DNA APTAMER CONSTRUCTION AS A FUNCTIONAL MATERIAL FOR ESCHERICHIA COLI THERAPY AND DIAGNOSIS

Abstract

This invention aims to provide a DNA aptamer construct that can be used as a raw material for therapy against E. coli bacteria. In addition, the DNA aptamer construct in this invention can also be used as a raw material for diagnostic reogens for E. coli bacteria. The chemical and physical characteristics of the DNA aptamer in this invention consist of the number and sequence of constituent bases, secondary structure, and Gibbs free energy. DNA aptamer 1 IbG—14.03 kcal / nol) with a base count of 81 has a composition of A-23, T-19, G=20 and 019, a base content percentage of GC 48.1%, and a secondary structure consisting of 4 loops.

Description

Description DNA APTAMER CONSTRUCTION AS A FUNCTIONAL MATERIAL FOR THERAPY AND DIAGNOSIS OF ESCHERICHIA COLI Invention Engineering Field This invention relates to the construction of DMA aptamer as a functional material for the therapy and diagnosis of bacteria or Escherichia coli or abbreviated as E. coli, more specifically DNA aptamer which has a different base structure compared to the natural base structure, which is obtained by In Vitro techniques. Background of the Invention Diarrheal disease is still a health burden, especially in developing countries. In Indonesia, diarrheal disease ranks 13th among deadly diseases with a mortality proportion reaching 3.5% (Riskesdas, 2007. The number of diarrhea incidents has increased by 2.6% from 2016, which recorded 6.8 million cases (Data and Information Center, Ministry of Health of Indonesia, 2016). The results of research on diarrhea cases in several areas in Jakarta show that the rate of diarrhea diagnosis in toddlers is around 13.5% and environmental sanitation factors and poor community lifestyles are one of the factors in the high incidence of diarrheal disease (Mulyani and Kuscithawati, 2011). Enteropathogenic infections such as bacteria, protozoa or viruses that enter the human body through food or drink are the main causes of diarrhea (Sujaya et al., 2000; Trisnowati et al., 2017).This is supported by the results of clinical studies from observations of feces taken from babies with severe diarrhea, which showed infection due to E. coli in almost 70% of toddlers (Muttagin et al., 2016). Currently, aptamers have been widely studied as new drugs to replace antibiotics that often cause resistance mechanisms in pathogens. The application of aptamers for diagnostic purposes only, the results of in-vitro selection for E. coli are still limited to high-specificity DNA aptamers against E. coli KCTC2571 with a kd value of 12 nM (Kim et al., 2013). Then, Savory et al (2014) succeeded in isolating the EcA5-27 DNA aptamer with a characteristic aptamer length of 72 bases, a Kd value of UOnM, and the presence of a G-quadruplex motif. This DNA Aptamer has been claimed to be able to be used for the detection of E. coli in patients with a fairly high degree of specificity. Furthermore, Marton et al (2016) succeeded in obtaining DNA aptamer P12-31 with a length of 88 bases specific for the diagnosis of E. coli. The kd of this DNA aptamer, namely 87 0157, was successfully obtained by Amraee, which is quite high and very specific for E. coli 0157:H7. DNA aptamer in biosensor format was successfully developed for the purpose of rapid detection of E.coli O157:H7 On the other hand, the application of aptamer as salmonella and Mycobacterium tuberculosis. Application by Yu et al (2017) QCM sensor, antibacterial against has been done. based on the cause of septicemia where the nM value. DNA aptamer for E. coli et al (2017) with affinity for E. coli There are at least three previous inventions that discuss DNA aptamer for the identification of E. coli bacteria, namely Korean Patent Number KR 1020170054700 specifically binding to the surface of use thereof; Korean Patent Number Single Stranded DNA Aptamer O157:H7 And Production Method CN102808022 with the title “Application nf ij -i Application of oligonucleotide aptamer capable of identifying salmonella specifically. The comparative document above shows that there is no DNA aptamer construction that can be used as a therapeutic raw material or therapeutic and can also be used as a diagnostic raw material (reagent) for E. coli bacteria. Meanwhile, in the title "DNA Aptamer enterotoxin e coli bacteria and KR 1020160011511 with Specifically Binding to E. Thereof; and Chinese Patent title Coli The proposed invention number is that the DNA aptamer produced has two functions at once, namely the therapeutic function and diagnosis of diseases caused by E. coli infection, such as the DNA aptamer found in this invention. Brief Description of the Invention This invention aims to provide a DNA aptamer construct that can be used as a therapeutic raw material for E. coli bacteria. Furthermore, the DNA aptamer construct in this invention can also be used as a diagnostic reagent for E. coli bacteria. The DNA aptamer construct in this invention consists of the following base sequence: 5'CCGGAATTCCTAATACGACTCTACAAAAAAGTCGTGTCCAGTTGCCATGTGTAAAACTGTGT ATTGAAAACGCGGCCGCGG' 3 The construction of DNA aptamer in this invention consists of the number and sequence of constituent bases, secondary structure, and Gibbs free energy characterized by AG= -14.03 kcal / mol, with the number of bases 81 having a composition of A=23, T=19, G=20 and C=19, the percentage of base content GC 48.1%, and the secondary structure consisting of 4 loops. Short Description of Image Figure 1 is a Tm shift profiling image of the results of the in vitro DNA aptamer isolation process against the E.Coli target in this invention; Figure 2 is an image of the DNA aptamer construction resulting from isolation using the In Vitro technique using E. coli bacteria as the target in this invention; Figure 3 is a picture or photograph of the antimicrobial activity of DNA aptamer on several bacteria in this invention; Figure 4(A) is a graph showing the results of the biofilm formation inhibition test on E. coli EPEC K. 1.1 in this invention; Figure 4(B) is a graph of the results of the selectivity test of antibiofilm DNA apatamer 1 on several types of E.coupada invenslini; Figure 5(A) is a graph of the results of gPCR DNA aptamer specificity of three types of DNA aptamer on target bacteria; and Figure 5(B) is a graph of the qPCR results of DNA aptamer 1 selectivity in several types of E. coli. Complete Description of the Invention This invention aims to describe a DNA aptamer that has therapeutic properties for the diagnosis of diseases caused by E. coli infection. The DNA aptamer according to this invention is further described in more detail as follows. The DNA aptamer in this invention was obtained by isolating a random single-stranded DNA (Random ssDNA library) using an In vitro technique using E. coli as a target following the method developed by Marton et al. (2016) with modifications. The Random ssDNA library was synthesized by a chemical method with a population of -13X10K. The length of the Random ssDNA library base sequence was 81 bases. The process of isolating DNA aptamers in this invention uses the E. coli technique with the stages of (1) mixing coli, (2) washing to remove DNA aptamers that are not (3) multiplying DNA aptames using the PCR technique, and as many as 10 cycles. In the selection to increase Results of the DNA aptame binding process by performing Tm analysis which is bound to the target in vitro with the target Random ssDNA library with E. coli mixed solution to bind to E. coli, bound to E. coli stages 1 to 3 to 5 were carried out counter DNA aptamer against E. coli. on the target evaluated profiling of DNA aptamer 'cycle where DNA aptamer which (4) repeats the 4th cycle and specificity shift each successfully binds to E. coli is characterized by a shift in the Tm value of DNA aptamer to a higher temperature with a higher and sharper peak (Figure 1). DNA aptamer results of PCR amplification in cycles 8 and 10 were carried out Base sequence analysis using DNA sequencing method. The chemical and physical characteristics of the DNA aptamer in this invention consist of the number and sequence of constituent bases, secondary structure, and Gibbs free energy (Figure 2). DNA aptamer 1 (Z1G = 14.03 kcal / mol) with a base count of 81 has a composition of A = 23, T = 19, G = 20 and C = 19, a base content percentage of GC 48.1%, and a secondary structure consisting of 4 loops. The construction of DNA Aptamer 1 in this invention consists of the following base sequence: 5'CCGGAATTCCTAATACGACTCTACAAAAAAGTCGTGTCCAGTTGCCATGTGTAAAACTGTGT ATTGAAAACGCGGCCGCGG'3 The biological characteristics of the DNA aptamer in this invention are antibacterial and antibiofilm activity on E. coli. DNA aptamer 1 showed inhibition on two types of E. coli, EPEC K.1.1 and DH5a, while the inhibition on non-pathogenic bacteria was nil (figure 3). The results of the antibiofilm test of DNA aptamer 1 on E. coli type EPEC K.1.1 showed quite good activity in a wide pH range (figure 4a) which mimics the biological conditions of human intestinal pH. The antibiofilm activity of DNA aptamer 1 was highly selective on enteropathogenic E. coli only (figure 4b). DNA aptamer 1 in this invention is also used as a reagent for the diagnosis of E. coli bacteria, which is indicated by the gPCR Ct value on the template with the target EPEC K.1.1 compared to the qPCR Ct value on other comparison bacteria (Figure 4). This DNA aptamer 1 shows specific diagnostic potential for E. coli types, especially enteropathogens (Figure 5).

Claims

Claim 1. A DNA aptamer construct consisting of the number and sequence of constituent bases, secondary structure, and Gibbs free energy characterized by AG= -14.03 kcal / mol, with a total of 5 bases 81 having a composition of A=23, T=19, G=20 and C=19, a base content percentage of GC 48.1%, and a secondary structure consisting of 4 loops With the following base sequence: 5'CCGGAATTCCTAATACGACTCTACAAAAAGTCGTGGTCCAGTTGCCATGTGTAAAAC TGTGTATTGAAAACGCGGCCGCGG'3 10 has uses as a therapeutic or therapeutic raw material for Escherichia coli bacteria and as a diagnostic raw material for Escherichia coli bacteria.

2. The DNA aptamer construct as claimed in claims 1, 15 is preferably used as a specific diagnostic raw material for Escherichia coli strains, especially enteropathogens.

Images