-modified nucleotide, and the remaining nucleotides are independently selected from a 2’-O-methyl- modified nucleotide; (AS‑6) from 5’-end to 3’-end, in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 10, 14 and 16 are selected from a 2’-fluoro-modified nucleotide, nucleotide at position 15 is selected from a 2’-O- methoxyethyl-modified nucleotide, and the remaining nucleotides are independently selected from a 2’-O-methyl- modified nucleotide; (AS‑7) rom 5’-end to 3’-end, in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 11,14 and 16 are selected from a 2’-fluoro-modified nucleotide, nucleotide at position 15 is selected from a 2’-O- methoxyethyl-modified nucleotide, and the remaining nucleotides are independently selected from a 2’-O-methyl- modified nucleotide; (AS‑8) from 5’-end to 3’-end, in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 12, 7 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 14 and 16 are selected from a 2’-fluoro-modified nucleotide, nucleotide at position 15 is selected from a 2’-O- methoxyethyl-modified nucleotide, and the remaining nucleotides are independently selected from a 2’-O-methyl- modified nucleotide.

[0063] In some specific embodiments of the present disclosure, from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, at least 3 nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, and the remaining nucleotides are independently selected from a 2’-O-methyl-modified nucleotide and a 2’-O-methoxyethyl- modified nucleotide; in the nucleotide sequence of the antisense strand, at least 4 nucleotides at positions 2, 6, 9 to 12, 14 and 16 are selected from a 2’-fluoro-modified nucleotide, and the remaining nucleotides are independently selected from a 2’-O-methyl- modified nucleotide and a 2’-O-methoxyethyl-modified nucleotide.

[0064] In some specific embodiments of the present disclosure, from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, at least 3 nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, and the remaining nucleotides are independently selected from a 2’-O-methyl-modified nucleotide and a 2’-O-methoxyethyl- modified nucleotide; in the nucleotide sequence of the antisense strand, at least 4 nucleotides at positions 2, 6, 9 to 12, 14 and 16 are selected from a 2’-fluoro-modified nucleotide, nucleotides at positions 2, 6, 14 and 16 are selected from a 2’-fluoro-modified nucleotide, and the remaining nucleotides are independently selected from a 2’-O-methyl-modified nucleotide and a 2’-O- methoxyethyl-modified nucleotide.

[0065] In some specific embodiments of the present disclosure, from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, at least 3 nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, no more than 2 nucleotides at positions 5, 12, 13 and 18 are selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; in the nucleotide sequence of the antisense strand, at least 4 nucleotides at positions 2, 6, 9 to 12, 14 and 16 are selected from a 2’-fluoro-modified nucleotide, nucleotides at positions 2, 6, 14 and 16 are selected from a 2’-fluoro-modified nucleotide, at least one nucleotide at positions 8 and 15 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide.

[0066] In some specific embodiments of the present disclosure, from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, no more than 1 nucleotide at positions 5, 12, 13 and 18 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; in the nucleotide sequence of the antisense strand, at least 4 nucleotides at positions 2, 6, 14 and 16 are selected from a 2’- fluoro-modified nucleotide, any one of nucleotides at positions 9 to 12 is selected from a 2’-fluoro-modified nucleotide, at least one nucleotide at positions 8 and 15 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide.

[0067] In some specific embodiments of the present disclosure, the sense strand and the antisense strand of the double- stranded oligonucleotide have a modification pattern selected from (ds‑1) to (ds‑8): (ds‑1) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl- modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 9, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 8 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; (ds‑2) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl- modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 10, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 8 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; (ds‑3) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl- modified nucleotide; and 8 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 11, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 8 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; (ds‑4) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl- modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 12, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 8 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; (ds‑5) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl- modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 9, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 15 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; (ds‑6) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl- modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 10, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 15 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; (ds‑7) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl- modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 11, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 15 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; and (ds‑8) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl- modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 12, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 15 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; (ds‑9) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 5 is selected from a 2’-O-methoxyethyl- modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 9, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 8 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; (ds‑10) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 5 is selected from a 2’-O-methoxyethyl- modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 10, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 8 is selected from a 2’-O-methoxyethyl-modified nucleotide, 9 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; (ds‑11) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 5 is selected from a 2’-O-methoxyethyl- modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 11, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 8 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; (ds‑12) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 5 is selected from a 2’-O-methoxyethyl- modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 9, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 15 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; (ds‑13) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 5 is selected from a 2’-O-methoxyethyl- modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 10, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 15 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; (ds‑14) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 5 is selected from a 2’-O-methoxyethyl- modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 11, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 15 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; (ds‑15) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 12 is selected from a 2’-O-methoxyethyl- modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 9, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 8 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; (ds‑16) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 12 is selected from a 2’-O-methoxyethyl- modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 10, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 8 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; (ds‑17) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 12 is selected from a 2’-O-methoxyethyl- modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 11, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 8 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; 10 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (ds‑18) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 12 is selected from a 2’-O-methoxyethyl- modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 9, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 15 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; (ds‑19) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 12 is selected from a 2’-O-methoxyethyl- modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 10, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 15 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; (ds‑20) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 12 is selected from a 2’-O-methoxyethyl- modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 11, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 15 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; (ds‑21) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 13 is selected from a 2’-O-methoxyethyl- modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 9, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 8 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; (ds‑22) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 13 is selected from a 2’-O-methoxyethyl- modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 10, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 8 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; (ds‑23) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 13 is selected from a 2’-O-methoxyethyl- modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 11, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 8 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; (ds‑24) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 13 is selected from a 2’-O-methoxyethyl- modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 9, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 15 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; (ds‑25) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 13 is selected from a 2’-O-methoxyethyl- 11 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 10, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 15 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; (ds‑26) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 13 is selected from a 2’-O-methoxyethyl- modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 11, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 15 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; (ds‑27) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 18 is selected from a 2’-O-methoxyethyl- modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 9, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 8 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; (ds‑28) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 18 is selected from a 2’-O-methoxyethyl- modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 10, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 8 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; (ds‑29) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 18 is selected from a 2’-O-methoxyethyl- modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 11, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 8 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; (ds‑30) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 18 is selected from a 2’-O-methoxyethyl- modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 9, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 15 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; (ds‑31) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 18 is selected from a 2’-O-methoxyethyl- modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 10, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 15 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; (ds‑32) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 18 is selected from a 2’-O-methoxyethyl- modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; and 12 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 11, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 15 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide. In some specific embodiments of the present disclosure, from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, at least 4 of the nucleotides at positions 2, 6, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, any one of nucleotides at positions 9 to 12 is selected from a 2’-fluoro- modified nucleotide, at least one nucleotide at positions 8 and 15 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide.

[0068] In some specific embodiments of the present disclosure, from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, at least 4 of the nucleotides at positions 2, 6, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, any one of nucleotides at positions 9 to 12 is selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 8 or 15 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide.

[0069] In some specific embodiments of the present disclosure, the sense strand and the antisense strand of the double- stranded oligonucleotide have a modification pattern selected from (ds‑1) to (ds‑8): (ds‑1) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl- modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 9, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 8 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; (ds‑2) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl- modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 10, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 8 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; (ds‑3) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl- modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 11, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 8 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; (ds‑4) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl- modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 12, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 8 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; (ds‑5) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl- modified nucleotide; and 13 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 9, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 15 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; (ds‑6) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl- modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 10, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 15 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; (ds‑7) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl- modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 11, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 15 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide; and (ds‑8) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl- modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 12, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 15 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleotide.

[0070] In some specific embodiments of the present disclosure, the sense strand and / or the antisense strand independently comprise one or more internucleotide phosphorothioate linkages.

[0071] In some specific embodiments of the present disclosure, the sense strand comprises two contiguous inter- nucleotide phosphorothioate linkages at 5’-end.

[0072] In some specific embodiments of the present disclosure, the antisense strand comprises two contiguous internucleotide phosphorothioate linkages at 5’-end, and two contiguous internucleotide phosphorothioate linkages at 3’-end.

[0073] In some specific embodiments of the present disclosure, the sense strand comprises two internucleotide phosphorothioate linkages at 5’-end, and the antisense strand comprises two internucleotide phosphorothioate linkages at 5’-end and two internucleotide phosphorothioate linkages at 3’-end.

[0074] In some optional embodiments of the present disclosure, the sense strand or the antisense strand comprises a 3’- overhang having at least 1 nucleotide.

[0075] In some optional embodiments of the present disclosure, the antisense strand comprises a 3’-overhang having at least 1 nucleotide.

[0076] In some optional embodiments of the present disclosure, the antisense strand comprises a 3’-overhang having 2 nucleotides.

[0077] In some specific embodiments of the present disclosure, each nucleotide of the double-stranded oligonucleotide is independently selected from a modified nucleotide; wherein the sense strand is selected from any one of the sequences as set forth in SEQ ID NOs: 887 to 907; and / or the antisense strand is selected from any one of the sequences as set forth in SEQ ID NOs: 908 to 943; wherein the sense strand, from 5’-end to 3’-end, 14 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 15 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 and the antisense strand, from 5’-end to 3’-end, 16 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 17 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 18 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 and Wherein, C represents cytidine‑3’-monophosphate, G represents guanosine‑3’-monophosphate, U represents uridine‑3’-monophosphate, A represents adenosine‑3’-monophosphate, and T represents thymidine‑3’-monopho- sphate; m indicates that a nucleotide immediately to the left of the letter m is a 2’-O-methyl-modified nucleotide; f indicates that a nucleotide immediately to the left of the letter f is a 2’-fluoro-modified nucleotide; (moe) indicates that a nucleotide immediately to the left of the combined identifier (moe) is a 2’-O-methoxyethyl-modified nucleotide; and s indicates that two adjacent nucleotides are linked by a phosphorothioate diester bond. Wherein, the structural formula of U is and the structural formula of T(moe) is Herein, T(moe) is considered as a modification of U. 19 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55

[0078] It is particularly noted that: in the context of the present disclosure, since sequences in which all nucleotides are modified cannot be properly validated and thus a sequence list cannot be generated, all sequences involving modifications in the present disclosure cannot be presented by a sequence list, and for all such sequences, the descriptions in the specification shall prevail.

[0079] In some specific embodiments of the present disclosure, the double-stranded oligonucleotide comprises one or more pairs of: Pair Sense strand (5’‑3’) Antisense strand (5’‑3’) RX002 245 SEQ ID NO: 887 SEQ ID NO: 908 RX002 246 SEQ ID NO: 887 SEQ ID NO: 909 RX002 247 SEQ ID NO: 887 SEQ ID NO: 910 RX002 248 SEQ ID NO: 888 SEQ ID NO: 909 RX002 249 SEQ ID NO: 889 SEQ ID NO: 909 RX002 250 SEQ ID NO: 890 SEQ ID NO: 909 RX002 251 SEQ ID NO: 891 SEQ ID NO: 909 RX002 252 SEQ ID NO: 888 SEQ ID NO: 911 RX002 253 SEQ ID NO: 889 SEQ ID NO: 911 RX002 254 SEQ ID NO: 890 SEQ ID NO: 911 RX002 255 SEQ ID NO: 891 SEQ ID NO: 911 20 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) Pair Sense strand (5’‑3’) Antisense strand (5’‑3’) RX002 256 SEQ ID NO: 892 SEQ ID NO: 912 RX002 SEQ ID SEQ ID 257 NO: 892 NO: 913 RX002 258 SEQ ID NO: 892 SEQ ID NO: 914 RX002 259 SEQ ID NO: 893 SEQ ID NO: 913 RX002 260 SEQ ID NO: 894 SEQ ID NO: 913 RX002 261 SEQ ID NO: 895 SEQ ID NO: 913 RX002 262 SEQ ID NO: 896 SEQ ID NO: 913 RX002 263 SEQ ID NO: 893 SEQ ID NO: 915 RX002 264 SEQ ID NO: 894 SEQ ID NO: 915 RX002 265 SEQ ID NO: 895 SEQ ID NO: 915 RX002 266 SEQ ID NO: 896 SEQ ID NO: 915 RX002 267 SEQ ID NO: 897 SEQ ID NO: 916 21 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) Pair Sense strand (5’‑3’) Antisense strand (5’‑3’) RX002 268 SEQ ID NO: 897 SEQ ID NO: 917 RX002 269 SEQ ID NO: 897 SEQ ID NO: 918 RX002 270 SEQ ID NO: 898 SEQ ID NO: 917 RX002 271 SEQ ID NO: 899 SEQ ID NO: 917 RX002 272 SEQ ID NO: 900 SEQ ID NO: 917 RX002 273 SEQ ID NO: 901 SEQ ID NO: 917 RX002 274 SEQ ID NO: 898 SEQ ID NO: 919 RX002 275 SEQ ID NO: 899 SEQ ID NO: 919 RX002 276 SEQ ID NO: 900 SEQ ID NO: 919 RX002 277 SEQ ID NO: 901 SEQ ID NO: 919 RX002 278 SEQ ID NO: 902 SEQ ID NO: 920 RX002 279 SEQ ID NO: 902 SEQ ID NO: 921 22 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) Pair Sense strand (5’‑3’) Antisense strand (5’‑3’) RX002 280 SEQ ID NO: 902 SEQ ID NO: 922 RX002 281 SEQ ID NO: 903 SEQ ID NO: 921 RX002 282 SEQ ID NO: 904 SEQ ID NO: 921 RX002 283 SEQ ID NO: 905 SEQ ID NO: 921 RX002 284 SEQ ID NO: 906 SEQ ID NO: 921 RX002 285 SEQ ID NO: 903 SEQ ID NO: 923 RX002 286 SEQ ID NO: 904 SEQ ID NO: 923 RX002 287 SEQ ID NO: 905 SEQ ID NO: 923 RX002 288 SEQ ID NO: 906 SEQ ID NO: 923 RX002 289 SEQ ID NO: 888 SEQ ID NO: 910 RX002 290 SEQ ID NO: 890 SEQ ID NO: 910 RX002 291 SEQ ID NO: 890 SEQ ID NO: 924 23 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) Pair Sense strand (5’‑3’) Antisense strand (5’‑3’) RX002 292 SEQ ID NO: 891 SEQ ID NO: 924 RX002 293 SEQ ID NO: 895 SEQ ID NO: 914 RX002 294 SEQ ID NO: 896 SEQ ID NO: 925 RX002 295 SEQ ID NO: 905 SEQ ID NO: 922 RX002 296 SEQ ID NO: 906 SEQ ID NO: 926 RX002 297 SEQ ID NO: 892 SEQ ID NO: 927 RX002 298 SEQ ID NO: 907 SEQ ID NO: 928 RX002 299 SEQ ID NO: 907 SEQ ID NO: 929 RX002 300 SEQ ID NO: 907 SEQ ID NO: 930 RX002 301 SEQ ID NO: 887 SEQ ID NO: 931 RX002 302 SEQ ID NO: 887 SEQ ID NO: 932 RX002 303 SEQ ID NO: 887 SEQ ID NO: 933 24 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) Pair Sense strand (5’‑3’) Antisense strand (5’‑3’) RX002 304 SEQ ID NO: 902 SEQ ID NO: 934 RX002 305 SEQ ID NO: 902 SEQ ID NO: 935 RX002 306 SEQ ID NO: 902 SEQ ID NO: 936 RX002 307 SEQ ID NO: 892 SEQ ID NO: 937 RX002 308 SEQ ID NO: 892 SEQ ID NO: 938 RX002 309 SEQ ID NO: 907 SEQ ID NO: 939 RX002 310 SEQ ID NO: 897 SEQ ID NO: 940 RX002 311 SEQ ID NO: 897 SEQ ID NO: 941 RX002 312 SEQ ID NO: 897 SEQ ID NO: 942 RX002 313 SEQ ID NO: 897 SEQ ID NO: 943

[0080] In some specific embodiments of the present disclosure, the sense strand is selected from any one of the sequences as set forth in SEQ ID NO: 887, 892, 897, 902, and 907; and / or the antisense strand is selected from any one of the sequences as set forth in SEQ ID NO: 908, 912, 914, 920, and 927 to 943.

[0081] In some specific embodiments of the present disclosure, the double-stranded oligonucleotide comprises one or more pairs of: 25 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 Pair Sense strand (5’‑3’) Antisense strand (5’‑3’) RX002 245 SEQ ID NO: 887 SEQ ID NO: 908 RX002 256 SEQ ID NO: 892 SEQ ID NO: 912 RX002 258 SEQ ID NO: 892 SEQ ID NO: 914 RX002 278 SEQ ID NO: 902 SEQ ID NO: 920 RX002 297 SEQ ID NO: 892 SEQ ID NO: 927 RX002 298 SEQ ID NO: 907 SEQ ID NO: 928 RX002 299 SEQ ID NO: 907 SEQ ID NO: 929 RX002 300 SEQ ID NO: 907 SEQ ID NO: 930 RX002 301 SEQ ID NO: 887 SEQ ID NO: 931 RX002 302 SEQ ID NO: 887 SEQ ID NO: 932 RX002 303 SEQ ID NO: 887 SEQ ID NO: 933 RX002 304 SEQ ID NO: 902 SEQ ID NO: 934 RX002 305 SEQ ID NO: 902 SEQ ID NO: 935 RX002 306 SEQ ID NO: 902 SEQ ID NO: 936 RX002 307 SEQ ID NO: 892 SEQ ID NO: 937 RX002 308 SEQ ID NO: 892 SEQ ID NO: 938 26 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) Pair Sense strand (5’‑3’) Antisense strand (5’‑3’) RX002 309 SEQ ID NO: 907 SEQ ID NO: 939 RX002 310 SEQ ID NO: 897 SEQ ID NO: 940 RX002 311 SEQ ID NO: 897 SEQ ID NO: 941 RX002 312 SEQ ID NO: 897 SEQ ID NO: 942 RX002 313 SEQ ID NO: 897 SEQ ID NO: 943

[0082] In some specific embodiments of the present disclosure, the double-stranded oligonucleotide comprises the pair of: Pair Sense strand (5’‑3’) Antisense strand (5’‑3’) RX002 258 SEQ ID NO: 892 SEQ ID NO: 914

[0083] In some specific embodiments of the present disclosure, the double-stranded oligonucleotide is selected from siRNA.

[0084] In a second aspect, the present disclosure provides a double-stranded oligonucleotide for inhibiting the expression of C3 gene, wherein the double-stranded oligonucleotide comprises a sense strand and an antisense strand, and each nucleotide of the double-stranded nucleotide is independently selected from a modified nucleotide; wherein the nucleotide sequence from positions 2 to 19 of the antisense strand comprises at least 17 contiguous nucleotides from any one of the nucleotide sequences as set forth in SEQ ID NOs: 908 to 943 or a nucleotide sequence having 1, 2 or 3 nucleotide base differences from the contiguous nucleotides; and the sense strandcomprises at least17 nucleotides,and thesense strand and the antisense strandare complementary or substantially complementary to form a duplex region, wherein being substantial complementary means that the sense strand and the antisense strand have no more than 3 nucleotide mismatches in the duplex region.

[0085] In some optional embodiments of the present disclosure, the antisense strand comprises a nucleotide sequence having 0, 1, 2 or 3 nucleotide base differences from any one of the sequences as set forth in SEQ ID NOs: 908 to 943.

[0086] In some optional embodiments of the present disclosure, the antisense strand comprises a nucleotide sequence having 0 or 1 nucleotide base difference from any one of the sequences as set forth in SEQ ID NOs: 908 to 943.

[0087] In some optional embodiments of the present disclosure, the antisense strand comprises any one of the nucleotide sequences as set forth in SEQ ID NOs: 908 to 943.

[0088] In some optional embodiments of the present disclosure, the sense strand comprises at least 17 contiguous nucleotides of any one of the nucleotide sequences as set forth in SEQ ID NOs: 887 to 907 or a nucleotide sequence having 1, 2 or 3 nucleotide base differences from the at least 17 contiguous nucleotides.

[0089] In some optional embodiments of the present disclosure, the sense strand comprises a nucleotide sequence having 0, 1, 2 or 3 nucleotide base differences from any one of the sequences as set forth in SEQ ID NOs: 887 to 907.

[0090] In some optional embodiments of the present disclosure, the sense strand comprises a nucleotide sequence having 0 or 1 nucleotide base difference from any one of the nucleotide sequences as set forth in SEQ ID NOs: 887 to 907.

[0091] In some optional embodiments of the present disclosure, the sense strand comprises any one of the nucleotide 27 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 sequences as set forth in SEQ ID NOs: 887 to 907.

[0092] In some optional embodiments of the present disclosure, the antisense strand comprises any one of the nucleotide sequences as set forth in SEQ ID NOs: 908 to 943, and the sense strand comprises any one of the nucleotide sequences as set forth in SEQ ID NOs: 887 to 907.

[0093] In some optional embodiments of the present disclosure, the double-stranded oligonucleotide comprises one or more pairs of: an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 908, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 887; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 909, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 887; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 910, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 887; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 909, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 888; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 909, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 889; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 909, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 890; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 909, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 891; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 911, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 888; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 911, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 889; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 911, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 890; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 911, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 891; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 912, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 892; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 913, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 892; 28 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 914, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 892; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 913, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 893; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 913, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 894; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 913, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 895; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 913, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 896; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 915, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 893; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 915, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 894; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 915, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 895; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 915, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 896; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 916, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 897; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 917, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 897; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 918, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 897; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 917, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 898; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 917, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 899; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 917, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from 29 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 the sequence as set forth in SEQ ID NO: 900; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 917, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 901; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 919, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 898; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 919, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 899; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 919, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 900; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 919, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 901; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 920, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 902; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 921, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 902; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 922, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 902; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 921, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 903; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 921, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 904; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 921, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 905; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 921, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 906; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 923, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 903; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 923, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 904; 30 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 923, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 905; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 923, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 906; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 910, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 888; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 910, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 890; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 924, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 890; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 924, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 891; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 914, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 895; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 925, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 896; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 922, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 905; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 926, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 906; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 927, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 892; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 928, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 907; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 929, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 907; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 930, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 907; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 931, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from 31 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 the sequence as set forth in SEQ ID NO: 887; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 932, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 887; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 933, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 887; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 934, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 902; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 935, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 902; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 936, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 902; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 937, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 892; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 938, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 892; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 939, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 907; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 940, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 897; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 941, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 897; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 942, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 897; and an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 943, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 897.

[0094] In some specific embodiments of the present disclosure, the double-stranded oligonucleotide comprises one or more pairs of: 32 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 Pair Sense strand (5’‑3’) Antisense strand (5’‑3’) RX002 245 SEQ ID NO: 887 SEQ ID NO: 908 RX002 246 SEQ ID NO: 887 SEQ ID NO: 909 RX002 247 SEQ ID NO: 887 SEQ ID NO: 910 RX002 248 SEQ ID NO: 888 SEQ ID NO: 909 RX002 249 SEQ ID NO: 889 SEQ ID NO: 909 RX002 250 SEQ ID NO: 890 SEQ ID NO: 909 RX002 251 SEQ ID NO: 891 SEQ ID NO: 909 RX002 252 SEQ ID NO: 888 SEQ ID NO: 911 RX002 253 SEQ ID NO: 889 SEQ ID NO: 911 RX002 254 SEQ ID NO: 890 SEQ ID NO: 911 RX002 255 SEQ ID NO: 891 SEQ ID NO: 911 RX002 256 SEQ ID NO: 892 SEQ ID NO: 912 33 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) Pair Sense strand (5’‑3’) Antisense strand (5’‑3’) RX002 257 SEQ ID NO: 892 SEQ ID NO: 913 RX002 258 SEQ ID NO: 892 SEQ ID NO: 914 RX002 259 SEQ ID NO: 893 SEQ ID NO: 913 RX002 260 SEQ ID NO: 894 SEQ ID NO: 913 RX002 261 SEQ ID NO: 895 SEQ ID NO: 913 RX002 262 SEQ ID NO: 896 SEQ ID NO: 913 RX002 263 SEQ ID NO: 893 SEQ ID NO: 915 RX002 264 SEQ ID NO: 894 SEQ ID NO: 915 RX002 265 SEQ ID NO: 895 SEQ ID NO: 915 RX002 266 SEQ ID NO: 896 SEQ ID NO: 915 RX002 267 SEQ ID NO: 897 SEQ ID NO: 916 RX002 268 SEQ ID NO: 897 SEQ ID NO: 917 34 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) Pair Sense strand (5’‑3’) Antisense strand (5’‑3’) RX002 269 SEQ ID NO: 897 SEQ ID NO: 918 RX002 270 SEQ ID NO: 898 SEQ ID NO: 917 RX002 271 SEQ ID NO: 899 SEQ ID NO: 917 RX002 272 SEQ ID NO: 900 SEQ ID NO: 917 RX002 273 SEQ ID NO: 901 SEQ ID NO: 917 RX002 274 SEQ ID NO: 898 SEQ ID NO: 919 RX002 275 SEQ ID NO: 899 SEQ ID NO: 919 RX002 276 SEQ ID NO: 900 SEQ ID NO: 919 RX002 277 SEQ ID NO: 901 SEQ ID NO: 919 RX002 278 SEQ ID NO: 902 SEQ ID NO: 920 RX002 279 SEQ ID NO: 902 SEQ ID NO: 921 RX002 280 SEQ ID NO: 902 SEQ ID NO: 922 35 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) Pair Sense strand (5’‑3’) Antisense strand (5’‑3’) RX002 281 SEQ ID NO: 903 SEQ ID NO: 921 RX002 282 SEQ ID NO: 904 SEQ ID NO: 921 RX002 283 SEQ ID NO: 905 SEQ ID NO: 921 RX002 284 SEQ ID NO: 906 SEQ ID NO: 921 RX002 285 SEQ ID NO: 903 SEQ ID NO: 923 RX002 286 SEQ ID NO: 904 SEQ ID NO: 923 RX002 287 SEQ ID NO: 905 SEQ ID NO: 923 RX002 288 SEQ ID NO: 906 SEQ ID NO: 923 RX002 289 SEQ ID NO: 888 SEQ ID NO: 910 RX002 290 SEQ ID NO: 890 SEQ ID NO: 910 RX002 291 SEQ ID NO: 890 SEQ ID NO: 924 RX002 292 SEQ ID NO: 891 SEQ ID NO: 924 36 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) Pair Sense strand (5’‑3’) Antisense strand (5’‑3’) RX002 293 SEQ ID NO: 895 SEQ ID NO: 914 RX002 294 SEQ ID NO: 896 SEQ ID NO: 925 RX002 295 SEQ ID NO: 905 SEQ ID NO: 922 RX002 296 SEQ ID NO: 906 SEQ ID NO: 926 RX002 297 SEQ ID NO: 892 SEQ ID NO: 927 RX002 298 SEQ ID NO: 907 SEQ ID NO: 928 RX002 299 SEQ ID NO: 907 SEQ ID NO: 929 RX002 300 SEQ ID NO: 907 SEQ ID NO: 930 RX002 301 SEQ ID NO: 887 SEQ ID NO: 931 RX002 302 SEQ ID NO: 887 SEQ ID NO: 932 RX002 303 SEQ ID NO: 887 SEQ ID NO: 933 RX002 304 SEQ ID NO: 902 SEQ ID NO: 934 37 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) Pair Sense strand (5’‑3’) Antisense strand (5’‑3’) RX002 305 SEQ ID NO: 902 SEQ ID NO: 935 RX002 306 SEQ ID NO: 902 SEQ ID NO: 936 RX002 307 SEQ ID NO: 892 SEQ ID NO: 937 RX002 308 SEQ ID NO: 892 SEQ ID NO: 938 RX002 309 SEQ ID NO: 907 SEQ ID NO: 939 RX002 310 SEQ ID NO: 897 SEQ ID NO: 940 RX002 311 SEQ ID NO: 897 SEQ ID NO: 941 RX002 312 SEQ ID NO: 897 SEQ ID NO: 942 RX002 313 SEQ ID NO: 897 SEQ ID NO: 943

[0095] In some optional embodiments of the present disclosure, the antisense strand comprises a nucleotide sequence with 0, 1, 2 or 3 nucleotide base differences from any one of the sequences as set forth in SEQ ID NOs: 908, 912, 914, 920 and 927 to 943.

[0096] In some optional embodiments of the present disclosure, the antisense strand comprises a nucleotide sequence with 0 or 1 nucleotide base difference from any one of the sequences as set forth in SEQ ID NOs: 908, 912, 914, 920 and 927 to 943.

[0097] In some optional embodiments of the present disclosure, the antisense strand comprises any one of the sequences as set forth in SEQ ID NOs: 908, 912, 914, 920 and 927 to 943.

[0098] In some optional embodiments of the present disclosure, the sense strand comprises a nucleotide sequence with 0, 1, 2 or 3 nucleotide base differences from any one of the sequences as set forth in SEQ ID NOs: 887, 892, 897, 902 and 907.

[0099] In some optional embodiments of the present disclosure, the sense strand comprises a nucleotide sequence with 0 or 1 nucleotide base difference from any one of the sequences as set forth in SEQ ID NOs: 887, 892, 897, 902 and 907.

[0100] In some optional embodiments of the present disclosure, the sense strand comprises any one of the sequences 38 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 as set forth in SEQ ID NOs: 887, 892, 897, 902 and 907.

[0101] In some optional embodiments of the present disclosure, the antisense strand comprises any one of the sequences as set forth in SEQ ID NOs: 908, 912, 914, 920 and 927 to 943, and the sense strand comprises any one of the sequences as set forth in SEQ ID NOs: 887, 892, 897, 902 and 907.

[0102] In some optional embodiments of the present disclosure, the double-stranded oligonucleotide comprises one or more pairs of: an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 908, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 887; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 931, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 887; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 932, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 887; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 933, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 887; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 912, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 892; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 914, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 892; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 927, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 892; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 937, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 892; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 938, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 892; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 940, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 897; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 941, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 897; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 942, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 897; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 943, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 897; 39 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 920, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 902; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 934, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 902; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 935, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 902; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 936, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 902; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 928, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 907; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 929, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 907; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 930, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 907; and an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 939, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 907.

[0103] In some specific embodiments of the present disclosure, the double-stranded oligonucleotide comprises one or more pairs of: Pair Sense strand (5’‑3’) Antisense strand (5’‑3’) RX002 245 SEQ ID NO: 887 SEQ ID NO: 908 RX002 256 SEQ ID NO: 892 SEQ ID NO: 912 RX002 258 SEQ ID NO: 892 SEQ ID NO: 914 RX002 278 SEQ ID NO: 902 SEQ ID NO: 920 RX002 297 SEQ ID NO: 892 SEQ ID NO: 927 RX002 298 SEQ ID NO: 907 SEQ ID NO: 928 40 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) Pair Sense strand (5’‑3’) Antisense strand (5’‑3’) RX002 299 SEQ ID NO: 907 SEQ ID NO: 929 RX002 300 SEQ ID NO: 907 SEQ ID NO: 930 RX002 301 SEQ ID NO: 887 SEQ ID NO: 931 RX002 302 SEQ ID NO: 887 SEQ ID NO: 932 RX002 303 SEQ ID NO: 887 SEQ ID NO: 933 RX002 304 SEQ ID NO: 902 SEQ ID NO: 934 RX002 305 SEQ ID NO: 902 SEQ ID NO: 935 RX002 306 SEQ ID NO: 902 SEQ ID NO: 936 RX002 307 SEQ ID NO: 892 SEQ ID NO: 937 RX002 308 SEQ ID NO: 892 SEQ ID NO: 938 RX002 309 SEQ ID NO: 907 SEQ ID NO: 939 RX002 310 SEQ ID NO: 897 SEQ ID NO: 940 RX002 311 SEQ ID NO: 897 SEQ ID NO: 941 RX002 312 SEQ ID NO: 897 SEQ ID NO: 942 RX002 313 SEQ ID NO: 897 SEQ ID NO: 943

[0104] In some optional embodiments of the present disclosure, the antisense strand comprises a nucleotide sequence having 0, 1, 2 or 3 nucleotide base differences from the sequence as set forth in SEQ ID NO: 914.

[0105] In some optional embodiments of the present disclosure, the antisense strand comprises a nucleotide sequence 41 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 having 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 914.

[0106] In some optional embodiments of the present disclosure, the antisense strand comprises the sequence as set forth in SEQ ID NO: 914.

[0107] In some optional embodiments of the present disclosure, the sense strand comprises a nucleotide sequence having 0, 1, 2 or 3 nucleotide base differences from the sequence as set forth in SEQ ID NO: 892.

[0108] In some optional embodiments of the present disclosure, the sense strand comprises a nucleotide sequence having 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 892.

[0109] In some optional embodiments of the present disclosure, the sense strand comprises the sequence as set forth in SEQ ID NO: 892.

[0110] In some optional embodiments of the present disclosure, the double-stranded oligonucleotide comprises: an antisense strand comprising a nucleotide sequence having 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 914, and a sense strand comprising a nucleotide sequence having 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 892.

[0111] In some specific embodiments of the present disclosure, the double-stranded oligonucleotide comprises: an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 914, and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 892.

[0112] In some specific embodiments of the present disclosure, the double-stranded oligonucleotide is selected from siRNA.

[0113] In a third aspect, the present disclosure provides a conjugate comprising the double-stranded oligonucleotide of the first and / or second aspect, and one or more gene delivery carriers.

[0114] In some optional embodiments of the present disclosure, the gene delivery carrier is selected from a lipid, a nanoparticle, a polymer, and a ligand.

[0115] In some optional embodiments of the present disclosure, the lipid includes cholesterol and cholesterol deriva- tives; the polymer includes an amphiphilic polymer and a membrane active polymer; the ligand is selected from a ligand capable of binding to a cell surface receptor.

[0116] In some specific embodiments of the present disclosure, the gene delivery carrier is selected from a ligand capable of binding to a cell surface receptor.

[0117] In some specific embodiments of the present disclosure, the ligand specifically targets the liver tissue.

[0118] In some specific embodiments of the present disclosure, the ligand is selected from a ligand of asialoglycoprotein receptor (ASGPR). Binding between the ASGPR ligand and ASGPR can promote the specific targeting and the endocytosis of the conjugate into the hepatocytes.

[0119] In some specific embodiments of the present disclosure, the ASGPR ligand comprises galactose or a derivative thereof.

[0120] In some specific embodiments of the present disclosure, the galactose or the derivative thereof include but are not limited to galactose, galactosamine, N-formyl galactosamine, N-acetyl galactosamine, N-propionyl galactosamine, N- n-butyryl galactosamine and N-isobutyryl galactosamine.

[0121] In some specific embodiments of the present disclosure, the galactose or the derivative thereof is N-acetyl galactosamine (GalNAc).

[0122] In some specific embodiments of the present disclosure, the ASGPR ligand comprises N-acetyl galactosamine.

[0123] In some optional embodiments of the present disclosure, the ligand is conjugated to 3’-end of the sense strand, 5’-end of the sense strand, 3’-end of the antisense strand and / or 5’-end of the antisense strand.

[0124] In some specific embodiments of the present disclosure, the number of the ASGPR ligand is one, and the one ASGPR ligand is conjugated to 3’-end of the sense strand.

[0125] In some specific embodiments of the present disclosure, the double-stranded oligonucleotide is siRNA. The conjugate is a conjugate of siRNA.

[0126] In some optional embodiments of the present disclosure, the conjugate comprises a structure as shown by formula (101): wherein, Nu represents the double-stranded oligonucleotide; each Rligand is independently selected from an ASGPR ligand; and m is selected from 1, 2, 3 and 4. 42 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55

[0127] In some optional embodiments of the present disclosure, when m is one, the one Rligand is conjugated to 3’-end of the sense strand, the one Rligand is conjugated to 5’-end of the sense strand, the one Rligand is conjugated to 3’-end of the antisense strand, or the one Rligand is conjugated to 5’-end of the antisense strand; when m is two, the two Rligand are conjugated to 3’-end of the sense strand and 5’-end of the sense strand respectively; the two Rligand are conjugated to 3’-end of the sense strand and 3’-end of the antisense strand respectively; the two Rligand are conjugated to 5’-end of the sense strand and 3’-end of the antisense strand respectively; the two Rligand are conjugated to 5’-endof the sense strandand 3’-endof the antisense strand respectively; the twoRligand areconjugated to 5’-end of the sense strand and 5’-end of the antisense strand respectively; the two Rligand are conjugated to 3’-end of the antisense strand and 5’-end of the antisense strand respectively; when m is three, the three Rligand are conjugated to 3’-end of the sense strand, 5’-end of the sense strand, and the 3’- end of the antisense strand, respectively; the three Rligand are conjugated to 3’-end of the sense strand, 5’-end of the sense strand, and the 5’-end of the antisense strand, respectively; the three Rligand are conjugated to 3’-end of the sense strand, 3’-end of the antisense strand, and the 5’-end of the antisense strand, respectively; the three Rligand are conjugated to 5’-end of the sense strand, 3’-end of the antisense strand, and the 5’-end of the antisense strand, respectively; when m is four, the four Rligand are conjugated to 3’-end of the sense strand, 5’-end of the sense strand, 3’-end of the antisense strand, and 5’-end of the antisense strand.

[0128] In some specific embodiments of the present disclosure, m is one.

[0129] In some specific embodiments of the present disclosure, m is one, and the Rligand is conjugated to 3’-end of the sense strand.

[0130] In some specific embodiments of the present disclosure, m is two.

[0131] In some specific embodiments of the present disclosure, m is two, and the two Rligand are conjugated to 3’-end and 5’-end of the sense strand, respectively.

[0132] In some optional embodiments of the present disclosure, each Rligand is independently selected from a structure as shown by formula (201), a pharmaceutically acceptable salt thereof and a steroisomer thereof: wherein * represents a conjugation site of the ligand on the sense strand or the antisense strand; j is selected from 1, 2, 3 and 4; each Z is selected from hydroxy and sulfydryl; each p is selected from 1, 2 and 3; each q is selected from 1, 2 and 3; each R2 is independently selected from H, any optionally substituted C1‑6 alkyl and optionally substituted C1‑6 alkoxy; each L is selected from optionally substituted C2‑20 alkylene and 43 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 wherein RLa and RLb are independently selected from any optionally substituted C1‑10 alkylene, and k is selected from 1, 2, 3, 4 and 5; and each Y is selected from O, S and NH.

[0133] In some optional embodiments of the present disclosure, m is selected from 1, 2 or 3.

[0134] In some specific embodiments of the present disclosure, m is 3.

[0135] In some specific embodiments of the present disclosure, Z is hydroxy.

[0136] In some specific embodiments of the present disclosure, p is 1.

[0137] In some specific embodiments of the present disclosure, q is 1.

[0138] In some specific embodiments of the present disclosure, R2 is H.

[0139] In some optional embodiments of the present disclosure, each L is selected from optionally substituted C2‑10 alkylene and wherein RLa and RLb are independently selected from any optionally substituted C1‑10 alkylene, and k is selected from 1, 2 and 3.

[0140] In some specific embodiments of the present disclosure, k is 1.

[0141] In some optional embodiments of the present disclosure, each L is selected from and

[0142] In some optional embodiments of the present disclosure, each L is selected from 44 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55

[0143] In some specific embodiments of the present disclosure, L is

[0144] In some specific embodiments of the present disclosure, L is

[0145] In some specific embodiments of the present disclosure, Y is O.

[0146] In some optional embodiments of the present disclosure, each Rligand is independently selected from a structure as shown by formula (202), a pharmaceutically acceptable salt thereof and a steroisomer thereof:

[0147] In some optional embodiments of the present disclosure, each Rligand is independently selected from a structure as shown by formula (CR01008×3), a pharmaceutically acceptable salt thereof and a steroisomer thereof: 45 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55

[0148] In some optional embodiments of the present disclosure, each Rligand is independently selected from a structure as shown by formula (CR01013×3), a pharmaceutically acceptable salt thereof and a steroisomer thereof: 46 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55

[0149] In some optional embodiments of the present disclosure, each Rligand is independently selected from a structure as shown by formula L96, and a pharmaceutically acceptable salt thereof:

[0150] In some specific embodiments of the present disclosure, the conjugate comprises one or more pairs of: Pair Sense strand (5’‑3’) Antisense strand (5’‑3’) RZ00 2033 SEQ ID NO: 887_(CR01008× 3) SEQ ID NO: 908 47 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) Pair Sense strand (5’‑3’) Antisense strand (5’‑3’) RZ00 2034 SEQ ID NO: 887_(CR01008× 3) SEQ ID NO: 909 RZ00 2036 SEQ ID NO: 888_(CR01008× 3) SEQ ID NO: 909 RZ00 2037 SEQ ID NO: 889_(CR01008× 3) SEQ ID NO: 909 RZ00 2038 SEQ ID NO: 890(CR01008×3 ) SEQ ID NO: 909 RZ00 2039 SEQ ID NO: 891_(CR01008× 3) SEQ ID NO: 909 RZ00 2040 SEQ ID NO: 888_(CR01008× 3) SEQ ID NO: 911 RZ00 2041 SEQ ID NO: 889_(CR01008× 3) SEQ ID NO: 911 RZ00 2042 SEQ ID NO: 890_(CR01008× 3) SEQ ID NO: 911 RZ00 2043 SEQ ID NO: 891_(CR01008× 3) SEQ ID NO: 911 RZ00 2050 SEQ ID NO: 892_(CR01008× 3) SEQ ID NO: 912 RZ00 2051 SEQ ID NO: 892_(CR01008× 3) SEQ ID NO: 913 RZ00 2053 SEQ ID NO: 893_(CR01008× 3) SEQ ID NO: 913 48 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) Pair Sense strand (5’‑3’) Antisense strand (5’‑3’) RZ00 2054 SEQ ID NO: 894_(CR01008× 3) SEQ ID NO: 913 RZ00 2055 SEQ ID NO: 895_(CR01008× 3) SEQ ID NO: 913 RZ00 2056 SEQ ID NO: 896_(CR01008× 3) SEQ ID NO: 913 RZ00 2057 SEQ ID NO: 893_(CR01008× 3) SEQ ID NO: 915 RZ00 2058 SEQ ID NO: 894_(CR01008× 3) SEQ ID NO: 915 RZ00 2059 SEQ ID NO: 895_(CR01008× 3) SEQ ID NO: 915 RZ00 2060 SEQ ID NO: 896_(CR01008× 3) SEQ ID NO: 915 RZ00 2066 SEQ ID NO: 897_(CR01008× 3) SEQ ID NO: 916 RZ00 2067 SEQ ID NO: 897_(CR01008× 3) SEQ ID NO: 917 RZ00 2068 SEQ ID NO: 897_(CR01008× 3) SEQ ID NO: 918 RZ00 2069 SEQ ID NO: 898_(CR01008× 3) SEQ ID NO: 917 RZ00 2070 SEQ ID NO: 899_(CR01008× 3) SEQ ID NO: 917 49 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) Pair Sense strand (5’‑3’) Antisense strand (5’‑3’) RZ00 2071 SEQ ID NO: 900_(CR01008× 3) SEQ ID NO: 917 RZ00 2072 SEQ ID NO: 901_(CR01008× 3) SEQ ID NO: 917 RZ00 2073 SEQ ID NO: 898_(CR01008× 3) SEQ ID NO: 919 RZ00 2074 SEQ ID NO: 899_(CR01008× 3) SEQ ID NO: 919 RZ00 2075 SEQ ID NO: 900_(CR01008× 3) SEQ ID NO: 919 RZ00 2076 SEQ ID NO: 901_(CR01008× 3) SEQ ID NO: 919 RZ00 2082 SEQ ID NO: 902_(CR01008× 3) SEQ ID NO: 920 RZ00 2083 SEQ ID NO: 902_(CR01008× 3) SEQ ID NO: 921 RZ00 2084 SEQ ID NO: 902_(CR01008× 3) SEQ ID NO: 922 RZ00 2085 SEQ ID NO: 903_(CR01008× 3) SEQ ID NO: 921 RZ00 2086 SEQ ID NO: 904_(CR01008× 3) SEQ ID NO: 921 RZ00 2087 SEQ ID NO: 905_(CR01008× 3) SEQ ID NO: 921 50 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) Pair Sense strand (5’‑3’) Antisense strand (5’‑3’) RZ00 2088 SEQ ID NO: 906_(CR01008× 3) SEQ ID NO: 921 RZ00 2089 SEQ ID NO: 903_(CR01008× 3) SEQ ID NO: 923 RZ00 2090 SEQ ID NO: 904_(CR01008× 3) SEQ ID NO: 923 RZ00 2091 SEQ ID NO: 905_(CR01008× 3) SEQ ID NO: 923 RZ00 2092 SEQ ID NO: 906_(CR01008× 3) SEQ ID NO: 923 RZ00 2099 SEQ ID NO: 887_(CR01008× 3) SEQ ID NO: 910 RZ00 2100 SEQ ID NO: 888_(CR01008× 3) SEQ ID NO: 910 RZ00 2101 SEQ ID NO: 890_(CR01008× 3) SEQ ID NO: 910 RZ00 2102 SEQ ID NO: 890_(CR01008× 3) SEQ ID NO: 924 RZ00 2103 SEQ ID NO: 891_(CR01008× 3) SEQ ID NO: 924 RZ00 2106 SEQ ID NO: 892_(CR01008× 3) SEQ ID NO: 914 RZ00 2107 SEQ ID NO: 895_(CR01008× 3) SEQ ID NO: 914 51 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) Pair Sense strand (5’‑3’) Antisense strand (5’‑3’) RZ00 2108 SEQ ID NO: 896_(CR01008× 3) SEQ ID NO: 925 RZ00 2112 SEQ ID NO: 905_(CR01008× 3) SEQ ID NO: 922 RZ00 2113 SEQ ID NO: 906_(CR01008× 3) SEQ ID NO: 926 RZ00 2115 SEQ ID NO: 892_(CR01008× 3) SEQ ID NO: 927 RZ00 2116 SEQ ID NO: 907_(CR01008× 3) SEQ ID NO: 928 RZ00 2117 SEQ ID NO: 907_(CR01008× 3) SEQ ID NO: 929 RZ00 2118 SEQ ID NO: 907_(CR01008× 3) SEQ ID NO: 930 RZ00 2119 SEQ ID NO: 887_(CR01008× 3) SEQ ID NO: 931 RZ00 2120 SEQ ID NO: 887_(CR01008× 3) SEQ ID NO: 932 RZ00 2121 SEQ ID NO: 887_(CR01008× 3) SEQ ID NO: 933 RZ00 2122 SEQ ID NO: 902_(CR01008× 3) SEQ ID NO: 934 RZ00 2123 SEQ ID NO: 902_(CR01008× 3) SEQ ID NO: 935 52 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) Pair Sense strand (5’‑3’) Antisense strand (5’‑3’) RZ00 2124 SEQ ID NO: 902_(CR01008× 3) SEQ ID NO: 936 RZ00 2125 SEQ ID NO: 892_(CR01008× 3) SEQ ID NO: 937 RZ00 2126 SEQ ID NO: 892_(CR01008× 3) SEQ ID NO: 938 RZ00 2130 SEQ ID NO: 907_(CR01008× 3) SEQ ID NO: 939 RZ00 2131 SEQ ID NO: 897_(CR01008× 3) SEQ ID NO: 940 RZ00 2132 SEQ ID NO: 897_(CR01008× 3) SEQ ID NO: 941 RZ00 2133 SEQ ID NO: 897_(CR01008× 3) SEQ ID NO: 942 RZ00 2134 SEQ ID NO: 897_(CR01008× 3) SEQ ID NO: 943 as an illustrative example, "SEQ ID NO: 892_(CR01008×3)" indicates that the ligand represented by formula (CR01008×3) is conjugated to 3’-end of the sense strand as set forth in SEQ ID NO: 892.

[0151] In some specific embodiments of the present disclosure, the conjugate comprises one or more pairs of: Pair Sense strand (5’‑3’) Antisense strand (5’‑3’) RZ00 2033 SEQ ID NO: 887_(CR01008× 3) SEQ ID NO: 908 RZ00 2050 SEQ ID NO: 892_(CR01008× 3) SEQ ID NO: 912 RZ00 2082 SEQ ID NO: 902_(CR01008× 3) SEQ ID NO: 920 53 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) Pair Sense strand (5’‑3’) Antisense strand (5’‑3’) RZ00 2106 SEQ ID NO: 892_(CR01008× 3) SEQ ID NO: 914 RZ00 2115 SEQ ID NO: 892_(CR01008× 3) SEQ ID NO: 927 RZ00 2116 SEQ ID NO: 907_(CR01008× 3) SEQ ID NO: 928 RZ00 2117 SEQ ID NO: 907_(CR01008× 3) SEQ ID NO: 929 RZ00 2118 SEQ ID NO: 907_(CR01008× 3) SEQ ID NO: 930 RZ00 2119 SEQ ID NO: 887_(CR01008× 3) SEQ ID NO: 931 RZ00 2120 SEQ ID NO: 887_(CR01008× 3) SEQ ID NO: 932 RZ00 2121 SEQ ID NO: 887_(CR01008× 3) SEQ ID NO: 933 RZ00 2122 SEQ ID NO: 902_(CR01008× 3) SEQ ID NO: 934 RZ00 2123 SEQ ID NO: 902_(CR01008× 3) SEQ ID NO: 935 RZ00 2124 SEQ ID NO: 902_(CR01008× 3) SEQ ID NO: 936 RZ00 2125 SEQ ID NO: 892_(CR01008× 3) SEQ ID NO: 937 54 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) Pair Sense strand (5’‑3’) Antisense strand (5’‑3’) RZ00 2126 SEQ ID NO: 892_(CR01008× 3) SEQ ID NO: 938 RZ00 2130 SEQ ID NO: 907_(CR01008× 3) SEQ ID NO: 939 RZ00 2131 SEQ ID NO: 897_(CR01008× 3) SEQ ID NO: 940 RZ00 2132 SEQ ID NO: 897_(CR01008× 3) SEQ ID NO: 941 RZ00 2133 SEQ ID NO: 897_(CR01008× 3) SEQ ID NO: 942 RZ00 2134 SEQ ID NO: 897_(CR01008× 3) SEQ ID NO: 943 as an illustrative example, "SEQ ID NO: 892_(CR01008×3)" indicates that the ligand represented by formula (CR01008×3) is conjugated to 3’-end of the sense strand as set forth in SEQ ID NO: 892.

[0152] In some specific embodiments of the present disclosure, the conjugate comprises: Pair Sense strand (5’‑3’) Antisense strand (5’‑3’) RZ00 2106 SEQ ID NO: 892_(CR01008× 3) SEQ ID NO: 914 wherein, "SEQ ID NO: 892_(CR01008×3)" indicates that the ligand represented by formula (CR01008×3) is conju- gated to 3’-end of the sense strand as set forth in SEQ ID NO: 892.

[0153] In a fourth aspect, the present disclosure provides a use of the double-stranded oligonucleotide according to the first aspect, and / or the double-stranded oligonucleotide according to the second aspect, and / or the conjugate according to the third aspect, in the manufacture of a medicament for ameliorating, preventing and / or treating a disease or disorder mediated by C3 gene.

[0154] In some optional embodiments of the present disclosure, the disease or disorder mediated by C3 gene includes but is not limited to IgA nephropathy, atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy, lupus nephritis, and membranous nephropathy.

[0155] In a fifth aspect, the present disclosure provides a pharmaceutical composition comprising the double-stranded oligonucleotide according to the first aspect, and / or the double-stranded oligonucleotide according to the second aspect, and / or the conjugate according to the third aspect.

[0156] In some optional embodiments of the present disclosure, the pharmaceutical composition further comprises one or more pharmaceutically acceptable excipients or adjuvants.

[0157] In the present disclosure, a "pharmaceutical composition" may refer to one for use in the treatment of a disease, or for use in in vitro cell culture experiments. When used for the treatment of a disease, the term "pharmaceutical 55 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 composition" usually refers to a unit dosage form, and can be prepared by any of the methods well known in the pharmaceutical art. The methods include the step of bringing an active ingredient into association with an excipient which constitutes one or more accessory ingredients. Generally, compositions are prepared by uniformly and intimately bringing an active siRNA into association with a liquid excipient, a finely divided solid excipient, or both.

[0158] In the present disclosure, the term "pharmaceutically acceptable" means that a substance or composition must be chemically and / or toxicologically compatible with the other ingredients comprising a formulation and / or the mammal to be treated therewith. Preferably, "pharmaceutically acceptable" as described in the present disclosure refers to what is approved by a federal regulatory agency or a national government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.

[0159] In the present disclosure, the term "pharmaceutically acceptable excipient" include any solvents, solid ex- cipients, diluents, or other liquid excipients, and the like, that are suitable for a particular target dosage form. The use of any conventional excipient is contemplated herein, except to the extent that such excipients are incompatible with an siRNA of the present disclosure, for example, by producing any undesirable biological effect or interacting in a deleterious manner with any other component of the pharmaceutically acceptable composition.

[0160] The use of any conventional excipient is contemplated herein, except to the extent that such excipients are incompatible with an siRNA of the present disclosure, for example, by producing any undesirable biological effect or interacting in a deleterious manner with any other component of the pharmaceutically acceptable composition.

[0161] The pharmaceutical compositions of the present disclosure include formulations suitable for parenteral admin- istration. The formulations may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy. The amount of an active ingredient that can be combined with excipient materials to produce a single dosage form will generally be that amount of the siRNA which produces a therapeutic effect.

[0162] In a sixth aspect, the present disclosure provides a medicament, wherein the medicament comprises the pharmaceutical composition according to the fifth aspect.

[0163] In a seventh aspect, the present disclosure provides a medicament combination, comprising the medicament according to the sixth aspect and any other active ingredient.

[0164] In an eighth aspect, the present disclosure provides a kit comprising the double-stranded oligonucleotide according to the first aspect, and / or the double-stranded oligonucleotide according to the second aspect, and / or the conjugate according to the third aspect, and / or the pharmaceutical composition according to the fifth aspect, and / or the medicament according to the sixth aspect, and / or the medicament combination according to the seventh aspect.

[0165] In a ninth aspect, the present disclosure provides a method for inhibiting expression of C3 gene, comprising administering to a subject in need thereof the double-stranded oligonucleotide according to the first aspect, and / or the double-stranded oligonucleotide according to the second aspect, and / or the conjugate according to the third aspect, and / or the pharmaceutical composition according to the fifth aspect, and / or the medicament according to the sixth aspect, and / or the medicament combination according to the seventh aspect.

[0166] In some specific embodiments of the present disclosure, the present disclosure provides a method for inhibiting C3 gene expression in a cell in vitro, comprising contacting the cell with the double-stranded oligonucleotide according to the first aspect, and / or the double-stranded oligonucleotide according to the second aspect, and / or the conjugate according to the third aspect, and / or the pharmaceutical composition according to the fifth aspect, and / or the medicament according to the sixth aspect, and / or the medicament combination according to the seventh aspect.

[0167] In some optional embodiments of the present disclosure, the inhibition of the expression of the C3 gene is that the cell is maintained for a time sufficient to obtain degradation of the mRNA transcript of the C3 gene.

[0168] More practically, in a tenth aspect of, the present disclosure provides a method for ameliorating, treating and / or preventing a disease or disorder mediated by C3 gene, comprising administering the double-stranded oligonucleotide according to the first aspect, and / or the double-stranded oligonucleotide according to the second aspect, and / or the conjugate according to the third aspect, and / or the pharmaceutical composition according to the fifth aspect, and / or the medicament according to the sixth aspect, and / or the medicament combination according to the seventh aspect, to a subject in need thereof.

[0169] In some specific embodiments of the present disclosure, the subject is a human.

[0170] In some specific embodiments of the present disclosure, the medicament is administered at a dose of 0.01 mg / kg to 10 mg / kg, or 0.5 mg / kg to 50 mg / kg.

[0171] In some specific embodiments of the present disclosure, the mode of administration of the medicament includes subcutaneous administration or intravenous administration.

[0172] In some specific embodiments of the present disclosure, the disease or disorder mediated by C3 gene is associated with the mRNA expression level of C3 gene.

[0173] In some specific embodiments of the present disclosure, the disease or disorder is selected from IgA nephro- pathy, atypical hemolytic uremic syndrome, paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy, lupus nephritis and membranous nephropathy.

[0174] The double-stranded oligonucleotides or conjugates thereof provided by the present disclosure significantly 56 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 inhibit C3 gene mRNA expression in HepG2 cells, significantly inhibit C3 gene mRNA expression in animals, significantly reduce the protein level of the C3 gene in the serum of Macaca fascicularis and the inhibitory effect lasts until day 42, significantly inhibit the alternative complement pathway in the serum of Macaca fascicularis but has no effect on the classical complement pathway in the serum, reduce C3 gene mRNA and protein levels in CFA-IgA mice, reduce C3 deposition in renal tissue and improve the disease course in patients with C3 deposition in renal tissue, and no significant abnormalities are observed in animal hematology and blood biochemistry. The double-stranded oligonucleotide or a conjugate thereof provided by the present disclosure is useful for alleviating, preventing, and / or treating a disease or disorder mediated by C3 gene. BRIEF DESCRIPTION OF DRAWINGS

[0175] FIG. 1 shows the inhibitory activity on C3 mRNA in BALB / c-HDI mice after administration of the siRNA conjugate as described in Example 2; FIG. 2 shows representative histopathological images (H&E staining, 200x magnification) for each experimental group in Example 3; FIG. 3 shows the inhibitory activity on C3 mRNA in HepG2 cells after administration of the siRNA conjugate as described in Example 4; FIG. 4 shows the inhibitory activity on C3 mRNA in the liver ofMacaca fascicularis after administration of the siRNA conjugate as described in Example 5; FIG. 5 shows the change in the C3 protein level in the serum ofMacaca fascicularis after administration of the siRNA conjugate as described in Example 6; FIG. 6 shows the change in the activity of the alternative complement pathway in the serum of Macaca fascicularis after administration of the siRNA conjugate as described in Example 7; FIG. 7 shows the change in the activity of the classical complement pathway in the serum ofMacaca fascicularis after administration of the siRNA conjugate as described in Example 7; FIG. 8 shows the inhibitory activity on the target gene in the liver of CFA-hIgA mice after administration of the siRNA conjugate as described in Example 8; FIG. 9 shows the change in the C3 protein level in the serum of CFA-hIgA mice after administration of the siRNA conjugate as described in Example 8; and FIG. 10 shows the change in C3 deposition in the kidneys of CFA-hIgA mice after administration of the siRNA conjugate as described in Example 8. DETAILED DESCRIPTION

[0176] The present disclosure provides a double-stranded oligonucleotide for inhibiting C3 gene expression, a conjugate thereof, and uses thereof. A person skilled in the art can implement the present disclosure by referring to the content herein and appropriately modifying the process parameters. It is to be noted that all similar substitutions and modifications are obvious to a person skilled in the art and are considered to be included in the present disclosure. The methods and applications of the present disclosure have been described through preferred embodiments, and a person skilled in the art can obviously make modifications or appropriate changes and combinations to the methods and applications described herein without departing from the content, spirit, and scope of the present disclosure to realize and apply the technology of the present disclosure. Term Explanation

[0177] In the present disclosure, the term "comprising" or "including" is an open-ended expression, meaning that it specifies certain contents described in the present disclosure, but does not exclude the presence of other, unlisted 57 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 contents.

[0178] In the present disclosure, the terms "optionally", "optional", or "option" generally refer to an event or condition that is subsequently described that may or may not occur, and this description includes instances in which the event or condition occurs and instances in which it does not.

[0179] In the present disclosure, the term "small interfering RNA (siRNA)" is a double-stranded RNA of 17 to 25 nucleotides in length, comprising a sense strand and an antisense strand. An siRNA mediates target cleavage of an RNA transcript via the RISC pathway by forming an RNA-induced silencing complex (RISC). Specifically, an siRNA directs sequence-specific degradation of an mRNA through the known RNA interference (RNAi) process, thereby inhibiting the translation of the mRNA into amino acids and its conversion into a protein. For example, an siRNA can regulate (e.g., inhibit) the expression of C3 in a cell.

[0180] In the present disclosure, the term "antisense strand (or guide strand)" includes a region that is substantially complementary to a target sequence, such as the mRNA of C3. The "sense strand (or passenger strand)" refers to a siRNA strand that contains a sequence substantially complementary to the antisense strand. The term "substantially comple- mentary" means fully complementary or at least partially complementary, for example, the antisense strand is fully complementary or at least partially complementary to the target sequence. In the case of partial complementarity, mismatches can be present within the internal or terminal regions of the molecule, wherein the most tolerated mismatches are present within the terminal regions, for example, within 5, 4, 3, or 2 nucleotides of the 5’-end and / or 3’-end of the siRNA.

[0181] It should be noted that an antisense strand being "at least partially substantially complementary" to an mRNA means that the antisense strand has a polynucleotide that is substantially complementary to a contiguous portion of an mRNA of interest (e.g., an mRNA encoding C3). Alternatively, the antisense strand is complementary to at least a portion of the mRNA of C3 if a polynucleotide is substantially uninterruptedly complementary to a portion of the mRNA encoding C3.

[0182] In the present disclosure, the term "target sequence" refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of the C3 gene, including an mRNA that is a product of RNA processing of a primary transcript. C3 can be within a cell, for example, a cell in a subject.

[0183] In the present disclosure, the term "substantially complementary" means that the sense strand and the antisense strand have no more than 3 nucleotide mismatches, no more than 2 nucleotide mismatches, or no more than 1 nucleotide mismatch in the duplex region, forexample, 3 nucleotide mismatches, 2 nucleotide mismatches, 1 nucleotide mismatch, or 0 nucleotide mismatches.

[0184] In the present disclosure, the terms "nucleotide difference" and "nucleotide base difference" are used inter- changeably. A "nucleotide difference" exists between one nucleotide sequence and another nucleotide sequence when the type of base of the nucleotide at the same position has changed in the former compared to the latter. For example, when a nucleotide base at a certain position in the latter is A, and the corresponding nucleotide base at the same position in the former is U, C, G, or T, it is considered that a nucleotide difference exists between the two nucleotide sequences at that position. In some embodiments, when a nucleotide at the original position is replaced by an abasic nucleotide or an equivalent thereof, a nucleotide difference can also be considered to have been created at that position.

[0185] In the present disclosure, the term "overhang" refers to at least one unpaired nucleotide that protrudes from the double-helical structure of a double-stranded oligonucleotide, and also refers to the nucleotide sequence in a siRNA structure other than the duplex region. For example, when the 3’-end of one strand in the sense strand and / or the antisense strand extends beyond the 5’-end of the other strand, or when the 5’-end of one strand in the sense strand and / or the antisense strand extends beyond the 3’-end of the other strand, a nucleotide overhang is present. The overhang may comprise at least one nucleotide, at least two nucleotides, at least three nucleotides, at least four nucleotides, at least five nucleotides, or more nucleotides. The nucleotide overhang may comprise or be composed of nucleotides or nucleoside analogs, including deoxynucleotides and deoxynucleosides. The overhang can be located on the sense strand, the antisense strand, or any combination thereof. In addition, the nucleotides of the overhang can appear at the 5’-end, the 3’- end, or both ends of the antisense or sense strand.

[0186] In the present disclosure, the term "DEPC H2O" is ultrapure water (Type I water) that has been treated with diethyl pyrocarbonate (DEPC) and sterilized by high-temperature, high-pressure autoclaving.

[0187] In the present disclosure, the term "subject" refers to any animal being examined, studied, or treated, and is not intended to limit the present disclosure to any particular type of subject. In some embodiments of the present disclosure, a human is a preferred subject, while in other embodiments, a non-human animal is a preferred subject, including but not limited to a mouse, monkey, ferret, cow, sheep, goat, pig, chicken, turkey, dog, cat, horse, and reptile.

[0188] In the present disclosure, the term "inhibiting the expression of C3 gene" refers to any level of inhibition of the C3 gene expression, for example, at least partial inhibition of C3 gene expression, such as inhibition of at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%. Herein, the expression of the C3 gene can be evaluated based on the level of any variable associated with C3 gene expression, for example, the mRNA 58 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 level or protein level of C3. Inhibition can be evaluated by a decrease in the absolute or relative level of one or more of these variables compared to a control level. A control level can be any type of control level utilized in the art, for example, a baseline level before administration, or a level determined from a similar subject, cell, or sample that was not treated or was treated with a control (e.g., a buffer-only control or an inactive agent control).

[0189] In the present disclosure, unless otherwise specified, the siRNA sequences were synthesized by Kunshan Aotai Biotechnology Co., Ltd.; the PCR primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.; the human liver cancer HepG2 cells were purchased from Wuhan Procell Life Science & Technology Co., Ltd.; the experimental animal BALB / c mice were purchased from Zhejiang Vital River Laboratory Animal Technology Co. Ltd.; the CFA-hIgA nephro- pathy model mice were constructed by Peking University First Hospital; and the healthy Macaca fascicularis were purchased from Guangzhou Landao Biotechnology Co., Ltd.

[0190] In the present disclosure, unless otherwise specified, the base compositions and modifications are represented as follows: capital letters A, U, G, C, and T represent the base composition of the nucleotides, respectively; a lowercase letter m indicates that the nucleotide immediately to the left of the letter m is a 2’-O-methyl modified (alsonamed: 2’- methoxy modified) nucleotide; a lowercase letter f indicates that the nucleotide immediately to the left of the letter f is a 2’- fluoro modified nucleotide; a lowercase letter d indicates that the nucleotide immediately to the left of the letter d is a 2’- deoxy modified ribonucleic acid (also named: deoxyribonucleic acid); (moe) indicates that the nucleotide immediately to the left of the combination identifier (moe) is a 2’-O-methoxyethyl modified nucleotide; and a lowercase letter s indicates a phosphorothioate linkage between the two nucleotides immediately adjacent to the left and right of the letter s.

[0191] In the present disclosure, unless otherwise specified, the Real-time PCR detection data of the in vivo activity experiments described herein were subjected to relative quantification of the target gene mRNA in each test group using the ΔΔCt method. The calculation method is summarized as follows: ΔCt (test group) = Ct (target gene in the test group) - Ct (internal reference gene in the test group) ΔCt (control group) = Ct (target gene in the control group) - Ct (internal reference gene in the control group)

[0192] The mRNA expression level of the target gene in the test group is normalized with the control group as the baseline, and the remaining mRNA expression level of the target gene in the control group is defined as 100%. Relative remaining mRNA expression level of the target gene in the test group = 2-ΔΔCt (test group) × 100% mRNA inhibition rate of the target gene in the test group = 100% - relative remaining mRNA expression level of the target gene in the test group

[0193] For the C3 protein detection data at different time points in the in vivo activity experiments of the present disclosure, the calculation formula is: wherein, "pre-dose" represents the C3 protein concentration in the serum before administration, and "Dx" represents the C3 protein concentration in the serum on day x after administration.

[0194] For the CCP and CAP activity detection data at different time points in the in vivo activity experiments of the present disclosure, the calculation formula is: wherein, pre-dose represents the CCP activity or CAP activity in the serum before administration, and Dx represents the 59 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 CCP activity or CAP activity in the serum on day x after administration.

[0195] In the present disclosure, unless otherwise specified, the in vivo activity experimental data are expressed as mean ± SD (X ± STDEV), and the experimental data were all plotted and analyzed using GraphPad Prism 8.0 software.

[0196] In the present disclosure, unless otherwise specified, the proportions of the reagents are calculated by volume ratio (v / v).

[0197] Unless otherwise specified, the reagents used in the preparation of the compounds in the present disclosure were purchased from Beijing Ouhe Technology Co., Ltd., and information of the main reagents is shown in Table 1. Table 1: Main reagents Reagent Name Abbreviation CAS No. Lithium aluminum hydride (LiAlH4) - 16853‑85‑3 Wet palladium on carbon (10 wt%) Pd / C - Palladium hydroxide on carbon (10 wt%) Pd(OH)2 / C - O-Benzotriazole-N,N,N’,N’-tetramethyluronium hexafluorophosphate HBTU 94790‑37‑1 O‑(7-Azabenzotriazol‑1-yl)‑N,N,N’,N’-tetramethyluronium hexafluoropho- sphate HATU 148893‑10‑1 4,4’-Dimethoxytrityl chloride / 4,4’-Dimethoxytriphenylchloromethane DMTrCl 40615‑36‑9 bis(diisopropylamino)(2-cyanoethoxy)phosphine - 102691‑36‑1 4,5-Dicyanoimidazole DCI 1122‑28‑7 4-Dimethylaminopyridine DMAP 1122‑58‑3 Amino-CPG (Aminoalkyl-CPG, Model: C3006‑1000) - 4M Hydrochloric acid in 1,4-dioxane solution - - trans‑4‑(Boc-amino)cyclohexanecarboxaldehyde - 181308‑57‑6 N-Benzyloxycarbonyl‑4-aminobutanoic acid - 5105‑78‑2 5‑[[(2R,3R,4R,5R,6R)‑3-Acetamido‑4,5-diacetoxy‑6‑(acetoxymethyl)2-tet- rahydropyranyl]oxy]pentanoic acid Compound 4 1159408‑54‑4 wherein, CPG represents a Controlled Pore Glass support.

[0198] Unless otherwise specified, the reagents, consumables, instruments, and equipment used in the biological detection experiments in the present disclosure are all commercially available products. The main reagents and consumables and their sources are shown in Table 2, and the main instruments and equipment and their sources are shown in Table 3. Table 2: Main reagents and consumables Name Manufacturer Opti-MEM GENOM Bio MEM Medium Gibco FBS Gibco Penicilin-streptomycin HyClone Trypsin Gibco Power SYBR Green RNA-to-CTTM 1-Step Thermo Fisher 1×PBS Zhongke Maichen (Beijing) Technology Co., Ltd. DMEM Medium Zhongke Maichen (Beijing) Technology Co., Ltd. Opti-MEMTM Medium Gibco Serum Sigma 60 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) Trypsin Zhongke Maichen (Beijing) Technology Co., Ltd. Penicilin-streptomycin BBI Lipofectamine RNAiMax Invitrogen Nucleic Acid Extraction / Purification Kit Zhejiang Hanwei Technology Co ltd RevertAid First Strand cDNA Synthesis Kit Thermo Fisher Scientific TaqMan Fast Advanced Master Mix Thermo Fisher Scientific SYBR Select Master Mix Thermo Fisher Scientific Hanwei RNA Extraction Kit Zhejiang Hanwei Technology Co ltd RNALater™ Thermo Fisher Scientific Ambion® RNAlater® Invitrogen Human Complement C3 ELISA Kit Hycult Biotech WIESLAB® Complement System Alternative Pathway - RUO IBL America WIESLAB® Complement System Classical Pathway‑ RUO IBL America Table 3: Main instruments and equipment Name Manufacturer Automatic Nucleic Acid Extractor Zhejiang Hanwei Technology Co ltd High-Speed Refrigerated Centrifuge Eppendorf CO2 Incubator Thermo Fisher Scientific Biosafety Cabinet Shanghai Lishen Constant Temperature Water Bath Shanghai Boxun Automatic Cell Counter Shanghai Ruiyu Inverted Microscope Olympus NANODROP OneC Thermo Fisher Scientific Gradient PCR Thermal Cycler Eppendorf CFX Opus 384 Bio-Rad LightCycler 480 Roche Gel Imaging System Shanghai Tanon Life Science Co.,Ltd. Electrophoresis System BEIJING LIUYI BIOTECHNOLOGY CO.,LTD. Tissuelyser II Automatic Tissue Homogenizer Shanghaijingxin Experimental Technology Real-Time Quantitative PCR System Roche Paraffin Microtome JINHUA YIDI MEDICAL APPLIANCE CO.,LTD. Tissue Processor Leica Automatic Biological Tissue Embedding System JINHUA YIDI MEDICAL APPLIANCE CO.,LTD. Automatic Modular Hematology and Body Fluid Analyzer SYSMEX

[0199] The raw materials and reagents used for the double-stranded oligonucleotide for inhibiting C3 gene expression, the conjugate thereof, and the use thereof provided by the present disclosure are all commercially available.

[0200] The present disclosure is further described below in conjunction with examples: Preparation of compounds 61 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 Preparation Example 1: Preparation of Compound CR01008 and Compound CR01008Z (1.1) Synthesis of Compound CR01008

[0201] In this preparation example, the synthetic route for compound CR01008 was: (1.1.1) Synthesis of compound 2

[0202] Compound 1 (trans‑4‑(Boc-amino)cyclohexanecarboxaldehyde, 10.0 g, 1.0 eq) and an aqueous formaldehyde solution (8.9 g, 37 %, 2.4 eq) were dissolved in 33 mL of methanol. 13 mL of an aqueous KOH solution with a concentration of 45.3 % was added dropwise. After the addition was completed, the mixture was stirred and reacted at 25°C for 30 min, heated to 60°C, and reacted under reflux at 60°C for 2 h. After the reaction was completed, the reaction solution was cooled to room temperature and then evaporated to dryness under reduced pressure and a white solid crude product was obtained. A small amount of water was added to the crude product to form aslurry, which was then filtered, and compound 2 (9 g, yield 78.9%) was obtained as a white solid. MS-ESI (m / z) = 260 [M+H]+. (1.1.2) Synthesis of compound 3

[0203] Compound 2 (9 g, 1 eq) prepared according to step (1.1.1) was dissolved in 70 mL of 1,4-dioxane. A solution of hydrogen chloride in 1,4-dioxane (45 mL, 4 M) was added, and the mixture was stirred and reacted at 25°C for 1 hour. After the reaction was completed, the reaction solution was evaporated to dryness under reduced pressure, and compound 3 (6.8 g, yield 100%) was obtained as a white solid. (1.1.3) Synthesis of compound 5

[0204] Compound 3 (1.8 g, 2.0 eq) prepared according to step (1.1.2), compound 4 (5‑[[(2R,3R,4R,5R,6R)‑3-acet- amido‑4,5-diacetoxy‑6‑(acetoxymethyl)2-tetrahydropyranyl]oxy]pentanoic acid, 2.1 g, 1.0 eq), and DIEA (N,N-diisopro- pylethylamine, 3.5 g, 6.0 eq) were dissolved in 15 mL of DMF. HBTU (1.9 g, 1.1 eq) was added, and the mixture was stirred and reacted at 25°C for 3 h under an N2 atmosphere. After the reaction was completed, the reaction solution was evaporated to dryness under reduced pressure and purified by reverse-phase chromatography (using a 22 vol% aqueous acetonitrile solution). Compound 5 (1.78 g, yield 64.4%) was obtained as a white solid. MS-ESI (m / z) = 589 [M+H]+. 62 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (1.1.4) Synthesis of compound 6

[0205] Compound 5 (1.54 g, 1.0 eq) prepared according to step (1.1.3) was dissolved in 15 mL of pyridine. The reaction system was cooled to 0°C with an ice-water bath, and DMTrCl (4,4’-dimethoxytrityl chloride, 1.32 g, 1.5 eq) was added at 0°C. The mixture was reacted at 25°C for 3 h, and the reaction was quenched by adding 15 mL of methanol to the reaction solution. After the reaction was completed, the reaction solution was evaporated to dryness under reduced pressure and the residue was purified by reverse-phase chromatography (using a 60 vol% aqueous solution of acetonitrile). Compound 6 (1 g, yield 42.7%) was obtained as a yellow solid. MS-ESI (m / z) = 891 [M+H]+. (1.1.5) Synthesis of compound CR01008

[0206] Compound 6 (1.08 g, 1.0 eq) prepared according to step (1.1.4) was dissolved in 20 mL of anhydrous dichloromethane. DCI (115 mg, 0.8 eq) and compound 7 (bis(diisopropylamino)(2-cyanoethoxy)phosphine, 732 mg, 2.1 eq) were added respectively. The atmosphere was purged with nitrogen 3 times, and the mixture was stirred and reacted at 25°C for 2 h. After the reaction was completed, 20 mL of a saturated aqueous sodium bicarbonate solution was added to the reaction solution, and the mixture was extracted 3 times with 20 mL of dichloromethane (3×20 mL). The organic phases were combined and evaporated to dryness under reduced pressure, and the residue was purified by reverse-phase chromatography (using a 72 vol% aqueous acetonitrile solution), and then dried under vacuum for 12 h. Compound CR01008 (1 g, yield 76.0%) was obtained as a white powder. MS-ESI (m / z) = 1091 [M+Na]+.

[0207] 1H NMR (400 MHz, DMSO-d6) δ 1.05 (d, J = 6.7 Hz, 6H).1.14 (d, J = 6.7 Hz, 6H), 1.37 - 1.17 (m, 5H), 1.60 - 1.40 (m, 6H),1.68 - 1.62 (m, 1H),1.80 (s, 3H),1.80 (s, 3H),1.92 (s, 3H), 2.02 (s, 5H),2.13 (s, 3H),2.71 (t, J = 5.9 Hz, 2H), 2.79 (d, J = 8.4 Hz, 1H), 2.87 (d, J = 8.4 Hz, 1H),3.36 (s, 1H), 3.58 - 3.39 (m, 3H), 3.69 - 3.60 (m, 2H), 3.75 (s, 7H), 3.90 (dt, J = 11.2, 8.8 Hz, 1H), 4.05 (s, 3H),4.51 (d, J = 8.4 Hz, 1H), 4.99 (dd, J = 11.3, 3.4 Hz, 1H), 5.24 (d, J = 3.4 Hz, 1H), 5.78 (s, 1H), 6.93 - 6.87 (m, 4H),7.35 - 7.21 (m, 7H), 7.44 - 7.37 (m, 2H), 7.66 (d, J = 7.8 Hz, 1H), 7.84 (d, J = 9.2 Hz, 1H). (1.2) Synthesis of Compound CR01008Z

[0208]

[0209] In this preparation example, the synthetic route for compound CR01008Z was: (1.2.1) Synthesis of compound 9

[0210] Compound 6 (500 mg) prepared according to step (1.1.4) was dissolved in 10 mL of dichloromethane. 63 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 Compound 8 (succinic anhydride, 112 mg), DMAP (6.8 mg), and TEA (226.2 mg) were added. The atmosphere was purged with nitrogen 3 times, and the mixture was stirred and reacted at 25°C for 16 h. The residue was purified by flash chromatography, and compound 9 (300 mg, yield 53.6%) was obtained. MS-ESI (m / z) = 1013 [M+Na]+. (1.2.2) Synthesis of compound CR01008Z

[0211] Compound 9 (50 mg) prepared according to step (1.2.1), amino-CPG (1.25 g, 80 µmol / g, 0.1 mmol), HBTU (27 mg), and DIEA (12 mg) were added to a 20 mL vial. The mixture was reacted on a shaker for 16 h. After the reaction was completed, the reaction mixturewas filtered and afilter cakewas obtained.The filter cake wasfirst washed oncewith 10 mL of acetonitrile (1 × 10 mL) and then dried under vacuum. The dried filter cake, DMAP (3 mg), Cap1 (10 mL, 200V), and Cap2 (1 mL, 20V) were added to a 20 mL vial. The mixture was reacted on a shaker for 6 h. After the reaction was completed, the reaction mixturewas filtered and afilter cakewas obtained.The filter cake wasfirst washed oncewith 10 mL of acetonitrile (1 × 10 mL) and then dried under vacuum, and compound CR01008Z (1.03 g, loading capacity 20 to 30 µmol / g) was obtained.

[0212] Wherein Cap1 and Cap2 are capping reagents, Cap1 is a 20 vol% solution of N-methylimidazole in a mixed solution of pyridine / acetonitrile, with a volume ratio of pyridine to acetonitrile of 3:5; and Cap2 is a 20 vol% solution of acetic anhydride in acetonitrile. Preparation Example 2: Preparation of Compound CR01013 and Compound CR01013Z (2.1) Preparation of Compound CR01013

[0213] In this preparation example, the synthetic route for compound CR01013 was: (2.1.1) Synthesis of compound 2

[0214] Compound 1 (trans‑4‑(Boc-amino)cyclohexanecarbaldehyde, 4.9 g) was dissolved in 17 mL of methanol. An aqueous formaldehyde solution (4.21 g, with a concentration of 37 %) and an aqueous sodium hydroxide solution (6.5 mL, with a concentration of 45.3 %) were added dropwise. After the addition was completed, the mixture was heated to 60°C 64 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 and stirred and reacted at 60°C for 2 h. After the reaction was completed, the reaction solution was cooled to 25°C and then evaporated to dryness under reduced pressure. A white solid crude product was obtained. A small amount of water was added to the crude product to form a slurry, which was then filtered and dried, and compound 2 (4.8 g, yield 85.9%) was obtained as a white solid. ESI-MS (m / z) = 260.2 [M+H]+. (2.1.2) Synthesis of compound 3

[0215] Compound 2 (4.8 g) prepared according to step (2.1.1) was dissolved in 25 mL of 1,4-dioxane. A solution of hydrochloric acid in 1,4-dioxane (25 mL, 4 M) was added, and the mixture was stirred and reacted at 25°C for 2 h. After the reaction was completed, the reaction solution was evaporated to dryness under reduced pressure and compound 3 (3.6 g, yield 99.4%) was obtained as a white solid. (2.1.3) Synthesis of compound 11

[0216] Compound 3 (3.6 g) prepared according to step (2.1.2) was dissolved in 36 mL of DMF, and then TEA (5.62 g), compound 10 (N-benzyloxycarbonyl‑4-aminobutanoic acid, 5.28 g), and HBTU (8.43 g) were added. The mixture was stirred and reacted at 25°C for 16 h. After the reaction was completed, the reaction solution was added to 200 mL of a saturated aqueous sodium bicarbonate solution and extracted three times with 100 mL of ethyl acetate (3 × 100 mL). The organic phases were combined. The combined organic phase was first washed once with 50 mL of a saturated aqueous sodium chloride solution (1×50 mL) and then dried over anhydrous sodium sulfate. The organic phase was evaporated to dryness under reduced pressure and the residue was purified by normal-phase column chromatography (eluent: dichloromethane / methanol = 10 / 1, v / v). Compound 11 (2.3 g, yield 33.0%) was obtained as a white solid. ESI-MS (m / z) = 379.5 [M+H]+. (2.1.4) Synthesis of compound 12

[0217] Compound 11 (2.3 g) prepared in step (2.1.3) was dissolved in 23 mL of methanol. Wet palladium on carbon (230 mg, 10 % loading) was added. The atmosphere was purged with hydrogen three times, and the reaction system was stirred and reacted at 25°C for 16 h under a hydrogen atmosphere (15 psi). After the reaction was completed, the reaction mixture was filtered and a filtrate was obtained. The filtrate was evaporated to dryness under reduced pressure and compound 12 (1.48 g, yield 99.8%) was obtained as a yellow oil. (2.1.5) Synthesis of compound 13

[0218] Compound 12 (1.48 g) prepared in step (2.1.4) was dissolved in 15 mL of DMF. Triethylamine (TEA, 1.22 g), compound 4 (1.35 g), and HBTU (3.45 g) were added, and the mixture was stirred and reacted at 25°C for 16 h. After the reaction was completed, the reaction solution was added to 150 mL of a saturated aqueous sodium bicarbonate solution and extracted three times with 50 mL of ethyl acetate (3 × 50 mL). The organic phases were combined. The combined organic phase was first washed once with 30 mL of a saturated aqueous sodium chloride solution (1 × 30 mL) and then dried over anhydrous sodium sulfate. The organic phase was evaporated to dryness under reduced pressure and the residue was purified by reverse-phase column chromatography (C18 column, eluent: water / acetonitrile = 5 / 1, v / v). Compound 13 (1.3 g, yield 31.8%) was obtained as a white solid. ESI-MS (m / z): 674.3 [M+H]+. (2.1.6) Synthesis of compound 14

[0219] Compound 13 (1.1 g) prepared in step (2.1.5) was dissolved in 11 mL of pyridine. The reaction system was cooled to 0°C with an ice-water bath, and DMTrCl (813 mg) was added in portions at 0°C. The reaction system was stirred at 0°C for 1 hour. After the reaction was completed, the reaction was quenched by adding methanol to the reaction solution, the solvent was evaporated, and the residue was purified by reverse-phase column chromatography (eluent: water / acetoni- trile = 1 / 4, v / v). Compound 14 (800 mg, yield 50.3%) was obtained as a white solid. ESI-MS (m / z): 976.5 [M+H]+. (2.1.7) Synthesis of compound CR01013

[0220] At 25°C, compound 14 (550 mg) prepared according to step (2.1.6) was dissolved in 5 mL of dichloromethane (DCM). 4,5-dicyanoimidazole (DCI, 53.2 mg) and compound 7 (2-cyanoethyl N,N,N’,N’-tetraisopropylphosphorodiami- dite, 255.4 mg) were added. The atmosphere was purged with nitrogen three times, and the reaction system was stirred and reacted at 25°C for 1 hour under a nitrogen atmosphere. After the reaction was completed, the reaction solution was first washed twice with 5 mL of a saturated aqueous sodium bicarbonate solution (2× 5 mL) and then washed once with 30 65 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 mL of a saturated aqueous sodium chloride solution (1 × 30 mL). The organic phase was separated, dried over anhydrous sodium sulfate, and the solvent in the organic phase was evaporated under reduced pressure. The residue was purified by normal-phase column chromatography (eluent: dichloromethane / methanol = 20 / 1, v / v) and compound CR01013 (532 mg, yield 80.4%) was obtained as a white solid. ESI-MS (m / z): 1176.7 [M+H]+.

[0221] 1H NMR (400 MHz, DMSO-d6) δ0.95 - 1.05 (d, J = 6.7 Hz, 5H), 1.06 - 1.15 (q, J = 7.6 Hz, 8H), 1.15 - 1.21 (t, J = 7.2 Hz, 14H), 1.72 - 1.80 (s, 3H), 1.84 - 1.92 (s, 3H), 1.94 - 2.07 (d, J = 16.0 Hz, 7H), 2.07 - 2.14 (s, 3H), 2.64 - 2.72 (q, J = 5.8 Hz, 2H), 2.74 - 2.89 (d, J = 8.5 Hz, 2H), 3.35 - 3.56 (m, 4H), 3.57 - 3.70 (m, 4H), 3.71 - 3.77 (s, 6H), 3.81 - 3.93 (m, 1H), 3.96 - 4.09 (d, J = 6.4 Hz, 3H), 6.82 - 6.97 (d, J = 8.7 Hz, 4H), 7.17 - 7.27 (t, J = 8.7 Hz, 5H), 7.27 - 7.34 (t, J = 7.6 Hz, 2H), 7.34 - 7.43 (d, J = 7.5 Hz, 2H). (2.2) Preparation of Compound CR01013Z

[0222] In this preparation example, the synthetic route for compound CR01013Z was: (2.2.1) Synthesis of compound 15

[0223] At 25°C, compound 14 (100 mg, 0.10 mmol) prepared according to step (2.1.6) was dissolved in 2 mL of dichloromethane. Triethylamine (25.9 mg, 0.25 mmol), DMAP (1.25 mg, 0.01 mmol), and compound 8 (succinic anhydride, 15.4 mg, 0.15 mmol) were added. The reaction system was stirred at 25°C for 16 h. After the reaction was completed, the solvent in the reaction solution was evaporated, and the residue was purified by reverse-phase column chromatography (C18 column, eluent: water / acetonitrile = 2 / 1, v / v). Compound 15 (110 mg, 0.10 mmol, yield 100%) was obtained as a yellow oil. ESI-MS (m / z) = 1099.3 [M+Na]+. (2.2.2) Synthesis of compound CR01013Z

[0224] Compound 15 (50 mg, 0.04 mmol) prepared according to step (2.2.1) was dissolved in 10 mL of acetonitrile. HBTU (24.2 mg, 0.06 mmol), DIEA (11.0 mg, 0.08 mmol), and amino-CPG (1.06 g, loading capacity 80 µmol / g) were added. The reaction system was stirred and reacted at 25°C for 16 h. After the reaction was completed, the reaction mixture was filtered to obtain a filter cake. The filter cake was first washed sequentially twice with 50 mL of dichloromethane (2 × 50 mL), three times with 50 mL of acetonitrile (3 × 50 mL), and once with 50 mL of ethyl acetate (1 × 50 mL), and then dried under vacuum. To the dried filter cake were added Cap1 (4.8 mL), Cap2 (0.54 mL), and DMAP (2.59 mg). The reaction system was stirred and reacted at 25°C for 5 h. After the reaction was completed, the reaction mixture was filtered and a filter cake was obtained. The filter cake was washed three times with 50 mL of acetonitrile (3 × 50 mL) and dried under vacuum. Compound CR01013Z (900 mg, with a loading capacity of 20 to 30 µmol / g) was obtained.

[0225] Wherein Cap1 and Cap2 are capping reagents, Cap1 is a 20 vol% solution of N-methylimidazole in a mixed solution of pyridine / acetonitrile with a volume ratio of pyridine to acetonitrile of 3:5; and Cap2 is a 20 vol% solution of acetic anhydride in acetonitrile. Preparation of siRNA / siRNA Conjugates Preparation Example 3: Preparation of siRNA (3.1) Synthesis of sense strand (SS)

[0226] Using the phosphoramidite solid-phase nucleic acid synthesis method, nucleoside monomers were linked 66 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 sequentially in a 3’ to 5’ direction. Each cycle of nucleoside monomer addition included four reaction steps: deprotection, coupling, capping, and oxidation or sulfurization. The synthesis conditions were as follows.

[0227] The nucleoside monomers were prepared as 0.1 M solutions of the nucleoside monomer in acetonitrile.

[0228] The conditions for the deprotection reaction were the same for each step. The conditions for the deprotection reaction were: a temperature of 25°C, a reaction time of 70 s, and the deprotection reagent was a 3 vol% solution of dichloroacetic acid in dichloromethane, wherein the molar ratio of dichloroacetic acid to the 4,4’-dimethoxytrityl protecting group on the solid-phase support was 5:1.

[0229] The conditions for the coupling reaction were the same for each step. The conditions for the coupling reaction were: a temperature of 25°C, a molar ratio of the nucleic acid sequence linked on the solid-phase support to the nucleoside monomer of 1:10, a molar ratio of the nucleic acid sequence linked on the solid-phase support to the coupling reagent of 1:65, a reaction time of 600 s, the coupling reagent was a 0.5 M solution of 5-ethylthio‑1H-tetrazole in acetonitrile, and the thiolation reagent was a 0.2 M solution of xanthane hydride in a mixed solution of acetonitrile / pyridine (the volume ratio of acetonitrile to pyridine was 1:1).

[0230] The conditions for the capping reaction were the same for each step. The conditions for the capping reaction were: a temperature of 25°C; a reaction time of 2 min; the capping reagent solution was a mixed solution of Cap1 and Cap2 in a molar ratio of 1:1, where Cap1 was a 20 vol% solution of N-methylimidazole in a mixed solution of pyridine / acetonitrile with a volume ratio of pyridine to acetonitrile of 3:5, and Cap2 was a 20 vol% solution of acetic anhydride in acetonitrile; the molar ratio of N-methylimidazole in the Cap1 capping reagent, acetic anhydride in the Cap2 capping reagent, and the nucleic acid sequence linked on the solid-phase support was 1:1:1.

[0231] The conditions for the oxidation reaction were the same for each step. The conditions for the oxidation reaction were: a temperature of 25°C; a reaction time of 3 s; the oxidizing reagent was a 0.05 M aqueous iodine solution, with a molar ratio of iodine to the nucleic acid sequence linked on the solid-phase support of 30:1; and the oxidation reaction was performed in a mixed solvent of water / pyridine (the volume ratio of water to pyridine was 1:9). The conditions for the sulfurization reaction were: a temperature of 25°C; a reaction time of 360 s; the thiolation reagent was a 0.2 M solution of xanthane hydride in pyridine, with a molar ratio of the thiolation reagent to the nucleic acid sequence linked on the solid- phase support of 4:1; and the sulfurization reaction was performed in a mixed solvent of water / pyridine (the volume ratio of water to pyridine was 1:9).

[0232] After the last nucleoside monomer was linked, the nucleic acid moleculars linked on the solid-phase support was subjected to cleavage, deprotection, purification, desalting, and lyophilization sequentially, and the sense strands were obtained.

[0233] Cleavage and deprotection conditions were as follows: the synthesized nucleotide molecular linked to the solid- phase support was added to a 25 % aqueous ammonia solution, with the amount of aqueous ammonia being 0.5 mL / µmol, and the mixture was reacted at 55°C for 16 h. The solvent was removed, and the residue was concentrated to dryness under vacuum. After the aqueous ammonia treatment, the product was dissolved using 0.4 mL of N-methylpyrrolidone per µmol of the single-stranded nucleic acid, and 0.3 mL of triethylamine per µmol and 0.6 mL of triethylamine trihydrofluoride per µmol were added to remove the 2’-O-TBDMS protecting group on the ribose.

[0234] Purification and desalting conditions: Purification of the nucleic acid was accomplished by NaCl gradient elution using a preparative ion-exchange chromatography column (Source 15Q). Specifically: Eluent 1 was 20 mM sodium phosphate (pH=8.1) in a mixed solvent of water / acetonitrile (volume ratio of water to acetonitrile was 9:1); Eluent 2 was 1.5 M sodium chloride, 20 mM sodium phosphate (pH=8.1), in a mixed solvent of water / acetonitrile (volume ratio of water to acetonitrile was 9:1); and the elution gradient was from Eluent 1:Eluent 2 = (100:0) to (50:50). The product elution fractions were collected and combined, and desalting was performed using a reverse-phase chromatography column. The desalting conditions included desalting using a dextran gel column, with the packing material being dextran gel G25, and eluting with deionized water.

[0235] Detection: Purity was detected using ion-exchange chromatography (IEX-HPLC); molecular weight was detected using liquid chromatography-mass spectrometry (LC-MS). The measured value of the molecular weight was compared with the theoretical value. If the measured value and the theoretical value were consistent, it indicated that the sense strand of the siRNA was obtained. (3.2) Synthesis of antisense strand (AS)

[0236] A universal solid-phase support was used to synthesize the antisense strand. The conditions for deprotection, coupling, capping, and oxidation or sulfurization reactions, the conditions for cleavage and deprotection, and the processes and conditions for purification and desalting in the solid-phase synthesis method of the antisense strand were the same as those for the synthesis of the sense strand in step (3.1).

[0237] Detection: Purity was detected using ion-exchange chromatography (IEX-HPLC); molecular weight was detected using liquid chromatography-mass spectrometry (LC-MS). The measured value of the molecular weight was compared with the theoretical value. If the measured value and the theoretical value were consistent, it indicated that the 67 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 antisense strand of the siRNA was obtained. (3.3) Synthesis of siRNA duplex

[0238] The sense strand synthesized in step (3.1) and the antisense strand synthesized in step (3.2) were mixed in an equimolar ratio, dissolved in water for injection, and heated to 95°C. The mixture was slowly cooled to room temperature and held at room temperature for 10 min. The sense and antisense strands were allowed to form a double-stranded structure through hydrogen bonds, and siRNAs having the sense and antisense strands shown in Tables 4 to 7 were obtained. Table 4: Sequence Information of siRNAs siRNA No. sense strand (5’‑3’) antisense strand (5’‑3’) RN002001 GUCCACGACUUCCCAGGCA SEQ ID NO: 1 UGCCUGGGAAGUCGUGGACAG SEQ ID NO: 213 RN002002 CCACGACUUCCCAGGCAAA SEQ ID NO: 2 UUUGCCUGGGAAGUCGUGGAC SEQ ID NO: 214 RN002003 CACGACUUCCCAGGCAAAA SEQ ID NO: 3 UUUUGCCUGGGAAGUCGUGGA SEQ ID NO: 215 RN002004 GUGCUGUCCAGUGAGAAGA SEQ ID NO: 4 UCUUCUCACUGGACAGCACUA SEQ ID NO: 216 RN002005 GCUGUCCAGUGAGAAGACU SEQ ID NO: 5 AGUCUUCUCACUGGACAGCAC SEQ ID NO: 217 RN002006 CAGAGCGGGUACCUCUUCA SEQ ID NO: 6 UGAAGAGGUACCCGCUCUGCA SEQ ID NO: 218 RN002007 GCGGGUACCUCUUCAUCCA SEQ ID NO: 7 UGGAUGAAGAGGUACCCGCUC SEQ ID NO: 219 RN002008 CAGACAGACAAGACCAUCU SEQ ID NO: 8 AGAUGGUCUUGUCUGUCUGGA SEQ ID NO: 220 RN002009 GGAUCUUCACCGUCAACCA SEQ ID NO: 9 UGGUUGACGGUGAAGAUCCGA SEQ ID NO: 221 RN002010 CCGUCAACCACAAGCUGCU SEQ ID NO: 10 AGCAGCUUGUGGUUGACGGUG SEQ ID NO: 222 RN002011 CGUCAACCACAAGCUGCUA SEQ ID NO: 11 UAGCAGCUUGUGGUUGACGGU SEQ ID NO: 223 RN002012 CGGUCAAGCAGGACUCCUU SEQ ID NO: 12 AAGGAGUCCUGCUUGACCGGG SEQ ID NO: 224 RN002013 GUCAAGCAGGACUCCUUGU SEQ ID NO: 13 ACAAGGAGUCCUGCUUGACCG SEQ ID NO: 225 RN002014 CAAGCAGGACUCCUUGUCU SEQ ID NO: 14 AGACAAGGAGUCCUGCUUGAC SEQ ID NO: 226 RN002015 CUUGGGACAUUCCGGAACU SEQ ID NO: 15 AGUUCCGGAAUGUCCCAAGAC SEQ ID NO: 227 RN002016 GGGACAUUCCGGAACUCGU SEQ ID NO: 16 ACGAGUUCCGGAAUGUCCCAA SEQ ID NO: 228 RN002017 CAGUGGAAGAUCCGAGCCU SEQ ID NO: 17 AGGCUCGGAUCUUCCACUGGC SEQ ID NO: 229 RN002018 AGUGGAAGAUCCGAGCCUA SEQ ID NO: 18 UAGGCUCGGAUCUUCCACUGG SEQ ID NO: 230 RN002019 GGAAGAUCCGAGCCUACUA SEQ ID NO: 19 UAGUAGGCUCGGAUCUUCCAC SEQ ID NO: 231 68 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) siRNA No. sense strand (5’‑3’) antisense strand (5’‑3’) RN002020 GAAGAUCCGAGCCUACUAU SEQ ID NO: 20 AUAGUAGGCUCGGAUCUUCCA SEQ ID NO: 232 RN002021 GAUCCGAGCCUACUAUGAA SEQ ID NO: 21 UUCAUAGUAGGCUCGGAUCUU SEQ ID NO: 233 RN002022 AGUUUGAGGUGAAGGAGUA SEQ ID NO: 22 UACUCCUUCACCUCAAACUCA SEQID No.234 RN002023 GCCCAGUUUCGAGGUCAUA SEQ ID NO: 23 UAUGACCUCGAAACUGGGCAG SEQ ID NO: 235 RN002024 CCAGUUUCGAGGUCAUAGU SEQ ID NO: 24 ACUAUGACCUCGAAACUGGGC SEQ ID NO: 236 RN002025 CAGUUUCGAGGUCAUAGUG SEQ ID NO: 25 CACUAUGACCUCGAAACUGGG SEQ ID NO: 237 RN002026 GUUUCGAGGUCAUAGUGGA SEQ ID NO: 26 UCCACUAUGACCUCGAAACUG SEQ ID NO: 238 RN002027 CGAGGUCAUAGUGGAGCCU SEQ ID NO: 27 AGGCUCCACUAUGACCUCGAA SEQ ID NO: 239 RN002028 AGUGGAGCCUACAGAGAAA SEQ ID NO: 28 UUUCUCUGUAGGCUCCACUAU SEQ ID NO: 240 RN002029 CAGAGAAAUUCUACUACAU SEQ ID NO: 29 AUGUAGUAGAAUUUCUCUGUA SEQ ID NO: 241 RN002030 AAAUUCUACUACAUCUAUA SEQ ID NO: 30 UAUAGAUGUAGUAGAAUUUCU SEQ ID NO: 242 RN002031 GGAACUGCCUUUGUCAUCU SEQ ID NO: 31 AGAUGACAAAGGCAGUUCCCU SEQ ID NO: 243 RN002032 GAACUGCCUUUGUCAUCUU SEQ ID NO: 32 AAGAUGACAAAGGCAGUUCCC SEQ ID NO: 244 RN002033 CCUUUGUCAUCUUCGGGAU SEQ ID NO: 33 AUCCCGAAGAUGACAAAGGCA SEQ ID NO: 245 RN002034 CUGAAUCCCUCAAGCGCAU SEQ ID NO: 34 AUGCGCUUGAGGGAUUCAGGC SEQ ID NO: 246 RN002035 CAGGCAGUGACAUGGUGCA SEQ ID NO: 35 UGCACCAUGUCACUGCCUGAG SEQ ID NO: 247 RN002036 GUGACCUCUCCCUACCAGA SEQ ID NO: 36 UCUGGUAGGGAGAGGUCACGA SEQ ID NO: 248 RN002037 GAAUGCCCUUUGACCUCAU SEQ ID NO: 37 AUGAGGUCAAAGGGCAUUCCU SEQ ID NO: 249 RN002038 CCUUUGACCUCAUGGUGUU SEQ ID NO: 38 AACACCAUGAGGUCAAAGGGC SEQ ID NO: 250 RN002039 GACCUCAUGGUGUUCGUGA SEQ ID NO: 39 UCACGAACACCAUGAGGUCAA SEQ ID NO: 251 RN002040 CUCAUGGUGUUCGUGACGA SEQ ID NO: 40 UCGUCACGAACACCAUGAGGU SEQ ID NO: 252 RN002041 UCAUGGUGUUCGUGACGAA SEQ ID NO: 41 UUCGUCACGAACACCAUGAGG SEQ ID NO: 253 RN002042 CUGUGCAGUCUCUAACCCA SEQ ID NO: 42 UGGGUUAGAGACUGCACAGUG SEQ ID NO: 254 69 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) siRNA No. sense strand (5’‑3’) antisense strand (5’‑3’) RN002043 GCCAGAAGCCCUUGAGCAU SEQ ID NO: 43 AUGCUCAAGGGCUUCUGGCUG SEQ ID NO: 255 RN002044 CAGAAGCCCUUGAGCAUCA SEQ ID NO: 44 UGAUGCUCAAGGGCUUCUGGC SEQ ID NO: 256 RN002045 GCAUCACGGUGCGCACGAA SEQ ID NO: 45 UUCGUGCGCACCGUGAUGCUC SEQ ID NO: 257 RN002046 CGGUGCGCACGAAGAAGCA SEQ ID NO: 46 UGCUUCUUCGUGCGCACCGUG SEQ ID NO: 258 RN002047 CCGUGGGCAACUCCAACAA SEQ ID NO: 47 UUGUUGGAGUUGCCCACGGUG SEQ ID NO: 259 RN002048 CGUGGGCAACUCCAACAAU SEQ ID NO: 48 AUUGUUGGAGUUGCCCACGGU SEQ ID NO: 260 RN002049 GUGGGCAACUCCAACAAUU SEQ ID NO: 49 AAUUGUUGGAGUUGCCCACGG SEQ ID NO: 261 RN002050 GCAACUCCAACAAUUACCU SEQ ID NO: 50 AGGUAAUUGUUGGAGUUGCCC SEQ ID NO: 262 RN002051 CUCCAACAAUUACCUGCAU SEQ ID NO: 51 AUGCAGGUAAUUGUUGGAGUU SEQ ID NO: 263 RN002052 GGGGAGACCCUCAACGUCA SEQ ID NO: 52 UGACGUUGAGGGUCUCCCCGG SEQ ID NO: 264 RN002053 GGGAGACCCUCAACGUCAA SEQ ID NO: 53 UUGACGUUGAGGGUCUCCCCG SEQ ID NO: 265 RN002054 GAGACCCUCAACGUCAACU SEQ ID NO: 54 AGUUGACGUUGAGGGUCUCCC SEQ ID NO: 266 RN002055 CCCUCAACGUCAACUUCCU SEQ ID NO: 55 AGGAAGUUGACGUUGAGGGUC SEQ ID NO: 267 RN002056 UCAACUUCCUCCUGCGAAU SEQ ID NO: 56 AUUCGCAGGAGGAAGUUGACG SEQ ID NO: 268 RN002057 GAGGCCAAGAUCCGCUACU SEQ ID NO: 57 AGUAGCGGAUCUUGGCCUCGU SEQ ID NO: 269 RN002058 AGAUCCGCUACUACACCUA SEQ ID NO: 58 UAGGUGUAGUAGCGGAUCUUG SEQ ID NO: 270 RN002059 CGCUACUACACCUACCUGA SEQ ID NO: 59 UCAGGUAGGUGUAGUAGCGGA SEQ ID NO: 271 RN002060 GCUACUACACCUACCUGAU SEQ ID NO: 60 AUCAGGUAGGUGUAGUAGCGG SEQ ID NO: 272 RN002061 CCGUGUGGGUGGACGUCAA SEQ ID NO: 61 UUGACGUCCACCCACACGGAG SEQ ID NO: 273 RN002062 GGGCUCGCUGGUGGUAAAA SEQ ID NO: 62 UUUUACCACCAGCGAGCCCAC SEQ ID NO: 274 RN002063 CCCUGAAGAUAGAGGGUGA SEQ ID NO: 63 UCACCCUCUAUCUUCAGGGUC SEQ ID NO: 275 RN002064 CGGGAGAACCCCAUGAGGU SEQ ID NO: 64 ACCUCAUGGGGUUCUCCCGCA SEQ ID NO: 276 RN002065 GGGAGAACCCCAUGAGGUU SEQ ID NO: 65 AACCUCAUGGGGUUCUCCCGC SEQ ID NO: 277 70 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) siRNA No. sense strand (5’‑3’) antisense strand (5’‑3’) RN002066 GAGAACCCCAUGAGGUUCU SEQ ID NO: 66 AGAACCUCAUGGGGUUCUCCC SEQ ID NO: 278 RN002067 CUGCUGCAACUACAUCACA SEQ ID NO: 67 UGUGAUGUAGUUGCAGCAGUC SEQ ID NO: 279 RN002068 GGAGUAACCUGGAUGAGGA SEQ ID NO: 68 UCCUCAUCCAGGUUACUCCUG SEQ ID NO: 280 RN002069 GUAACCUGGAUGAGGACAU SEQ ID NO: 69 AUGUCCUCAUCCAGGUUACUC SEQ ID NO: 281 RN002070 GCAGAAGAGAACAUCGUUU SEQ ID NO: 70 AAACGAUGUUCUCUUCUGCAA SEQ ID NO: 282 RN002071 GAGAACAUCGUUUCCCGAA SEQ ID NO: 71 UUCGGGAAACGAUGUUCUCUU SEQ ID NO: 283 RN002072 CCCGAAGUGAGUUCCCAGA SEQ ID NO: 72 UCUGGGAACUCACUUCGGGAA SEQ ID NO: 284 RN002073 CGAAGCUCAUGAAUAUAUU SEQ ID NO: 73 AAUAUAUUCAUGAGCUUCGUA SEQ ID NO: 285 RN002074 GAAGCUCAUGAAUAUAUUU SEQ ID NO: 74 AAAUAUAUUCAUGAGCUUCGU SEQ ID NO: 286 RN002075 CCCUUCGAGGUCACAGUAA SEQ ID NO: 75 UUACUGUGACCUCGAAGGGGU SEQ ID NO: 287 RN002076 CCUUCGAGGUCACAGUAAU SEQ ID NO: 76 AUUACUGUGACCUCGAAGGGG SEQ ID NO: 288 RN002077 UCACAGUAAUGCAGGACUU SEQ ID NO: 77 AAGUCCUGCAUUACUGUGACC SEQ ID NO: 289 RN002078 CCUGCGGCUACCCUACUCU SEQ ID NO: 78 AGAGUAGGGUAGCCGCAGGUC SEQ ID NO: 290 RN002079 GCGGCUACCCUACUCUGUU SEQ ID NO: 79 AACAGAGUAGGGUAGCCGCAG SEQ ID NO: 291 RN002080 GGCUACCCUACUCUGUUGU SEQ ID NO: 80 ACAACAGAGUAGGGUAGCCGC SEQ ID NO: 292 RN002081 GCUACCCUACUCUGUUGUU SEQ ID NO: 81 AACAACAGAGUAGGGUAGCCG SEQ ID NO: 293 RN002082 ACCCUACUCUGUUGUUCGA SEQ ID NO: 82 UCGAACAACAGAGUAGGGUAG SEQ ID NO: 294 RN002083 CCCUACUCUGUUGUUCGAA SEQ ID NO: 83 UUCGAACAACAGAGUAGGGUA SEQ ID NO: 295 RN002084 CCUACUCUGUUGUUCGAAA SEQ ID NO: 84 UUUCGAACAACAGAGUAGGGU SEQ ID NO: 296 RN002085 CGAAACGAGCAGGUGGAAA SEQ ID NO: 85 UUUCCACCUGCUCGUUUCGAA SEQ ID NO: 297 RN002086 GAAACGAGCAGGUGGAAAU SEQ ID NO: 86 AUUUCCACCUGCUCGUUUCGA SEQ ID NO: 298 RN002087 CGAGCAGGUGGAAAUCCGA SEQ ID NO: 87 UCGGAUUUCCACCUGCUCGUU SEQ ID NO: 299 RN002088 CAAUUACCGGCAGAACCAA SEQ ID NO: 88 UUGGUUCUGCCGGUAAUUGUA SEQ ID NO: 300 71 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) siRNA No. sense strand (5’‑3’) antisense strand (5’‑3’) RN002089 GGGUGGAACUACUCCACAA SEQ ID NO: 89 UUGUGGAGUAGUUCCACCCUC SEQ ID NO: 301 RN002090 GGUGGAACUACUCCACAAU SEQ ID NO: 90 AUUGUGGAGUAGUUCCACCCU SEQ ID NO: 302 RN002091 GGAACUACUCCACAAUCCA SEQ ID NO: 91 UGGAUUGUGGAGUAGUUCCAC SEQ ID NO: 303 RN002092 CGUCACCAGCAGACCGUAA SEQ ID NO: 92 UUACGGUCUGCUGGUGACGCC SEQ ID NO: 304 RN002093 CACCAGCAGACCGUAACCA SEQ ID NO: 93 UGGUUACGGUCUGCUGGUGAC SEQ ID NO: 305 RN002094 GGAAGUCCCUGAAGGUCGU SEQ ID NO: 94 ACGACCUUCAGGGACUUCCUG SEQ ID NO: 306 RN002095 GUCGUGCCGGAAGGAAUCA SEQ ID NO: 95 UGAUUCCUUCCGGCACGACCU SEQ ID NO: 307 RN002096 CGUGCCGGAAGGAAUCAGA SEQ ID NO: 96 UCUGAUUCCUUCCGGCACGAC SEQ ID NO: 308 RN002097 GUGCCGGAAGGAAUCAGAA SEQ ID NO: 97 UUCUGAUUCCUUCCGGCACGA SEQ ID NO: 309 RN002098 CCGGAAGGAAUCAGAAUGA SEQ ID NO: 98 UCAUUCUGAUUCCUUCCGGCA SEQ ID NO: 310 RN002099 CGGAAGGAAUCAGAAUGAA SEQ ID NO: 99 UUCAUUCUGAUUCCUUCCGGC SEQ ID NO: 311 RN002100 UGCAGACCUCAGUGACCAA SEQ ID NO: 100 UUGGUCACUGAGGUCUGCAGG SEQ ID NO: 312 RN002101 GACCAGAAUUCUCCUGCAA SEQ ID NO: 101 UUGCAGGAGAAUUCUGGUCUC SEQ ID NO: 313 RN002102 GAACGGCUGAAGCACCUCA SEQ ID NO: 102 UGAGGUGCUUCAGCCGUUCCG SEQ ID NO: 314 RN002103 CGCUGUGCAUUACCUGGAU SEQ ID NO: 103 AUCCAGGUAAUGCACAGCGAU SEQ ID NO: 315 RN002104 GCAUUACCUGGAUGAAACG SEQ ID NO: 104 CGUUUCAUCCAGGUAAUGCAC SEQ ID NO: 316 RN002105 CCUUGGAGCUCAUCAAGAA SEQ ID NO: 105 UUCUUGAUGAGCUCCAAGGCC SEQ ID NO: 317 RN002106 GCAGCUGGCCUUCAGACAA SEQ ID NO: 106 UUGUCUGAAGGCCAGCUGCUG SEQ ID NO: 318 RN002107 CCGCCUACGUGGUCAAGGU SEQ ID NO: 107 ACCUUGACCACGUAGGCGGUC SEQ ID NO: 319 RN002108 CCUACGUGGUCAAGGUCUU SEQ ID NO: 108 AAGACCUUGACCACGUAGGCG SEQ ID NO: 320 RN002109 CGUGGUCAAGGUCUUCUCU SEQ ID NO: 109 AGAGAAGACCUUGACCACGUA SEQ ID NO: 321 RN002110 CUCUGGCUGUCAACCUCAU SEQ ID NO: 110 AUGAGGUUGACAGCCAGAGAG SEQ ID NO: 322 RN002111 CUCUGCGGGGCUGUUAAAU SEQ ID NO: 111 AUUUAACAGCCCCGCAGAGGA SEQ ID NO: 323 72 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) siRNA No. sense strand (5’‑3’) antisense strand (5’‑3’) RN002112 CUGUUAAAUGGCUGAUCCU SEQ ID NO: 112 AGGAUCAGCCAUUUAACAGCC SEQ ID NO: 324 RN002113 GGAGGAUGCGCCCGUGAUA SEQ ID NO: 113 UAUCACGGGCGCAUCCUCCUG SEQ ID NO: 325 RN002114 GGCCCUCACGGCCUUUGUU SEQ ID NO: 114 AACAAAGGCCGUGAGGGCCAU SEQ ID NO: 326 RN002115 CUCACGGCCUUUGUUCUCA SEQ ID NO: 115 UGAGAACAAAGGCCGUGAGGG SEQ ID NO: 327 RN002116 CCUUUGUUCUCAUCUCGCU SEQ ID NO: 116 AGCGAGAUGAGAACAAAGGCC SEQ ID NO: 328 RN002117 CUUGAAGCCAACUACAUGA SEQ ID NO: 117 UCAUGUAGUUGGCUUCAAGGA SEQ ID NO: 329 RN002118 CCAACUACAUGAACCUACA SEQ ID NO: 118 UGUAGGUUCAUGUAGUUGGCU SEQ ID NO: 330 RN002119 CCUACAGAGAUCCUACACU SEQ ID NO: 119 AGUGUAGGAUCUCUGUAGGUU SEQ ID NO: 331 RN002120 CUGACCACAGCCAAAGAUA SEQ ID NO: 120 UAUCUUUGGCUGUGGUCAGAA SEQ ID NO: 332 RN002121 CCACAGCCAAAGAUAAGAA SEQ ID NO: 121 UUCUUAUCUUUGGCUGUGGUC SEQ ID NO: 333 RN002122 GCCAAAGAUAAGAACCGCU SEQ ID NO: 122 AGCGGUUCUUAUCUUUGGCUG SEQ ID NO: 334 RN002123 GCCACAUCCUAUGCCCUCU SEQ ID NO: 123 AGAGGGCAUAGGAUGUGGCCU SEQ ID NO: 335 RN002124 CCACAUCCUAUGCCCUCUU SEQ ID NO: 124 AAGAGGGCAUAGGAUGUGGCC SEQ ID NO: 336 RN002125 GGCCCUACUGCAGCUAAAA SEQ ID NO: 125 UUUUAGCUGCAGUAGGGCCAA SEQ ID NO: 337 RN002126 CUACUGCAGCUAAAAGACU SEQ ID NO: 126 AGUCUUUUAGCUGCAGUAGGG SEQ ID NO: 338 RN002127 CAGCUAAAAGACUUUGACU SEQ ID NO: 127 AGUCAAAGUCUUUUAGCUGCA SEQ ID NO: 339 RN002128 GCUAAAAGACUUUGACUUU SEQ ID NO: 128 AAAGUCAAAGUCUUUUAGCUG SEQ ID NO: 340 RN002129 CCGUCGUGCGUUGGCUCAA SEQ ID NO: 129 UUGAGCCAACGCACGACGGGA SEQ ID NO: 341 RN002130 CGUCGUGCGUUGGCUCAAU SEQ ID NO: 130 AUUGAGCCAACGCACGACGGG SEQ ID NO: 342 RN002131 CGUGCGUUGGCUCAAUGAA SEQ ID NO: 131 UUCAUUGAGCCAACGCACGAC SEQ ID NO: 343 RN002132 CGUUGGCUCAAUGAACAGA SEQ ID NO: 132 UCUGUUCAUUGAGCCAACGCA SEQ ID NO: 344 RN002133 GGCUCAAUGAACAGAGAUA SEQ ID NO: 133 UAUCUCUGUUCAUUGAGCCAA SEQ ID NO: 345 RN002134 CUCAAUGAACAGAGAUACU SEQ ID NO: 134 AGUAUCUCUGUUCAUUGAGCC SEQ ID NO: 346 73 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) siRNA No. sense strand (5’‑3’) antisense strand (5’‑3’) RN002135 CCACCUUCAUGGUGUUCCA SEQ ID NO: 135 UGGAACACCAUGAAGGUGGCC SEQ ID NO: 347 RN002136 CACCUUCAUGGUGUUCCAA SEQ ID NO: 136 UUGGAACACCAUGAAGGUGGC SEQ ID NO: 348 RN002137 GGUGUUCCAAGCCUUGGCU SEQ ID NO: 137 AGCCAAGGCUUGGAACACCAU SEQ ID NO: 349 RN002138 CCGUAUCCACUGGGAAUCU SEQ ID NO: 138 AGAUUCCCAGUGGAUACGGUG SEQ ID NO: 350 RN002139 GCCUCCUGCGAUCAGAAGA SEQ ID NO: 139 UCUUCUGAUCGCAGGAGGCUG SEQ ID NO: 351 RN002140 UGCGAUCAGAAGAGACCAA SEQ ID NO: 140 UUGGUCUCUUCUGAUCGCAGG SEQ ID NO: 352 RN002141 GAUCAGAAGAGACCAAGGA SEQ ID NO: 141 UCCUUGGUCUCUUCUGAUCGC SEQ ID NO: 353 RN002142 GUUUCACAGUCACAGCUGA SEQ ID NO: 142 UCAGCUGUGACUGUGAAACCC SEQ ID NO: 354 RN002143 UGACAAUGUACCAUGCUAA SEQ ID NO: 143 UUAGCAUGGUACAUUGUCACC SEQ ID NO: 355 RN002144 GUACCAUGCUAAGGCCAAA SEQ ID NO: 144 UUUGGCCUUAGCAUGGUACAU SEQ ID NO: 356 RN002145 CAACUCACCUGUAAUAAAU SEQ ID NO: 145 AUUUAUUACAGGUGAGUUGAU SEQ ID NO: 357 RN002146 CCUGUAAUAAAUUCGACCU SEQ ID NO: 146 AGGUCGAAUUUAUUACAGGUG SEQ ID NO: 358 RN002147 GUAAUAAAUUCGACCUCAA SEQ ID NO: 147 UUGAGGUCGAAUUUAUUACAG SEQ ID NO: 359 RN002148 CGACCUCAAGGUCACCAUA SEQ ID NO: 148 UAUGGUGACCUUGAGGUCGAA SEQ ID NO: 360 RN002149 GACCUCAAGGUCACCAUAA SEQ ID NO: 149 UUAUGGUGACCUUGAGGUCGA SEQ ID NO: 361 RN002150 CAAGGUCACCAUAAAACCA SEQ ID NO: 150 UGGUUUUAUGGUGACCUUGAG SEQ ID NO: 362 RN002151 CCAGCACCGGAAACAGAAA SEQ ID NO: 151 UUUCUGUUUCCGGUGCUGGUU SEQ ID NO: 363 RN002152 GCACCGGAAACAGAAAAGA SEQ ID NO: 152 UCUUUUCUGUUUCCGGUGCUG SEQ ID NO: 364 RN002153 GGCCUCAGGAUGCCAAGAA SEQ ID NO: 153 UUCUUGGCAUCCUGAGGCCUC SEQ ID NO: 365 RN002154 CAGGAUGCCAAGAACACUA SEQ ID NO: 154 UAGUGUUCUUGGCAUCCUGAG SEQ ID NO: 366 RN002155 GAUGCCAAGAACACUAUGA SEQ ID NO: 155 UCAUAGUGUUCUUGGCAUCCU SEQ ID NO: 367 RN002156 CCAAGAACACUAUGAUCCU SEQ ID NO: 156 AGGAUCAUAGUGUUCUUGGCA SEQ ID NO: 368 RN002157 AGAACACUAUGAUCCUUGA SEQ ID NO: 157 UCAAGGAUCAUAGUGUUCUUG SEQ ID NO: 369 74 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) siRNA No. sense strand (5’‑3’) antisense strand (5’‑3’) RN002158 GAGACCAGGAUGCCACUAU SEQ ID NO: 158 AUAGUGGCAUCCUGGUCUCCC SEQ ID NO: 370 RN002159 CCAGGAUGCCACUAUGUCU SEQ ID NO: 159 AGACAUAGUGGCAUCCUGGUC SEQ ID NO: 371 RN002160 CAGGAUGCCACUAUGUCUA SEQ ID NO: 160 UAGACAUAGUGGCAUCCUGGU SEQ ID NO: 372 RN002161 GGAUGCCACUAUGUCUAUA SEQ ID NO: 161 UAUAGACAUAGUGGCAUCCUG SEQ ID NO: 373 RN002162 GAUGCCACUAUGUCUAUAU SEQ ID NO: 162 AUAUAGACAUAGUGGCAUCCU SEQ ID NO: 374 RN002163 GUUGACAGAUACAUCUCCA SEQ ID NO: 163 UGGAGAUGUAUCUGUCAACAC SEQ ID NO: 375 RN002164 GACAGAUACAUCUCCAAGU SEQ ID NO: 164 ACUUGGAGAUGUAUCUGUCAA SEQ ID NO: 376 RN002165 CAGAUACAUCUCCAAGUAU SEQ ID NO: 165 AUACUUGGAGAUGUAUCUGUC SEQ ID NO: 377 RN002166 AGAUACAUCUCCAAGUAUG SEQ ID NO: 166 CAUACUUGGAGAUGUAUCUGU SEQ ID NO: 378 RN002167 GAUACAUCUCCAAGUAUGA SEQ ID NO: 167 UCAUACUUGGAGAUGUAUCUG SEQ ID NO: 379 RN002168 CCAAGUAUGAGCUGGACAA SEQ ID NO: 168 UUGUCCAGCUCAUACUUGGAG SEQ ID NO: 380 RN002169 GGACAAAGCCUUCUCCGAU SEQ ID NO: 169 AUCGGAGAAGGCUUUGUCCAG SEQ ID NO: 381 RN002170 GACAAAGCCUUCUCCGAUA SEQ ID NO: 170 UAUCGGAGAAGGCUUUGUCCA SEQ ID NO: 382 RN002171 GCCUUCUCCGAUAGGAACA SEQ ID NO: 171 UGUUCCUAUCGGAGAAGGCUU SEQ ID NO: 383 RN002172 CCGAUAGGAACACCCUCAU SEQ ID NO: 172 AUGAGGGUGUUCCUAUCGGAG SEQ ID NO: 384 RN002173 GAUAGGAACACCCUCAUCA SEQ ID NO: 173 UGAUGAGGGUGUUCCUAUCGG SEQ ID NO: 385 RN002174 CUGGACAAGGUCUCACACU SEQ ID NO: 174 AGUGUGAGACCUUGUCCAGGU SEQ ID NO: 386 RN002175 GCUUUCAAAGUUCACCAAU SEQ ID NO: 175 AUUGGUGAACUUUGAAAGCUA SEQ ID NO: 387 RN002176 CUUUCAAAGUUCACCAAUA SEQ ID NO: 176 UAUUGGUGAACUUUGAAAGCU SEQ ID NO: 388 RN002177 CAGUCAAGGUCUACGCCUA SEQ ID NO: 177 UAGGCGUAGACCUUGACUGCU SEQ ID NO: 389 RN002178 GUCAAGGUCUACGCCUAUU SEQ ID NO: 178 AAUAGGCGUAGACCUUGACUG SEQ ID NO: 390 RN002179 AGGUCUACGCCUAUUACAA SEQ ID NO: 179 UUGUAAUAGGCGUAGACCUUG SEQ ID NO: 391 RN002180 GCUGUACCCGGUUCUACCA SEQ ID NO: 180 UGGUAGAACCGGGUACAGCUU SEQ ID NO: 392 75 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) siRNA No. sense strand (5’‑3’) antisense strand (5’‑3’) RN002181 CUGUACCCGGUUCUACCAU SEQ ID NO: 181 AUGGUAGAACCGGGUACAGCU SEQ ID NO: 393 RN002182 CCGGAAAAGGAGGAUGGAA SEQ ID NO: 182 UUCCAUCCUCCUUUUCCGGAU SEQ ID NO: 394 RN002183 CGGAAAAGGAGGAUGGAAA SEQ ID NO: 183 UUUCCAUCCUCCUUUUCCGGA SEQ ID NO: 395 RN002184 GAGGAUGGAAAGCUGAACA SEQ ID NO: 184 UGUUCAGCUUUCCAUCCUCCU SEQ ID NO: 396 RN002185 GCCGCUGUGCUGAGGAGAA SEQ ID NO: 185 UUCUCCUCAGCACAGCGGCAC SEQ ID NO: 397 RN002186 CCGCUGUGCUGAGGAGAAU SEQ ID NO: 186 AUUCUCCUCAGCACAGCGGCA SEQ ID NO: 398 RN002187 CGCUGUGCUGAGGAGAAUU SEQ ID NO: 187 AAUUCUCCUCAGCACAGCGGC SEQ ID NO: 399 RN002188 GUGCUGAGGAGAAUUGCUU SEQ ID NO: 188 AAGCAAUUCUCCUCAGCACAG SEQ ID NO: 400 RN002189 GCUGAGGAGAAUUGCUUCA SEQ ID NO: 189 UGAAGCAAUUCUCCUCAGCAC SEQ ID NO: 401 RN002190 GGAGAAUUGCUUCAUACAA SEQ ID NO: 190 UUGUAUGAAGCAAUUCUCCUC SEQ ID NO: 402 RN002191 GAGAAUUGCUUCAUACAAA SEQ ID NO: 191 UUUGUAUGAAGCAAUUCUCCU SEQ ID NO: 403 RN002192 GUGAGCCAGGAGUGGACUA SEQ ID NO: 192 UAGUCCACUCCUGGCUCACAG SEQ ID NO: 404 RN002193 CCAGGAGUGGACUAUGUGU SEQ ID NO: 193 ACACAUAGUCCACUCCUGGCU SEQ ID NO: 405 RN002194 CAGGAGUGGACUAUGUGUA SEQ ID NO: 194 UACACAUAGUCCACUCCUGGC SEQ ID NO: 406 RN002195 GGAGUGGACUAUGUGUACA SEQ ID NO: 195 UGUACACAUAGUCCACUCCUG SEQ ID NO: 407 RN002196 GAGUGGACUAUGUGUACAA SEQ ID NO: 196 UUGUACACAUAGUCCACUCCU SEQ ID NO: 408 RN002197 GUGGACUAUGUGUACAAGA SEQ ID NO: 197 UCUUGUACACAUAGUCCACUC SEQ ID NO: 409 RN002198 CCAAUGACUUUGACGAGUA SEQ ID NO: 198 UACUCGUCAAAGUCAUUGGAC SEQ ID NO: 410 RN002199 GACUUUGACGAGUACAUCA SEQ ID NO: 199 UGAUGUACUCGUCAAAGUCAU SEQ ID NO: 411 RN002200 ACUUUGACGAGUACAUCAU SEQ ID NO: 200 AUGAUGUACUCGUCAAAGUCA SEQ ID NO: 412 RN002201 GACGAGUACAUCAUGGCCA SEQ ID NO: 201 UGGCCAUGAUGUACUCGUCAA SEQ ID NO: 413 RN002202 CAUCAAGUCAGGCUCGGAU SEQ ID NO: 202 AUCCGAGCCUGACUUGAUGGU SEQ ID NO: 414 RN002203 CAGGCUCGGAUGAGGUGCA SEQ ID NO: 203 UGCACCUCAUCCGAGCCUGAC SEQ ID NO: 415 76 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) siRNA No. sense strand (5’‑3’) antisense strand (5’‑3’) RN002204 GCUCGGAUGAGGUGCAGGU SEQ ID NO: 204 ACCUGCACCUCAUCCGAGCCU SEQ ID NO: 416 RN002205 CGUUCAUCAGCCCCAUCAA SEQ ID NO: 205 UUGAUGGGGCUGAUGAACGUG SEQ ID NO: 417 RN002206 GGGGUCUCUCCUCCGAUUU SEQ ID NO: 206 AAAUCGGAGGAGAGACCCCAC SEQ ID NO: 418 RN002207 CCGAUUUCUGGGGAGAGAA SEQ ID NO: 207 UUCUCUCCCCAGAAAUCGGAG SEQ ID NO: 419 RN002208 CUCAGCUACAUCAUCGGGA SEQ ID NO: 208 UCCCGAUGAUGUAGCUGAGGU SEQ ID NO: 420 RN002209 GCUACAUCAUCGGGAAGGA SEQ ID NO: 209 UCCUUCCCGAUGAUGUAGCUG SEQ ID NO: 421 RN002210 CCGAGGAGGACGAAUGCCA SEQ ID NO: 210 UGGCAUUCGUCCUCCUCGGGC SEQ ID NO: 422 RN002211 CGAGGAGGACGAAUGCCAA SEQ ID NO: 211 UUGGCAUUCGUCCUCCUCGGG SEQ ID NO: 423 RN002212 CUUUGGGUGCCCCAACUGA SEQ ID NO: 212 UCAGUUGGGGCACCCAAAGAC SEQ ID NO: 424

[0239] The software for preparing the sequence listing requires that U be represented as T when generating RNA sequences. Therefore, the siRNA sequences of the present disclosure cannot be correctly represented in the sequence listing. All sequences are as set forth in the description. Table 5: Sequence Information of siRNAs siRNA No. sense strand (5’‑3’) antisense strand (5’‑3’) RX002 001 SEQ ID NO: 425 SEQ ID NO: 637 RX002 002 SEQ ID NO: 426 SEQ ID NO: 638 RX002 003 SEQ ID NO: 427 SEQ ID NO: 639 RX002 004 SEQ ID NO: 428 SEQ ID NO: 640 RX002 005 SEQ ID NO: 429 SEQ ID NO: 641 RX002 006 SEQ ID NO: 430 SEQ ID NO: 642 RX002 007 SEQ ID NO: 431 SEQ ID NO: 643 77 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) siRNA No. sense strand (5’‑3’) antisense strand (5’‑3’) RX002 008 SEQ ID NO: 432 SEQ ID NO: 644 RX002 009 SEQ ID NO: 433 SEQ ID NO: 645 RX002 010 SEQ ID NO: 434 SEQ ID NO: 646 RX002 011 SEQ ID NO: 435 SEQ ID NO: 647 RX002 012 SEQ ID NO: 436 SEQ ID NO: 648 RX002 013 SEQ ID NO: 437 SEQ ID NO: 649 RX002 014 SEQ ID NO: 438 SEQ ID NO: 650 RX002 015 SEQ ID NO: 439 SEQ ID NO: 651 RX002 016 SEQ ID NO: 440 SEQ ID NO: 652 RX002 017 SEQ ID NO: 441 SEQ ID NO: 653 RX002 018 SEQ ID NO: 442 SEQ ID NO: 654 RX002 019 SEQ ID NO: 443 SEQ ID NO: 655 RX002 020 SEQ ID NO: 444 SEQ ID NO: 656 RX002 021 SEQ ID NO: 445 SEQ ID NO: 657 RX002 022 SEQ ID NO: 446 SEQ ID NO: 658 RX002 023 SEQ ID NO: 447 SEQ ID NO: 659 78 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) siRNA No. sense strand (5’‑3’) antisense strand (5’‑3’) RX002 024 SEQ ID NO: 448 SEQ ID NO: 660 RX002 025 SEQ ID NO: 449 SEQ ID NO: 661 RX002 026 SEQ ID NO: 450 SEQ ID NO: 662 RX002 027 SEQ ID NO: 451 SEQ ID NO: 663 RX002 028 SEQ ID NO: 452 SEQ ID NO: 664 RX002 029 SEQ ID NO: 453 SEQ ID NO: 665 RX002 030 SEQ ID NO: 454 SEQ ID NO: 666 RX002 031 SEQ ID NO: 455 SEQ ID NO: 667 RX002 032 SEQ ID NO: 456 SEQ ID NO: 668 RX002 033 SEQ ID NO: 457 SEQ ID NO: 669 RX002 034 SEQ ID NO: 458 SEQ ID NO: 670 RX002 035 SEQ ID NO: 459 SEQ ID NO: 671 RX002 036 SEQ ID NO: 460 SEQ ID NO: 672 RX002 037 SEQ ID NO: 461 SEQ ID NO: 673 RX002 038 SEQ ID NO: 462 SEQ ID NO: 674 RX002 039 SEQ ID NO: 463 SEQ ID NO: 675 79 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) siRNA No. sense strand (5’‑3’) antisense strand (5’‑3’) RX002 040 SEQ ID NO: 464 SEQ ID NO: 676 RX002 041 SEQ ID NO: 465 SEQ ID NO: 677 RX002 042 SEQ ID NO: 466 SEQ ID NO: 678 RX002 043 SEQ ID NO: 467 SEQ ID NO: 679 RX002 044 SEQ ID NO: 468 SEQ ID NO: 680 RX002 045 SEQ ID NO: 469 SEQ ID NO: 681 RX002 046 SEQ ID NO: 470 SEQ ID NO: 682 RX002 047 SEQ ID NO: 471 SEQ ID NO: 683 RX002 048 SEQ ID NO: 472 SEQ ID NO: 684 RX002 049 SEQ ID NO: 473 SEQ ID NO: 685 RX002 050 SEQ ID NO: 474 SEQ ID NO: 686 RX002 051 SEQ ID NO: 475 SEQ ID NO: 687 RX002 052 SEQ ID NO: 476 SEQ ID NO: 688 RX002 053 SEQ ID NO: 477 SEQ ID NO: 689 RX002 054 SEQ ID NO: 478 SEQ ID NO: 690 RX002 055 SEQ ID NO: 479 SEQ ID NO: 691 80 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) siRNA No. sense strand (5’‑3’) antisense strand (5’‑3’) RX002 056 SEQ ID NO: 480 SEQ ID NO: 692 RX002 057 SEQ ID NO: 481 SEQ ID NO: 693 RX002 058 SEQ ID NO: 482 SEQ ID NO: 694 RX002 059 SEQ ID NO: 483 SEQ ID NO: 695 RX002 060 SEQ ID NO: 484 SEQ ID NO: 696 RX002 061 SEQ ID NO: 485 SEQ ID NO: 697 RX002 062 SEQ ID NO: 486 SEQ ID NO: 698 RX002 063 SEQ ID NO: 487 SEQ ID NO: 699 RX002 064 SEQ ID NO: 488 SEQ ID NO: 700 RX002 065 SEQ ID NO: 489 SEQ ID NO: 701 RX002 066 SEQ ID NO: 490 SEQ ID NO: 702 RX002 067 SEQ ID NO: 491 SEQ ID NO: 703 RX002 068 SEQ ID NO: 492 SEQ ID NO: 704 RX002 069 SEQ ID NO: 493 SEQ ID NO: 705 RX002 070 SEQ ID NO: 494 SEQ ID NO: 706 RX002 071 SEQ ID NO: 495 SEQ ID NO: 707 81 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) siRNA No. sense strand (5’‑3’) antisense strand (5’‑3’) RX002 072 SEQ ID NO: 496 SEQ ID NO: 708 RX002 073 SEQ ID NO: 497 SEQ ID NO: 709 RX002 074 SEQ ID NO: 498 SEQ ID NO: 710 RX002 075 SEQ ID NO: 499 SEQ ID NO: 711 RX002 076 SEQ ID NO: 500 SEQ ID NO: 712 RX002 077 SEQ ID NO: 501 SEQ ID NO: 713 RX002 078 SEQ ID NO: 502 SEQ ID NO: 714 RX002 079 SEQ ID NO: 503 SEQ ID NO: 715 RX002 080 SEQ ID NO: 504 SEQ ID NO: 716 RX002 081 SEQ ID NO: 505 SEQ ID NO: 717 RX002 082 SEQ ID NO: 506 SEQ ID NO: 718 RX002 083 SEQ ID NO: 507 SEQ ID NO: 719 RX002 084 SEQ ID NO: 508 SEQ ID NO: 720 RX002 085 SEQ ID NO: 509 SEQ ID NO: 721 RX002 086 SEQ ID NO: 510 SEQ ID NO: 722 RX002 087 SEQ ID NO: 511 SEQ ID NO: 723 82 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) siRNA No. sense strand (5’‑3’) antisense strand (5’‑3’) RX002 088 SEQ ID NO: 512 SEQ ID NO: 724 RX002 089 SEQ ID NO: 513 SEQ ID NO: 725 RX002 090 SEQ ID NO: 514 SEQ ID NO: 726 RX002 091 SEQ ID NO: 515 SEQ ID NO: 727 RX002 092 SEQ ID NO: 516 SEQ ID NO: 728 RX002 093 SEQ ID NO: 517 SEQ ID NO: 729 RX002 094 SEQ ID NO: 518 SEQ ID NO: 730 RX002 095 SEQ ID NO: 519 SEQ ID NO: 731 RX002 096 SEQ ID NO: 520 SEQ ID NO: 732 RX002 097 SEQ ID NO: 521 SEQ ID NO: 733 RX002 098 SEQ ID NO: 522 SEQ ID NO: 734 RX002 099 SEQ ID NO: 523 SEQ ID NO: 735 RX002 100 SEQ ID NO: 524 SEQ ID NO: 736 RX002 101 SEQ ID NO: 525 SEQ ID NO: 737 RX002 102 SEQ ID NO: 526 SEQ ID NO: 738 RX002 103 SEQ ID NO: 527 SEQ ID NO: 739 83 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) siRNA No. sense strand (5’‑3’) antisense strand (5’‑3’) RX002 104 SEQ ID NO: 528 SEQ ID NO: 740 RX002 105 SEQ ID NO: 529 SEQ ID NO: 741 RX002 106 SEQ ID NO: 530 SEQ ID NO: 742 RX002 107 SEQ ID NO: 531 SEQ ID NO: 743 RX002 108 SEQ ID NO: 532 SEQ ID NO: 744 RX002 109 SEQ ID NO: 533 SEQ ID NO: 745 RX002 110 SEQ ID NO: 534 SEQ ID NO: 746 RX002 111 SEQ ID NO: 535 SEQ ID NO: 747 RX002 112 SEQ ID NO: 536 SEQ ID NO: 748 RX002 113 SEQ ID NO: 537 SEQ ID NO: 749 RX002 114 SEQ ID NO: 538 SEQ ID NO: 750 RX002 115 SEQ ID NO: 539 SEQ ID NO: 751 RX002 116 SEQ ID NO: 540 SEQ ID NO: 752 RX002 117 SEQ ID NO: 541 SEQ ID NO: 753 RX002 118 SEQ ID NO: 542 SEQ ID NO: 754 RX002 119 SEQ ID NO: 543 SEQ ID NO: 755 84 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) siRNA No. sense strand (5’‑3’) antisense strand (5’‑3’) RX002 120 SEQ ID NO: 544 SEQ ID NO: 756 RX002 121 SEQ ID NO: 545 SEQ ID NO: 757 RX002 122 SEQ ID NO: 546 SEQ ID NO: 758 RX002 123 SEQ ID NO: 547 SEQ ID NO: 759 RX002 124 SEQ ID NO: 548 SEQ ID NO: 760 RX002 125 SEQ ID NO: 549 SEQ ID NO: 761 RX002 126 SEQ ID NO: 550 SEQ ID NO: 762 RX002 127 SEQ ID NO: 551 SEQ ID NO: 763 RX002 128 SEQ ID NO: 552 SEQ ID NO: 764 RX002 129 SEQ ID NO: 553 SEQ ID NO: 765 RX002 130 SEQ ID NO: 554 SEQ ID NO: 766 RX002 131 SEQ ID NO: 555 SEQ ID NO: 767 RX002 132 SEQ ID NO: 556 SEQ ID NO: 768 RX002 133 SEQ ID NO: 557 SEQ ID NO: 769 RX002 134 SEQ ID NO: 558 SEQ ID NO: 770 RX002 135 SEQ ID NO: 559 SEQ ID NO: 771 85 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) siRNA No. sense strand (5’‑3’) antisense strand (5’‑3’) RX002 136 SEQ ID NO: 560 SEQ ID NO: 772 RX002 137 SEQ ID NO: 561 SEQ ID NO: 773 RX002 138 SEQ ID NO: 562 SEQ ID NO: 774 RX002 139 SEQ ID NO: 563 SEQ ID NO: 775 RX002 140 SEQ ID NO: 564 SEQ ID NO: 776 RX002 141 SEQ ID NO: 565 SEQ ID NO: 777 RX002 142 SEQ ID NO: 566 SEQ ID NO: 778 RX002 143 SEQ ID NO: 567 SEQ ID NO: 779 RX002 144 SEQ ID NO: 568 SEQ ID NO: 780 RX002 145 SEQ ID NO: 569 SEQ ID NO: 781 RX002 146 SEQ ID NO: 570 SEQ ID NO: 782 RX002 147 SEQ ID NO: 571 SEQ ID NO: 783 RX002 148 SEQ ID NO: 572 SEQ ID NO: 784 RX002 149 SEQ ID NO: 573 SEQ ID NO: 785 RX002 150 SEQ ID NO: 574 SEQ ID NO: 786 RX002 151 SEQ ID NO: 575 SEQ ID NO: 787 86 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) siRNA No. sense strand (5’‑3’) antisense strand (5’‑3’) RX002 152 SEQ ID NO: 576 SEQ ID NO: 788 RX002 153 SEQ ID NO: 577 SEQ ID NO: 789 RX002 154 SEQ ID NO: 578 SEQ ID NO: 790 RX002 155 SEQ ID NO: 579 SEQ ID NO: 791 RX002 156 SEQ ID NO: 580 SEQ ID NO: 792 RX002 157 SEQ ID NO: 581 SEQ ID NO: 793 RX002 158 SEQ ID NO: 582 SEQ ID NO: 794 RX002 159 SEQ ID NO: 583 SEQ ID NO: 795 RX002 160 SEQ ID NO: 584 SEQ ID NO: 796 RX002 161 SEQ ID NO: 585 SEQ ID NO: 797 RX002 162 SEQ ID NO: 586 SEQ ID NO: 798 RX002 163 SEQ ID NO: 587 SEQ ID NO: 799 RX002 164 SEQ ID NO: 588 SEQ ID NO: 780 RX002 165 SEQ ID NO: 589 SEQ ID NO: 801 RX002 166 SEQ ID NO: 590 SEQ ID NO: 802 RX002 167 SEQ ID NO: 591 SEQ ID NO: 803 87 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) siRNA No. sense strand (5’‑3’) antisense strand (5’‑3’) RX002 168 SEQ ID NO: 592 SEQ ID NO: 804 RX002 169 SEQ ID NO: 593 SEQ ID NO: 805 RX002 170 SEQ ID NO: 594 SEQ ID NO: 806 RX002 171 SEQ ID NO: 595 SEQ ID NO: 807 RX002 172 SEQ ID NO: 596 SEQ ID NO: 808 RX002 173 SEQ ID NO: 597 SEQ ID NO: 809 RX002 174 SEQ ID NO: 598 SEQ ID NO: 810 RX002 175 SEQ ID NO: 599 SEQ ID NO: 811 RX002 176 SEQ ID NO: 600 SEQ ID NO: 812 RX002 177 SEQ ID NO: 601 SEQ ID NO: 813 RX002 178 SEQ ID NO: 602 SEQ ID NO: 814 RX002 179 SEQ ID NO: 603 SEQ ID NO: 815 RX002 180 SEQ ID NO: 604 SEQ ID NO: 816 RX002 181 SEQ ID NO: 605 SEQ ID NO: 817 RX002 182 SEQ ID NO: 606 SEQ ID NO: 818 RX002 183 SEQ ID NO: 607 SEQ ID NO: 819 88 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) siRNA No. sense strand (5’‑3’) antisense strand (5’‑3’) RX002 184 SEQ ID NO: 608 SEQ ID NO: 820 RX002 185 SEQ ID NO: 609 SEQ ID NO: 821 RX002 186 SEQ ID NO: 610 SEQ ID NO: 822 RX002 187 SEQ ID NO: 611 SEQ ID NO: 823 RX002 188 SEQ ID NO: 612 SEQ ID NO: 824 RX002 189 SEQ ID NO: 613 SEQ ID NO: 825 RX002 190 SEQ ID NO: 614 SEQ ID NO: 826 RX002 191 SEQ ID NO: 615 SEQ ID NO: 827 RX002 192 SEQ ID NO: 616 SEQ ID NO: 828 RX002 193 SEQ ID NO: 617 SEQ ID NO: 829 RX002 194 SEQ ID NO: 618 SEQ ID NO: 830 RX002 195 SEQ ID NO: 619 SEQ ID NO: 831 RX002 196 SEQ ID NO: 620 SEQ ID NO: 832 RX002 197 SEQ ID NO: 621 SEQ ID NO: 833 RX002 198 SEQ ID NO: 622 SEQ ID NO: 834 RX002 199 SEQ ID NO: 623 SEQ ID NO: 835 89 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) siRNA No. sense strand (5’‑3’) antisense strand (5’‑3’) RX002 200 SEQ ID NO: 624 SEQ ID NO: 836 RX002 201 SEQ ID NO: 625 SEQ ID NO: 837 RX002 202 SEQ ID NO: 626 SEQ ID NO: 838 RX002 203 SEQ ID NO: 627 SEQ ID NO: 839 RX002 204 SEQ ID NO: 628 SEQ ID NO: 840 RX002 205 SEQ ID NO: 629 SEQ ID NO: 841 RX002 206 SEQ ID NO: 630 SEQ ID NO: 842 RX002 207 SEQ ID NO: 631 SEQ ID NO: 843 RX002 208 SEQ ID NO: 632 SEQ ID NO: 844 RX002 209 SEQ ID NO: 633 SEQ ID NO: 845 RX002 210 SEQ ID NO: 634 SEQ ID NO: 846 RX002 211 SEQ ID NO: 635 SEQ ID NO: 847 RX002 212 SEQ ID NO: 636 SEQ ID NO: 848 90 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 Ta bl e 6: Se qu en ce In fo rm at io n of si R N As si R N A N o. se ns e st ra nd (5 ’‑3 ’) an tis en se st ra nd (5 ’‑3 ’) R X0 02 21 3 SE Q ID N O :8 49 SE Q ID N O :6 44 R X0 02 21 4 SE Q ID N O :8 50 SE Q ID N O :6 50 R X0 02 21 5 SE Q ID N O :8 51 SE Q ID N O :6 65 R X0 02 21 6 SE Q ID N O :8 52 SE Q ID N O :6 92 R X0 02 21 7 SE Q ID N O :8 53 SE Q ID N O :7 06 R X0 02 21 8 SE Q ID N O :8 54 SE Q ID N O :7 09 R X0 02 21 9 SE Q ID N O :8 55 SE Q ID N O :7 20 R X0 02 22 0 SE Q ID N O :8 56 SE Q ID N O :7 54 R X0 02 22 1 SE Q ID N O :8 57 SE Q ID N O :7 63 R X0 02 22 2 SE Q ID N O :8 58 SE Q ID N O :7 66 R X0 02 22 3 SE Q ID N O :8 59 SE Q ID N O :7 81 R X0 02 22 4 SE Q ID N O :8 60 SE Q ID N O :8 01 R X0 02 22 5 SE Q ID N O :8 61 SE Q ID N O :8 08 R X0 02 22 6( AD 57 07 14 ) SE Q ID N O :8 62 SE Q ID N O :8 81 91 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (c on tin ue d) si R N A N o. se ns e st ra nd (5 ’‑3 ’) an tis en se st ra nd (5 ’‑3 ’) R X0 02 22 7 SE Q ID N O :8 63 SE Q ID N O :6 66 R X0 02 22 8 SE Q ID N O :8 64 SE Q ID N O :6 87 R X0 02 22 9 SE Q ID N O :8 65 SE Q ID N O :7 03 R X0 02 23 0 SE Q ID N O :8 66 SE Q ID N O :7 10 R X0 02 23 1 SE Q ID N O :8 67 SE Q ID N O :7 12 R X0 02 23 2 SE Q ID N O :8 68 SE Q ID N O :7 34 R X0 02 23 3 SE Q ID N O :8 69 SE Q ID N O :7 39 R X0 02 23 4 SE Q ID N O :8 70 SE Q ID N O :7 53 R X0 02 23 5 SE Q ID N O :8 71 SE Q ID N O :7 62 R X0 02 23 6 SE Q ID N O :8 72 SE Q ID N O :7 64 R X0 02 23 7 SE Q ID N O :8 73 SE Q ID N O :7 93 R X0 02 23 8 SE Q ID N O :8 74 SE Q ID N O :8 03 R X0 02 23 9 SE Q ID N O :8 75 SE Q ID N O :8 05 R X0 02 24 0 SE Q ID N O :8 76 SE Q ID N O :8 12 92 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (c on tin ue d) si R N A N o. se ns e st ra nd (5 ’‑3 ’) an tis en se st ra nd (5 ’‑3 ’) R X0 02 24 1 SE Q ID N O :8 77 SE Q ID N O :8 13 R X0 02 24 2 SE Q ID N O :8 78 SE Q ID N O :8 14 R X0 02 24 3 SE Q ID N O :8 79 SE Q ID N O :8 27 R X0 02 24 4 SE Q ID N O :8 80 SE Q ID N O :8 47 R XM 02 00 3 SE Q ID N O :8 82 SE Q ID N O :8 83 R X0 00 00 1 SE Q ID N O :8 84 SE Q ID N O :8 86 R X0 00 00 2 SE Q ID N O :8 85 SE Q ID N O :8 86 93 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 Table 7: Sequence Information of siRNAs siRNA No. sense strand (5’‑3’) antisense strand (5’‑3’) RX002 245 SEQ ID NO: 887 SEQ ID NO: 908 RX002 246 SEQ ID NO: 887 SEQ ID NO: 909 RX002 247 SEQ ID NO: 887 SEQ ID NO: 910 RX002 248 SEQ ID NO: 888 SEQ ID NO: 909 RX002 249 SEQ ID NO: 889 SEQ ID NO: 909 RX002 250 SEQ ID NO: 890 SEQ ID NO: 909 RX002 251 SEQ ID NO: 891 SEQ ID NO: 909 RX002 252 SEQ ID NO: 888 SEQ ID NO: 911 RX002 253 SEQ ID NO: 889 SEQ ID NO: 911 RX002 254 SEQ ID NO: 890 SEQ ID NO: 911 RX002 255 SEQ ID NO: 891 SEQ ID NO: 911 RX002 256 SEQ ID NO: 892 SEQ ID NO: 912 94 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) siRNA No. sense strand (5’‑3’) antisense strand (5’‑3’) RX002 257 SEQ ID NO: 892 SEQ ID NO: 913 RX002 258 SEQ ID NO: 892 SEQ ID NO: 914 RX002 259 SEQ ID NO: 893 SEQ ID NO: 913 RX002 260 SEQ ID NO: 894 SEQ ID NO: 913 RX002 261 SEQ ID NO: 895 SEQ ID NO: 913 RX002 262 SEQ ID NO: 896 SEQ ID NO: 913 RX002 263 SEQ ID NO: 893 SEQ ID NO: 915 RX002 264 SEQ ID NO: 894 SEQ ID NO: 915 RX002 265 SEQ ID NO: 895 SEQ ID NO: 915 RX002 266 SEQ ID NO: 896 SEQ ID NO: 915 RX002 267 SEQ ID NO: 897 SEQ ID NO: 916 RX002 268 SEQ ID NO: 897 SEQ ID NO: 917 95 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) siRNA No. sense strand (5’‑3’) antisense strand (5’‑3’) RX002 269 SEQ ID NO: 897 SEQ ID NO: 918 RX002 270 SEQ ID NO: 898 SEQ ID NO: 917 RX002 271 SEQ ID NO: 899 SEQ ID NO: 917 RX002 272 SEQ ID NO: 900 SEQ ID NO: 917 RX002 273 SEQ ID NO: 901 SEQ ID NO: 917 RX002 274 SEQ ID NO: 898 SEQ ID NO: 919 RX002 275 SEQ ID NO: 899 SEQ ID NO: 919 RX002 276 SEQ ID NO: 900 SEQ ID NO: 919 RX002 277 SEQ ID NO: 901 SEQ ID NO: 919 RX002 278 SEQ ID NO: 902 SEQ ID NO: 920 RX002 279 SEQ ID NO: 902 SEQ ID NO: 921 RX002 280 SEQ ID NO: 902 SEQ ID NO: 922 96 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) siRNA No. sense strand (5’‑3’) antisense strand (5’‑3’) RX002 281 SEQ ID NO: 903 SEQ ID NO: 921 RX002 282 SEQ ID NO: 904 SEQ ID NO: 921 RX002 283 SEQ ID NO: 905 SEQ ID NO: 921 RX002 284 SEQ ID NO: 906 SEQ ID NO: 921 RX002 285 SEQ ID NO: 903 SEQ ID NO: 923 RX002 286 SEQ ID NO: 904 SEQ ID NO: 923 RX002 287 SEQ ID NO: 905 SEQ ID NO: 923 RX002 288 SEQ ID NO: 906 SEQ ID NO: 923 RX002 289 SEQ ID NO: 888 SEQ ID NO: 910 RX002 290 SEQ ID NO: 890 SEQ ID NO: 910 RX002 291 SEQ ID NO: 890 SEQ ID NO: 924 RX002 292 SEQ ID NO: 891 SEQ ID NO: 924 97 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) siRNA No. sense strand (5’‑3’) antisense strand (5’‑3’) RX002 293 SEQ ID NO: 895 SEQ ID NO: 914 RX002 294 SEQ ID NO: 896 SEQ ID NO: 925 RX002 295 SEQ ID NO: 905 SEQ ID NO: 922 RX002 296 SEQ ID NO: 906 SEQ ID NO: 926 RX002 297 SEQ ID NO: 892 SEQ ID NO: 927 RX002 298 SEQ ID NO: 907 SEQ ID NO: 928 RX002 299 SEQ ID NO: 907 SEQ ID NO: 929 RX002 300 SEQ ID NO: 907 SEQ ID NO: 930 RX002 301 SEQ ID NO: 887 SEQ ID NO: 931 RX002 302 SEQ ID NO: 887 SEQ ID NO: 932 RX002 303 SEQ ID NO: 887 SEQ ID NO: 933 RX002 304 SEQ ID NO: 902 SEQ ID NO: 934 98 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) siRNA No. sense strand (5’‑3’) antisense strand (5’‑3’) RX002 305 SEQ ID NO: 902 SEQ ID NO: 935 RX002 306 SEQ ID NO: 902 SEQ ID NO: 936 RX002 307 SEQ ID NO: 892 SEQ ID NO: 937 RX002 308 SEQ ID NO: 892 SEQ ID NO: 938 RX002 309 SEQ ID NO: 907 SEQ ID NO: 939 RX002 310 SEQ ID NO: 897 SEQ ID NO: 940 RX002 311 SEQ ID NO: 897 SEQ ID NO: 941 RX002 312 SEQ ID NO: 897 SEQ ID NO: 942 RX002 313 SEQ ID NO: 897 SEQ ID NO: 943 Preparation Example 4: Preparation of siRNA Conjugate with L96 Moiety Conjugated to 3’-end of Sense Strand

[0240] Wherein, compound L96-PS was purchased from Asymchem Laboratories (Tianjin) Co., Ltd., with a loading capacity of 120 ± 12 µmol / g (detection method: UV / HPLC). The structural formula of compound L96-PS is: 99 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 Wherein, PS represents a polystyrene resin solid-phase support. (4.1) Synthesis of sense strand

[0241] Using the phosphoramidite solid-phase nucleic acid synthesis method, reaction cycles were started with the aforementioned L96-PS compound linked to a solid-phase support, and nucleoside monomers were linked sequentially in a 3’ to 5’ direction according to the nucleotide sequence. Each cycle of nucleoside monomer addition included four reaction steps: deprotection, coupling, capping, and oxidation or sulfurization. The synthesis method and conditions followed the sense strand synthesis method shown in step (3.1) of Preparation Example 3. (4.2) Synthesis of antisense strand

[0242] The siRNA antisense strands in this preparation example were synthesized according to the antisense strand synthesis method shown in step (3.2) of Preparation Example 3. (4.3) Synthesis of siRNA conjugate

[0243] The siRNA conjugates of this preparation example were synthesized according to the method shown in step (3.3) of Preparation Example 3.

[0244] Wherein, the structural formula of the siRNA conjugate with the L96 moiety conjugated to the 3’-end of the sense strand is as follows:

[0245] Wherein, 100 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 represents siRNA. L96 was conjugated to the 3’-end of the sense strand of the siRNA via a phosphodiester bond. Table 8: Sequence Information of siRNA Conjugates with an L96 Moiety Conjugated to the 3’-end of the Sense Strand siRNA conjugate No. sense strand (5’‑3’) antisense strand (5’‑3’) RZ002001 SEQ ID NO: 849_L96 SEQ ID NO: 644 RZ002002 SEQ ID NO: 850_L96 SEQ ID NO: 650 RZ002003 SEQ ID NO: 851_L96 SEQ ID NO: 665 RZ002004 SEQ ID NO: 852_L96 SEQ ID NO: 692 RZ002005 SEQ ID NO: 853_L96 SEQ ID NO: 706 RZ002006 SEQ ID NO: 854_L96 SEQ ID NO: 709 RZ002007 SEQ ID NO: 855_L96 SEQ ID NO: 720 RZ002008 SEQ ID NO: 856_L96 SEQ ID NO: 754 RZ002009 SEQ ID NO: 857_L96 SEQ ID NO: 763 RZ002010 SEQ ID NO: 858_L96 SEQ ID NO: 766 RZ002011 SEQ ID NO: 859_L96 SEQ ID NO: 781 RZ002012 SEQ ID NO: 860_L96 SEQ ID NO: 801 101 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) siRNA conjugate No. sense strand (5’‑3’) antisense strand (5’‑3’) RZ002013 SEQ ID NO: 861_L96 SEQ ID NO: 808 RZ002014(A D570714) SEQ ID NO: 862_L96 SEQ ID NO: 881 RZ002015 SEQ ID NO: 863_L96 SEQ ID NO: 666 RZ002016 SEQ ID NO: 864_L96 SEQ ID NO: 687 RZ002017 SEQ ID NO: 865_L96 SEQ ID NO: 703 RZ002018 SEQ ID NO: 866_L96 SEQ ID NO: 710 RZ002019 SEQ ID NO: 867_L96 SEQ ID NO: 712 RZ002020 SEQ ID NO: 868_L96 SEQ ID NO: 734 RZ002021 SEQ ID NO: 869_L96 SEQ ID NO: 739 RZ002022 SEQ ID NO: 870_L96 SEQ ID NO: 753 RZ002023 SEQ ID NO: 871_L96 SEQ ID NO: 762 RZ002024 SEQ ID NO: 872_L96 SEQ ID NO: 764 102 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) siRNA conjugate No. sense strand (5’‑3’) antisense strand (5’‑3’) RZ002025 SEQ ID NO: 873_L96 SEQ ID NO: 793 RZ002026 SEQ ID NO: 874_L96 SEQ ID NO: 803 RZ002027 SEQ ID NO: 875_L96 SEQ ID NO: 805 RZ002028 SEQ ID NO: 876_L96 SEQ ID NO: 812 RZ002029 SEQ ID NO: 877_L96 SEQ ID NO: 813 RZ002030 SEQ ID NO: 878_L96 SEQ ID NO: 814 RZ002031 SEQ ID NO: 879_L96 SEQ ID NO: 827 RZ002032 SEQ ID NO: 880_L96 SEQ ID NO: 847

[0246] As an exemplary explanation, "SEQ ID NO: 849_L96" indicates that the L96 moiety is conjugated to the 3’-end of the sense strand as shown in SEQ ID NO: 849 via a phosphodiester bond. Table 9: Sequence Information of Murine siRNA Conjugates with an L96 Moiety Conjugated to the 3’-end of the Sense Strand siRNA conjugate No. sense strand (5’‑3’) antisense strand (5’‑3’) RZM02003 SEQ ID NO: 882_L96 SEQ ID NO: 883 103 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 Table 10: Sequence Information of siRNA Conjugates with an L96 Moiety Conjugated to the 3’-end of the Sense Strand siRNA conjugate No. sense strand (5’‑3’) antisense strand (5’‑3’) RZ000001 SEQ ID NO: 884_L96 SEQ ID NO: 886 RZ000002 SEQ ID NO: 885_L96 SEQ ID NO: 886 Preparation Example 5: Synthesis of siRNA Conjugate with (CR01008×3) Moiety Conjugated to 3’-end of Sense Strand (5.1) Synthesis of sense strand

[0247] Using the phosphoramidite solid-phase nucleic acid synthesis method, starting with the aforementioned compound CR01008Z linked to a solid-phase support, nucleoside monomers were linked sequentially in cycles in a 3’ to 5’ direction according to the nucleotide sequence (compound CR01008 was regarded as a nucleoside monomer).

[0248] Each cycle of nucleoside monomer addition included four reaction steps: deprotection, coupling, capping, and oxidation or sulfurization. In the synthesis of the sense strand of this preparation example, the conditions for deprotection, coupling, capping, and oxidation or sulfurization reactions, the conditions for cleavage and deprotection, and the conditions for purification and desalting were the same as those for the synthesis of the sense strand in step (3.1) of Preparation Example 3.

[0249] In this step, three clusters of CR01008 were synthesized during the synthesis of the sense strand, denoted as (CR01008)×3 or (CR01008×3).

[0250] The structural formula of the three clusters of CR01008 is: (5.2) Synthesis of antisense strand:

[0251] The antisense strands of this preparation example were synthesized according to the antisense strand synthesis method shown in step (3.2) of Preparation Example 3. 104 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (5.3) Synthesis of siRNA conjugate

[0252] The siRNA conjugates of this preparation example were synthesized according to the method shown in step (3.3) of Preparation Example 3.

[0253] Wherein, when the ligand is the three clusters of CR01008, the structural formula of the siRNA conjugate is:

[0254] Wherein, represents siRNA. The (CR01018×3) moiety was conjugated to the 3’-end of the sense strand of the siRNA. Table 11: Sequence Information of siRNA Conjugates with a (CR01008×3) Moiety Conjugated to the 3’-end of the Sense Strand siRNA conjugate No. sense strand (5’‑3’) antisense strand (5’‑3’) RZ002033 SEQ ID NO: 887_(CR01008×3) SEQ ID NO: 908 RZ002034 SEQ ID NO: 887_(CR01008×3) SEQ ID NO: 909 RZ002036 SEQ ID NO: 888_(CR01008×3) SEQ ID NO: 909 RZ002037 SEQ ID NO: 889_(CR01008×3) SEQ ID NO: 909 105 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) siRNA conjugate No. sense strand (5’‑3’) antisense strand (5’‑3’) RZ002038 SEQ ID NO: 890(CR01008×3) SEQ ID NO: 909 RZ002039 SEQ ID NO: 891_(CR01008×3) SEQ ID NO: 909 RZ002040 SEQ ID NO: 888_(CR01008×3) SEQ ID NO: 911 RZ002041 SEQ ID NO: 889_(CR01008×3) SEQ ID NO: 911 RZ002042 SEQ ID NO: 890_(CR01008×3) SEQ ID NO: 911 RZ002043 SEQ ID NO: 891_(CR01008×3) SEQ ID NO: 911 RZ002050 SEQ ID NO: 892_(CR01008×3) SEQ ID NO: 912 RZ002051 SEQ ID NO: 892_(CR01008×3) SEQ ID NO: 913 RZ002053 SEQ ID NO: 893_(CR01008×3) SEQ ID NO: 913 RZ002054 SEQ ID NO: 894_(CR01008×3) SEQ ID NO: 913 RZ002055 SEQ ID NO: 895_(CR01008×3) SEQ ID NO: 913 RZ002056 SEQ ID NO: 896_(CR01008×3) SEQ ID NO: 913 RZ002057 SEQ ID NO: 893_(CR01008×3) SEQ ID NO: 915 106 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) siRNA conjugate No. sense strand (5’‑3’) antisense strand (5’‑3’) RZ002058 SEQ ID NO: 894_(CR01008×3) SEQ ID NO: 915 RZ002059 SEQ ID NO: 895_(CR01008×3) SEQ ID NO: 915 RZ002060 SEQ ID NO: 896_(CR01008×3) SEQ ID NO: 915 RZ002066 SEQ ID NO: 897_(CR01008×3) SEQ ID NO: 916 RZ002067 SEQ ID NO: 897_(CR01008×3) SEQ ID NO: 917 RZ002068 SEQ ID NO: 897_(CR01008×3) SEQ ID NO: 918 RZ002069 SEQ ID NO: 898_(CR01008×3) SEQ ID NO: 917 RZ002070 SEQ ID NO: 899_(CR01008×3) SEQ ID NO: 917 RZ002071 SEQ ID NO: 900_(CR01008×3) SEQ ID NO: 917 RZ002072 SEQ ID NO: 901_(CR01008×3) SEQ ID NO: 917 RZ002073 SEQ ID NO: 898_(CR01008×3) SEQ ID NO: 919 RZ002074 SEQ ID NO: 899_(CR01008×3) SEQ ID NO: 919 RZ002075 SEQ ID NO: 900_(CR01008×3) SEQ ID NO: 919 107 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) siRNA conjugate No. sense strand (5’‑3’) antisense strand (5’‑3’) RZ002076 SEQ ID NO: 901_(CR01008×3) SEQ ID NO: 919 RZ002082 SEQ ID NO: 902_(CR01008×3) SEQ ID NO: 920 RZ002083 SEQ ID NO: 902_(CR01008×3) SEQ ID NO: 921 RZ002084 SEQ ID NO: 902_(CR01008×3) SEQ ID NO: 922 RZ002085 SEQ ID NO: 903_(CR01008×3) SEQ ID NO: 921 RZ002086 SEQ ID NO: 904_(CR01008×3) SEQ ID NO: 921 RZ002087 SEQ ID NO: 905_(CR01008×3) SEQ ID NO: 921 RZ002088 SEQ ID NO: 906_(CR01008×3) SEQ ID NO: 921 RZ002089 SEQ ID NO: 903_(CR01008×3) SEQ ID NO: 923 RZ002090 SEQ ID NO: 904_(CR01008×3) SEQ ID NO: 923 RZ002091 SEQ ID NO: 905_(CR01008×3) SEQ ID NO: 923 RZ002092 SEQ ID NO: 906_(CR01008×3) SEQ ID NO: 923 RZ002099 SEQ ID NO: 887_(CR01008×3) SEQ ID NO: 910 RZ002100 SEQ ID NO: 888_(CR01008×3) SEQ ID NO: 910 108 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) siRNA conjugate No. sense strand (5’‑3’) antisense strand (5’‑3’) RZ002101 SEQ ID NO: 890_(CR01008×3) SEQ ID NO: 910 RZ002102 SEQ ID NO: 890_(CR01008×3) SEQ ID NO: 924 RZ002103 SEQ ID NO: 891_(CR01008×3) SEQ ID NO: 924 RZ002106 SEQ ID NO: 892_(CR01008×3) SEQ ID NO: 914 RZ002107 SEQ ID NO: 895_(CR01008×3) SEQ ID NO: 914 RZ002108 SEQ ID NO: 896_(CR01008×3) SEQ ID NO: 925 RZ002112 SEQ ID NO: 905_(CR01008×3) SEQ ID NO: 922 RZ002113 SEQ ID NO: 906_(CR01008×3) SEQ ID NO: 926 RZ002115 SEQ ID NO: 892_(CR01008×3) SEQ ID NO: 927 RZ002116 SEQ ID NO: 907_(CR01008×3) SEQ ID NO: 928 RZ002117 SEQ ID NO: 907_(CR01008×3) SEQ ID NO: 929 RZ002118 SEQ ID NO: 907_(CR01008×3) SEQ ID NO: 930 RZ002119 SEQ ID NO: 887_(CR01008×3) SEQ ID NO: 931 RZ002120 SEQ ID NO: 887_(CR01008×3) SEQ ID NO: 932 109 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) siRNA conjugate No. sense strand (5’‑3’) antisense strand (5’‑3’) RZ002121 SEQ ID NO: 887_(CR01008×3) SEQ ID NO: 933 RZ002122 SEQ ID NO: 902_(CR01008×3) SEQ ID NO: 934 RZ002123 SEQ ID NO: 902_(CR01008×3) SEQ ID NO: 935 RZ002124 SEQ ID NO: 902_(CR01008×3) SEQ ID NO: 936 RZ002125 SEQ ID NO: 892_(CR01008×3) SEQ ID NO: 937 RZ002126 SEQ ID NO: 892_(CR01008×3) SEQ ID NO: 938 RZ002130 SEQ ID NO: 907_(CR01008×3) SEQ ID NO: 939 RZ002131 SEQ ID NO: 897_(CR01008×3) SEQ ID NO: 940 RZ002132 SEQ ID NO: 897_(CR01008×3) SEQ ID NO: 941 RZ002133 SEQ ID NO: 897_(CR01008×3) SEQ ID NO: 942 RZ002134 SEQ ID NO: 897_(CR01008×3) SEQ ID NO: 943

[0255] For the table above, as an exemplary explanation, "SEQ ID NO: 858_(CR01008×3)" indicates that the (CR01008×3) moiety is conjugated to the 3’-end of the sense strand as shown in SEQ ID NO: 858. Biological Assays Example 1: In vitro Activity Assessment of Complement C3 (C3) siRNA

[0256] In this example, the inhibitory activity of RX002001 to RX002212 targeting the same C3 target region on the C3 mRNA (Accession No. NM_000064.4) in cells, was assessed using a target gene inhibition activityassay in the liver cancer HepG2 cell line. Preparation of test sample

[0257] After the above siRNA test samples were centrifuged, an appropriate amount of DEPC H2O was added to each 110 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 tube to dissolve the siRNA, and 20 µM stock solutions was prepared. The stock solutions were then further serially diluted with DEPC H2O into 0.04µM and 0.004µM working solutions. Dose screening experiments were performed at final duplex concentrations of 1 nM and 0.1 nM. 96-well transfection and detection:

[0258] HepG2 cells grown to near confluence were digested with trypsin, the cells were washed, and a cell suspension was prepared for plating in 96-well plates.

[0259] 5 µL of 0.4 µM and 0.04 µM working solutions were dispersed in 20 µL of Opti-MEM to form siRNA mixtures. 0.2 µL of RNAiMAX was dispersed in 24.8 µL of Opti-MEM, and after incubating for 5 min, was mixed with each siRNA mixture and incubated for 10 min to form transfection complexes. 150 µL of cell suspension (12,000 cells) was added to each well of a 96-well plate containing the transfection complex, and the 96-well plate was placed in an incubator for continued culture for 24 h.

[0260] For the mock control group, 0.2 µL of RNAiMAX was dispersed in 24.8 µL of Opti-MEM, and after incubating for 5 min, 25 µL of Opti-MEM was added, followed by incubation for 10 min to form the transfection complex. 150 µL of cell suspension (12,000 cells) was added to each well of a 96-well plate containing the transfection complex, and the 96-well plate was placed in an incubator for continued culture for 24 h.

[0261] The 96-well plate was taken out, the cells were lysed, and the lysate was diluted. A one-step qPCR kit (Thermo Fisher, Power SYBR Green RNA-to-CTTM 1-Step, 4389986) was used to detect the expression level of the target gene mRNA in HepG2 cells on a real-time quantitative PCR system (Roche, LightCycler 480). In this real-time quantitative PCR method, the TATA-box binding protein (TBP) gene was used as an internal reference gene, and primers for the target gene and primers for the TBP internal reference gene were used to detect the target gene and the TBP internal reference gene, respectively. The sequences of the detection primers are shown in Table 12. Table 12: Sequences of Detection Primers Gene Primer type Primer sequence Target gene C3 Forward primer 5’-AAGCGCATTCCGATTGAGGA‑3’ (SEQ ID NO: 944) Reverse primer 5’-CCTGAGTGCAAGATGACGGT‑3’ (SEQ ID NO: 945) Reference gene TBP Forward primer Reverse primer

[0262] In the real-time quantitative PCR method, theΔΔCt method was used to perform relative quantitative calculations on the expression level and inhibition rate of the target gene mRNA in each test group according to the technical method described above in DETAILED DESCRIPTION. Table 13: Inhibitory Activity of siRNAs on the Target Gene in HepG2 Cells after Administration of the siRNAs Group 10 nM 1 nM Relative remaining expression level (%) STDEV Relative remaining expression level (%) STDEV Mock 100.00 6.32 100.00 6.36 RX002001 88.92 8.70 91.03 7.28 RX002002 32.08 2.72 78.55 4.62 RX002003 97.20 2.38 96.63 0.32 RX002004 59.07 5.59 83.87 8.89 RX002005 21.55 0.46 74.79 5.74 RX002006 21.20 0.45 70.17 0.80 111 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) Group 10 nM 1 nM Relative remaining expression level (%) STDEV Relative remaining expression level (%) STDEV RX002007 53.48 0.17 87.91 2.58 RX002008 16.50 4.86 66.24 7.99 RX002009 47.33 4.79 85.36 4.74 RX002010 33.17 9.10 80.28 8.77 RX002011 19.57 4.56 68.58 5.15 RX002012 36.59 10.84 83.70 7.37 RX002013 69.76 4.67 106.55 5.57 RX002014 13.88 0.59 59.50 4.56 RX002015 59.80 15.93 96.89 4.11 RX002016 34.05 6.58 66.32 11.21 RX002017 71.24 1.86 94.47 4.32 RX002018 40.33 8.05 77.44 3.29 RX002019 60.78 10.67 84.84 3.46 RX002020 21.11 4.79 64.86 0.11 RX002021 17.12 5.23 73.89 12.49 RX002022 53.64 6.29 115.88 7.00 RX002023 72.78 15.69 131.80 4.09 RX002024 16.74 1.82 90.86 16.02 RX002025 28.19 1.01 88.20 4.18 RX002026 35.77 11.82 108.83 23.81 RX002027 85.79 13.68 131.81 29.89 RX002028 14.71 0.96 97.87 10.69 RX002029 5.33 1.17 47.14 6.11 RX002030 8.26 3.42 42.37 9.47 RX002031 28.29 17.54 81.26 22.92 RX002032 47.25 23.91 99.86 0.49 RX002033 40.09 2.62 99.54 10.07 RX002034 24.25 2.73 77.37 2.02 RX002035 79.47 6.23 97.35 6.36 RX002036 86.71 7.78 104.42 36.74 RX002037 27.42 11.56 60.53 15.07 RX002038 35.63 0.17 86.48 7.20 RX002039 109.95 4.31 126.48 6.40 RX002040 90.28 7.95 121.25 8.31 RX002041 19.33 0.38 70.01 7.48 RX002042 63.06 8.01 95.41 11.04 RX002043 32.88 3.00 68.85 5.84 RX002044 18.42 0.42 64.59 4.74 112 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) Group 10 nM 1 nM Relative remaining expression level (%) STDEV Relative remaining expression level (%) STDEV RX002045 15.61 5.58 68.67 12.50 RX002046 71.98 10.89 79.60 1.69 RX002047 71.96 19.85 80.73 6.32 RX002048 28.40 6.35 70.45 8.72 RX002049 15.93 1.55 80.72 23.46 RX002050 21.72 1.08 79.15 2.59 RX002051 9.52 4.02 47.97 19.35 RX002052 63.67 4.94 85.52 2.65 RX002053 30.14 12.56 78.96 7.73 RX002054 81.67 20.07 100.44 8.03 RX002055 21.17 9.45 73.13 13.78 RX002056 10.46 3.33 13.82 3.77 RX002057 71.21 7.89 76.89 1.38 RX002058 79.01 5.74 93.15 2.59 RX002059 92.56 2.80 82.44 3.64 RX002060 26.23 0.94 72.29 6.37 RX002061 21.32 0.38 70.21 9.66 RX002062 73.05 10.94 91.82 15.08 RX002063 43.75 1.22 85.30 1.25 RX002064 95.49 8.57 86.94 9.50 RX002065 74.28 3.03 96.80 4.74 RX002066 70.54 6.10 86.38 13.07 RX002067 18.88 13.32 58.14 14.29 RX002068 24.77 5.04 78.19 8.80 RX002069 64.37 5.25 98.77 10.55 RX002070 6.53 1.20 33.94 10.05 RX002071 74.34 5.22 81.50 14.17 RX002072 83.25 13.81 83.11 1.43 RX002073 5.62 2.25 20.36 8.12 RX002074 7.28 3.89 29.56 5.24 RX002075 86.15 4.64 93.48 3.66 RX002076 10.73 0.28 37.74 3.88 RX002077 29.35 2.49 65.25 4.69 RX002078 83.30 4.35 91.22 2.53 RX002079 25.47 3.44 86.01 22.64 RX002080 86.76 18.29 82.78 2.03 RX002081 29.17 6.20 66.34 0.65 RX002082 37.01 12.34 79.57 3.51 113 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) Group 10 nM 1 nM Relative remaining expression level (%) STDEV Relative remaining expression level (%) STDEV RX002083 40.56 0.53 111.30 38.65 RX002084 7.50 2.02 29.94 1.22 RX002085 78.59 11.51 104.16 4.76 RX002086 11.51 0.11 59.01 22.83 RX002087 26.78 5.00 72.22 5.89 RX002088 59.94 4.40 98.15 0.80 RX002089 95.37 7.01 94.88 9.52 RX002090 92.87 2.88 94.77 3.17 RX002091 73.63 10.31 102.08 1.17 RX002092 27.46 7.01 75.38 6.52 RX002093 82.63 0.81 99.27 6.16 RX002094 43.09 10.08 95.26 11.49 RX002095 91.65 3.22 111.33 2.91 RX002096 61.23 3.40 89.27 5.83 RX002097 41.10 0.77 82.72 9.71 RX002098 12.61 2.35 32.95 1.29 RX002099 43.88 11.55 72.18 1.06 RX002100 42.55 5.41 82.51 5.12 RX002101 50.21 0.16 68.39 5.58 RX002102 40.12 3.67 88.41 11.52 RX002103 11.74 2.96 65.23 1.12 RX002104 62.66 5.52 93.37 10.96 RX002105 23.86 1.68 89.66 5.71 RX002106 21.00 2.60 57.57 2.44 RX002107 73.21 12.09 88.31 2.67 RX002108 16.40 0.42 79.88 14.15 RX002109 18.45 1.10 63.84 10.85 RX002110 18.44 7.13 51.16 1.34 RX002111 77.15 4.66 68.32 3.57 RX002112 56.80 1.62 90.03 7.35 RX002113 68.05 1.89 89.83 16.63 RX002114 90.74 12.71 92.74 6.66 RX002115 41.90 9.50 90.01 3.09 RX002116 33.60 10.84 67.39 10.85 RX002117 14.28 1.21 45.74 1.42 RX002118 7.93 1.94 27.30 2.94 RX002119 23.35 10.29 70.12 12.14 RX002120 65.79 5.21 75.26 5.77 114 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) Group 10 nM 1 nM Relative remaining expression level (%) STDEV Relative remaining expression level (%) STDEV RX002121 24.86 2.43 84.69 40.29 RX002122 20.41 0.37 87.12 9.23 RX002123 14.56 1.61 83.55 33.96 RX002124 35.75 4.49 86.63 18.12 RX002125 19.33 4.28 61.15 10.24 RX002126 14.48 1.51 37.15 21.28 RX002127 15.10 5.36 38.05 6.98 RX002128 13.02 4.30 54.98 15.68 RX002129 72.17 14.29 95.39 20.41 RX002130 12.03 4.38 43.21 3.60 RX002131 84.28 21.12 89.93 8.66 RX002132 77.35 16.18 94.03 24.15 RX002133 43.46 13.55 89.19 24.95 RX002134 27.71 3.21 61.83 6.85 RX002135 37.92 5.37 83.08 15.25 RX002136 60.48 2.86 88.08 10.34 RX002137 39.71 1.88 77.74 16.51 RX002138 20.58 1.78 52.71 6.78 RX002139 92.08 31.70 104.80 27.75 RX002140 50.22 7.36 72.04 4.70 RX002141 72.00 8.92 112.40 10.45 RX002142 22.40 4.18 75.67 11.94 RX002143 17.15 0.13 67.91 9.95 RX002144 18.54 3.25 65.58 3.21 RX002145 7.54 1.73 17.61 0.86 RX002146 57.03 14.65 92.90 0.30 RX002147 66.15 12.67 99.91 6.52 RX002148 18.72 7.22 79.84 16.51 RX002149 108.94 9.95 96.51 0.47 RX002150 15.27 0.02 52.75 13.30 RX002151 41.59 17.34 84.58 21.86 RX002152 79.40 26.60 96.65 16.34 RX002153 108.89 22.61 117.10 4.59 RX002154 15.25 2.92 46.49 2.73 RX002155 59.28 5.90 99.20 8.90 RX002156 11.88 4.97 41.07 3.35 RX002157 10.00 6.13 29.95 7.55 RX002158 31.99 3.18 63.43 12.66 115 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) Group 10 nM 1 nM Relative remaining expression level (%) STDEV Relative remaining expression level (%) STDEV RX002159 15.88 2.97 48.71 1.03 RX002160 35.89 3.10 75.98 17.71 RX002161 25.16 3.56 82.42 3.23 RX002162 27.58 6.60 68.42 1.90 RX002163 40.79 4.46 102.03 1.83 RX002164 21.86 4.29 76.61 1.13 RX002165 10.83 2.25 37.09 2.66 RX002166 49.92 13.14 93.55 0.31 RX002167 13.42 5.35 55.49 14.43 RX002168 71.33 2.68 93.66 0.46 RX002169 12.19 2.98 45.76 15.61 RX002170 14.00 0.75 51.64 5.64 RX002171 92.05 0.00 95.86 9.54 RX002172 10.02 2.64 36.70 0.84 RX002173 33.36 1.25 80.30 9.03 RX002174 69.36 12.40 92.65 21.30 RX002175 16.98 2.49 74.89 6.11 RX002176 10.83 0.88 20.50 1.94 RX002177 9.00 0.25 31.74 2.98 RX002178 14.11 1.31 45.92 3.07 RX002179 18.55 2.96 55.38 4.07 RX002180 102.34 16.65 106.61 7.66 RX002181 89.85 14.69 90.17 3.68 RX002182 100.82 0.99 105.62 4.14 RX002183 65.10 2.87 90.89 12.73 RX002184 38.38 0.88 93.89 3.99 RX002185 86.78 2.84 100.14 2.62 RX002186 25.42 8.44 62.34 5.90 RX002187 22.25 0.15 72.57 14.25 RX002188 30.98 6.83 94.67 13.72 RX002189 72.25 3.89 109.49 8.93 RX002190 13.96 2.92 56.74 9.37 RX002191 7.54 2.97 30.24 10.27 RX002192 101.65 12.26 105.80 8.03 RX002193 67.68 0.33 98.30 2.25 RX002194 76.28 15.10 105.19 6.18 RX002195 36.19 7.80 96.71 0.32 RX002196 32.28 10.34 64.29 5.56 116 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) Group 10 nM 1 nM Relative remaining expression level (%) STDEV Relative remaining expression level (%) STDEV RX002197 52.12 4.85 81.45 3.06 RX002198 47.23 8.21 74.57 8.75 RX002199 57.00 2.61 84.64 4.42 RX002200 46.22 12.82 80.84 7.52 RX002201 87.15 9.24 104.87 5.65 RX002202 19.06 7.03 83.61 7.10 RX002203 68.75 6.73 93.46 12.48 RX002204 78.25 2.30 107.51 7.72 RX002205 41.98 14.13 81.37 0.27 RX002206 101.99 8.65 108.83 9.59 RX002207 92.20 6.77 113.75 7.61 RX002208 78.89 2.19 106.14 1.04 RX002209 60.79 3.28 105.51 17.33 RX002210 52.75 11.21 101.34 0.33 RX002211 14.45 0.09 36.90 7.25 RX002212 109.84 14.32 107.61 7.20 Example 2: In vivo Activity Assessment of siRNA Conjugates with L96 Moiety Conjugated to 3’-end of Sense Strand in BALB / c-HDI Mice

[0263] In this example, a BALB / c mouse hydrodynamic tail vein injection model was used to assess the inhibitory activity of siRNA conjugates RZ002001-RZ0020032, with an L96 moiety conjugated to the 3’-end of the sense strand targeting the same C3 target region on the C3 mRNA, with RZ000001 as a negative control. Plasmid construction

[0264] A pcDNA-CMV-RG002 plasmid (ID: NM_000064.4) was constructed by Sangon Biotech (Shanghai) Co., Ltd. Mouse model construction

[0265] The BALB / c mouse hydrodynamic injection model was established by rapidly injecting a pcDNA-CMV-RG002 plasmid solution into the mice via tail vein under high pressure. On day 3 of the experiment, mice were injected with 10µg of pcDNA-CMV-RG002 via hydrodynamic tail vein injection within 5 s, with an injection volume equivalent to 8% of the mouse’s body weight. The plasmid DNA for injection was diluted with PBS. The solution was prepared before injection and stored at 4°C. Animal grouping, administration, and tissue sample collection

[0266] 6 to 7-week-old female BALB / c mice were randomly grouped by body weight, with 5 mice per group. Each test group was administered a predetermined dose of the drug conjugate, and a PBS control group was included. The administration dose for all mice was calculated based on their body weight. A single dose was administered via subcutaneous injection in the abdomen. Each drug conjugate was administered as a 0.1 mg / mL (calculated as siRNA) solution in PBS, with a dosing volume of 10 mL / kg (mouse body weight). That is, the administration dose of each drug conjugate was 1 mg / kg (siRNA / mouse body weight). The PBS control group was administered 10 mL / kg (mouse body weight) of a PBS solution without the siRNA conjugate. The day of administration was recorded as day 0 (D0). Plasmid injection was performed on day 3 (D3) after administration, and all 5 mice in each group were sacrificed on day 4 (D4). Dissection was performed on the sacrificed mice, and the liver tissue from each sacrificed mouse was collected. The liver 117 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 tissue was cut into approximately 2 mm3 small pieces and preserved in RNAlaterTM solution.

[0267] For each mouse, an appropriate amount of liver tissue sample was taken out from RNAlaterTM solution. The liver tissue sample was disrupted for 60 s in a Tissuelyser II automatic tissue homogenizer. Then, total RNAwas extracted using an automatic nucleic acid extractor (purchased from Zhejiang Hanwei Technology Co., Ltd.) and a nucleic acid extraction kit (purchased from Zhejiang Hanwei Technology Co., Ltd., GO-MNTR‑100) according to the standard operating procedure for total RNA extraction.

[0268] For each mouse, 1 µg of total RNA was used for reverse-transcription using a reverse transcription kit (Thermo Fisher Scientific, RevertAid First Strand cDNA Synthesis Kit, K1622) with Oligo(dT)18 as the reverse transcription primer. A 20µL reverse transcription system was prepared, and the reverse transcription reaction was completed according to the instruction manual. After the reaction, 60 µL of RNase-Free water was added to the reverse transcription system to obtain a cDNA solution. Next, the expression level of the target gene mRNA in the animals was detected on a real-time quantitative PCR system (Bio-Rad, CFX Opus 384) using a real-time quantitative PCR kit (Thermo Fisher Scientific, TaqMan Fast Advanced Master Mix, 4444557). In this real-time quantitative PCR method, the Nero gene on the plasmid backbone was used as an internal reference gene, and primers for the target gene and primers for the Nero internal reference gene were used to detect the target gene and the Nero internal reference gene, respectively. The sequences of the detection primers are shown in Table 14. Table 14: Sequences of Detection Primers Gene Primer type Primer sequence Fluorescen t group Target gene C3 Forward primer / Reverse primer 5’-GCCTTTGTTCTCATCTCGCT‑3’ (SEQ ID NO: 949) / Probe primer 5’FAM; 3’MGB Reference gene Ner o Forward primer 5’-CGTTGGCTACCCGTGATATT‑3’ (SEQ ID NO: 951) / Reverse primer / Probe primer 5’VIC; 3’MGB

[0269] A 10 µL Real-time PCR reaction system was prepared for each PCR detection well according to the method described in the instruction manual of the real-time quantitative PCR kit. Each reaction system contained 4 µL of the cDNA solution obtained from the reverse transcription reaction described above, 5 µL of TaqMan™ Fast Advanced Master Mix (2×), 0.15 µL of 10 µM forward primer, 0.15 µL of 10 µM reverse primer (for primer information, see Table 8), 0.15 µL of 10 µM probe primer, and 0.55 µL of RNase-Free H2O. The prepared reaction system was placed on a real-time quantitative PCR system (Bio-Rad, CFX Opus 384), and Real-time PCR amplification was performed using a two-step method. The amplification program was: 50°C for 2 min, pre-denaturation at 95°C for 20 s, and then 40 cycles of denaturation at 95°C for 3 s and annealing and extension at 60°C for 30 s. In this real-time quantitative PCR method, the ΔΔCt method was used to perform relative quantitative calculations on the expression level and inhibition rate of the target gene mRNA in each test group according to the technical method described above in DETAILED DESCRIPTION.

[0270] The results of Example 2 showed that at a dose of 1 mg / kg, RZ002003, RZ002006, RZ002011, RZ002015, and RZ002031 significantly inhibited the expression of C3 gene mRNA in mouse liver tissue (FIG. 1, Table 15). 118 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 Table 15: Inhibitory Activity of siRNA Conjugates on C3 Gene mRNA in Liver Tissue of BALB / c-HDI Mice after Administration of the siRNA Conjugates Group 1 mg / kg Relative remaining expression level (%) STDEV PBS 100.00 21.64 RZ000001 107.29 21.82 RZ002001 71.27 40.59 RZ002002 49.64 13.24 RZ002003 27.97 15.06 RZ002004 47.73 9.78 RZ002005 60.75 11.91 RZ002006 23.39 4.50 RZ002007 40.26 10.97 RZ002008 49.83 7.77 RZ002009 43.55 9.71 RZ002010 57.71 14.87 RZ002011 39.12 16.78 RZ002012 109.83 39.57 RZ002013 90.25 15.70 RZ002015 12.45 3.11 RZ002016 39.26 6.37 RZ002017 75.85 16.85 RZ002018 42.00 16.33 RZ002019 66.95 11.04 RZ002020 91.29 24.69 RZ002021 55.92 17.25 RZ002022 117.15 74.63 RZ002023 33.31 27.44 RZ002024 45.34 13.76 RZ002025 74.24 33.05 RZ002026 68.33 25.03 RZ002027 53.43 13.26 RZ002028 63.89 28.42 RZ002029 58.55 20.98 RZ002030 63.63 19.14 RZ002031 17.91 7.95 RZ002032 67.48 23.43 Example 3: Toxicological Assessment of siRNA Conjugates with L96 Moiety Conjugated to 3’-end of Sense Strand in ICR Mice

[0271] This example assessed the nature and extent of toxic reactions of L96 moiety conjugates RZ002003, RZ002006, RZ002011, RZ002015, and RZ002031 in ICR mice via a single subcutaneous injection at 300 mg / kg. 119 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 Animal grouping, administration, and tissue sample collection

[0272] 6 to 8-week-old ICR mice (purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd.) were randomly grouped by body weight, with 10 mice per group, half male and half female. Each test group was administered a predetermined dose of the drug conjugate, and a PBS control group was included. The administration dose for all mice was calculated based on their body weight. A single dose was administered via subcutaneous injection in the abdomen. Each drug conjugate was administered as a 30 mg / mL (calculated as siRNA) solution in PBS, with a dosing volume of 10 mL / kg (mouse body weight). That is, the administration dose of each drug conjugate was 300 mg / kg (siRNA / mouse body weight). The PBS control group was administered 10 mL / kg (mouse body weight) of a PBS solution without the siRNA conjugate and observed for 14 days. The day of administration was recorded as day 0 (D0). During the experiment, clinical observations were performed at least once daily after the first administration, and body weight and food consumption were measured twice a week. On day 14 (D14) of the experiment, blood was collected from all animals (mice were fasted for no less than 12 h before sampling and detection, with free access to water) for hematology and blood biochemistry tests. Collected blood was anticoagulated with EDTA-K2, and a complete blood count was performed using an automatic modular hematology and body fluid analyzer (Sysmex XN‑10B1). Blood samples (without anticoagulant) were collected and left at room temperature for about 30 min. After blood coagulation, the samples were centrifuged at 2000 g for 10 min at 4°C, and blood biochemistry was tested using a fully automatic biochemical analyzer (Sysmex BX‑4000). On day 14 (D14) of the experiment, all animals were desected. Before desection, the mice to be desected were fasted for at least 12 h with free access to water, anesthetized with Zoletil 50 (Virbac, France, 8G4VA), and then euthanized by exsanguination from the abdominal aorta after blood collection, followed by gross necropsy observation. Histopathological examinations were performed on the livers and kidneys of all animals, as shown in FIG. 2 (using hematoxylin-eosin staining). The results showed that each test sample had no significant effect on the general condition, body weight, food consumption, and gross necropsy observations of the ICR mice. Compared to the PBS group, at a dose of 300 mg / kg (siRNA / mouse body weight), no significant abnormalities were observed in the hematology and blood biochemistry of animals in the RZ002003, RZ002006, RZ002011, and RZ002015 groups; no significant abnormalities were observed in the hematology of animals in the RZ002031 group, with slight elevations in ALT and AST. Example 4: In vitro Activity Assessment of siRNA Conjugates with (CR01008)×3 Moiety Conjugated to 3’-end of Sense Strand

[0273] In this example, the inhibitory activity of (CR01008)×3 moiety siRNA conjugates on the target gene C3 mRNA in cells was assessed using a target gene inhibition activity assay in the human liver cancer HepG2 cell line. Preparation of test samples

[0274] After each of the above siRNA test samples was centrifuged, an appropriate amount of PBS was added to each tube to dissolve the siRNA, and 20µM stock solutions were prepared. The stock solutions were then further serially diluted with PBS into 0.5µM and 0.05µM working solutions. Dose experiments were performed at final duplex concentrations of 5 nM and 0.5 nM. 96-well transfection and detection

[0275] HepG2 cells grown to near confluence were digested with trypsin, the cells were washed to prepare a cell suspension, and 100 µL of the cell suspension, containing 12,000 cells, was added to each well of a 96-well plate and cultured in an incubator at 37°C with 5% CO2. After the cells had adhered for 24 h, the DMEM medium in the 96-well plate was aspirated, 80 µL of Opti-MEMTM medium was added to each well, and the 96-well plate was then placed back in the incubator for continued culture. 1 µL of 0.1 µM and 0.01 µM working solutions were dispersed in 9 µL of Opti-MEM to form siRNA mixtures, and 0.3µL of RNAiMAX was dispersed in 9.7µL of Opti-MEM and mixed with each siRNA mixture to form transfection complexes. The transfection complexes were incubated at room temperature for 10 min and then added to the 96-well plate at 20 µL / well. After culturing for 4 h, 100 µL of DMEM medium containing 20% FBS was added to each well, and the 96-well plate was placed in the incubator for continued culture for 24 h. For the Mock control group: 0.3 µL of RNAiMAX was dispersed in 9.7 µL of Opti-MEM, and then 10 µL of Opti-MEM was added, followed by incubation at room temperature for 10 min; it was then added to the 96-well plate at 20µL / well. After culturing for 4 h, 100µL of DMEM medium containing 20% FBS was added to each well, and the 96-well plate was placed in the incubator for continued culture for 24 h.

[0276] The 96-well plate was taken out, and total RNA was extracted using an automatic nucleic acid extractor (purchased from Zhejiang Hanwei Technology Co., Ltd.) and a nucleic acid extraction kit (purchased from Zhejiang Hanwei Technology Co., Ltd., GO-MNTR‑100) according to the standard operating procedure for total RNA extraction. 120 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55

[0277] A reverse transcription kit (Thermo Fisher Scientific, RevertAid First Strand cDNA Synthesis Kit, K1622) was used with Oligo(dT)18 as the reverse transcription primer. A 20 µL reverse transcription system was prepared, and the reverse transcription reaction was completed according to the method described in the instruction manual. Next, a real- time quantitative PCR kit (Thermo Fisher Scientific, TaqMan Fast Advanced Master Mix, 4444557) was used to detect the expression level of the target gene mRNA in HepG2 cells on a real-time quantitative PCR system (Bio-Rad, CFX Opus 384). In this real-time quantitative PCR method, the glyceraldehyde‑3-phosphate dehydrogenase (GAPDH) gene was used as an internal reference gene, and primers for the target gene and primers for the GAPDH internal reference gene were used to detect the target gene and the GAPDH internal reference gene, respectively. The sequences of the detection primers are shown in Table 16. Table 16: Sequences of Detection Primers Gene Primer type Primer sequence Fluorescent group Forward primer / Target gene C3 Reverse primer / Probe primer 5’FAM; 3’MGB Forward primer / Reference gene GAPDH Reverse primer / Probe primer 5’VIC; 3’MGB

[0278] A 10 µL Real-time PCR reaction system was prepared for each PCR detection well according to the method described in the instruction manual of the real-time quantitative PCR kit. Each reaction system contained 4 µL of the cDNA solution obtained from the reverse transcription reaction described above, 5 µL of TaqManTM Fast Advanced Master Mix (2×), 0.15µL of 10µM forward primer,0.15µL of 10µM reverse primer (for primer information, see Table14), 0.15µL of 10 µM probe primer, and 0.55 µL of RNase-Free H2O. The prepared reaction system was placed on a real-time quantitative PCR system (Bio-Rad, CFX Opus 384), and Real-time PCR amplification was performed using a two-step method. The amplification program was: 50°C for 2 min, followed by pre-denaturation at 95°C for 20 s, and then 40 cycles of denaturation at 95°C for 3 s and annealing and extension at 60°C for 30 s. In this real-time quantitative PCR method, the ΔΔCt method was used to perform relative quantitative calculations on the expression level and inhibition rate of the target gene mRNA in each test group according to the technical method described above in DETAILED DESCRIPTION. Table 17: Inhibitory Activity of siRNA Conjugates on the Target Gene C3 mRNA in HepG2 Cells After Administration of the siRNA Conjugates Name 5 nM 0.5 nM Relative remaining expression level (%) STDEV Relative remaining expression level (%) STDEV Mock 100.00 3.12 100.00 3.12 121 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) Name 5 nM 0.5 nM Relative remaining expression level (%) STDEV Relative remaining expression level (%) STDEV RZ002033 9.16 0.94 31.05 0.71 RZ002034 8.80 0.76 24.48 6.22 RZ002099 7.65 1.92 32.10 1.97 RZ002036 11.98 0.18 24.00 1.03 RZ002037 11.26 0.61 27.13 0.60 RZ002038 9.04 1.21 30.71 0.51 RZ002039 10.98 0.37 36.07 1.88 RZ002040 12.62 0.59 31.73 1.40 RZ002041 10.48 1.47 27.68 6.13 RZ002042 9.07 0.71 26.13 1.61 RZ002043 8.04 0.71 30.68 0.16 RZ002050 17.65 2.29 36.54 2.38 RZ002051 16.27 2.17 27.43 6.32 RZ002106 13.92 1.18 30.03 0.72 RZ002053 14.88 4.01 26.00 0.90 RZ002054 17.8 10.42 28.19 2.16 RZ002055 15.57 2.71 24.53 2.19 RZ002056 16.48 2.71 43.19 1.83 RZ002057 17.52 3.31 40.75 5.49 RZ002058 14.75 0.11 31.72 1.35 RZ002059 11.28 1.47 26.63 4.85 RZ002060 10.28 1.48 25.93 0.70 RZ002066 20.09 9.16 42.86 15.61 RZ002067 16.89 4.88 27.44 1.50 RZ002068 15.99 9.04 38.27 2.66 RZ002069 18.44 5.73 31.22 2.43 RZ002070 16.77 8.10 34.34 1.93 RZ002071 16.24 5.08 32.74 1.91 RZ002072 24.64 4.76 53.87 6.33 RZ002073 34.06 3.25 51.24 0.29 RZ002074 14.91 0.16 44.37 1.31 RZ002075 10.69 0.15 41.05 4.82 RZ002076 10.76 1.08 41.10 1.94 RZ002082 21.93 5.23 28.44 2.52 RZ002083 19.48 8.68 25.39 1.18 RZ002084 15.71 8.17 27.85 2.26 RZ002085 23.27 5.75 33.20 2.55 RZ002086 21.12 8.65 34.10 6.23 122 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) Name 5 nM 0.5 nM Relative remaining expression level (%) STDEV Relative remaining expression level (%) STDEV RZ002087 21.77 0.85 36.53 3.15 RZ002088 34.48 0.91 69.65 6.92 RZ002089 31.49 5.73 54.13 8.64 RZ002090 14.91 0.03 51.77 15.52 RZ002091 11.73 0.65 36.02 0.00 RZ002092 11.67 1.28 37.72 0.36

[0279] The results of Example 4 showed that at doses of 5 nM and 0.5 nM, different siRNA conjugates modified with CR01008 significantly inhibited C3 gene mRNA expression in HepG2 cells (Table 17). Example 5: Assessment of mRNA Knockdown Effect of siRNA Conjugates with (CR01008)×3 Moiety Conju- gated to 3’-end of Sense Strand in Normal Macaca fascicularis

[0280] This example assessed the inhibitory activity of RZ002099, RZ002101, RZ002106, and RZ002113 on the target gene C3 mRNA in Macaca fascicularis. Animal grouping, administration, and tissue sample collection

[0281] HealthyMacaca fascicularisweighing 3 to 5 kg were grouped, with 4Macaca fascicularisper group, half male and half female. Each test group was administered a predetermined dose of the drug conjugate, and a PBS control group was included. The administration dose for all animals was calculated based on their body weight. A single dose was administered via subcutaneous injection in the abdomen. Each drug conjugate wasadministered as a 9 mg / mL(calculated as siRNA) solution in PBS, with a dosing volume of 1 mL / kg (Macaca fascicularis body weight). That is, the administration dose of each drug conjugate was 9 mg / kg (siRNA / Macaca fascicularis body weight). The PBS control group was administered 1 mL / kg (Macaca fascicularis body weight) of a PBS solution without the siRNA conjugate. The day of administration was recorded as day 0 (D0). On day 14 (D14) after administration, liver biopsies were performed on the Macaca fascicularis in each group, and the liver biopsy tissues were immediately preserved in RNAlaterTM solution.

[0282] For eachMacaca fascicularis, a liver tissue sample was taken from RNAlaterTM solution. The liver tissue sample was disrupted for 60 s in a Tissuelyser II automatic tissue homogenizer. Then, total RNA was extracted using an automatic nucleic acid extractor (purchased from Zhejiang Hanwei Technology Co., Ltd.) and a nucleic acid extraction kit (purchased from Zhejiang Hanwei Technology Co., Ltd., GO-MNTR‑100) according to the standard operating procedure for total RNA extraction.

[0283] For eachMacaca fascicularis, 1 µg of total RNA was taken for reverse-transcription using a reverse transcription kit (Thermo Fisher Scientific, RevertAid First Strand cDNA Synthesis Kit, K1622) with Oligo(dT)18 as the reverse transcription primer. A 20 µL reverse transcription system was prepared, and the reverse transcription reaction was completed according to the method described in the instruction manual of the reverse transcription kit. After the reaction, 60 µL of RNase-Free water was added to the reverse transcription system to obtain a cDNA solution. Next, the expression level of the target gene mRNA in the animals was detected on a real-time quantitative PCR system (Roche, Lightcycler 480II) using a real-time quantitative PCR kit (Thermo Fisher Scientific, TaqMan Fast Advanced Master Mix, 4444557). In this real-time quantitative PCR method, the glyceraldehyde‑3-phosphate dehydrogenase (GAPDH) gene was used as an internal reference gene, and primers for the target gene and primers for the GAPDH internal reference gene were used to detect the target gene and the GAPDH internal reference gene, respectively. The sequences of the detection primers are shown in Table 18. 123 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 Table 18: Sequences of Detection Primers Gene Primer type Primer sequence Fluorescent group Target gene C3 Forward primer / Reverse primer / Probe primer 5’FAM; 3’MGB Reference gene GAPDH Forward primer / Reverse primer / Probe primer 5’VIC; 3’MGB

[0284] A 10 µL Real-time PCR reaction system was prepared for each PCR detection well according to the method described in the instruction manual of the real-time quantitative PCR kit. Each reaction system contained 4 µL of the cDNA solution obtained from the reverse transcription reaction described above, 5 µL of TaqManTM Fast Advanced Master Mix (2×), 0.15µL of 10µM forward primer,0.15µL of 10µM reverse primer (for primer information, see Table16), 0.15µL of 10 µM probe primer, and 0.55 µL of RNase-Free H2O. The prepared reaction system was placed on a real-time quantitative PCR system (Bio-Rad, CFX Opus 384), and Real-time PCR amplification was performed using a two-step method. The amplification program was: 50°C for 2 min, followed by pre-denaturation at 95°C for 20 s, and then 40 cycles of denaturation at 95°C for 3 s and annealing and extension at 60°C for 30 s. In this real-time quantitative PCR method, the ΔΔCt method was used to perform relative quantitative calculations on the expression level and inhibition rate of the target gene mRNA in each test group according to the technical method described above in DETAILED DESCRIPTION.

[0285] The results of Example 5 showed that at a single dose of 9 mg / kg, RZ002099, RZ002101, RZ002106, and RZ002113 significantly inhibited C3 gene mRNA expression (Table 19, FIG. 4). Table 19: Change of C3 mRNA Level in Macaca fascicularis Liver After Administration of the siRNA Conjugates Group C3 mRNA level (9 mg / kg, D14) Relative remaining expression level (%) STDEV PBS 100.00 28.24 RZ002099 15.51 5.60 RZ002101 22.29 12.07 RZ002106 9.86 1.44 RZ002113 12.96 6.94 124 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 Example 6: Assessment of C3 Protein Reduction Caused by siRNA Conjugates with (CR01008)×3 Moiety at 3’-end of Sense Strand in Normal Macaca fascicularis

[0286] This example assessed the expression of C3 protein in the serum ofMacaca fascicularis at different time points after a single administration of (CR01008)×3 moiety conjugates RZ002099, RZ002101, RZ002106, and RZ002113 using an ELISA method. Animal grouping, administration, and tissue sample collection

[0287] Healthy Macaca fascicularis weighing 3 to 5 kg were grouped according to serum C3 protein levels, with 4 Macaca fascicularis per group, half male and half female. Each test group was administered a predetermined dose of the drug conjugate, and a PBS control group was included. The administration dose for all animals was calculated based on their body weight. A single dose was administered via subcutaneous injection in the abdomen. Each drug conjugate was administered as a 9 mg / mL (calculated as siRNA) solution in PBS, with a dosing volume of 1 mL / kg (Macaca fascicularis body weight). That is, the administration dose of each drug conjugate was 9 mg / kg (siRNA / Macaca fascicularis body weight). The PBS control group was administered 1 mL / kg (Macaca fascicularisbody weight) of a PBS solution without the siRNA conjugate.Macaca fascicularis serum was collected before administration (recorded as pre-dose), on the day of administration recorded as day 0 (D0), and on day 7 (D7), day 14 (D14), day 21 (D21), day 28 (D28), day 35 (D35), day 42 (D42), day 49 (D49), day 56 (D56), day 63 (D63), day 70 (D70), day 77 (D77), day 84 (D84), day 91 (D91), day 98 (D98), and day 105 (D105) after administration. C3 protein expression was measured using a human complement C3 ELISA kit (Hycult Biotech, HK366‑01).

[0288] The results of Example 6 showed that at a single dose of 9 mg / kg, RZ002099, RZ002101, RZ002106, and RZ002113 all significantly reduced the C3 protein level in Macaca fascicularis serum. Among them, the C3 protein reduction caused by RZ002106 reached up to 90%, with an 80% protein reduction still observed at D70, and the protein level had not returned to the pre-dose level by D105 (FIG. 5, Table 20). Table 20: Change of C3 Protein Level in Macaca fascicularis Serum after Administration of the siRNA Conjugates Group pre-dose D7 D14 D21 Relative remaining expression level (%) STDEV Relative remaining expression level (%) STDEV Relative remaining expression level (%) STDEV Relative remaining expression level (%) STDEV PBS 100.00 0.00 100.20 6.80 95.70 14.00 104.10 18.10 RZ002099 100.00 0.00 48.57 12.93 27.63 11.82 30.95 14.81 RZ002101 100.00 0.00 47.87 15.67 26.08 8.71 22.75 10.48 RZ002106 100.00 0.00 44.31 6.21 21.03 5.24 11.88 3.48 RZ002113 100.00 0.00 41.55 13.82 21.54 9.85 17.12 8.27 Group D28 D35 D42 D49 Relative remaining expression level (%) STDEV Relative remaining expression level (%) STDEV Relative remaining expression level (%) STDEV Relative remaining expression level (%) STDEV PBS 82.90 10.00 79.30 7.90 80.60 4.50 88.10 8.40 RZ002099 24.25 11.70 26.75 8.80 30.29 15.16 37.84 24.22 RZ002101 19.11 6.12 20.99 4.49 23.77 6.44 21.76 4.33 RZ002106 13.34 6.63 12.15 4.03 11.87 4.67 9.01 1.95 RZ002113 16.91 5.24 15.70 5.49 15.73 5.48 14.45 5.65 125 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) Group D56 D63 D70 D77 Relative remaining expression level (%) STDEV Relative remaining expression level (%) STDEV Relative remaining expression level (%) STDEV Relative remaining expression level (%) STDEV PBS 79.41 7.84 84.87 17.19 87.71 13.88 103.71 10.45 RZ002099 34.34 26.33 / / / / / / RZ002101 25.18 3.66 / / / / / / RZ002106 9.51 2.59 15.41 5.99 15.17 4.63 24.45 8.90 RZ002113 19.25 8.15 / / / / / / Group D84 D91 D98 D105 Relative remaining expression level (%) STDEV Relative remaining expression level (%) STDEV Relative remaining expression level (%) STDEV Relative remaining expression level (%) STDEV PBS 99.52 15.57 91.57 3.00 95.00 1.80 117.08 9.46 RZ002099 / / / / / / / / RZ002101 / / / / / / / / RZ002106 38.93 16.88 34.23 13.01 36.06 14.85 36.61 13.59 RZ002113 / / / / / / / / Example 7: Effect of siRNA Conjugates with (CR01008)×3 Conjugated to 3’-end of Sense Strand on Comple- ment Pathway Activity in Normal Macaca fascicularis

[0289] This example evaluated the complement activity in the serum ofMacaca fascicularis at different time points after a single administration of (CR01008)×3 (i.e., (CR01008×3) ligand) conjugates RZ002099, RZ002101, RZ002106, and RZ002113. Animal grouping, administration, and tissue sample collection

[0290] HealthyMacaca fascicularisweighing 3 to 5 kg were grouped, with 4Macaca fascicularisper group, half male and half female. Each test group was administered a predetermined dose of the drug conjugate, and a PBS control group was included. The administration dose for all animals was calculated based on their body weight. A single dose was administered via subcutaneous injection in the abdomen. Each drug conjugate wasadministered as a 9 mg / mL(calculated as siRNA) solution in PBS, with a dosing volume of 1 mL / kg (Macaca fascicularis body weight). That is, the administration dose of each drug conjugate was 9 mg / kg (siRNA / Macaca fascicularis body weight). The PBS control group was administered 1 mL / kg (Macaca fascicularis body weight) of a PBS solution without the siRNA conjugate. Macaca fascicularis serum in all groups was collected before administration (recorded as pre-dose), on the day of administration recorded as day 0 (D0), and on day 7 (D7), day 14 (D14), day 21 (D21), day 28 (D28), day 35 (D35), day 42 (D42), day 49 (D49), day 56 (D56), day 63 (D63), day 70 (D70), day 77 (D77), day 84 (D84), day 91 (D91), day 98 (D98), and day 105 (D105) after administration. The activities of the complement system alternative pathway (CAP) and the complement system classical pathway (CCP) were determined using the WIESLAB® Complement System Alternative Pathway Kit (COMPL AP330 RUO, IBL America) and the Complement System Classical Pathway Kit (COMPL CP310 RUO, IBL America).

[0291] The results of Example 7 showed that at a single dose of 9 mg / kg, RZ002099, RZ002101, RZ002106, and RZ002113 all significantly inhibited the complement alternative pathway in the serum ofMacaca fascicularis, but had no significant effect on the complement classical pathway in the serum (FIG. 6, FIG. 7, Table 21, Table 22). 126 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 Table 21: Change of Serum CAP Activity in Macaca fascicularis after Administration of the siRNA Conjugates Group pre-dose D7 D14 D21 Relative remaining activity (%) STDEV Relative remaining activity (%) STDEV Relative remaining activity (%) STDEV Relative remaining activity (%) STDEV PBS 100.00 0.00 88.36 21.09 101.24 11.59 92.70 4.88 RZ002099 100.00 0.00 50.06 38.25 37.05 44.75 53.62 38.25 RZ002101 100.00 0.00 70.48 21.06 48.03 13.21 35.31 13.64 RZ002106 100.00 0.00 70.73 32.47 20.20 13.96 9.87 8.83 RZ002113 100.00 0.00 74.86 27.76 32.66 34.63 27.77 27.59 Group D28 D35 D42 D49 Relative remaining activity (%) STDEV Relative remaining activity (%) STDEV Relative remaining activity (%) STDEV Relative remaining activity (%) STDEV PBS 83.52 15.70 88.55 8.63 93.52 6.11 85.74 6.29 RZ002099 33.90 48.51 65.90 33.90 44.33 42.25 53.30 42.55 RZ002101 21.65 17.68 38.20 22.71 35.92 17.57 46.36 15.37 RZ002106 10.69 11.51 4.69 4.04 7.55 10.01 9.04 10.40 RZ002113 22.33 26.74 21.20 26.92 18.09 22.65 37.16 37.55 Group D56 D63 D70 D77 Relative remaining activity (%) STDEV Relative remaining activity (%) STDEV Relative remaining activity (%) STDEV Relative remaining activity (%) STDEV PBS 87.26 12.82 84.05 13.23 85.94 19.26 90.42 10.01 RZ002099 65.11 27.63 / / / / / / RZ002101 58.12 17.72 / / / / / / RZ002106 8.63 10.62 30.58 30.75 31.67 29.63 66.68 38.17 RZ002113 48.77 33.16 / / / / / / Group D84 D91 D98 D105 Relative remaining activity (%) STDEV Relative remaining activity (%) STDEV Relative remaining activity (%) STDEV Relative remaining activity (%) STDEV PBS 82.42 17.05 77.47 18.50 82.48 12.97 91.80 10.47 RZ002099 / / / / / / / / RZ002101 / / / / / / / / RZ002106 59.91 37.62 63.49 32.68 74.24 36.30 72.33 31.73 RZ002113 / / / / / / / / 127 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 Ta bl e 22 :C ha ng e of Se ru m C C P Ac tiv ity in M ac ac a fa sc ic ul ar is af te rA dm in is tra tio n of th e si R N A C on ju ga te s G ro up pr e- do se D 7 D 21 D 28 D 35 D 42 R el at iv e re m ai n in g ac tiv it y (% ) ST D EV R el at iv e re m ai n in g ac tiv it y (% ) ST D EV R el at iv e re m ai n in g ac tiv it y (% ) ST D EV R el at iv e re m ai n in g ac tiv it y (% ) ST D EV R el at iv e re m ai n in g ac tiv it y (% ) ST D EV R el at iv e re m ai n in g ac tiv it y (% ) ST D EV PB S 10 0. 00 0. 00 10 4. 01 11 .1 6 99 .7 9 7. 36 10 4. 11 16 .2 3 97 .0 8 6. 62 91 .5 7 5. 24 R Z0 02 09 9 10 0. 00 0. 00 11 3. 28 16 .7 0 10 8. 76 10 .8 0 10 9. 49 21 .9 2 10 3. 35 3. 85 91 .4 3 13 .7 6 R Z0 02 10 1 10 0. 00 0. 00 11 2. 86 9. 29 93 .6 1 6. 07 10 8. 28 8. 23 87 .5 9 6. 20 86 .3 9 2. 74 R Z0 02 10 6 10 0. 00 0. 00 10 2. 62 8. 50 89 .2 4 6. 88 91 .6 0 5. 93 81 .1 6 3. 79 79 .8 6 4. 17 R Z0 02 11 3 10 0. 00 0. 00 10 7. 08 6. 66 92 .1 7 7. 22 10 4. 28 9. 25 10 1. 74 11 .1 4 98 .1 4 3. 99 128 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 Example 8: In Vivo Efficacy Evaluation of siRNA Conjugates with L96 Ligand Conjugated to 3’-end of the Sense Strand in CFA-hIgA Mice

[0292] In this embodiment, an IgA nephropathy mouse model was constructed by inducing IgA-humanized mice with Complete Freund’s Adjuvant (CFA). The inhibitory effect of RZM02003 on mouse C3 mRNA in CFA-IgA mice was detected by a QPCR method; the expression level of mouse C3 protein in serum at different time points was determined by an enzyme-linked immunosorbent assay (ELISA); the deposition of mouse C3 protein and human IgA immune protein in kidney tissue was observed by an immunofluorescence method; and kidney tissue lesions were observed by a Periodic Acid-Schiff (PAS) staining method. Animal grouping, administration, and tissue sample collection

[0293] The CFA-hIgA model mice were randomly grouped, with 3 mice in each group. Each test group was administered a predetermined dose of a drug conjugate, and a PBS control group was included. For all mice, the drug dose was calculated based on body weight, and the administration volume was 10 mL / kg (mouse body weight). A single dose of RZM02003 was administered via subcutaneous injection in the abdomen. Each drug conjugate was administered as a 0.9 mg / mL (calculated as siRNA) solution in PBS. That is, the administration dose of the drug conjugate was 9 mg / kg (siRNA / mouse body weight). The PBS control group (Model PBS Control Group) was administered with a PBS solution without an siRNA conjugate at 10 mL / kg (mouse body weight).

[0294] Before administration, the upper pole of kidney tissue of each mouse after modeling was collected by an open surgical method. A portion of the kidney tissue was fixed in a 10% formalin solution, embedded in paraffin, and sectioned for PAS staining to observe pre-administration kidney tissue lesions; another portion of the kidney tissue was embedded and fixed with OCT (optimal cutting temperature compound) and then cryosectioned for immunofluorescence staining of kidney tissue to observe pre-administration mouse C3 deposition and human IgA deposition in the kidney. The day of administration was recorded as day 0 (D0). On day 14 (D14) after administration, 3 mice from all groups were euthanized, and on day 28 (D28) after administration, 3 mice from all groups were euthanized. Serum from all euthanized mice was collected, and the C3 protein expression in the serum was detected using a mouse complement C3 ELISA kit (abcam, 157711). Dissection was performed on the euthanized mice, respectively. The liver tissue of each euthanized mouse was collected and cut into small pieces of about 2 mm3 and stored in RNAlater. The kidney tissue of each euthanized mouse was collected. A portion of the kidney tissue was fixed in a 10% formalin solution, embedded in paraffin, and sectioned for PAS staining to observe kidney tissue lesions on D14and D28after administration; another portion of the kidney tissue was embedded and fixed with OCT, and then cryosectioned for immunofluorescence staining of kidney tissue to observe mouse C3 deposition and human IgA deposition in the kidney on D14 and D28 after administration.

[0295] The results of Example 8 showed that at a single dose of 9 mg / kg, RZM02003 significantly reduced the C3 mRNA and protein levels in CFA-IgA mice. On day 14 after administration, the reduction of C3 mRNA and protein reached 98% (FIG. 8, Table 23) and 78% (FIG. 9, Table 24), respectively. On day 28 after administration, the reduction of C3 mRNA was still greater than 98% (FIG. 8, Table 23), and the reduction of C3 protein was about 70% (FIG. 9, Table 24).

[0296] The results of Example 8 showed that at a single dose of 9 mg / kg, RZM02003 could reduce C3 deposition in kidney tissue, and a significant reduction in C3 fluorescence staining in kidney tissue was observed on both day 14 and day 28 after administration (FIG. 10). Table 23: Inhibitory Activity of siRNA Conjugates on C3 mRNA in the Liver of CFA-hIgA Mice after Administration of the siRNA Conjugates Group C3 mRNA Relative remaining expression level (%) STDEV Model PBS (D14) 100.00 15.63 RZM02003 (D14) 1.11 1.05 Model PBS (D28) 100.00 8.55 RZM02003 (D28) 1.67 0.38 129 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 Table 24: Change of Serum C3 Protein Level in CFA-hIgA Mice after Administration of the siRNA Conjugate Group Serum C3 protein Relative remaining expression level (%) STDEV Model PBS (D14) 100.00 22.24 RZM02003 (D14) 21.80 4.17 Model PBS (D28) 100.00 29.70 RZM02003 (D28) 30.14 10.12

[0297] The double-stranded oligonucleotide for inhibiting C3 gene expression, the conjugate thereof, and uses thereof provided by the present disclosure have been described in detail above. Specific examples have been used herein to illustrate the principles and embodiments of the present disclosure, and the description of the above examples is only for the purpose of helping to understand the method of the presentdisclosure and its core idea. It should be pointed out that, for a person skilled in the art, several improvements and modifications can be made to the present disclosure without departing from the principles of the present disclosure, and these improvements and modifications also fall within the protection scope of the claims of the present disclosure. Claims 1. A double-stranded oligonucleotide for inhibiting expression of C3 gene, comprising a sense strand and an antisense strand; from 5’-end to 3’-end, nucleotides of positions 2 to 19 of the antisense strand comprise a complementary region to a C3 RNA transcript, wherein the complementary region comprises at least 17 contiguous nucleotides of any one of the nucleotide sequences as set forth in SEQ ID NOs: 213 to 424 or a nucleotide sequence having 1, 2 or 3 nucleotide differences from the at least 17 contiguous nucleotides; and the sense strand comprises at least 17 nucleotides, and the sense strand and the antisense strand are complementary or substantially complementary to form a duplex region, wherein being substantial complemen- tary means that the sense strand and the antisense strand have no more than 3 nucleotide mismatches in the duplex region. 2. The double-stranded oligonucleotide according to claim 1, wherein the antisense strand comprises a nucleotide sequence having 0, 1, 2 or 3 nucleotide differences from any one of the sequences as set forth in SEQ ID NOs: 213 to 424; optionally, the antisense strand comprises a nucleotide sequence having 0 or 1 nucleotide difference from any one of the sequences as set forth in SEQ ID NOs: 213 to 424; and optionally, the antisense strand is selected from or comprises any one of the nucleotide sequences as set forth in SEQ ID NOs: 213 to 424. 3. The double-stranded oligonucleotide according to claim 1, wherein the sense strand comprises at least 17 contiguous nucleotides of any one of the nucleotide sequences as set forth in SEQ ID NOs: 1 to 212 or a nucleotide sequence having 1, 2 or 3 nucleotide differences from the at least 17 contiguous nucleotides; optionally, the sense strand comprises a nucleotide sequence having 0, 1, 2 or 3 nucleotide differences from any one of the sequences as set forth in SEQ ID NOs: 1 to 212; optionally, the sense strand comprises a nucleotide sequence having 0 or 1 nucleotide difference from any one of the nucleotide sequences as set forth in SEQ ID NOs: 1 to 212; and optionally, the sense strand is selected from or comprises any one of the nucleotide sequences as set forth in SEQ ID NOs: 1 to 212. 4. The double-stranded oligonucleotide according to claim 3, wherein the antisense strand comprises a nucleotide sequence having 0 or 1 nucleotide difference from any one of the nucleotide sequences as set forth in SEQ ID NOs: 241, 242, 285, 357 or 403; 130 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 optionally, the antisense strand comprises any one of the nucleotide sequences as set forth in SEQ ID NOs: 241, 242, 285, 357 or 403; optionally, the sense strand comprises a nucleotide sequence having 0 or 1 nucleotide difference from any one of the nucleotide sequences as set forth in SEQ ID NOs: 29, 30, 73, 145 or 191; optionally, the sense strand comprises any one of the nucleotide sequences as set forth in SEQ ID NOs: 29, 30, 73, 145 or 191; optionally, the double-stranded oligonucleotide comprises one or more pairs of: an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 241 or a nucleotide sequence having 0 or 1 nucleotide difference therefrom, and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 29 or a nucleotide sequence having 0 or 1 nucleotide difference therefrom; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 242 or a nucleotide sequence having 0 or 1 nucleotide difference therefrom, and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 30 or a nucleotide sequence having 0 or 1 nucleotide difference therefrom; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 285 or a nucleotide sequence having 0 or 1 nucleotide difference therefrom, and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 73 or a nucleotide sequence having 0 or 1 nucleotide difference therefrom; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 357 or a nucleotide sequence having 0 or 1 nucleotide difference therefrom, and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 145 or a nucleotide sequence having 0 or 1 nucleotide difference therefrom; and an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 403 or a nucleotide sequence having 0 or 1 nucleotide difference therefrom, and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 191 or a nucleotide sequence having 0 or 1 nucleotide difference therefrom; and optionally, the double-stranded oligonucleotide comprises: an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 241 or a nucleotide sequence having 0 or 1 nucleotide difference therefrom, and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 29 or a nucleotide sequence having 0 or 1 nucleotide difference therefrom. 5. The double-stranded oligonucleotide according to any one of claims 1 to 4, wherein each nucleotide of the double- stranded oligonucleotide is independently selected from a modified or unmodified nucleotide; optionally, substantially all nucleotides of the double-stranded oligonucleotide are independently selected from modified nucleotides; optionally, all nucleotides of the double-stranded oligonucleotide are independently selected from modified nucleotides; optionally, each nucleotide of the double-stranded oligonucleotide is independently selected from the group consisting of: a 2’-halogen-modified nucleotide, a 2’-deoxy-modified nucleotide, a 2’-O-optionally substituted C1‑6 alkyl- modified nucleotide, a 2’-O‑(CH2)n‑O-R1-modified nucleotide, a 2’-amino-modified nucleotide, an abasic nu- cleotide or a nucleotide analog, wherein the nucleotide analog is one or more selected from PNA, MNA, BNA, LNA, GNA, TNA and UNA; wherein n is selected from 1 or 2, R1 is selected from an optionally substituted C1‑6 alkyl or an optionally substituted C1‑6 alkoxy; when R1 is substituted, the substituent is selected from a halogen, a C1‑6 alkoxy, a hydroxyl and an amino; optionally, the 2’-halogen-modified nucleotide is a 2’-fluoro-modified nucleotide; optionally, the 2’-O-optionally substituted C1‑6 alkyl-modified nucleotide is a 2’-O-methyl-modified nucleotide; optionally, the 2’-O‑(CH2)n‑O-R1-modified nucleotide is selected from a 2’-O-methoxyethyl-modified nucleotide, a 2’-O-ethoxymethyl-modified nucleotide and a 2’-O‑2,2,2-trifluoroethoxymethyl-modified nucleotide; optionally, the 2’-O‑(CH2)n‑O-R1-modified nucleotide is selected from a 2’-O-methoxyethyl-modified nucleotide; optionally, each nucleotide of the double-stranded oligonucleotide is independently selected from the group consisting of: a 2’-fluoro-modified nucleotide, a 2’-deoxy-modified nucleotide, a 2’-O-methyl-modified nucleotide and a 2’- O-methoxyethyl-modified nucleotide; and optionally, each nucleotide of the double-stranded oligonucleotide is independently selected from the group consisting of: a 2’-fluoro-modified nucleotide, a 2’-O-methyl-modified nucleotide and a 2’-O-methoxyethyl-modified nu- cleotide. 131 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 6. The double-stranded oligonucleotide according to claim 5, wherein the double-stranded oligonucleotide comprises at least one 2’-O-methoxyethyl-modified nucleotide; optionally, the antisense strand comprises at least one 2’-O-methoxyethyl-modified nucleotide; and the sense strand comprises no more than one 2’-O-methoxyethyl-modified nucleotide; optionally, from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, at least 3 nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, no more than one nucleotide at positions 5, 12, 13, and 18 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are independently selected from a 2’-O-methyl-modified nucleotide; in the nucleotide sequence of the antisense strand, at least 4 nucleotides at positions 2, 6, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, any one of the nucleotides at positions 9 to 12 is selected from a 2’-fluoro-modified nucleotide, at least one nucleotide at positions 8 and 15 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are independently selected from a 2’-O-methyl-modified nucleotide; optionally, from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, and the remaining nucleotides are selected from a 2’-O- methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, at least 4 nucleotides at positions 2, 6, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, any one of the nucleotides at positions 9 to 12 is selected from a 2’-fluoro-modified nucleotide, at least one nucleotide at positions 8 and 15 is selected from a 2’-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are independently selected from a 2’-O-methyl-modified nucleotide; optionally, from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, and the remaining nucleotides are selected from a 2’-O- methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, at least 4 nucleotides at positions 2, 6, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, any one of the nucleotides at positions 9 to 12 is selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 8 or 15 is selected from a 2’-O- methoxyethyl-modified nucleotide, and the remaining nucleotides are independently selected from a 2’-O- methyl-modified nucleotide; optionally, the sense strand and the antisense strand of the double-stranded oligonucleotide have a modification pattern selected from (ds‑1) to (ds‑8): (ds‑1) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, and the remaining nucleotides are selected from a 2’-O- methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 9, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 8 is selected from a 2’-O-methox- yethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleo- tide; (ds‑2) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, and the remaining nucleotides are selected from a 2’-O- methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 10, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 8 is selected from a 2’-O-methox- yethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleo- tide; (ds‑3) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, and the remaining nucleotides are selected from a 2’-O- methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 11, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 8 is selected from a 2’-O-methox- yethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleo- tide; (ds‑4) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, and the remaining nucleotides are selected from a 2’-O- methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 12, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 8 is selected from a 2’-O-methox- yethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleo- tide; 132 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (ds‑5) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, and the remaining nucleotides are selected from a 2’-O- methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 9, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 15 is selected from a 2’-O-methox- yethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleo- tide; (ds‑6) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, and the remaining nucleotides are selected from a 2’-O- methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 10, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 15 is selected from a 2’-O-methox- yethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleo- tide; (ds‑7) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, and the remaining nucleotides are selected from a 2’-O- methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 11, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 15 is selected from a 2’-O-methox- yethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleo- tide; and (ds‑8) from 5’-end to 3’-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2’-fluoro-modified nucleotide, and the remaining nucleotides are selected from a 2’-O- methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 12, 14, and 16 are selected from a 2’-fluoro-modified nucleotide, the nucleotide at position 15 is selected from a 2’-O-methox- yethyl-modified nucleotide, and the remaining nucleotides are selected from a 2’-O-methyl-modified nucleo- tide; and optionally, the sense strand comprises two contiguous internucleotide phosphorothioate linkages at 5’-end; and the antisense strand comprises two internucleotide phosphorothioate linkages at 5’-end, and two contiguous internucleotide phosphorothioate linkages at 3’-end. 7. The double-stranded oligonucleotide according to claim 5, wherein each nucleotide of the double-stranded oligo- nucleotide is independently selected from a modified nucleotide; wherein the sense strand is selected from any one of the sequences as set forth in SEQ ID NOs: 887 to 907; and / or the antisense strand is selected from any one of the sequences as set forth in SEQ ID NOs: 908 to 943. 8. The double-stranded oligonucleotide according to claim 7, wherein the double-stranded oligonucleotide comprises one or more pairs of: ➽Too large Table Pair Sense strand (5’‑3’) Antisense strand (5’‑3’) RX002 245 SEQ ID NO: 887 SEQ ID NO: 908 RX002 246 SEQ ID NO: 887 SEQ ID NO: 909 RX002 247 SEQ ID NO: 887 SEQ ID NO: 910 133 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) Pair Sense strand (5’‑3’) Antisense strand (5’‑3’) RX002 248 SEQ ID NO: 888 SEQ ID NO: 909 RX002 249 SEQ ID NO: 889 SEQ ID NO: 909 RX002 250 SEQ ID NO: 890 SEQ ID NO: 909 RX002 251 SEQ ID NO: 891 SEQ ID NO: 909 RX002 252 SEQ ID NO: 888 SEQ ID NO: 911 RX002 253 SEQ ID NO: 889 SEQ ID NO: 911 RX002 254 SEQ ID NO: 890 SEQ ID NO: 911 RX002 255 SEQ ID NO: 891 SEQ ID NO: 911 RX002 256 SEQ ID NO: 892 SEQ ID NO: 912 RX002 257 SEQ ID NO: 892 SEQ ID NO: 913 RX002 258 SEQ ID NO: 892 SEQ ID NO: 914 RX002 259 SEQ ID NO: 893 SEQ ID NO: 913 134 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) Pair Sense strand (5’‑3’) Antisense strand (5’‑3’) RX002 260 SEQ ID NO: 894 SEQ ID NO: 913 RX002 261 SEQ ID NO: 895 SEQ ID NO: 913 RX002 262 SEQ ID NO: 896 SEQ ID NO: 913 RX002 263 SEQ ID NO: 893 SEQ ID NO: 915 RX002 264 SEQ ID NO: 894 SEQ ID NO: 915 RX002 265 SEQ ID NO: 895 SEQ ID NO: 915 RX002 266 SEQ ID NO: 896 SEQ ID NO: 915 RX002 267 SEQ ID NO: 897 SEQ ID NO: 916 RX002 268 SEQ ID NO: 897 SEQ ID NO: 917 RX002 269 SEQ ID NO: 897 SEQ ID NO: 918 RX002 270 SEQ ID NO: 898 SEQ ID NO: 917 RX002 271 SEQ ID NO: 899 SEQ ID NO: 917 135 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) Pair Sense strand (5’‑3’) Antisense strand (5’‑3’) RX002 272 SEQ ID NO: 900 SEQ ID NO: 917 RX002 273 SEQ ID NO: 901 SEQ ID NO: 917 RX002 274 SEQ ID NO: 898 SEQ ID NO: 919 RX002 275 SEQ ID NO: 899 SEQ ID NO: 919 RX002 276 SEQ ID NO: 900 SEQ ID NO: 919 RX002 277 SEQ ID NO: 901 SEQ ID NO: 919 RX002 278 SEQ ID NO: 902 SEQ ID NO: 920 RX002 279 SEQ ID NO: 902 SEQ ID NO: 921 RX002 280 SEQ ID NO: 902 SEQ ID NO: 922 RX002 281 SEQ ID NO: 903 SEQ ID NO: 921 RX002 282 SEQ ID NO: 904 SEQ ID NO: 921 RX002 283 SEQ ID NO: 905 SEQ ID NO: 921 136 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) Pair Sense strand (5’‑3’) Antisense strand (5’‑3’) RX002 284 SEQ ID NO: 906 SEQ ID NO: 921 RX002 285 SEQ ID NO: 903 SEQ ID NO: 923 RX002 286 SEQ ID NO: 904 SEQ ID NO: 923 RX002 287 SEQ ID NO: 905 SEQ ID NO: 923 RX002 288 SEQ ID NO: 906 SEQ ID NO: 923 RX002 289 SEQ ID NO: 888 SEQ ID NO: 910 RX002 290 SEQ ID NO: 890 SEQ ID NO: 910 RX002 291 SEQ ID NO: 890 SEQ ID NO: 924 RX002 292 SEQ ID NO: 891 SEQ ID NO: 924 RX002 293 SEQ ID NO: 895 SEQ ID NO: 914 RX002 294 SEQ ID NO: 896 SEQ ID NO: 925 RX002 295 SEQ ID NO: 905 SEQ ID NO: 922 137 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) Pair Sense strand (5’‑3’) Antisense strand (5’‑3’) RX002 296 SEQ ID NO: 906 SEQ ID NO: 926 RX002 297 SEQ ID NO: 892 SEQ ID NO: 927 RX002 298 SEQ ID NO: 907 SEQ ID NO: 928 RX002 299 SEQ ID NO: 907 SEQ ID NO: 929 RX002 300 SEQ ID NO: 907 SEQ ID NO: 930 RX002 301 SEQ ID NO: 887 SEQ ID NO: 931 RX002 302 SEQ ID NO: 887 SEQ ID NO: 932 RX002 303 SEQ ID NO: 887 SEQ ID NO: 933 RX002 304 SEQ ID NO: 902 SEQ ID NO: 934 RX002 305 SEQ ID NO: 902 SEQ ID NO: 935 RX002 306 SEQ ID NO: 902 SEQ ID NO: 936 RX002 307 SEQ ID NO: 892 SEQ ID NO: 937 138 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) Pair Sense strand (5’‑3’) Antisense strand (5’‑3’) RX002 308 SEQ ID NO: 892 SEQ ID NO: 938 RX002 309 SEQ ID NO: 907 SEQ ID NO: 939 RX002 310 SEQ ID NO: 897 SEQ ID NO: 940 RX002 311 SEQ ID NO: 897 SEQ ID NO: 941 RX002 312 SEQ ID NO: 897 SEQ ID NO: 942 RX002 313 SEQ ID NO: 897 SEQ ID NO: 943 9. The double-stranded oligonucleotide according to claim 7, wherein the sense strand is selected from any one of the sequences as set forth in SEQ ID NOs: 887, 892, 897, 902, and 907; and / or the antisense strand is selected from any one of the sequences as set forth in SEQ ID NOs: 908, 912, 914, 920, and 927 to 943. 10. The double-stranded oligonucleotide according to claim 9, wherein the double-stranded oligonucleotide comprises one or more pairs of: Pair Sense strand (5’‑3’) Antisense strand (5’‑3’) RX002 245 SEQ ID NO: 887 SEQ ID NO: 908 RX002 256 SEQ ID NO: 892 SEQ ID NO: 912 RX002 258 SEQ ID NO: 892 SEQ ID NO: 914 139 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) Pair Sense strand (5’‑3’) Antisense strand (5’‑3’) RX002 278 SEQ ID NO: 902 SEQ ID NO: 920 RX002 297 SEQ ID NO: 892 SEQ ID NO: 927 RX002 298 SEQ ID NO: 907 SEQ ID NO: 928 RX002 299 SEQ ID NO: 907 SEQ ID NO: 929 RX002 300 SEQ ID NO: 907 SEQ ID NO: 930 RX002 301 SEQ ID NO: 887 SEQ ID NO: 931 RX002 302 SEQ ID NO: 887 SEQ ID NO: 932 RX002 303 SEQ ID NO: 887 SEQ ID NO: 933 RX002 304 SEQ ID NO: 902 SEQ ID NO: 934 RX002 305 SEQ ID NO: 902 SEQ ID NO: 935 RX002 306 SEQ ID NO: 902 SEQ ID NO: 936 RX002 307 SEQ ID NO: 892 SEQ ID NO: 937 140 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 (continued) Pair Sense strand (5’‑3’) Antisense strand (5’‑3’) RX002 308 SEQ ID NO: 892 SEQ ID NO: 938 RX002 309 SEQ ID NO: 907 SEQ ID NO: 939 RX002 310 SEQ ID NO: 897 SEQ ID NO: 940 RX002 311 SEQ ID NO: 897 SEQ ID NO: 941 RX002 312 SEQ ID NO: 897 SEQ ID NO: 942 RX002 313 SEQ ID NO: 897 SEQ ID NO: 943 . 11. The double-stranded oligonucleotide according to claim 10, wherein the double-stranded oligonucleotide is selected from: Pair Sense strand (5’‑3’) Antisense strand (5’‑3’) RX002 258 SEQ ID NO: 892 SEQ ID NO: 914 12. A double-stranded oligonucleotide for inhibiting the expression of C3 gene, wherein the double-stranded oligonu- cleotide comprises a sense strand and an antisense strand, and each nucleotide of the double-stranded nucleotide is independently selected from a modified nucleotide; wherein the nucleotide sequence from positions 2 to 19 of the antisense strand comprises at least 17 contiguous nucleotides from any one of the nucleotide sequences as set forth in SEQ ID NOs: 908 to 943 or a nucleotide sequence having 1, 2 or 3 nucleotide base differences from the contiguous nucleotides; and the sense strand comprises at least 17 nucleotides, and the sense strand and the antisense strand are complementary or substantially complementary to form a duplex region, wherein being substantial complemen- tary means that the sense strand and the antisense strand have no more than 3 nucleotide mismatches in the duplex region. 13. The double-stranded oligonucleotide according to claim 12, wherein the antisense strand comprises a nucleotide sequence having 0, 1, 2 or 3 nucleotide base differences from any one of the sequences as set forth in SEQ ID NOs: 908 to 943; 141 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 optionally, the antisense strand comprises a nucleotide sequence having 0 or 1 nucleotide base difference from any one of the sequences as set forth in SEQ ID NOs: 908 to 943; and optionally, the antisense strand comprises any one of the nucleotide sequences as set forth in SEQ ID NOs: 908 to 943. 14. The double-stranded oligonucleotide according to claim 12, wherein the sense strand comprises at least 17 contiguous nucleotides of any one of the nucleotide sequences as set forth in SEQ ID NOs: 887 to 907 or a nucleotide sequence having 1, 2 or 3 nucleotide base differences from the at least 17 contiguous nucleotides; optionally, the sense strand comprises a nucleotide sequence having 0, 1, 2 or 3 nucleotide base differences from any one of the sequences as set forth in SEQ ID NOs: 887 to 907; optionally, the sense strand comprises a nucleotide sequence having 0 or 1 nucleotide base difference from any one of the nucleotide sequences as set forth in SEQ ID NOs: 887 to 907; and optionally, the sense strand comprises any one of the nucleotide sequences as set forth in SEQ ID NOs: 887 to 907. 15. The double-stranded oligonucleotide according to any one of claims 12 to 14, wherein the double-stranded oligonucleotide comprises one or more pairs of: an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 908, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 887; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 909, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 887; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 910, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 887; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 909, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 888; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 909, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 889; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 909, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 890; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 909, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 891; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 911, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 888; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 911, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 889; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 911, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 890; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 911, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 891; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 912, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 892; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 913, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 892; 142 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 914, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 892; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 913, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 893; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 913, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 894; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 913, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 895; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 913, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 896; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 915, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 893; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 915, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 894; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 915, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 895; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 915, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 896; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 916, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 897; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 917, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 897; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 918, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 897; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 917, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 898; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 917, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 899; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 917, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 900; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 917, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 901; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 919, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 898; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 919, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 899; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 919, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 900; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set 143 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 forth in SEQ ID NO: 919, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 901; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 920, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 902; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 921, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 902; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 922, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 902; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 921, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 903; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 921, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 904; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 921, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 905; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 921, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 906; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 923, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 903; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 923, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 904; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 923, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 905; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 923, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 906; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 910, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 888; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 910, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 890; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 924, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 890; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 924, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 891; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 914, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 895; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 925, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 896; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 922, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 905; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 926, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference 144 EP 4 772 631 A1 5 10 15 20 25 30 35 40 45 50 55 from the sequence as set forth in SEQ ID NO: 906; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 927, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 892; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 928, and a ...

Claims

1. A double-stranded oligonucleotide for inhibiting expression of C3 gene, comprising a sense strand and an antisense strand; from 5'-end to 3'-end, nucleotides of positions 2 to 19 of the antisense strand comprise a complementary region to a C3 RNA transcript, wherein the complementary region comprises at least 17 contiguous nucleotides of any one of the nucleotide sequences as set forth in SEQ ID NOs: 213 to 424 or a nucleotide sequence having 1, 2 or 3 nucleotide differences from the at least 17 contiguous nucleotides; and the sense strand comprises at least 17 nucleotides, and the sense strand and the antisense strand are complementary or substantially complementary to form a duplex region, wherein being substantial complementary means that the sense strand and the antisense strand have no more than 3 nucleotide mismatches in the duplex region.

2. The double-stranded oligonucleotide according to claim 1, wherein the antisense strand comprises a nucleotide sequence having 0, 1, 2 or 3 nucleotide differences from any one of the sequences as set forth in SEQ ID NOs: 213 to 424; optionally, the antisense strand comprises a nucleotide sequence having 0 or 1 nucleotide difference from any one of the sequences as set forth in SEQ ID NOs: 213 to 424; and optionally, the antisense strand is selected from or comprises any one of the nucleotide sequences as set forth in SEQ ID NOs: 213 to 424.

3. The double-stranded oligonucleotide according to claim 1, wherein the sense strand comprises at least 17 contiguous nucleotides of any one of the nucleotide sequences as set forth in SEQ ID NOs: 1 to 212 or a nucleotide sequence having 1, 2 or 3 nucleotide differences from the at least 17 contiguous nucleotides; optionally, the sense strand comprises a nucleotide sequence having 0, 1, 2 or 3 nucleotide differences from any one of the sequences as set forth in SEQ ID NOs: 1 to 212; optionally, the sense strand comprises a nucleotide sequence having 0 or 1 nucleotide difference from any one of the nucleotide sequences as set forth in SEQ ID NOs: 1 to 212; and optionally, the sense strand is selected from or comprises any one of the nucleotide sequences as set forth in SEQ ID NOs: 1 to 212.

4. The double-stranded oligonucleotide according to claim 3, wherein the antisense strand comprises a nucleotide sequence having 0 or 1 nucleotide difference from any one of the nucleotide sequences as set forth in SEQ ID NOs: 241, 242, 285, 357 or 403; optionally, the antisense strand comprises any one of the nucleotide sequences as set forth in SEQ ID NOs: 241, 242, 285, 357 or 403; optionally, the sense strand comprises a nucleotide sequence having 0 or 1 nucleotide difference from any one of the nucleotide sequences as set forth in SEQ ID NOs: 29, 30, 73, 145 or 191; optionally, the sense strand comprises any one of the nucleotide sequences as set forth in SEQ ID NOs: 29, 30, 73, 145 or 191; optionally, the double-stranded oligonucleotide comprises one or more pairs of: an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 241 or a nucleotide sequence having 0 or 1 nucleotide difference therefrom, and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 29 or a nucleotide sequence having 0 or 1 nucleotide difference therefrom; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 242 or a nucleotide sequence having 0 or 1 nucleotide difference therefrom, and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 30 or a nucleotide sequence having 0 or 1 nucleotide difference therefrom; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 285 or a nucleotide sequence having 0 or 1 nucleotide difference therefrom, and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 73 or a nucleotide sequence having 0 or 1 nucleotide difference therefrom; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 357 or a nucleotide sequence having 0 or 1 nucleotide difference therefrom, and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 145 or a nucleotide sequence having 0 or 1 nucleotide difference therefrom; and an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 403 or a nucleotide sequence having 0 or 1 nucleotide difference therefrom, and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 191 or a nucleotide sequence having 0 or 1 nucleotide difference therefrom; and optionally, the double-stranded oligonucleotide comprises: an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 241 or a nucleotide sequence having 0 or 1 nucleotide difference therefrom, and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 29 or a nucleotide sequence having 0 or 1 nucleotide difference therefrom.

5. The double-stranded oligonucleotide according to any one of claims 1 to 4, wherein each nucleotide of the double-stranded oligonucleotide is independently selected from a modified or unmodified nucleotide; optionally, substantially all nucleotides of the double-stranded oligonucleotide are independently selected from modified nucleotides; optionally, all nucleotides of the double-stranded oligonucleotide are independently selected from modified nucleotides; optionally, each nucleotide of the double-stranded oligonucleotide is independently selected from the group consisting of: a 2'-halogen-modified nucleotide, a 2'-deoxy-modified nucleotide, a 2'-O-optionally substituted C1-6 alkyl-modified nucleotide, a 2'-O-(CH2)n-O-R1-modified nucleotide, a 2'-amino-modified nucleotide, an abasic nucleotide or a nucleotide analog, wherein the nucleotide analog is one or more selected from PNA, MNA, BNA, LNA, GNA, TNA and UNA; wherein n is selected from 1 or 2, R1 is selected from an optionally substituted C1-6 alkyl or an optionally substituted C1-6 alkoxy; when R1 is substituted, the substituent is selected from a halogen, a C1-6 alkoxy, a hydroxyl and an amino; optionally, the 2'-halogen-modified nucleotide is a 2'-fluoro-modified nucleotide; optionally, the 2'-O-optionally substituted C1-6 alkyl-modified nucleotide is a 2'-O-methyl-modified nucleotide; optionally, the 2'-O-(CH2)n-O-R1-modified nucleotide is selected from a 2'-O-methoxyethyl-modified nucleotide, a 2'-O-ethoxymethyl-modified nucleotide and a 2'-O-2,2,2-trifluoroethoxymethyl-modified nucleotide; optionally, the 2'-O-(CH2)n-O-R1-modified nucleotide is selected from a 2'-O-methoxyethyl-modified nucleotide; optionally, each nucleotide of the double-stranded oligonucleotide is independently selected from the group consisting of: a 2'-fluoro-modified nucleotide, a 2'-deoxy-modified nucleotide, a 2'-O-methyl-modified nucleotide and a 2'-O-methoxyethyl-modified nucleotide; and optionally, each nucleotide of the double-stranded oligonucleotide is independently selected from the group consisting of: a 2'-fluoro-modified nucleotide, a 2'-O-methyl-modified nucleotide and a 2'-O-methoxyethyl-modified nucleotide.

6. The double-stranded oligonucleotide according to claim 5, wherein the double-stranded oligonucleotide comprises at least one 2'-O-methoxyethyl-modified nucleotide; optionally, the antisense strand comprises at least one 2'-O-methoxyethyl-modified nucleotide; and the sense strand comprises no more than one 2'-O-methoxyethyl-modified nucleotide; optionally, from 5'-end to 3'-end, in the nucleotide sequence of the sense strand, at least 3 nucleotides at positions 7 to 10 are selected from a 2'-fluoro-modified nucleotide, no more than one nucleotide at positions 5, 12, 13, and 18 is selected from a 2'-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are independently selected from a 2'-O-methyl-modified nucleotide; in the nucleotide sequence of the antisense strand, at least 4 nucleotides at positions 2, 6, 14, and 16 are selected from a 2'-fluoro-modified nucleotide, any one of the nucleotides at positions 9 to 12 is selected from a 2'-fluoro-modified nucleotide, at least one nucleotide at positions 8 and 15 is selected from a 2'-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are independently selected from a 2'-O-methyl-modified nucleotide; optionally, from 5'-end to 3'-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2'-fluoro-modified nucleotide, and the remaining nucleotides are selected from a 2'-O-methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, at least 4 nucleotides at positions 2, 6, 14, and 16 are selected from a 2'-fluoro-modified nucleotide, any one of the nucleotides at positions 9 to 12 is selected from a 2'-fluoro-modified nucleotide, at least one nucleotide at positions 8 and 15 is selected from a 2'-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are independently selected from a 2'-O-methyl-modified nucleotide; optionally, from 5'-end to 3'-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2'-fluoro-modified nucleotide, and the remaining nucleotides are selected from a 2'-O-methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, at least 4 nucleotides at positions 2, 6, 14, and 16 are selected from a 2'-fluoro-modified nucleotide, any one of the nucleotides at positions 9 to 12 is selected from a 2'-fluoro-modified nucleotide, the nucleotide at position 8 or 15 is selected from a 2'-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are independently selected from a 2'-O-methyl-modified nucleotide; optionally, the sense strand and the antisense strand of the double-stranded oligonucleotide have a modification pattern selected from (ds-1) to (ds-8): (ds-1) from 5'-end to 3'-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2'-fluoro-modified nucleotide, and the remaining nucleotides are selected from a 2'-O-methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 9, 14, and 16 are selected from a 2'-fluoro-modified nucleotide, the nucleotide at position 8 is selected from a 2'-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2'-O-methyl-modified nucleotide; (ds-2) from 5'-end to 3'-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2'-fluoro-modified nucleotide, and the remaining nucleotides are selected from a 2'-O-methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 10, 14, and 16 are selected from a 2'-fluoro-modified nucleotide, the nucleotide at position 8 is selected from a 2'-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2'-O-methyl-modified nucleotide; (ds-3) from 5'-end to 3'-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2'-fluoro-modified nucleotide, and the remaining nucleotides are selected from a 2'-O-methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 11, 14, and 16 are selected from a 2'-fluoro-modified nucleotide, the nucleotide at position 8 is selected from a 2'-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2'-O-methyl-modified nucleotide; (ds-4) from 5'-end to 3'-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2'-fluoro-modified nucleotide, and the remaining nucleotides are selected from a 2'-O-methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 12, 14, and 16 are selected from a 2'-fluoro-modified nucleotide, the nucleotide at position 8 is selected from a 2'-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2'-O-methyl-modified nucleotide; (ds-5) from 5'-end to 3'-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2'-fluoro-modified nucleotide, and the remaining nucleotides are selected from a 2'-O-methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 9, 14, and 16 are selected from a 2'-fluoro-modified nucleotide, the nucleotide at position 15 is selected from a 2'-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2'-O-methyl-modified nucleotide; (ds-6) from 5'-end to 3'-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2'-fluoro-modified nucleotide, and the remaining nucleotides are selected from a 2'-O-methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 10, 14, and 16 are selected from a 2'-fluoro-modified nucleotide, the nucleotide at position 15 is selected from a 2'-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2'-O-methyl-modified nucleotide; (ds-7) from 5'-end to 3'-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2'-fluoro-modified nucleotide, and the remaining nucleotides are selected from a 2'-O-methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 11, 14, and 16 are selected from a 2'-fluoro-modified nucleotide, the nucleotide at position 15 is selected from a 2'-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2'-O-methyl-modified nucleotide; and (ds-8) from 5'-end to 3'-end, in the nucleotide sequence of the sense strand, the nucleotides at positions 7 to 10 are selected from a 2'-fluoro-modified nucleotide, and the remaining nucleotides are selected from a 2'-O-methyl-modified nucleotide; and in the nucleotide sequence of the antisense strand, the nucleotides at positions 2, 6, 12, 14, and 16 are selected from a 2'-fluoro-modified nucleotide, the nucleotide at position 15 is selected from a 2'-O-methoxyethyl-modified nucleotide, and the remaining nucleotides are selected from a 2'-O-methyl-modified nucleotide; and optionally, the sense strand comprises two contiguous internucleotide phosphorothioate linkages at 5'-end; and the antisense strand comprises two internucleotide phosphorothioate linkages at 5'-end, and two contiguous internucleotide phosphorothioate linkages at 3'-end.

7. The double-stranded oligonucleotide according to claim 5, wherein each nucleotide of the double-stranded oligonucleotide is independently selected from a modified nucleotide; wherein the sense strand is selected from any one of the sequences as set forth in SEQ ID NOs: 887 to 907; and / or the antisense strand is selected from any one of the sequences as set forth in SEQ ID NOs: 908 to 943.

8. The double-stranded oligonucleotide according to claim 7, wherein the double-stranded oligonucleotide comprises one or more pairs of: PairSense strand (5'-3')Antisense strand (5'-3')RX002 245SEQ ID NO: 887SEQ ID NO: 908RX002 246SEQ ID NO: 887SEQ ID NO: 909RX002 247SEQ ID NO: 887SEQ ID NO: 910RX002 248SEQ ID NO: 888SEQ ID NO: 909RX002 249SEQ ID NO: 889SEQ ID NO: 909RX002 250SEQ ID NO: 890SEQ ID NO: 909RX002 251SEQ ID NO: 891SEQ ID NO: 909RX002 252SEQ ID NO: 888SEQ ID NO: 911RX002 253SEQ ID NO: 889SEQ ID NO: 911RX002 254SEQ ID NO: 890SEQ ID NO: 911RX002 255SEQ ID NO: 891SEQ ID NO: 911RX002 256SEQ ID NO: 892SEQ ID NO: 912RX002 257SEQ ID NO: 892SEQ ID NO: 913RX002 258SEQ ID NO: 892SEQ ID NO: 914RX002 259SEQ ID NO: 893SEQ ID NO: 913RX002 260SEQ ID NO: 894SEQ ID NO: 913RX002 261SEQ ID NO: 895SEQ ID NO: 913RX002 262SEQ ID NO: 896SEQ ID NO: 913RX002 263SEQ ID NO: 893SEQ ID NO: 915RX002 264SEQ ID NO: 894SEQ ID NO: 915RX002 265SEQ ID NO: 895SEQ ID NO: 915RX002 266SEQ ID NO: 896SEQ ID NO: 915RX002 267SEQ ID NO: 897SEQ ID NO: 916RX002 268SEQ ID NO: 897SEQ ID NO: 917RX002 269SEQ ID NO: 897SEQ ID NO: 918RX002 270SEQ ID NO: 898SEQ ID NO: 917RX002 271SEQ ID NO: 899SEQ ID NO: 917RX002 272SEQ ID NO: 900SEQ ID NO: 917RX002 273SEQ ID NO: 901SEQ ID NO: 917RX002 274SEQ ID NO: 898SEQ ID NO: 919RX002 275SEQ ID NO: 899SEQ ID NO: 919RX002 276SEQ ID NO: 900SEQ ID NO: 919RX002 277SEQ ID NO: 901SEQ ID NO: 919RX002 278SEQ ID NO: 902SEQ ID NO: 920RX002 279SEQ ID NO: 902SEQ ID NO: 921RX002 280SEQ ID NO: 902SEQ ID NO: 922RX002 281SEQ ID NO: 903SEQ ID NO: 921RX002 282SEQ ID NO: 904SEQ ID NO: 921RX002 283SEQ ID NO: 905SEQ ID NO: 921RX002 284SEQ ID NO: 906SEQ ID NO: 921RX002 285SEQ ID NO: 903SEQ ID NO: 923RX002 286SEQ ID NO: 904SEQ ID NO: 923RX002 287SEQ ID NO: 905SEQ ID NO: 923RX002 288SEQ ID NO: 906SEQ ID NO: 923RX002 289SEQ ID NO: 888SEQ ID NO: 910RX002 290SEQ ID NO: 890SEQ ID NO: 910RX002 291SEQ ID NO: 890SEQ ID NO: 924RX002 292SEQ ID NO: 891SEQ ID NO: 924RX002 293SEQ ID NO: 895SEQ ID NO: 914RX002 294SEQ ID NO: 896SEQ ID NO: 925RX002 295SEQ ID NO: 905SEQ ID NO: 922RX002 296SEQ ID NO: 906SEQ ID NO: 926RX002 297SEQ ID NO: 892SEQ ID NO: 927RX002 298SEQ ID NO: 907SEQ ID NO: 928RX002 299SEQ ID NO: 907SEQ ID NO: 929RX002 300SEQ ID NO: 907SEQ ID NO: 930RX002 301SEQ ID NO: 887SEQ ID NO: 931RX002 302SEQ ID NO: 887SEQ ID NO: 932RX002 303SEQ ID NO: 887SEQ ID NO: 933RX002 304SEQ ID NO: 902SEQ ID NO: 934RX002 305SEQ ID NO: 902SEQ ID NO: 935RX002 306SEQ ID NO: 902SEQ ID NO: 936RX002 307SEQ ID NO: 892SEQ ID NO: 937RX002 308SEQ ID NO: 892SEQ ID NO: 938RX002 309SEQ ID NO: 907SEQ ID NO: 939RX002 310SEQ ID NO: 897SEQ ID NO: 940RX002 311SEQ ID NO: 897SEQ ID NO: 941RX002 312SEQ ID NO: 897SEQ ID NO: 942RX002 313SEQ ID NO: 897SEQ ID NO: 9439. The double-stranded oligonucleotide according to claim 7, wherein the sense strand is selected from any one of the sequences as set forth in SEQ ID NOs: 887, 892, 897, 902, and 907; and / or the antisense strand is selected from any one of the sequences as set forth in SEQ ID NOs: 908, 912, 914, 920, and 927 to 943.

10. The double-stranded oligonucleotide according to claim 9, wherein the double-stranded oligonucleotide comprises one or more pairs of: PairSense strand (5'-3')Antisense strand (5'-3')RX002 245SEQ ID NO: 887SEQ ID NO: 908RX002 256SEQ ID NO: 892SEQ ID NO: 912RX002 258SEQ ID NO: 892SEQ ID NO: 914RX002 278SEQ ID NO: 902SEQ ID NO: 920RX002 297SEQ ID NO: 892SEQ ID NO: 927RX002 298SEQ ID NO: 907SEQ ID NO: 928RX002 299SEQ ID NO: 907SEQ ID NO: 929RX002 300SEQ ID NO: 907SEQ ID NO: 930RX002 301SEQ ID NO: 887SEQ ID NO: 931RX002 302SEQ ID NO: 887SEQ ID NO: 932RX002 303SEQ ID NO: 887SEQ ID NO: 933RX002 304SEQ ID NO: 902SEQ ID NO: 934RX002 305SEQ ID NO: 902SEQ ID NO: 935RX002 306SEQ ID NO: 902SEQ ID NO: 936RX002 307SEQ ID NO: 892SEQ ID NO: 937RX002 308SEQ ID NO: 892SEQ ID NO: 938RX002 309SEQ ID NO: 907SEQ ID NO: 939RX002 310SEQ ID NO: 897SEQ ID NO: 940RX002 311SEQ ID NO: 897SEQ ID NO: 941RX002 312SEQ ID NO: 897SEQ ID NO: 942RX002 313SEQ ID NO: 897SEQ ID NO: 943 .

11. The double-stranded oligonucleotide according to claim 10, wherein the double-stranded oligonucleotide is selected from: PairSense strand (5'-3')Antisense strand (5'-3')RX002 258SEQ ID NO: 892SEQ ID NO: 91412. A double-stranded oligonucleotide for inhibiting the expression of C3 gene, wherein the double-stranded oligonucleotide comprises a sense strand and an antisense strand, and each nucleotide of the double-stranded nucleotide is independently selected from a modified nucleotide; wherein the nucleotide sequence from positions 2 to 19 of the antisense strand comprises at least 17 contiguous nucleotides from any one of the nucleotide sequences as set forth in SEQ ID NOs: 908 to 943 or a nucleotide sequence having 1, 2 or 3 nucleotide base differences from the contiguous nucleotides; and the sense strand comprises at least 17 nucleotides, and the sense strand and the antisense strand are complementary or substantially complementary to form a duplex region, wherein being substantial complementary means that the sense strand and the antisense strand have no more than 3 nucleotide mismatches in the duplex region.

13. The double-stranded oligonucleotide according to claim 12, wherein the antisense strand comprises a nucleotide sequence having 0, 1, 2 or 3 nucleotide base differences from any one of the sequences as set forth in SEQ ID NOs: 908 to 943; optionally, the antisense strand comprises a nucleotide sequence having 0 or 1 nucleotide base difference from any one of the sequences as set forth in SEQ ID NOs: 908 to 943; and optionally, the antisense strand comprises any one of the nucleotide sequences as set forth in SEQ ID NOs: 908 to 943.

14. The double-stranded oligonucleotide according to claim 12, wherein the sense strand comprises at least 17 contiguous nucleotides of any one of the nucleotide sequences as set forth in SEQ ID NOs: 887 to 907 or a nucleotide sequence having 1, 2 or 3 nucleotide base differences from the at least 17 contiguous nucleotides; optionally, the sense strand comprises a nucleotide sequence having 0, 1, 2 or 3 nucleotide base differences from any one of the sequences as set forth in SEQ ID NOs: 887 to 907; optionally, the sense strand comprises a nucleotide sequence having 0 or 1 nucleotide base difference from any one of the nucleotide sequences as set forth in SEQ ID NOs: 887 to 907; and optionally, the sense strand comprises any one of the nucleotide sequences as set forth in SEQ ID NOs: 887 to 907.

15. The double-stranded oligonucleotide according to any one of claims 12 to 14, wherein the double-stranded oligonucleotide comprises one or more pairs of: an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 908, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 887; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 909, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 887; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 910, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 887; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 909, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 888; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 909, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 889; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 909, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 890; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 909, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 891; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 911, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 888; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 911, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 889; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 911, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 890; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 911, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 891; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 912, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 892; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 913, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 892; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 914, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 892; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 913, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 893; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 913, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 894; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 913, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 895; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 913, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 896; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 915, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 893; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 915, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 894; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 915, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 895; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 915, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 896; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 916, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 897; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 917, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 897; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 918, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 897; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 917, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 898; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 917, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 899; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 917, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 900; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 917, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 901; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 919, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 898; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 919, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 899; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 919, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 900; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 919, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 901; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 920, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 902; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 921, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 902; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 922, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 902; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 921, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 903; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 921, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 904; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 921, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 905; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 921, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 906; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 923, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 903; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 923, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 904; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 923, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 905; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 923, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 906; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 910, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 888; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 910, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 890; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 924, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 890; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 924, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 891; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 914, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 895; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 925, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 896; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 922, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 905; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 926, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 906; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 927, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 892; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 928, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 907; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 929, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 907; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 930, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 907; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 931, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 887; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 932, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 887; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 933, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 887; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 934, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 902; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 935, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 902; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 936, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 902; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 937, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 892; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 938, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 892; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 939, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 907; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 940, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 897; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 941, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 897; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 942, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 897; and an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 943, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 897; optionally, the double-stranded oligonucleotide comprises one or more pairs of: an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 908 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 887; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 909 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 887; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 910 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 887; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 909 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 888; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 909 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 889; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 909 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 890; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 909 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 891; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 911 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 888; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 911 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 889; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 911 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 890; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 911 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 891; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 912 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 892; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 913 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 892; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 914, and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 892; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 913 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 893; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 913 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 894; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 913 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 895; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 913 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 896; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 915 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 893; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 915 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 894; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 915 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 895; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 915 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 896; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 916 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 897; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 917 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 897; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 918 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 897; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 917 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 898; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 917 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 899; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 917 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 900; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 917 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 901; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 919 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 898; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 919 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 899; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 919 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 900; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 919 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 901; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 920 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 902; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 921 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 902; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 922 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 902; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 921 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 903; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 921 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 904; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 921 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 905; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 921 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 906; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 923 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 903; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 923 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 904; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 923 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 905; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 923 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 906; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 910 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 888; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 910 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 890; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 924 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 890; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 924 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 891; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 914 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 895; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 925 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 896; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 922 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 905; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 926 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 906; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 927 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 892; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 928 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 907; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 929 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 907; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 930 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 907; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 931 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 887; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 932 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 887; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 933 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 887; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 934 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 902; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 935 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 902; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 936 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 902; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 937 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 892; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 938 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 892; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 939 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 907; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 940 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 897; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 941 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 897; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 942 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 897; and an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 943 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 897.

16. The double-stranded oligonucleotide according to any one of claims 12 to 14, wherein the antisense strand comprises a nucleotide sequence having 0, 1, 2 or 3 nucleotide base differences from any one of the sequences as set forth in SEQ ID NO: 908, 912, 914, 920, and 927 to 943; optionally, the antisense strand comprises a nucleotide sequence having 0 or 1 nucleotide base difference from any one of the sequences as set forth in SEQ ID NO: 908, 912, 914, 920, and 927 to 943; and optionally, the antisense strand comprises any one of the sequences as set forth in SEQ ID NO: 908, 912, 914, 920, and 927 to 943.

17. The double-stranded oligonucleotide according to any one of claims 12 to 14, wherein the sense strand comprises a nucleotide sequence having 0, 1, 2 or 3 nucleotide base differences from any one of the sequences as set forth in SEQ ID NO: 887, 892, 897, 902, and 907; optionally, the sense strand comprises a nucleotide sequence having 0 or 1 nucleotide base difference from any one of the sequences as set forth in SEQ ID NO: 887, 892, 897, 902, and 907; and optionally, the sense strand comprises any one of the sequences as set forth in SEQ ID NO: 887, 892, 897, 902, and 907.

18. The double-stranded oligonucleotide according to any one of claims 16 to 17, wherein the double-stranded oligonucleotide comprises one or more pairs of: an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 908, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 887; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 931, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 887; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 932, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 887; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 933, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 887; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 912, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 892; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 914, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 892; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 927, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 892; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 937, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 892; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 938, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 892; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 940, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 897; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 941, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 897; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 942, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 897; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 943, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 897; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 920, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 902; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 934, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 902; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 935, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 902; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 936, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 902; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 928, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 907; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 929, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 907; an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 930, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 907; and an antisense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 939, and a sense strand having a nucleotide sequence with 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 907; optionally, the double-stranded oligonucleotide comprises one or more pairs of: an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 908 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 887; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 931 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 887; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 932 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 887; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 933 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 887; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 912 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 892; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 914 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 892; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 927 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 892; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 937 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 892; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 938 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 892; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 940 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 897; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 941 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 897; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 942 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 897; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 943 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 897; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 920 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 902; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 934 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 902; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 935 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 902; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 936 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 902; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 928 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 907; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 929 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 907; an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 930 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 907; and an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 939 and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 907.

19. The double-stranded oligonucleotide according to any one of claims 12 to 14, wherein the antisense strand comprises a nucleotide sequence having 0, 1, 2 or 3 nucleotide base differences from the sequence as set forth in SEQ ID NO: 914; optionally, the antisense strand comprises a nucleotide sequence having 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 914; and optionally, the antisense strand comprises the sequence as set forth in SEQ ID NO: 914.

20. The double-stranded oligonucleotide according to claim 19, wherein the sense strand comprises a nucleotide sequence having 0, 1, 2 or 3 nucleotide base differences from the sequence as set forth in SEQ ID NO: 892; optionally, the sense strand comprises a nucleotide sequence having 0 or 1 nucleotide base difference from the sequence as set forth in SEQ ID NO: 892; and optionally, the sense strand comprises the sequence as set forth in SEQ ID NO: 892.

21. The double-stranded oligonucleotide according to claim 20, wherein the double-stranded oligonucleotide comprises: an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 914 or a nucleotide sequence having 0 or 1 nucleotide base difference therefrom, and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 892 or a nucleotide sequence having 0 or 1 nucleotide base difference therefrom.

22. The double-stranded oligonucleotide according to claim 21, wherein the double-stranded oligonucleotide comprises: an antisense strand having a nucleotide sequence as set forth in SEQ ID NO: 914, and a sense strand having a nucleotide sequence as set forth in SEQ ID NO: 892.

23. The double-stranded oligonucleotide according to any one of claims 1 to 22, wherein the double-stranded oligonucleotide is siRNA.

24. A conjugate comprising the double-stranded oligonucleotide according to any one of claims 1 to 23, and one or more gene delivery carriers; optionally, the gene delivery carrier is selected from a ligand capable of binding to a cell surface receptor; optionally, the ligand is selected from a ligand of asialoglycoprotein receptor (ASGPR ligand); optionally, the ASGPR ligand comprises galactose or a derivative thereof; the galactose or the derivative thereof is selected from galactose, galactosamine, N-formyl galactosamine, N-acetyl galactosamine, N-propionyl galactosamine, N-n-butyryl galactosamine and N-isobutyryl galactosamine; and optionally, the number of the ASGPR ligand is one, and the one ASGPR ligand is conjugated to 3'-end of the sense strand of the double-stranded oligonucleotide.

25. The conjugate according to claim 24, wherein the conjugate comprises a structure as shown by formula (101): wherein Nu represents the double-stranded oligonucleotide; each Rligand is independently selected from an ASGPR ligand; and m is selected from 1, 2, 3 and 4; optionally, m is 1; and optionally, m is one, and the one Rligand is conjugated to 3'-end of the sense strand.

26. The conjugate according to claim 25, wherein each Rligand is independently selected from a structure as shown by formula (201), a pharmaceutically acceptable salt thereof and a steroisomer thereof: wherein * represents a conjugation site of the ligand on the sense strand or the antisense strand; j is selected from 1, 2, 3 and 4; each Z is selected from hydroxy and sulfydryl; each p is selected from 1, 2 and 3; each q is selected from 1, 2 and 3; each R2 is independently selected from H, any optionally substituted C1-6 alkyl and optionally substituted C1-6 alkoxy; each L is selected from optionally substituted C2-20 alkylene and wherein RLa and RLb are independently selected from any optionally substituted C1-10 alkylene, and k is selected from 1, 2, 3, 4 and 5; and each Y is selected from O, S and NH; optionally, m is selected from 1, 2 or 3; optionally, m is 3; optionally, Z is hydroxy; optionally, p is 1; optionally, q is 1; optionally, R2 is H; optionally, each L is selected from optionally substituted C2-10 alkylene and wherein RLa and RLb are independently selected from any optionally substituted C1-10 alkylene, and k is selected from 1, 2 and 3; optionally, k is 1; optionally, each L is selected from and and optionally, Y is O.

27. The conjugate according to claim 26, wherein each Rligand is independently selected from a structure as shown by formula (202), a pharmaceutically acceptable salt thereof and a steroisomer thereof:

28. The conjugate according to any one of claims 25 to 27, wherein each Rligand is independently selected from a structure as shown by formula (CR01008×3), a pharmaceutically acceptable salt thereof and a steroisomer thereof: alternatively, each Rligand is independently selected from a structure as shown by formula (CR01013×3), a pharmaceutically acceptable salt thereof and a steroisomer thereof:

29. The conjugate according to claim 28, wherein the conjugate comprises one or more pairs of: PairSense strand (5'-3')Antisense strand (5'-3')RZ00 2033SEQ ID NO: 887_(CR01008× 3)SEQ ID NO: 908RZ00 2034SEQ ID NO: 887_(CR01008× 3)SEQ ID NO: 909RZ00 2036SEQ ID NO: 888_(CR01008× 3)SEQ ID NO: 909RZ00 2037SEQ ID NO: 889_(CR01008× 3)SEQ ID NO: 909RZ00 2038SEQ ID NO: 890(CR01008×3 )SEQ ID NO: 909RZ00 2039SEQ ID NO: 891_(CR01008× 3)SEQ ID NO: 909RZ00 2040SEQ ID NO: 888_(CR01008× 3)SEQ ID NO: 911RZ00 2041SEQ ID NO: 889_(CR01008× 3)SEQ ID NO: 911RZ00 2042SEQ ID NO: 890_(CR01008× 3)SEQ ID NO: 911RZ00 2043SEQ ID NO: 891_(CR01008× 3)SEQ ID NO: 911RZ00 2050SEQ ID NO: 892_(CR01008× 3)SEQ ID NO: 912RZ00 2051SEQ ID NO: 892_(CR01008× 3)SEQ ID NO: 913RZ00 2053SEQ ID NO: 893_(CR01008× 3)SEQ ID NO: 913RZ00 2054SEQ ID NO: 894_(CR01008× 3)SEQ ID NO: 913RZ00 2055SEQ ID NO: 895_(CR01008× 3)SEQ ID NO: 913RZ00 2056SEQ ID NO: 896_(CR01008× 3)SEQ ID NO: 913RZ00 2057SEQ ID NO: 893_(CR01008× 3)SEQ ID NO: 915RZ00 2058SEQ ID NO: 894_(CR01008× 3)SEQ ID NO: 915RZ00 2059SEQ ID NO: 895_(CR01008× 3)SEQ ID NO: 915RZ00 2060SEQ ID NO: 896_(CR01008× 3)SEQ ID NO: 915RZ00 2066SEQ ID NO: 897_(CR01008× 3)SEQ ID NO: 916RZ00 2067SEQ ID NO: 897_(CR01008× 3)SEQ ID NO: 917RZ00 2068SEQ ID NO: 897_(CR01008× 3)SEQ ID NO: 918RZ00 2069SEQ ID NO: 898_(CR01008× 3)SEQ ID NO: 917RZ00 2070SEQ ID NO: 899_(CR01008× 3)SEQ ID NO: 917RZ00 2071SEQ ID NO: 900_(CR01008× 3)SEQ ID NO: 917RZ00 2072SEQ ID NO: 901_(CR01008× 3)SEQ ID NO: 917RZ00 2073SEQ ID NO: 898_(CR01008× 3)SEQ ID NO: 919RZ00 2074SEQ ID NO: 899_(CR01008× 3)SEQ ID NO: 919RZ00 2075SEQ ID NO: 900_(CR01008× 3)SEQ ID NO: 919RZ00 2076SEQ ID NO: 901_(CR01008× 3)SEQ ID NO: 919RZ00 2082SEQ ID NO: 902_(CR01008× 3)SEQ ID NO: 920RZ00 2083SEQ ID NO: 902_(CR01008× 3)SEQ ID NO: 921RZ00 2084SEQ ID NO: 902_(CR01008× 3)SEQ ID NO: 922RZ00 2085SEQ ID NO: 903_(CR01008× 3)SEQ ID NO: 921RZ00 2086SEQ ID NO: 904_(CR01008× 3)SEQ ID NO: 921RZ00 2087SEQ ID NO: 905_(CR01008× 3)SEQ ID NO: 921RZ00 2088SEQ ID NO: 906_(CR01008× 3)SEQ ID NO: 921RZ00 2089SEQ ID NO: 903_(CR01008× 3)SEQ ID NO: 923RZ00 2090SEQ ID NO: 904_(CR01008× 3)SEQ ID NO: 923RZ00 2091SEQ ID NO: 905_(CR01008× 3)SEQ ID NO: 923RZ00 2092SEQ ID NO: 906_(CR01008× 3)SEQ ID NO: 923RZ00 2099SEQ ID NO: 887_(CR01008× 3)SEQ ID NO: 910RZ00 2100SEQ ID NO: 888_(CR01008× 3)SEQ ID NO: 910RZ00 2101SEQ ID NO: 890_(CR01008× 3)SEQ ID NO: 910RZ00 2102SEQ ID NO: 890_(CR01008× 3)SEQ ID NO: 924RZ00 2103SEQ ID NO: 891_(CR01008× 3)SEQ ID NO: 924RZ00 2106SEQ ID NO: 892_(CR01008× 3)SEQ ID NO: 914RZ00 2107SEQ ID NO: 895_(CR01008× 3)SEQ ID NO: 914RZ00 2108SEQ ID NO: 896_(CR01008× 3)SEQ ID NO: 925RZ00 2112SEQ ID NO: 905_(CR01008× 3)SEQ ID NO: 922RZ00 2113SEQ ID NO: 906_(CR01008× 3)SEQ ID NO: 926RZ00 2115SEQ ID NO: 892_(CR01008× 3)SEQ ID NO: 927RZ00 2116SEQ ID NO: 907_(CR01008× 3)SEQ ID NO: 928RZ00 2117SEQ ID NO: 907_(CR01008× 3)SEQ ID NO: 929RZ00 2118SEQ ID NO: 907_(CR01008× 3)SEQ ID NO: 930RZ00 2119SEQ ID NO: 887_(CR01008× 3)SEQ ID NO: 931RZ00 2120SEQ ID NO: 887_(CR01008× 3)SEQ ID NO: 932RZ00 2121SEQ ID NO: 887_(CR01008× 3)SEQ ID NO: 933RZ00 2122SEQ ID NO: 902_(CR01008× 3)SEQ ID NO: 934RZ00 2123SEQ ID NO: 902_(CR01008× 3)SEQ ID NO: 935RZ00 2124SEQ ID NO: 902_(CR01008× 3)SEQ ID NO: 936RZ00 2125SEQ ID NO: 892_(CR01008× 3)SEQ ID NO: 937RZ00 2126SEQ ID NO: 892_(CR01008× 3)SEQ ID NO: 938RZ00 2130SEQ ID NO: 907_(CR01008× 3)SEQ ID NO: 939RZ00 2131SEQ ID NO: 897_(CR01008× 3)SEQ ID NO: 940RZ00 2132SEQ ID NO: 897_(CR01008× 3)SEQ ID NO: 941RZ00 2133SEQ ID NO: 897_(CR01008× 3)SEQ ID NO: 942RZ00 2134SEQ ID NO: 897_(CR01008× 3)SEQ ID NO: 943 optionally, the conjugate comprises one or more pairs of: PairSense strand (5'-3')Antisense strand (5'-3')RZ00 2033SEQ ID NO: 887_(CR01008× 3)SEQ ID NO: 908RZ00 2050SEQ ID NO: 892_(CR01008× 3)SEQ ID NO: 912RZ00 2082SEQ ID NO: 902_(CR01008× 3)SEQ ID NO: 920RZ00 2106SEQ ID NO: 892_(CR01008× 3)SEQ ID NO: 914RZ00 2115SEQ ID NO: 892_(CR01008× 3)SEQ ID NO: 927RZ00 2116SEQ ID NO: 907_(CR01008× 3)SEQ ID NO: 928RZ00 2117SEQ ID NO: 907_(CR01008× 3)SEQ ID NO: 929RZ00 2118SEQ ID NO: 907_(CR01008× 3)SEQ ID NO: 930RZ00 2119SEQ ID NO: 887_(CR01008× 3)SEQ ID NO: 931RZ00 2120SEQ ID NO: 887_(CR01008× 3)SEQ ID NO: 932RZ00 2121SEQ ID NO: 887_(CR01008× 3)SEQ ID NO: 933RZ00 2122SEQ ID NO: 902_(CR01008× 3)SEQ ID NO: 934RZ00 2123SEQ ID NO: 902_(CR01008× 3)SEQ ID NO: 935RZ00 2124SEQ ID NO: 902_(CR01008×3)SEQ ID NO: 936RZ00 2125SEQ ID NO: 892_(CR01008× 3)SEQ ID NO: 937RZ00 2126SEQ ID NO: 892_(CR01008× 3)SEQ ID NO: 938RZ00 2130SEQ ID NO: 907_(CR01008× 3)SEQ ID NO: 939RZ00 2131SEQ ID NO: 897_(CR01008× 3)SEQ ID NO: 940RZ00 2132SEQ ID NO: 897_(CR01008× 3)SEQ ID NO: 941RZ00 2133SEQ ID NO: 897_(CR01008× 3)SEQ ID NO: 942RZ00 2134SEQ ID NO: 897_(CR01008× 3)SEQ ID NO: 943 ; and optionally, the conjugate comprises the pair of: PairSense strand (5'-3')Antisense strand (5'-3')RZ00 2106SEQ ID NO: 892_(CR01008× 3)SEQ ID NO: 91430. Use of the double-stranded oligonucleotide according to any one of claims 1 to 23 or the conjugate according to any one of claims 24 to 29, in the manufacture of a medicament for ameliorating, preventing and / or treating a disease or disorder mediated by C3 gene; optionally, the disease or disorder mediated by C3 gene is selected from: IgA nephropathy, atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy, lupus nephritis, and membranous nephropathy.

31. A pharmaceutical composition comprising the double-stranded oligonucleotide according to any one of claims 1 to 23 and / or the conjugate according to any one of claims 24 to 29.

32. A kit comprising the double-stranded oligonucleotide according to any one of claims 1 to 23 and / or the conjugate according to any one of claims 24 to 29.

33. A method for inhibiting expression of C3 gene, comprising administering the double-stranded oligonucleotide according to any one of claims 1 to 23, and / or the conjugate according to any one of claims 24 to 29, and / or the pharmaceutical composition according to claim 31, to a subject in need thereof.

34. A method for ameliorating, treating and / or preventing a disease or disorder mediated by C3 gene, comprising administering the double-stranded oligonucleotide according to any one of claims 1 to 23, and / or the conjugate according to any one of claims 24 to 29, and / or the pharmaceutical composition according to claim 31, to a subject in need thereof; optionally, the disease or disorder mediated by C3 gene is associated with the mRNA expression level of C3 gene; optionally, the disease or disorder is selected from IgA nephropathy, atypical hemolytic uremic syndrome, paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy, lupus nephritis and membranous nephropathy.

Images