Compositions and methods for inhibiting gene expression of lpa

Abstract

RNA interference (RNAi) agents and RNAi agent conjugates for inhibiting the expression of the LPA (apo(a)) gene are described. Pharmaceutical compositions comprising one or more LPA RNAi agents optionally with one or more additional therapeutics are also described. Delivery of the described LPA RNAi agents to liver cells in vivo provides for inhibition of LPA gene expression and treatment of cardiovascular and cardiovascular-related diseases.

Description

Compositions and Methods for Inhibiting Gene Expression of LPABACKGROUNDLipoprotein(a) [ Lp(a)| is a heterogeneous low density lipoprotein ( LDL)-like particle containing a lipid core and apolipoprotein B (apoB-100) with a unique constituent, apolipoprotein (a) (apo(a)), that is attached to apoB-100 through a disulfide bond.The apo(a) gene (LPA) is expressed predominantly in the liver and expression is restricted to human and non-human primates. Lp(a) levels in humans are genetically defined and do not change significantly with diet, exercise, or other lifestyle changes. LPA varies in length depending upon the number of Kringle KIV2 domains present and its expression is inversely correlated with the number of domains present. Normal Lp(a) levels range from 0.1-25 mg / dl, with about 25% of the population in the United States of America having Lp(a) levels of 30 mg / dl or higher.Analysis of Lp(a) levels in multiple studies have implicated high Lp(a) levels as an independent risk factor for cardiovascular disease, stroke, and other related disorders including atherosclerotic stenosis. In addition, genome-w ide association analyses have also implicated LPA as a genetic risk factor for diseases such as atherosclerotic stenosis.When therapeutic lipoprotein apheresis is used to lower both Lp(a) and LDL levels in hy perli pi demic patients, significant reductions of cardiovascular events have been observed. Therefore there exists a need for therapeutics and treatments related to these and other LPA- related diseases.SUMMARYDescribed herein are LPA (also termed apo(a)) RNA interference (RNAi) agents (also termed RNAi trigger, or trigger) and compositions containing LPA RNAi agents for selectively and efficiently inhibiting expression of the LPA gene. LPA is the name of the gene which encodes apolipoprotein (a) (apo(a)), a key component of the lipoprotein (a) particle (Lp(a)). The LPA RNAi agents described herein can be used in the prevention or treatment or the preparation of a medicament for the prevention or treatment of diseases including, but not limited to: Berger's disease, peripheral artery disease, coronary artery disease, metabolic syndrome, acute coronary syndrome, aortic valve stenosis, aortic valve regurgitation, aortic dissection, retinal arteryocclusion, cerebrovascular disease, mesenteric ischemia, superior mesenteric artery occlusion, renal artery stenosis, stable / unstable angina, acute coronary syndrome, heterozygous or homozygous familial hypercholesterolemia, hyperapobetalipoproteinemia, cerebrovascular atherosclerosis, cerebrovascular disease, and venous thrombosis.Each LPA RNAi agent includes at least a sense strand and an antisense strand. The sense strand and the antisense strand can be partially, substantially, or fully complementary to each other. The length of the RNAi agent sense and antisense strands described herein each can be 17 to 30 nucleotides in length. In some embodiments, the sense and antisense strands are independently 17 to 26 nucleotides in length. The sense and antisense strands can be either the same length or different lengths. The RNAi agents described herein, upon delivery to a cell expressing the LPA gene, inhibit the expression of the LPA gene in vitro or in vivo.A sense strand of an LPA RNAi agent comprises a nucleotide sequence having at least 90% identity over a core stretch of at least 17 consecutive nucleotides to a sequence in an LPA mRNA. In some embodiments, the sense strand nucleotide sequence having at least 90% identity to a sequence in the LPA mRNA is 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. An antisense strand of an LPA RNAi agent comprises a nucleotide sequence having at least 90% complementary over a core stretch of at least 16 consecutive nucleotides to a sequence in the LPA mRNA and the corresponding sense strand. In some embodiments, the antisense strand nucleotide sequence having at least 90% complementarity to a sequence in the LPA mRNA or the corresponding sense strand is 17, 18, 19, 20, 21, 22, or 23 nucleotides in length.In some embodiments, one or more LPA RNAi agents are delivered to target cells or tissues using any oligonucleotide delivery technology known in the art. Nucleic acid delivery methods include, but are not limited to, by encapsulation in liposomes, by iontophoresis, or by incorporation into other vehicles, such as hydrogels, cyclodextrins, biodegradable nanocapsules, and bioadhesive microspheres, proteinaceous vectors or Dynamic Polyconjugates™ (DPCs (see, for example WO 2000 / 053722, WO 2008 / 0022309, WO 2011 / 104169, and WO 2012 / 083185, each of which is incorporated herein by reference). In some embodiments, an LPA RNAi agent is conjugated to a targeting group. In some embodiments, the targeting group can include a cell receptor ligand, such as a galactose cluster, including a galactose cluster comprising an N-acetyl-galactosamine trimer.In some embodiments are described pharmaceutical compositions comprising one or more LPA RNAi agents. In some embodiments, an LPA RNAi agent is optionally combined with one or more additional (i.e., second, third, etc.) therapeutics. An additional therapeutic can be another LPA RNAi agent (e.g., an LPA RNAi agent which targets a different sequence within the LPA target). An additional therapeutic can also be a small molecule drug, antibody, antibody fragment, and / or vaccine. The LPA RNAi agents, with or without the one or more additional therapeutics, can be combined with one or more excipients to form pharmaceutical compositions. In some embodiments, compositions for delivering an LPA RNAi agent to a liver cell, particularly hepatocytes, in vivo are described, comprising: an LPA RNAi agent conjugated to a targeting group. In some embodiments, the targeting group is a asialoglycoprotein ligand.Also described are methods of treating a human subject having a pathological state or at risk of developing a pathological state mediated at least in part by LPA expression, the methods comprising the step(s) of administering to the subject a therapeutically effective amount of an LPA RNAi agent or LPA RNAi agent-containing composition. The method of treating a subject with an LPA RNAi agent or LPA RNAi agent-containing composition can optionally be combined with one or more steps of administering one or more additional (i.e., second) therapeutics or treatments. The LPA RNAi agent and additional therapeutics can be administered in a single composition or they may be administered separately. Examples of additional therapeutics include, but are not limited to, HMg Co-A reductase inhibitors (statins), ezetimibe, PCSK-9 inhibitors, CTEP inhibitors, therapies targeting ANGPTL3, therapies targeting APOC3, and niacin.Use of the described LPA RNAi agents can be used in methods for therapeutic prevention or treatment of diseases including, but not limited to: Berger's disease, peripheral artery disease, coronary artery disease, metabolic syndrome, acute coronary syndrome, aortic valve stenosis, aortic valve regurgitation, aortic dissection, retinal artery occlusion, cerebrovascular disease, mesenteric ischemia, superior mesenteric artery occlusion, renal artery stenosis, stable / unstable angina, acute coronary syndrome, heterozygous or homozygous familial hypercholesterolemia, hyperapobetalipoproteinemia, cerebrovascular atherosclerosis, cerebrovascular disease, and venous thrombosis. Such methods comprise administration of an LPA RNAi agent as described herein to a subject, e.g., a human or animal subject.The pharmaceutical compositions can be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration can be made by any way commonly known in the art, such as, but not limited to, topical (e.g., by a transdermal patch), pulmonary (e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer, intratracheal, intranasal), epidermal, transdermal, oral or parenteral. Parenteral administration includes, but is not limited to, intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subdermal (e.g., via an implanted device), intracranial, intraparenchymal, intrathecal, and intraventricular, administration. In some embodiments, the pharmaceutical compositions described herein are administered by subcutaneous injection.The described LPA RNAi agents and / or compositions can be used in methods for therapeutic treatment of diseases, including but not limited to: Berger's disease, peripheral artery disease, coronary artery disease, metabolic syndrome, acute coronary syndrome, aortic valve stenosis, aortic valve regurgitation, aortic dissection, retinal artery occlusion, cerebrovascular disease, mesenteric ischemia, superior mesenteric artery occlusion, renal artery stenosis, stable / unstable angina, acute coronary syndrome, heterozygous or homozygous familial hypercholesterolemia, hyperapobetalipoproteinemia, cerebrovascular atherosclerosis, cerebrovascular disease, and venous thrombosis. Such methods comprise administration of an LPA RNAi agent as described herein to a subject, e.g., a human or animal subject.Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.Other features and advantages of the invention will be apparent from the following detailed description, and from the claims.BRIEF DESCRIPTION OF THE FIGURESFIG. 1. Graph illustrating serum Lp(a) protein levels in Lp(a) transgenic (Tg) mice following a single subcutaneous administration of 0.5 mg / kg (dashed line) or 2 mg / kg (solid line) of indicated LPA RNAi agent. Lp(a) levels were normalized to day 1 and saline control. FIG. 2. Graph illustrating serum Lp(a) protein levels in Lp(a) Tg mice following administration of three subcutaneous doses of 1 mg / kg (dashed line) or 3 mg / kg (solid line) of indicated LPA RNAi agent, administered once a week for three weeks (dose on days 1, 8, and 15). Lp(a) levels were normalized to day 1 and saline control.FIG. 3. Graph illustrating Lp(a) particle levels in Cynomolgus monkey serum following administration of a single 2 mg / kg ADO 1196 LPA RNAi agent dosed 1 : 1 (wt / wt) with delivery polymer on day 1. Lp(a) levels were normalized to two pre-dose values (shown as day 0).FIG. 4. Graph illustrating Lp(a) particle levels in Cynomolgus monkey serum following administration of 4 mg / kg or 6 mg / kg LPA RNAi agent dosed 1 : 1 (wt / wt) with delivery polymer on day 1 and day 71. Lp(a) levels were normalized to two pre-dose values(shown as day 0). 4 mg / kg dose = black circles; 6 mg / kg dose = gray squares.FIG. 5. Graph illustrating Lp(a) particle levels in Cynomolgus monkey serum following three weekly subcutaneous doses of 3 mg / kg of AD02819 LPA RNAi agent on days 1, 8, and 15. Lp(a) levels were normalized to three pre-dose values (shown as day 0).FIG. 6. Graph illustrating Lp(a) particle levels in Cynomolgus monkey serum following a single subcutaneous administration of 3 mg / kg of LPA RNAi agent on day 1. AD03460 and AD03536 groups received an additional 1 mg / kg dose of LPA RNAi agent on day 48. Lp(a) levels were normalized to three pre-dose values (shown as day 0). DETAILED DESCRIPTIONDescribed herein are RNAi agents for inhibiting expression of the LPA gene (referred to herein as LPA RNAi agents). The RNAi agents described herein, upon delivery to a cell expressing the LPA gene, inhibit or knockdown expression of LPA in vitro and / or in vivo through the biological process of RNA interference (RNAi). As used herein, unless specifically noted otherwise, LPA may refer to an LPA gene, an LPA mRNA, or an LP(a) protein, as appropriate.An LPA RNAi agent comprises a sense strand and an antisense strand. The sense strand andantisense strand each contain a core sequence 17-23 nucleobases in length. An antisense strand core sequence is 100% (perfectly) complementary or at least 90% (substantially) complementary to a nucleotide sequence (sometimes referred to, e.g., as a target sequence) present in an LP A mRNA. A sense strand core sequence is 100% (perfectly) complementary or at least 90% (substantially) complementary to a sequence in the antisense strand and thus the sense strand core sequence is perfectly identical or at least 90% identical to a nucleotide sequence (target sequence) present in the LPA mRNA. A sense strand core sequence can be the same length as a corresponding antisense core sequence or it can be a different length. In some embodiments, the antisense strand core sequence is 17, 18, 19, 20, 21 , 22, or 23 nucleotides in length. In some embodiments, the sense strand core sequence is 17, 18, 19, 20, 21 , 22, or 23 nucleotides in length.LPA RNAi agent sense and antisense strands anneal to form a duplex. A sense strand and an antisense strand of an LPA RNAi agent are partially, substantially, or fully complementary to each other. Within the complementary duplex region, the sense strand core sequence is at least 90% complementary or 100% complementary to the antisense core sequence. In some embodiments, the sense strand core sequence contains a sequence of at least 17, at least 18, at least 19, at least 20, or at least 21 nucleotides that is at least 90% or 100% complementary to a corresponding 17, 18, 19, 20, or 21 nucleotide sequence of the antisense strand core sequence (i.e., the sense strand and antisense core sequences of an LPA RNAi agent have a region of at least 17, at least 18, at least 19, at least 20, or at least 21 nucleotides that is at least 90% base paired or 100% base paired.)As used herein, and unless otherwise indicated, the term "complementary," when used to describe a first nucleotide sequence (e.g., RNAi agent sense strand or LPA mRNA) in relation to a second nucleotide sequence (e.g., RNAi agent antisense strand), refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize (form base pair hydrogen bonds) and form a duplex or double helical structure under certain conditions with an oligonucleotide or polynucleotide comprising the second nucleotide sequence. Complementary sequences include Watson-Crick base pairs or non- Watson-Crick base pairs and include natural or modified nucleotides or nucleotide mimics as long as the above requirements with respect to their ability to hybridize are fulfilled. "Perfectly complementary" or "fully complementary" means that all (100%) of the bases in a contiguous sequence of a first polynucleotide will hybridize with the same number of bases in a contiguoussequence of a second polynucleotide. The contiguous sequence may comprise all or a part of a first or second nucleotide sequence. As used herein, "partial complementary" means that in a hybridized pair of nucleobase sequences, at least 70% of the bases in a contiguous sequence of a first polynucleotide will hybridize with the same number of bases in a contiguous sequence of a second polynucleotide. As used herein, "substantial complementary" means that in a hybridized pair of nucleobase sequences, at least 85% of the bases in a contiguous sequence of a first polynucleotide will hybridize with the same number of bases in a contiguous sequence of a second polynucleotide. The terms "complementary", "fully complementary" and "substantially complementary" as used herein may be used with respect to the base matching between the sense strand and the antisense strand of an RNAi agent, or between the antisense strand of an RNAi agent and a sequence of an LP A mRNA. Sequence identity or complementarity is independent of modification. For the purposes of determining identity or complementarity, for example, a and Af are complementary to U (or T) and identical to A. The length of the LPA RNAi agent sense and antisense strands described herein are independently 17 to 30 nucleotides in length. In some embodiments, the sense and antisense strands are independently 17 to 26 nucleotides in length. In some embodiments, the sense and antisense strands are 19-26 nucleotides in length. In some embodiments, the described RNAi agent sense and antisense strands are independently 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length. The sense and antisense strands can be either the same length or they can be different lengths. In some embodiments, a sense strand and an antisense strand are each 26 nucleotides in length. In some embodiments, a sense strand is 23 nucleotides in length and an antisense strand is 21 nucleotides in length. In some embodiments, a sense strand is 22 nucleotides in length and an antisense strand is 21 nucleotides in length. In some embodiments, a sense strand is 21 nucleotides in length and an antisense strand is 21 nucleotides in length. In some embodiments, a sense strand is 19 nucleotides in length and an antisense strand is 21 nucleotides in length.The sense strand and / or the antisense strand may optionally and independently contain an additional 1, 2, 3, 4, 5, or 6 nucleotides (extension) at the 3' end, the 5' end, or both the 3' and 5' ends of the core sequences. The antisense strand additional nucleotides, if present, may or may not be complementary to the corresponding sequence in the LPA mRNA. The sense strand additional nucleotides, if present, may or may not be identical to the corresponding sequence in the LPA mRNA. The antisense strand additional nucleotides, if present, may or may not becomplementary to the corresponding sense strand's additional nucleotides, if present.As used herein, an extension comprises 1, 2, 3, 4, 5, or 6 nucleotides at the 5' and / or 3' end of the sense strand core sequence and / or antisense strand core sequence. The extension nucleotides on a sense strand may or may not be complementary to nucleotides, either core sequence nucleotides or extension nucleotides, in the corresponding antisense strand. Conversely, the extension nucleotides on an antisense strand may or may not be complementary to nucleotides, either core sequence nucleotides or extension nucleotides, in the corresponding sense strand. In some embodiments, both the sense strand and the antisense strand of an RNAi agent contain 3' and 5' extensions. In some embodiments, one or more of the 3' extension nucleotides of one strand base pairs with one or more 5' extension nucleotides of the other strand. In other embodiments, one or more of 3' extension nucleotides of one strand do not base pair with one or more 5' extension nucleotides of the other strand. In some embodiments, an LPA RNAi agent has an antisense strand having a 3' extension and a sense strand having a 5' extension.In some embodiments an LPA RNAi agent comprises an antisense strand having a 3' extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In other embodiments, an LPA RNAi agent comprises an antisense strand having a 3' extension of 1, 2, or 3 nucleotides in length. In some embodiments, one or more of the antisense strand extension nucleotides comprise uracil or thymidine nucleotides or nucleotides which are complementary to the corresponding LPA mRNA sequence. In some embodiments, a 3' antisense strand extension includes or consists of, but is not limited to: Ab, AbAb, AUA, UGCUU, CUG, UG, UGCC, CUGCC, CGU, CUU, UGCCUA, CUGCCU, UGCCU, UGAUU, GCCUAU, T, TT (each listed 5' to 3').In some embodiments, an LPA RNAi agent comprises an antisense strand having a 5' extension of 1, 2, 3, 4, or 5 nucleotides in length. In other embodiments, an LPA RNAi agent comprises an antisense strand having a 5' extension of 1 or 2 nucleotides in length. In some embodiments, one or more of the antisense strand extension nucleotides comprises uracil or thymidine nucleotides or nucleotides which are complementary to the corresponding LPA mRNA sequence. In some embodiments, the 5' antisense strand extension includes or consists of, but is no limited to, UA, TU, U, T, CUC (each listed 5' to 3'). An antisense strand may have any of the 3' extensions described above in combination with any of the 5' antisense strand extensions described, if present.In some embodiments, an LPA RNAi agent comprises a sense strand having a 3' extension of 1, 2, 3, 4, or 5 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprises adenosine, uracil, or thymidine nucleotides, AT dinucleotide, or nucleotides which correspond to nucleotides in the LPA mRNA sequence. In some embodiments, the 3' sense strand extension includes or consists of, but is no limited to: T, UUAb, UAb, Ab, UT, TT, UUT, TTT, or TTTT (each listed 5' to 3').In some embodiments, an LPA RNAi agent comprises a sense strand having a 5' extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprise uracil or adenosine nucleotides or nucleotides which correspond to nucleotides in the LPA mRNA sequence. In some embodiments, the sense strand 5' extension can be, but is not limited to: CA, AUAGGC, AUAGG, AUAG, AUA, A, AA, AC, GCA, GGCA, GGC, UAUCA, UAUC, Ab, UCA, UAU (each listed 5' to 3'). A sense strand may have a 3' extension and / or a 5' extension.Examples of nucleotide sequences used in forming LPA RNAi agents are provided in Tables 1, 2A, 2B, 3A, and 3B. As used herein, the term "sequence" or "nucleotide sequence" refers to a succession or order of nucleobases, nucleotides, and / or nucleosides, whether modified or unmodified, described with a succession of letters using the standard nucleotide nomenclature and the key for modified nucleotides described herein.RNAi agents include, but are not limited to: short interfering RNAs (siRNAs), double-strand RNAs (dsRNA), micro RNAs (miRNAs), short hairpin RNAs (shRNA), and dicer substrates (e.g., U.S. Patent Nos. 8084599, 8349809, and 8513207).Unmodified LPA RNAi agent sense strand and antisense strand sequences are provided in Table 1. In forming LPA RNAi agents, each of the nucleotides in each of the sequences listed in Table 1 may be a modified nucleotide.Table 1. Unmodified LPA RNAi agent antisense strand and sense strand sequences.Antisense strand base sequence SEQ ID Sense strand base sequence SEQ ID5·→3· NO. 5·→3· NO.TCGGCAGUCCCUUCUGCGUTT 1 ACGCAGAAGGGACUGCCGAT 190TG U AG CACU CCU G CACCCCTT 2 GGGGUGCAGGAGUGCUACAT 191TAAUAAGGGGCUGCCACAGTT 3 CUGUGGCAGCCCCUUAUUAT 192TUAACAAUAAGGGGCUGCCTT 4 GGCAGCCCCUUAUUGUUAAT 193TGUAUAACAAUAAGGGGCUTT 5 AGCCCCUUAUUGUUAUACAT 194TCGUAUAACAAUAAGGGGCTT 6 GCCCCUUAUUGUUAUACGAT 195TCGUCUGAGCAUUGUGUCATT 7 UGACACAAUGCUCAGACGAT 196TGCGUCUGAGCAUUGUGUCTT 8 GACACAAUGCUCAGACGCAT 197TUGCGUCUGAGCAUUGUGUTT 9 ACACAAUGCUCAGACGCAAT 198TUCUGCGUCUGAGCAUUGUTT 10 ACAAUGCUCAGACGCAGAAT 199TGGAUCUGGAUUUCGGCAGTT 11 CUGCCGAAAUCCAGAUCCAT 200TCAGGAUCUGGAUUUCGGCTT 12 GCCGAAAUCCAGAUCCUGAT 201TCAUCUGAGCAUCGUGU CATT 13 UGACACGAUGCUCAGAUGAT 202TGCAUCUGAGCAUCGUGUCTT 14 GACACGAUGCUCAGAUGCAT 203TUGCAUCUGAGCAUCGUGUTT 15 ACACGAUGCUCAGAUGCAAT 204TUCUGCAUCUGAGCAUCGUTT 16 ACGAUGCUCAGAUGCAGAAT 205TAAAGCCUCUAGGCUUGGATT 17 UCCAAGCCUAGAGGCUUUAT 206TGUACCCCGGGGGUUUCCUTT 18 AGGAAACCCCCGGGGUACAT 207TUGUACCCCGGGGGUUUCCTT 19 GGAAACCCCCGGGGUACAAT 208TCUGUACCCCGGGGGUUUCTT 20 GAAACCCCCGGGGUACAGAT 209TUCCAUAAUGGUAGUAGCATT 21 UGCUACUACCAUUAUGGAAT 210TGUCCAUAAUGGUAGUAGCTT 22 GCUACUACCAUUAUGGACAT 211TCUCUGUCCAUAAUGGUAGTT 23 CUACCAUUAUGGACAGAGAT 212TCGACUAUGCUGGUGUGGUTT 24 ACCACACCAGCAUAGUCGAT 213TCCGACUAUGCUGGUGUGGTT 25 CCACACCAG CAU AG U CG G AT 214TUCCGACUAUGCUGGUGUGTT 26 CACACCAG CAU AG U CG GAAT 215TGGUCCGACUAUGCUGGUGTT 27 CACCAGCAUAGUCGGACCAT 216TUUUCUGGGGUCCGACUAUTT 28 AUAGUCGGACCCCAGAAAAT 217TUUUUCUGGGGUCCGACUATT 29 UAGUCGGACCCCAGAAAAAT 218TGCGAAUCUCAGCAUCUGGTT 30 CCAGAUGCUGAGAUUCGCAT 219TCCAAGGGCGAAUCUCAGCTT 31 GCUGAGAUUCGCCCUUGGAT 220TACCAAGGGCGAAUCUCAGTT 32 CUGAGAUUCGCCCUUGGUAT 221TCACCAAGGGCGAAUCUCATT 33 UGAGAUUCGCCCUUGGUGAT 222TACACCAAGGGCGAAUCUCTT 34 GAGAUUCGCCCUUGGUGUAT 223TCCUGACACUGGGAUCCAUTT 35 AUGGAUCCCAGUGUCAGGAT 224TUGCAAGGACACUUGAUUCTT 36 GAAUCAAGUGUCCUUGCAAT 225TUUGCAAGGACACUUGAUUTT 37 AAUCAAGUGUCCUUGCAAAT 226TUUGCUCCGUUGGUGCUUCTT 38 G AAGCACCAACG GAG CAAAT 227TAAUGAGCCUCGAUAACUCTT 39 GAGUUAUCGAGGCUCAUUAT 228TGAAUGAGCCUCGAUAACUTT 40 AGUUAUCGAGGCUCAUUCAT 229TGGAUAAUAUUCUGUUGUCTT 41 GACAACAGAAUAUUAUCCAT 230TCCAUGGUAUAACACCAAGTT 42 CUUGGUGUUAUACCAUGGAT 231TGAUCCAUGGUAUAACACCTT 43 GGUGUUAUACCAUGGAUCAT 232TAUUGGGAUCCAUGGUAUATT 44 UAUACCAUGGAUCCCAAUAT 233TCAUUGGGAUCCAUGGUAUTT 45 AUACCAUGGAUCCCAAUGAT 234TACAUUGGGAUCCAUGGUATT 46 UACCAUGGAUCCCAAUGUAT 235TGACAUUGGGAUCCAUGGUTT 47 ACCAUGGAUCCCAAUGUCAT 236TGACAUUGUGUCAGGUUGCTT 48 GCAACCUGACACAAUGUCAT 237TCACUGGACAUUGUGUCAGTT 49 CUGACACAAUGUCCAGUGAT 238TACUUGAUUCUGUCACUGGTT 50 CCAGUGACAGAAUCAAGUAT 239TGAGAAU GAGCCU CG AU AATT 51 UUAUCGAGGCUCAUUCUCAT 240TCCAUUUGGGUAGUAUUCUTT 52 AGAAUACUACCCAAAUGGAT 241TCACCAUUUGGGUAGUAUUTT 53 AAUACUACCCAAAUGGUGAT 242TCCACCAUUUGGGUAGUAUTT 54 AUACUACCCAAAUGGUGGAT 243TAUAACACCAAGGGCGAAUTT 55 AUUCGCCCUUGGUGUUAUAT 244TACUGGGAUCCAUGGUAUATT 56 UAUACCAUGGAUCCCAGUAT 245TCACUGGGAUCCAUGGUAUTT 57 AUACCAUGGAUCCCAGUGAT 246TACCACCGUGGGAGUUGUGTT 58 CACAACUCCCACGGUGGUAT 247TCAAGACUGACAUGUUCUUTT 59 AAGAACAUGUCAGUCUUGAT 248TGGGAGUUGUGAGGACACUTT 60 AGUGUCCUCACAACUCCCAT 249TUCUCAGGUGGUGCUUGUUTT 61 AACAAGCACCACCUGAGAAT 250TCACAGGGCUUUUCUCAGGTT 62 CCUGAGAAAAGCCCUGUGAT 251TGAUGCCAGUGUGGUAUCATT 63 UGAUACCACACUGGCAUCAT 252TUGAUGCCAGUGUGGUAUCTT 64 GAUACCACACUGGCAUCAAT 253TGACACCUGAUUCUGUUUCTT 65 G AAACAG AAU CAG G U G U CAT 254TGGACACCUGAUUCUGUUUTT 66 AAACAG AAU CAG G U G U CCAT 255TCUAGGACACCUGAUUCUGTT 67 CAGAAUCAGGUGUCCUAGAT 256TAUAAGGGGCUGCCACAGGTT 68 CCUGUGGCAGCCCCUUAUAT 257TAACAAUAAGGGGCUGCCATT 69 UGGCAGCCCCUUAUUGUUAT 258TGUCCGACUAUGCUGGUGUTT 70 ACACCAGCAUAGUCGGACAT 259TUCUCAGCAUCUGGAUUCCTT 71 GGAAUCCAGAUGCUGAGAAT 260TCGAAUCUCAGCAUCUGGATT 72 UCCAGAUGCUGAGAUUCGAT 261TAAGGGCGAAUCUCAGCAUTT 73 AUGCUGAGAUUCGCCCUUAT 262TUGACACUGGGAUCCAUGGTT 74 CCAUGGAUCCCAGUGUCAAT 263TCCGUUGGUGCUUCUUCAGTT 75 CUGAAGAAGCACCAACGGAT 264TCUUGAUUCUGUCACUGGATT 76 UCCAGUGACAGAAUCAAGAT 265TCACCGUGGGAGUUGUGAGTT 77 CUCACAACUCCCACGGUGAT 266TUCUAGGACACCUGAUUCUTT 78 AGAAUCAGGUGUCCUAGAAT 267TAGUCUCUAGGACACCUGATT 79 UCAGGUGUCCUAGAGACUAT 268TCAAUAAGGGGCUGCCACATT 80 UAUAGCCCCUUAUUGUUAUACAT 269TCUGCGUCUGAGCAUUGUGTT 81 UAUGCCCCUUAUUGUUAUACGAT 270TACAGGAUCUGGAUUUCGGTT 82 UAUGACACAAUGCUCAGACGCAT 271TCCGGGGGUUUCCUCAGUCTT 83 UAUACACAAUGCUCAGACGCAAT 272TUGUCCAUAAUGGUAGUAGTT 84 UAUUUAUCGAGGCUCAUUCUCAT 273TUCUGUCCAUAAUGGUAGUTT 85 U AU G AAACAG AAU CAG G U G U CAT 274TACUCUGUCCAUAAUGGUATT 86 U AU ACACCAG CAU AG U CG G ACAT 275TAACUCUGUCCAUAAUGGUTT 87 UAUUCCAGAUGCUGAGAUUCGAT 276TGGGCGAAUCUCAGCAUCUTT 88 UAUAUGCUGAGAUUCGCCCUUAT 277TAGGGCGAAUCUCAGCAUCTT 89 UAUCCAUGGAUCCCAGUGUCAAT 278TAACACCAAGGGCGAAUCUTT 90 UGUGGCAGCCCCUUAUUGAT 279TAGGACACUUGAUUCUGUCTT 91 CACAAUGCUCAGACGCAGAT 280TGG ACCAAGACU GACAUG UTT 92 CCGAAAUCCAGAUCCUGUAT 281TGGUCAGGCCACCAUUUGGTT 93 GACUGAGGAAACCCCCGGAT 282TAUCCAUGGUAUAACACCATT 94 CUACUACCAUUAUGGACAAT 283TGGGAUCCAUGGUAUAACATT 95 ACUACCAUUAUGGACAGAAT 284TUGGACAUUGUGUCAGGUUTT 96 UACCAUUAUGGACAGAGUAT 285TAUUCUGUCACUGGACAUUTT 97 ACCAUUAUGGACAGAGUUAT 286TGGUGCUUGUUCAGAAACATT 98 AGAUGCUGAGAUUCGCCCAT 287TGGAGAAUGAGCCUCGAUATT 99 GAUGCUGAGAUUCGCCCUAT 288TGUGGAGAAUGAGCCUCGATT 100 AGAUUCGCCCUUGGUGUUAT 289TCCGUGGGAGUUGUGAGGATT 101 GACAGAAUCAAGUGUCCUAT 290TGGACCACCGUGGGAGUUGTT 102 ACAUGUCAGUCUUGGUCCAT 291TUGCUUGUUCAGAAGGAGCTT 103 CCAAAUGGUGGCCUGACCAT 292TCUGAUGCCAGUGUGGUAUTT 104 UGGUGUUAUACCAUGGAUAT 293TUAGGACACCUGAUUCUGUTT 105 UGUUAUACCAUGGAUCCCAT 294TCUCUAGGACACCUGAUUCTT 106 AACCUGACACAAUGUCCAAT 295TUCUCUAGGACACCUGAUUTT 107 AAUGUCCAGUGACAGAAUAT 296TGUCUCUAGGACACCUGAUTT 108 UGUUUCUGAACAAGCACCAT 297TGAGAAUGAGCCUCGAUAACUCUUAU 109 UAUCGAGGCUCAUUCUCCAT 298TGACACCUGAUUCUGUUUCUGAGUAU 110 UCGAGGCUCAUUCUCCACAT 299TCGUAUAACAAUAAGGGGCUGCCUAU 111 UCCUCACAACUCCCACGGAT 300TGCGUCUGAGCAUUGUGUCAGGUUAU 112 CAACUCCCACGGUGGUCCAT 301TUGCGUCUGAGCAUUGUGUCAGGUAU 113 GCUCCUUCUGAACAAGCAAT 302TAAGGGCGAAUCUCAGCAUCUGGUAU 114 AUACCACACUGGCAUCAGAT 303UUAACAAUAAGGGGCUGCAb 115 ACAGAAUCAGGUGUCCUAAT 304UGUAUAACAAUAAGGGGCAb 116 GAAUCAGGUGUCCUAGAGAT 305UCGUAUAACAAUAAGGGGAb 117 AAUCAGGUGUCCUAGAGAAT 306UGCGUCUGAGCAUUGUGUAb 118 AUCAGGUGUCCUAGAGACAT 307UUGCGUCUGAGCAUUGUGAb 119 UAUAUAGUUAUCGAGGCUCAUUCUCA 308UCAGGAUCUGGAUUUCGGAb 120 UAUAUCAGAAACAGAAUCAGGUGUCA 309UUGCAUCUGAGCAUCGUGAb 121 UAUAUCAGCCCCUUAUUGUUAUACGA 310UCGACUAUGCUGGUGUGGAb 122 UAUAUCUGACACAAUGCUCAGACGCA 311UUUUCUGGGGUCCGACUAAb 123 UAUAUUGACACAAUGCUCAGACGCAA 312UGCGAAUCUCAGCAUCUGAb 124 UAUAUAGAUGCUGAGAUUCGCCCUUA 313UUGCAAGGACACUUGAUUAb 125 GCAGCCCCUUAUUGUUAA 314UAAUGAGCCUCGAUAACUAb 126 GCCCCUUAUUGUUAUACA 315UGAAUGAGCCUCGAUAACAb 127 CCCCUUAUUGUUAUACGA 316UGACAUUGUGUCAGGUUGAb 128 ACACAAUGCUCAGACGCA 317UGAGAAUGAGCCUCGAUAAb 129 CACAAUGCUCAGACGCAA 318UCCAUUUGGGUAGUAUUCAb 130 CCGAAAUCCAGAUCCUGA 319UCACCAUUUGGGUAGUAUAb 131 CACGAUGCUCAGAUGCAA 320UGACACCUGAUUCUGUUUAb 132 CCACACCAG CAU AG U CG A 321UGGACACCUGAUUCUGUUAb 133 UAGUCGGACCCCAGAAAA 322UUAACAAUAAGGGGCUGAbAb 134 CAGAUGCUGAGAUUCGCA 323UGUAUAACAAUAAGGGGAbAb 135 AAUCAAGUGUCCUUGCAA 324UCGUAUAACAAUAAGGGAbAb 136 AGUUAUCGAGGCUCAUUA 325UGCGUCUGAGCAUUGUGAbAb 137 GUUAUCGAGGCUCAUUCA 326UUGCGUCUGAGCAUUGUAbAb 138 CAACCUGACACAAUGUCA 327UCAGGAUCUGGAUUUCGAbAb 139 UAUCGAGGCUCAUUCUCA 328UUGCAUCUGAGCAUCGUAbAb 140 GAAUACUACCCAAAUGGA 329UCGACUAUGCUGGUGUGAbAb 141 AUACUACCCAAAUGGUGA 330UUUUCUGGGGUCCGACUAbAb 142 AAACAG AAU CAG G U G U CA 331UGCGAAUCUCAGCAUCUAbAb 143 AACAG AAU CAG G U G U CCA 332UUGCAAGGACACUUGAUAbAb 144 CAGCCCCUUAUUGUUAA 333UAAUGAGCCUCGAUAACAbAb 145 CCCCUUAUUGUUAUACA 334UGAAUGAGCCUCGAUAAAbAb 146 CCCUUAUUGUUAUACGA 335UGACAUUGUGUCAGGUUAbAb 147 CACAAUGCUCAGACGCA 336UGAGAAUGAGCCUCGAUAbAb 148 ACAAUGCUCAGACGCAA 337UCCAUUUGGGUAGUAUUAbAb 149 CGAAAUCCAGAUCCUGA 338UCACCAUUUGGGUAGUAAbAb 150 ACGAUGCUCAGAUGCAA 339UGACACCUGAUUCUGUUAbAb 151 CACACCAGCAUAGUCGA 340UGGACACCUGAUUCUGUAbAb 152 AGUCGGACCCCAGAAAA 341UGAGAAUGAGCCUCGAUAACUCUUAU 153 AGAUGCUGAGAUUCGCA 342UGACACCUGAUUCUGUUUCUGAGUAU 154 AUCAAGUGUCCUUGCAA 343UGAGAAUGAGCCUCGAUAACUCTUAU 155 GUUAUCGAGGCUCAUUA 344UCGUAUAACAAUAAGGGGCUGCCUAU 156 UUAUCGAGGCUCAUUCA 345UGAGAAUGAGCCUCGAUAATT 157 AACCUGACACAAUGUCA 346UCGUAUAACAAUAAGGCGCUGCCUAU 158 AUCGAGGCUCAUUCUCA 347UGAGAAUGAGCCUCGATAbAb 159 AAU ACU ACCCAAAU GG A 348UGACACCUGAUUCUGTTAbAb 160 UACUACCCAAAUGGUGA 349UCGUAUAACAAUAAGGGGCUGAUU 161 AACAG AAU CAG G U G U CA 350UCGUAUAACAAUAAGGGGCUGCUU 162 ACAGAAUCAGGUGUCCA 351UGAGAAUGAGCCUCGAUAACUCUU 163 UAUAUCAGCGCCUUAUUGUUAUACGA 352UCGUAUAACAAUAAGGGGCUU 164 ATCGAGGCUCAUUCUCA 353UGUAUAACAAUAAGGGG 165 UCAGCCCCUUAUUGUUAUACGAUUAb 354UCGUAUAACAAUAAGGG 166 UCAGCCCCUUAUUGUUAUACGAAb 355UGAGAAUGAGCCUCGAT 167 UAGUUAUCGAGGCUCAUUCUCAUUAb 356UGACACCUGAUUCUGTT 168 AbGCCCCUUAUUGUUAUACGAUUAb 357TUCGUAUAACAAUAAGGGGCUGCCUA 169 AUAUCAGCCCCUUAUUGUUAUACGAT 358UAUCGUAUAACAAUAAGGGGCUGCCU 170 UAUCAGCCCCUUAUUGUUAUACGAUT 359TCCGUAUAACAAUAAGGGGCUGCCUA 171 AUAUAGUUAUCGAGGCUCAUUCUCAT 360CUCCGUAUAACAAUAAGGGGCUGCCU 172 UAUAGUUAUCGAGGCUCAUUCUCAUT 361TUGAGAAUGAGCCUCGAUAACUCUUA 173 AbUUAUCGAGGCUCAUUCUCAUUAb 362UAUGAGAAUGAGCCUCGAUAACUCUU 174 UAUAUAAUUAUCGAGGCUCAUUCUCAAb 363TGGAGAAUGAGCCUCGAUAACUCUUA 175 GGCAGCCCCUUAUUGUUAUACGATT 364GUGGAGAAUGAGCCUCGAUAACUCUU 176 GGCAGCCCCUUAUUGUUAUACGAUUT 365UGAGAAUGAGCCUCGAUAAUU 177 CAGCCCCUUAUUGUUAUACGA I 1 1 1 366TCGUAUAACAAUAAGGGGCUU 178 GCGAUAGUUAUCGAGGCUCAUUCUCA 367UGAGAAUGAGCCUCGAUAAUUAUAUA 179 UGAAUAGUUAUCGAGGCUCAUUCUCA 368UCGUAUAACAAUAAGGGGCUGCC 180 AUCGUAGUUAUCGAGGCUCAUUCUCA 369TUCGUAUAACAAUAAGGGGCUGCC 181 UAUAAAGUUAUCGAGGCUCAUUCUCA 370TUCGUAUAACAAUAAGGGGCUG 182 AGCCCCUUAUUGUUAUACGAAb 371UGAGAAUGAGCCUCGAUAACUAUCGC 183 AAGCCCCUUAUUGUUAUACGAAb 372UGAGAAUGAGCCUCGAUAACUAUUCA 184 GCAGCCCCUUAUUGUUAUACGAAb 373UGAGAAUGAGCCUCGAUAACUACGAU 185 UAUAUAGUUAUCGAGGCUCAUUCUCAAb 374UCGUAUAACAAUAAGGGGCGU 186 ACGCCCCUUAUUGUUAUACGAAb 375UCGUAUAACAAUAAGGGGCUGCCU 187 GCCCCUUAUUGUUAUACGAUUAb 376UCGUAUAACAAUAAGGGGCUG 188 AGCCCCUUAUUGUUAUACGAUUAb 377TCGUAUAACAAUAAGGGGCUGCUU 189 AAGCCCCUUAUUGUUAUACGAUUAb 378TCGUAUAACAAUAAGGGGC 1242 UAUCAGCCCCUUAUUGUUAUACGA 379UCGUAUAACAAUAAGGGG 1244 UAGCAGCCCCUUAUUGUUAUACGA 380UCGUAUAACAAUAAGGG 1246 GCAGCCCCUUAUUGUUAUACGA 381TGAGAAU GAGCCU CG AU AA 1248 AUAAGAGUUAUCGAGGCUCAUUCUCA 382UGAGAAUGAGCCUCGAUA 1250 AUAGGCAGCCCCUUAUUGUUAUACGA 383UGAGAAUGAGCCUCGAU 1252 CAGCCCCUUAUUGUUAUACGA 384UGUAUAACAAUAAGGGG 1254 UAUAUCAGCCCCTUAUUGUUAUACGA 385CGUAUAACAAUAAGGGGC 1280 AbGCCCCTUAUUGUUAUACGAUUAb 1241GAGAAUGAGCCUCGAUAA 1281 GCCCCUUAUUGUUAUACGA 1243UCGUAUAACAAUAAGGGGC 1282 CCCCUUAUUGUUAUACGA 1245UGAGAAUGAGCCUCGAUAA 1283 CCCUUAUUGUUAUACGA 1247UUAUCGAGGCUCAUUCUCA 1249UAUCGAGGCUCAUUCUCA 1251AUCGAGGCUCAUUCUCA 1253CCCCUUAUUGUUAUACA 1255UUAUCGAGGCUCAUUCUCA 1258GCCCCUUAUUGUUAUACGA 1259ACAGCCCCUUAUUGUUAUACGA 1260AAAGCCCCUUAUUGUUAUACGA 1261GCCCCUUAUUGUUAUACG 1284UUAUCGAGGCUCAUUCUC 1285Ab = abasic nucleotideThe LPA RNAi agents described herein are formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence listed in Table 1 or Table 2B can be hybridized to any antisense strand containing a sequence listed in Table 1 or Table 2A provided the two sequences have a region of at least 90% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence.In some embodiments, an LPA RNAi agent antisense strand comprises a nucleotide sequence of any of the sequences in Table 1. In some embodiments, an LPA RNAi agent antisense strand comprises the sequence of nucleotides 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2- 21, 1-22, 2-22, 1-23, 2-23, 1-24, 2-24, 1-25, 2-25, 1-26, or 2-26 of any of the sequences inTable 1. In some embodiments, an LP A RNAi agent sense strand comprises the nucleotide sequence of any of the sequences in Tables 1. In some embodiments, an LPA RNAi agent sense strand comprises the sequence of nucleotides 1-17, 2-17, 1 -18, 2-18, 1 -19, 2-19, 1-20, 2-20, 1 - 21, 2-21 , 1 -22, 2-22, 1 -23, 2-23, 1-24, 2-24, 1-25, 2-25, 1-26, or 2-26 of any of the sequences in Table 1.In some embodiments, the sense and antisense strands of the RNAi agents described herein contain the same number of nucleotides. In some embodiments the sense and antisense strands of the RNAi agents described herein contain different numbers of nucleotides. In some embodiments, the sense strand 5' end and the antisense strand 3' end of an RNAi agent form a blunt end. In some embodiments, the sense strand 3' end and the antisense strand 5' end of an RNAi agent form a blunt end. In some embodiments, both ends of an RNAi agent form blunt ends. In some embodiments, neither end of an RNAi agent is blunt-ended. As used herein a blunt end refers to an end of a double stranded RNAi agent in which the terminal nucleotides of the two annealed strands are complementary (form a complementary base-pair). In some embodiments, the sense strand 5' end and the antisense strand 3' end of an RNAi agent form a frayed end. In some embodiments, the sense strand 3' end and the antisense strand 5' end of an RNAi agent form a frayed end. In some embodiments, both ends of an RNAi agent form a frayed end. In some embodiments, neither end of an RNAi agent is a frayed end. As used herein a frayed end refers to an end of a double stranded RNAi agent in which the terminal nucleotides of the two annealed strands from a pair (i.e. do not form an overhang) but are not complementary (i.e. form a non-complementary pair). As used herein, an overhang is a stretch of one or more unpaired nucleotides at the end of one strand of a double stranded RNAi agent. The unpaired nucleotides may be on the sense strand or the antisense strand, creating either 3' or 5' overhangs. In some embodiments the RNAi agent contains: a blunt end and a frayed end, a blunt end and 5' overhang end, a blunt end and a 3' overhang end, a frayed end and a 5' overhang end, a frayed end and a 3' overhang end, two 5' overhang ends, two 3' overhang ends, a 5' overhang end and a 3' overhang end, two frayed ends, or two blunt ends. A nucleotide base (or nucleobase) is a heterocyclic pyrimidine or purine compound which is a constituent of all nucleic acids and includes adenine (A), guanine (G), cytosine (C), thymine (T), and uracil (U). As used herein, the term "nucleotide" can include a modified nucleotide or nucleotide mimic, abasic site (Ab or X), or a surrogate replacement moiety.In some embodiments, an LPA RNAi agent is prepared or provided as a salt, mixed salt, or a free-acid.Modified NucleotidesIn some embodiments, an LPA RNAi agent contains one or more modified nucleotides. As used herein, a "modified nucleotide" is a nucleotide other than a ribonucleotide (2'-hydroxyl nucleotide). In some embodiments, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% of the nucleotides are modified. Modified nucleotides include, but are not limited to, deoxynucleotides, nucleotide mimics, abasic nucleotides (represented herein as X, Ab), 2'-modified nucleotides, 3' to 3' linkages (inverted) nucleotides (represented herein as invdN, invN, invn, invX, invAb, non-natural base-comprising nucleotides, bridged nucleotides, peptide nucleic acids (PNAs), 2',3'-seco nucleotide mimics (unlocked nucleobase analogues, represented herein as NU A or NUNA), locked nucleotides (represented herein as NLNA or NLNA), 3'-0-Methoxy (2' intemucleoside linked) nucleotides (represented herein as 3'-OMen), 2'-F-Arabino nucleotides (represented herein as NfANA or WANA), 5'-Me,2'-fluoro nucleotide (represented herein as 5Me-Nf), morpholino nucleotides, vinyl phosphonate deoxyribonucleotides (represented herein as vpdN), vinyl phosphonate containing nucleotides, and cyclopropyl phosphonate containing nucleotides (cPrpN). 2'-modified nucleotides (i.e. a nucleotide with a group other than a hydroxyl group at the 2' position of the five-membered sugar ring) include, but are not limited to, 2'-0-methyl nucleotides (represented herein as a lower case letter 'n' in a nucleotide sequence), 2'-deoxy-2'-fluoro nucleotides (represented herein as Nf, also represented herein as 2'-fluoro nucleotide), 2'-deoxy nucleotides (represented herein as dN), 2'-methoxy ethyl (2'-0-2-methoxylethyl) nucleotides (represented herein as NM or 2'-MOE), 2'-amino nucleotides, and 2'-alkyl nucleotides. It is not necessary for all positions in a given compound to be uniformly modified. Conversely, more than one modification may be incorporated in a single LPA RNAi agent or even in a single nucleotide thereof. The LPA RNAi agent sense strands and antisense strands may be synthesized and / or modified by methods known in the art. Modification at one nucleotide is independent of modification at another nucleotide.Modified nucleotides also include nucleotides having modified nucleobases. Modified nucleobases include, but are not limited to, synthetic and natural nucleobases, 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine, 5-methylcytosine (5-me-C),5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2- thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8- halo, 8-amino, 8-thiol, 8-thioalkyl, 8- hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5- trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Modified Intemucleoside LinkagesIn some embodiments, one or more nucleotides of an LPA RNAi agent are linked by nonstandard linkages or backbones (i.e. modified intemucleoside linkages or modified backbones). In some embodiments, a modified intemucleoside linkage is a non-phosphate-containing covalent intemucleoside linkage. Modified intemucleoside linkages or backbones include, but are not limited to, 5'-phosphorothioate group (represented herein as a lower case 's' before a nucleotide, as in sN, sn, sNf, or sdN), chiral phosphorothioates, thiophosphate, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphorami dates including 3 '-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkyl-phosphonates, thionoalkylphosphotriesters, morpholino linkages, and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3 '-5' to 5'-3' or 2'-5' to 5'-2'. In other embodiments, a modified intemucleoside linkage or backbone lacks a phosphorus atom. Modified intemucleoside linkages lacking a phosphorus atom include, but are not limited to, short chain alkyl or cycloalkyl inter-sugar linkages, mixed heteroatom and alkyl or cycloalkyl inter-sugar linkages, or one or more short chain heteroatomic or heterocyclic inter-sugar linkages. In some embodiments, modified intemucleoside backbones include, but are not limited to, siloxane backbones, sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones, methylene formacetyl and thioformacetyl backbones, alkene containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones; and others having mixed N, O, S, and CH2 component parts.In some embodiments, a sense strand of an LPA RNAi agent can contain 1, 2, 3, 4phosphorothioate linkages, an antisense strand of an LPA RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, or both the sense strand and the antisense strand independently can contain 1, 2, 3, or 4 phosphorothioate linkages. In some embodiments, an LPA RNAi agent sense strand contains two phosphorothioate intemucleoside linkages. In some embodiments, the two phosphorothioate internucleoside linkages are between the nucleotides at positions 1 -3 from the 3' end of the sense strand. In some embodiments, the two phosphorothioate internucleoside linkages are between the nucleotides at positions 1 -3, 2-4, 3-5, 4-6, 4-5, or 6-8 from the 5' end of the sense strand. In some embodiments, an LPA RNAi agent antisense strand contains four phosphorothioate internucleoside linkages. In some embodiments, the four phosphorothioate internucleoside linkages are between the nucleotides at positions 1 -3 from the 5' end of the sense strand and between the nucleotides at positions 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 from the 5' end. In some embodiments, an LPA RNAi agent contains two phosphorothioate internucleoside linkages in the sense strand and four phosphorothioate internucleoside linkages in the antisense strand.In some embodiments, an LPA RNAi agent contains one or more modified nucleotides and one or more modified internucleoside linkages. In some embodiments, a 2'-modified nucleotide is combined with modified internucleoside linkage.LPA RNAi Agents Having Modified NucleotidesExamples of antisense strands containing modified nucleotides are provided in Table 2A. Examples of sense strands containing modified nucleotides are provided in Table 2B. In Tables 2A and 2B, the following notations are used to indicate modified nucleotides:N 2'-OH (unmodified) ribonucleotide (capital letter without f or d indication)n 2'-OMe modified nucleotideNf 2'-fluoro modified nucleotidedN 2'-deoxy nucleotidesNU A 2',3'-seco nucleotide mimics (unlocked nucleobase analogs)NLNA locked nucleotideNfANA 2'-F-Arabino nucleotideNM 2'-methoxy ethyl nucleotideAb abasic ribose(invdN) = inverted deoxyribonucleotide (3'-3' linked nucleotide)(invAb) = inverted abasic nucleotide(invn) = inverted 2'-OMe nucleotides = phosphorothioate linked nucleotidep = phosphatevpdN = vinyl phosphonate deoxyribonucleotide(3'OMen) = 3 '-OMe nucleotide(5Me-Nf) = 5'-Me, 2'-fluoro nucleotidecPrp = cyclopropyl phosphonateepTcPr = see Table 4epTM = see Table 4In addition the following targeting groups and linking groups are listed in Tables 2 A and 2B: (Alk-PEG5-C6), (C11-PEG3-NAG3), (C12), (C6-PEG4-NAG3), (C6-SS-Alk-Me), (Chol-TEG), (Dy540), (NAG 13), (NAG18), (NAG24), (NAG25), (NAG26), (NAG27), (NAG28), (NAG29), (NAG30), (NAG31), (NAG32), (NAG33), (NAG34), (NAG35), (NAG36), (NAG37), (NAG4), (PAZ), (Spl8), (Steryl), (Alk-SMPT-C6). Each sense strand and / or antisense strand can have any of the above indicated targeting groups or linking groups, as well as other targeting or linking groups, conjugated to the 5' and or 3' end of the sequence. The chemical structures for these groups are provided in Table 4.Table 2 A. LP A RNAi agent antisense strands having modified nucleotides.Antisense SEQ SEQAntisense strand sequence 5'Strand ID ID NO. ID NO.AM01240-AS dTCfgGfcAfgUfcCfcUfuCfuGfcGfudTsdT 386 1AM01241-AS dTGfuAfgCfaCfuCfcUfgCfaCfcCfcdTsdT 387 2AM01242-AS dTAfa UfaAfgGfgGfcUfgCfcAfcAfgdTsdT 388 3AM01243-AS dTUfaAfcAfa UfaAfgGfgGfcUfgCfcdTsdT 389 4AM01244-AS dTGfuAfuAfaCfaAfuAfaGfgGfgCfudTsdT 390 5AM01245-AS dTCfgUfa UfaAfcAfa UfaAfgGfgGfcdTsdT 391 6AM01246-AS dTCfgUfcUfgAfgCfa UfuGfuGfuCfadTsdT 392 7AM01247-AS dTGfcGfuCfuGfaGfcAfuUfgUfgUfcdTsdT 393 8AM01248-AS dTUfgCfgUfcUfgAfgCfa UfuGfuGfudTsdT 394 9AM01249-AS dTUfcUfgCfgUfcUfgAfgCfa UfuGfudTsdT 395 10AM01250-AS dTGfgAfuCfuGfgAfu UfuCfgGfcAfgdTsdT 396 11AM01251-AS dTCfaGfgAfuCfuGfgAfu UfuCfgGfcdTsdT 397 12AM01252-AS dTCfa UfcUfgAfgCfaUfcGfuGfuCfadTsdT 398 13AM01253-AS dTGfcAfuCfuGfaGfcAfuCfgUfgUfcdTsdT 399 14AM01254-AS dTUfgCfaUfcUfgAfgCfaUfcGfuGfudTsdT 400 15AM01255-AS dTUfcUfgCfaUfcUfgAfgCfa UfcGfudTsdT 401 16 AM01256-AS dTAfaAfgCfcUfcUfaGfgCfu UfgGfadTsdT 402 17AM01257-AS dTGfuAfcCfcCfgGfgGfgUfuUfcCfudTsdT 403 18AM01258-AS dTUfgUfaCfcCfcGfgGfgGfu UfuCfcdTsdT 404 19AM01259-AS dTCfuGfuAfcCfcCfgGfgGfgUfu UfcdTsdT 405 20AM01260-AS dTUfcCfaUfaAfuGfgUfaGfuAfgCfadTsdT 406 21AM01261-AS dTGfuCfcAfuAfa UfgGfuAfgUfaGfcdTsdT 407 22AM01262-AS dTCfuCfuGfuCfcAfuAfaUfgGfuAfgdTsdT 408 23AM01263-AS dTCfgAfcUfa UfgCfuGfgUfgUfgGfudTsdT 409 24AM01264-AS dTCfcGfaCfuAfuGfcUfgGfuGfuGfgdTsdT 410 25AM01265-AS dTUfcCfgAfcUfa UfgCfuGfgUfgUfgdTsdT 411 26AM01266-AS dTGfgUfcCfgAfcUfa UfgCfuGfgUfgdTsdT 412 27AM01267-AS dTUfu UfcUfgGfgGfuCfcGfaCfuAfudTsdT 413 28AM01268-AS dTUfu UfuCfuGfgGfgUfcCfgAfcUfadTsdT 414 29AM01269-AS dTGf cGf a Af uCf u Cf a Gf cAf u Cf u GfgdTsdT 415 30AM01270-AS dTCfcAfaGfgGfcGfaAfuCfuCfaGfcdTsdT 416 31AM01271-AS dTAfcCfaAfgGfgCfgAfa UfcUfcAfgdTsdT 417 32AM01272-AS dTCfaCfcAfaGfgGfcGfaAfuCfuCfadTsdT 418 33AM01273-AS dTAfcAfcCfaAfgGfgCfgAfaUfcUfcdTsdT 419 34AM01274-AS dTCfcUfgAfcAfcUfgGfgAfuCfcAfudTsdT 420 35AM01275-AS dTUfgCfaAfgGfaCfaCfuUfgAfuUfcdTsdT 421 36AM01276-AS dTUfuGfcAfaGfgAfcAfcUfuGfa UfudTsdT 422 37AM01277-AS dTUfuGfcUfcCfgUfuGfgUfgCfu UfcdTsdT 423 38AM01278-AS dTAfaUfgAfgCfcUfcGfaUfaAfcUfcdTsdT 424 39AM01279-AS dTGfaAfuGfaGfcCfuCfgAfuAfaCfudTsdT 425 40AM01280-AS dTGfgAfuAfaUfa UfuCfuGfu UfgUfcdTsdT 426 41AM01281-AS dTCfcAfuGfgUfaUfaAfcAfcCfaAfgdTsdT 427 42AM01282-AS dTGfaUfcCfa UfgGfuAfuAfaCfaCfcdTsdT 428 43AM01283-AS dTAf u UfgGfgAf u Cf cAf u Gfg Uf a Uf a dTsdT 429 44AM01284-AS dTCfa Uf uGfgGf a UfcCfa UfgGf uAf udTsdT 430 45AM01285-AS dTAf cAfu UfgGfgAf u Cf cAf u Gfg Ufa dTsdT 431 46AM01286-AS dTGfaCfaUfuGfgGfa UfcCfa UfgGfudTsdT 432 47AM01287-AS dTGfaCfa UfuGfuGfuCfaGfgUfuGfcdTsdT 433 48AM01288-AS dTCfaCfuGfgAfcAfu UfgUfgUfcAfgdTsdT 434 49AM01289-AS dTAfcUfuGfaUfuCfuGfuCfaCfuGfgdTsdT 435 50AM01290-AS dTGfaGfaAfuGfaGfcCfuCfgAfuAfadTsdT 436 51AM01291-AS dTCfcAfuUfuGfgGfuAfgUfaUfuCfudTsdT 437 52AM01292-AS dTCfaCfcAfu UfuGfgGfuAfgUfaUfudTsdT 438 53AM01293-AS dTCfcAfcCfaUfu UfgGfgUfaGfuAfudTsdT 439 54AM01294-AS dTAfuAfaCfaCfcAfaGfgGfcGfaAfudTsdT 440 55AM01295-AS dTAfcUfgGfgAfuCfcAfuGfgUfa UfadTsdT 441 56AM01296-AS dTCfaCfuGfgGfa UfcCfaUfgGfuAfudTsdT 442 57AM01297-AS dTAfcCfaCfcGfuGfgGfaGfu UfgUfgdTsdT 443 58AM01298-AS dTCfaAfgAfcUfgAfcAfuGfuUfcUfudTsdT 444 59AM01299-AS dTGfgGfaGfu UfgUfgAfgGfaCfaCfudTsdT 445 60AM01300-AS dTUfcUfcAfgGfuGfgUfgCfuUfgUfudTsdT 446 61AM01301-AS dTCfaCfaGfgGfcUfu UfuCfuCfaGfgdTsdT 447 62AM01302-AS dTGfaUfgCfcAfgUfgUfgGfuAfuCfadTsdT 448 63AM01303-AS dTUfgAfuGfcCfaGfuGfuGfgUfaUfcdTsdT 449 64AM01304-AS dTGfaCfaCfcUfgAfuUfcUfgUfu UfcdTsdT 450 65AM01305-AS dTGfgAfcAfcCf uGfa Uf uCf uGf u Uf udTsdT 451 66AM01306-AS dTCfuAfgGfaCfaCfcUfgAfuUfcUfgdTsdT 452 67AM01796-AS dTAfuAfaGfgGfgCfuGfcCfaCfaGfgdTsdT 453 68AM01798-AS dTAfaCfaAfuAfaGfgGfgCfuGfcCfadTsdT 454 69AM01800-AS dTGfuCfcGfaCfuAfuGfcUfgGfuGfudTsdT 455 70AM01802-AS dTUfcUfcAfgCfa UfcUfgGfaUfuCfcdTsdT 456 71AM01804-AS dTCfgAfaUfcUfcAfgCfaUfcUfgGfadTsdT 457 72AM01806-AS dTAfaGfgGfcGfaAfuCfuCfaGfcAfudTsdT 458 73AM01808-AS dTUfgAfcAfcUfgGfgAfuCfcAfuGfgdTsdT 459 74AM01810-AS dTCfcGfu UfgGfuGfcUfuCfuUfcAfgdTsdT 460 75AM01812-AS dTCfuUfgAfu UfcUfgUfcAfcUfgGfadTsdT 461 76AM01814-AS dTCfaCfcGfuGfgGfaGfuUfgUfgAfgdTsdT 462 77AM01816-AS dTUfcUfaGfgAfcAfcCfuGfa UfuCfudTsdT 463 78AM01818-AS dTAfgUfcUfcUfaGfgAfcAfcCfuGfadTsdT 464 79AM02003-AS dTGfuAfuAfaCfaAfuaaGfgGfgCfudTsdT 465 5AM02004-AS dTGfuAfuAuNAaCfaAfuaaGfgGfgCfudTsdT 466 5AM02005-AS dTGfuAfuAfAuNACfaAfuaaGfgGfgCfudTsdT 467 5AM02007-AS dTCfgUfa UfaAfcAfauaAfgGfgGfcdTsdT 468 6AM02008-AS dTCfgUfa UuNAaAfcAfauaAfgGfgGfcdTsdT 469 6AM02009-AS dTCfgUfa UfAuNAAfcAfauaAfgGfgGfcdTsdT 470 6AM02011-AS dTGfcGfuCfuGfaGfcau UfgUfgUfcdTsdT 471 8AM02012-AS dTGfcGfuCuNAuGfaGfcau UfgUfgUfcdTsdT 472 8AM02013-AS dTGfcGfuCfUuNAGfaGfcau UfgUfgUfcdTsdT 473 8AM02015-AS dTUfgCfgUfcUfgAfgca UfuGfuGfudTsdT 474 9AM02016-AS dTUfgCfgUuNAcUfgAfgca UfuGfuGfudTsdT 475 9AM02017-AS dTUfgCfgUfCuNAUfgAfgca UfuGfuGfudTsdT 476 9AM02019-AS dTGfaGfaAfuGfaGfccuCfgAfuAfadTsdT 477 51AM02020-AS dTGfaGfaAuNAuGfaGfccuCfgAfuAfadTsdT 478 51AM02021-AS dTGfaGfaAfUuNAGfaGfccuCfgAfuAfadTsdT 479 51AM02023-AS dTGfaCfaCfcUfgAfuucUfgUfu UfcdTsdT 480 65AM02024-AS dTGfaCfaCuNAcUfgAfuucUfgUfu UfcdTsdT 481 65AM02025-AS dTGfaCfaCfCuNAUfgAfuucUfgUfu UfcdTsdT 482 65AM02027-AS dTGfuCfcGfaCfuAfugcUfgGfuGfudTsdT 483 70AM02028-AS dTGfuCfcGuNAaCfuAfugcUfgGfuGfudTsdT 484 70AM02029-AS dTGfuCfcGfAuNACfuAfugcUfgGfuGfudTsdT 485 70AM02031-AS dTCfgAfaUfcUfcAfgcaUfcUfgGfadTsdT 486 72AM02032-AS dTCfgAfa UuNAcUfcAfgcaUfcUfgGfadTsdT 487 72AM02033-AS dTCfgAfa UfCuNAUfcAfgca UfcUfgGfadTsdT 488 72AM02035-AS dTAfaGfgGfcGfaAfucuCfaGfcAfudTsdT 489 73AM02036-AS dTAf a G f gG u NAcGf a Af u c u Cf a Gf cAf u dTsdT 490 73AM02037-AS dTAfaGfgGfCuNAGfaAfucuCfaGfcAfudTsdT 491 73AM02039-AS dTUfgAfcAfcUfgGfgauCfcAfuGfgdTsdT 492 74AM02040-AS dTUfgAfcAuNAcUfgGfgauCfcAfuGfgdTsdT 493 74AM02041-AS dTUfgAfcAfCuNAUfgGfgauCfcAfuGfgdTsdT 494 74AM02240-AS dTCfaAfuAfaGfgGfgcuGfcCfaCfadTsdT 495 80AM02241-AS dTCfuGfcGfuCfuGfagcAfu UfgUfgdTsdT 496 81AM03280-AS usCfsgUfa UfaAfcAfauaAfggggcUfgCfscsuAu 632 156AM03281-AS usCfsguauaAfcAfauaAfgGfgGfcUfgCfscsuAu 633 156AM03282-AS usCfsgUfa UfaAfcAfauaAfgGfgGfcugcscsuAu 634 156AM03283-AS usCfsgUfa UfaacaauaAfgGfgGfcugcscsuAu 635 156AM03284-AS usCfsguauaAfcAfauaAfggggcUfgCfscsuAu 636 156AM03300-AS usCfsgUfaUfaacaa UfaAfgGfgGfcUfgCfscsuAu 637 156AM03301-AS usCfsguauaAfcAfaUfaAfggggcUfgCfscsuAu 638 156AM03331-AS usGfsaGfaAfuGfaGfcCfuCfgAfuAfasdTsdT 639 157AM03375-AS usCfsguauaAfcAfauaAfggggcugcscsuAu 640 156AM03376-AS usCfsguauaacaauaAfggggcugcscsuAu 641 156AM03377-AS usGfsagaauGfaGfccuCfgauaacucsusuAu 642 153AM03427-AS dTsGfaGfaAfuGfaGfccuCfgAfuAfaCfuCfuuAu 643 109AM03486-AS vpdTGfsaGfaAfuGfaGfccuCfgAfuAfaCfucsusuAu 644 109AM03487-AS vpdTsGfsaGfaAfuGfaGfccuCfgAfuAfaCfucsusuAu 645 109AM03488-AS dTsGfsaGfaAfuGfaGfccuCfgAfuAfaCfucsusuAu 646 109AM03490-AS vpdTCfsgUfa UfaAfcAfauaAfgGfgGfcUfgCfscsuAu 647 111AM03491-AS vpdTsCfsgUfaUfaAfcAfauaAfgGfgGfcUfgCfscsuAu 648 111AM03655-AS usGfsAfgaaugagccuCfgauaacucsusuAu 649 153AM03656-AS usGfsaGfaaugagccuCfgauaacucsusuAu 650 153AM03657-AS usGfsagAfaugagccuCfgauaacucsusuAu 651 153AM03658-AS usGfsagaAfugagccuCfgauaacucsusuAu 652 153AM03659-AS usGfsagaa UfgagccuCfgauaacucsusuAu 653 153AM03660-AS usGfsagaauGfagccuCfgauaacucsusuAu 654 153AM03661-AS usGfsagaaugaGfccuCfgauaacucsusuAu 655 153AM03671-AS usCfsgUfaUfaAfcAfauaAfgGfcGfcUfgCfscsuAu 656 158AM03672-AS usCfsgUfa UfaAfcAfauaAfggggCfugCfscsuAu 657 156AM03673-AS usCfsgUfa UfaAfcAfauaAfggggcugcscsuAu 658 156AM03674-AS usCfsGfuauaAfcAfauaAfggggcugcscsuAu 659 156AM03675-AS usCfsgUfa UfaAfcaauaAfggggcugcscsuAu 660 156AM03676-AS usCfsgUfa UfaaCfaauaAfggggcugcscsuAu 661 156AM03677-AS usCfsGfuauAfaCfaauaAfggggcugcscsuAu 662 156AM03678-AS usGfsaGfaAfuGfaGfccuCfgauaacucsusuAu 663 153AM03679-AS usGfsAfgaAfuGfaGfccuCfgauaacucsusuAu 664 153AM03680-AS usGfsAfgAfauGfaGfcCfuCfgauaacucsusuAu 665 153AM03681-AS usGfsAfgAfauGfagCfCfuCfgauaacucsusuAu 666 153AM03682-AS usGfsaGfaAfuGfagccuCfgauaacucsusuAu 667 153AM03744-AS usGfsuauaaCfaAfuaaGfgggAbAbs(PAZ) 668 135AM03745-AS usGfsuAfuAfaCfaAfuAfaGfgGMGMAbAbs(PAZ) 669 135AM03749-AS usCfsguauaAfcAfauaAfgggAbAbs(PAZ) 670 136AM03750-AS usCfsgUfa UfaAfcAfaUfaAfgGMGMAbAbs(PAZ) 671 136AM03754-AS usGfsagaauGfaGfccuCfgauAbAbs(PAZ) 672 148AM03755-AS usGfsagaaugagcCfuCfgauAbAbs(PAZ) 673 148AM03756-AS usGfsaGfaAfuGfaGfcCfuCfgAMTMAbAbs(PAZ) 674 159AM03760-AS usGfsacaccUfgAfuucL)fguuAbAbs(PAZ) 675 151AM03761-AS usGfsaCfaCfcugauucL)fguuAbAbs(PAZ) 676 151AM03762-AS usGfsaCfaCfcUfgAfuUfcUfgTMTMAbAbs(PAZ) 677 160AM03823-AS usCfANASgUfa UfaAfCfAfauaAfgGfgGfcUfgcscsuAu 678 156AM03824-AS usCfsgUfANAa UfaAfCfAfauaAfgGfgGfcUfgcscsuAu 679 156AM03825-AS usCfsgUfaUfANAaAfCfAfauaAfgGfgGfcUfgcscsuAu 680 156AM03826-AS usCfsgUfaUfaAfANACfAfauaAfgGfgGfcUfgcscsuAu 681 156AM03827-AS usGfANAsagaauGfaGfccuCfgauaacucsusuAu 682 153AM03828-AS usGfsagaauGfANAaGfccuCfgauaacucsusuAu 683 153AM03856-AS TMsGfsagaauGfaGfccuCfgauaacucsusuAu 684 109AM03857-AS TMsCfsgUfa UfaAfCfAfauaAfgGfgGfcUfgcscsuAu 685 111AM03862-AS TMsGfsagaaugagccuCfgauaacucsusuAu 686 109AM03866-AS usCfsgUfa UfaacaauaAfggggcugcscsuAu 687 156AM03867-AS usCfsgUfauaAfcaauaAfggggcugcscsuAu 688 156AM03868-AS usCfsgUfauaacAfauaAfggggcugcscsuAu 689 156AM03869-AS usCfsgUfauaacaa UfaAfggggcugcscsuAu 690 156AM03870-AS usCfsgua UfaAfcaauaAfggggcugcscsuAu 691 156AM03871-AS usCfsguaUfaacAfauaAfggggcugcscsuAu 692 156AM03872-AS usCfsgua Ufaacaa UfaAfggggcugcscsuAu 693 156AM03873-AS usCfsguauaAfcaa UfaAfggggcugcscsuAu 694 156AM03874-AS usCfsguauaacAfa UfaAfggggcugcscsuAu 695 156AM03875-AS usCfsgUfaUfaAfcAfaUfaAfgggGfcUfgCfscsuAu 696 156AM03876-AS u sCf sg Uf a U f a Af c Af a U fa Af gG f ggc U f gCf scs u Au 697 156AM03877-AS usCfsgUfaUfaAfcAfa UfaAfgGfgGfcugCfscsuAu 698 156AM03878-AS usCfsgUfa UfaAfcAfaUfaAfgGfgGfcUfgcscsuAu 699 156AM03883-AS vpusCfsgsUfa UfaAfCfAfauaAfgGfgGfcUfgasusu 700 161AM03884-AS vpusCfsgsUfa UfaAfCfAfauaAfgGfgGfcUfgcsusu 701 162AM03885-AS vpusGfsasgaauGfaGfccuCfgauaacucsusu 702 163AM03929-AS usCfsgua UfaAfcaauaAfgGfggcugcscsuAu 703 156AM03930-AS usCfsguaUfaAfCfaauaAfgGfggcugcscsuAu 704 156AM03932-AS usGfsagaAfuGfagccuCfgAfuaacucsusuAu 705 153AM03933-AS usGfsagaAfuGfAfgccuCfgAfuaacucsusuAu 706 153AM03969-AS vpusCfsgUfaUfaAfCfAfauaAfgGfgGfcUfgcscsuAu 707 156AM03971-AS vpusCfsgsUfa UfaAfCfAfauaAfgGfgGfcusu 708 164AM03972-AS usCfsgsUfa UfaAfCfAfauaAfgGfgGfcusu 709 164AM03973-AS UuNAsCfsgsUfaUfaAfCfAfauaAfgGfgGfcusu 710 164AM04132-AS usGfsaGfaAfuGfaGfccuCfgAfuAfaCfucsusuau 711 153AM04133-AS usGfsagaauGfaGfccuCfgauaacucsusuau 712 153AM04134-AS usGfsaGfaAfuGfAfGfccuCfgAfuAfaCfucsusuau 713 153AM04135-AS usGfsagaauGfAfGfccuCfgauaacucsusuau 714 153AM04136-AS usGfsaGfaAfuGfAfgccuCfgAfuAfaCfucsusuau 715 153AM04137-AS usGfsagaauGfAfgccuCfgauaacucsusuau 716 153AM04150-AS usGfsagaauGfaGfccuCfgauaacucsusuau(Dy540) 717 153AM04215-AS usCfsgUfaUfaaCfaa UfaAfgGfgGfcUfgCfscsuAu 718 156AM04216-AS usCfsguauaAfcaa UfaAfggggcugCfscsuAu 719 156AM04217-AS usCfsguauaaCfaa UfaAfggggcugCfscsuAu 720 156AM04218-AS usCfsguauaaCfaa UfaAfggggCfugCfscsuAu 721 156AM04219-AS usCfsgua UfaaCfaaUfaAfggggCfugCfscsuAu 722 156AM04250-AS usGfsu Af u AfaCfa Af u AfaGfgG MG MsAbsAbs( PAZ) 723 135AM04251-AS usGfsuAfuAfaCfaAfuAfaGfgGMGM(Spl8)s(PAZ) 724 165AM04252-AS usGfsuAfuAfaCfaAfuAfaGfgGMGM(C12)s(PAZ) 725 165AM04253-AS usCfsgUfaUfaAfcAfa UfaAfgGMGMsAbsAbs(PAZ) 726 136AM04254-AS usCfsgUfa UfaAfcAfaUfaAfgGMGM(Spl8)s(PAZ) 727 166AM04255-AS usCfsgUfa UfaAfcAfa UfaAfgGMGM(C12)s(PAZ) 728 166AM04256-AS usGfsaGfaAfuGfaGfcCfuCfgAMTMsAbsAbs(PAZ) 729 159AM04257-AS usGfsaGfaAfuGfaGfcCfuCfgAMTM(Spl8)s(PAZ) 730 167AM04258-AS usGfsaGfaAfuGfaGfcCfuCfgAMTM(C12)s(PAZ) 731 167AM04259-AS usGfsaCfaCfcUfgAfu UfcUfgTMTMsAbsAbs(PAZ) 732 160AM04260-AS usGfsaCfaCfcUfgAfuUfcUfgTMTM(Spl8)s(PAZ) 733 168AM04261-AS usGfsaCfaCfcUfgAfuUfcUfgTMTM(C12)s(PAZ) 734 168AM04377-AS dTusCfsgUfa Ufaacaa UfaAfgGfgGfcUfgCfscsua 735 169AM04378-AS uAusCfsgUfa UfaacaaUfaAfgGfgGfcUfgCfscsu 736 170AM04379-AS dTcsCfsgUfaUfaacaa UfaAfgGfgGfcUfgCfscsua 737 171AM04380-AS cUcsCfsgUfa UfaacaaUfaAfgGfgGfcUfgCfscsu 738 172AM04383-AS dTusGfsaGfaAfuGfaGfccuCfgAfuAfaCfucsusua 739 173AM04384-AS uAusGfsaGfaAfuGfaGfccuCfgAfuAfaCfucsusu 740 174AM04385-AS dTgsGfsaGfaAfuGfaGfccuCfgAfuAfaCfucsusua 741 175AM04386-AS gUgsGfsaGfaAfuGfaGfccuCfgAfuAfaCfucsusu 742 176AM04387-AS dTusGfsagaauGfaGfccuCfgauaacucsusua 743 173AM04388-AS uAusGfsagaauGfaGfccuCfgauaacucsusu 744 174AM04389-AS dTgsGfsagaauGfaGfccuCfgauaacucsusua 745 175AM04390-AS gUgsGfsagaauGfaGfccuCfgauaacucsusu 746 176AM04413-AS usCfsgsUfa Ufaacaa UfaAfgGfgGfcusu 747 164AM04415-AS usGfsasGfaAfuGfaGfccuCfgAfuAfausu 748 177AM04437-AS usGfsuAfuAfaCfaAfuAfaGfgG MG Ms(C12)s(PAZ) 749 165AM04438-AS usCfsgUfa UfaAfcAfa UfaAfgGMGMs(C12)s(PAZ) 750 166AM04439-AS usGfsaGfaAfuGfaGfcCfuCfgAMTMs(C12)s(PAZ) 751 167AM04440-AS usGfsaCfaCfcUfgAfuUfcUfgTMTMs(C12)s(PAZ) 752 168AM04501-AS cPrpTMsCfsgsUfa UfaAfCfAfauaAfgGfgGfcusu 753 178AM04507-AS usGfsasGfaAfuGfaGfccuCfgAfuAfausuAUAUA 754 179AM04539-AS usCfsgUfaUfaacaa UfaAfgGfgGfcUfgsCfscuAu 755 156AM04540-AS usCfsgUfaUfaacaa UfaAfgGfgGfcUfgsCfcuAu 756 156AM04541-AS usGfsaGfaAfuGfaGfccuCfgAfuAfaCfuscsuuAu 757 153AM04542-AS usGfsaGfaAfuGfaGfccuCfgAfuAfaCfuscuuAu 758 153AM04544-AS usCfsgsUfa UfaAfCfAfauaAfgGfgGfcUfgcsusu 759 162AM04545-AS usCfsgsUfaUfaAfCfAfauaagGfgGfcusu 760 164AM04546-AS usCfsgsUfaUfaAfCfAfa UfaagGfgGfcusu 761 164AM04582-AS usCfsgUfaUfaacaa UfaAfgGfgGfcUfgsCfsc 762 180AM04583-AS dTusCfsgUfaUfaacaa UfaAfgGfgGfcUfgsCfsc 763 181AM04584-AS dTusCfsgUfa Ufaacaa UfaAfgGfgGfcUfgscsc 764 181AM04585-AS dTusCfsgsUfa Ufaacaa UfaAfgGfgGfcUfgscsc 765 181AM04586-AS dTusCfsgsUfa UfaacaaUfaAfgGfgGfcUfgcsc 766 181AM04587-AS dTusCfsgsUfa UfaacaaUfaAfgGfgGfcusg 767 182AM04609-AS epTcPrsCfsgsUfa UfaAfCfAfauaAfgGfgGfcusu 768 178AM04610-AS e pTM sCf sgs U f a U f a Af Cf Af a u a Af gG f gG f cu su 769 178AM04677-AS usGfsaGfaAfuGfaGfccuCfgAfuAfaCfsuscuuAu 770 153AM04678-AS usGfsaGfaAfuGfaGfccuCfgAfuAfasCfsucuuAu 771 153AM04679-AS usGfsaGfaAfuGfaGfccuCfgAfuAfaCfuasuscGc 772 183AM04680-AS usGfsaGfaAfuGfaGfccuCfgAfuAfaCfuasusuCa 773 184AM04681-AS usGfsaGfaAfuGfaGfccuCfgAfuAfaCfuascsgAu 774 185AM04733-AS us(5Me-Gf)saGfaAfuGfaGfccuCfgAfuAfaCfucsusuAu 775 153AM04734-AS usGfsa(5Me-Gf)aAfuGfaGfccuCfgAfuAfaCfucsusuAu 776 153AM04735-AS usGfsaGfaAfu(5Me-Gf)aGfccuCfgAfuAfaCfucsusuAu 777 153AM04736-AS usGfsaGfaAfuGfa(5Me-Gf)ccuCfgAfuAfaCfucsusuAu 778 153AM04805-AS vpusCfsgsUfa UfaAfCfAfauaAfgGfgGfcgsu 779 186AM04821-AS usCfsgUfaUfaacaa UfaAfgGfgGfcUfgCfscsu 780 187AM04822-AS usCfsgUfaUfaacaa UfaAfgGfgGfcUfgCfsusu 781 162AM04823-AS vpusCfsgUfa Ufaacaa Ufa AfgGfgGfcUfgCfscsu 782 187AM04824-AS vpusCfsgUfa Ufaacaa UfaAfgGfgGfcUfgCfsusu 783 162AM04871-AS usGfsaGfaAfuGfAfgccuCfgAfuAfaCfusCfsuuAu 784 153AM04872-AS cPrpusGfsaGfaAfuGfaGfccuCfgAfuAfaCfucsusuAu 785 153AM04873-AS cPrpusCfsgUfa Ufaacaa Ufa AfgGfgGfcUfgCfscsu Au 786 156AM04874-AS usCfsgUf a Ufaacaa UfaAfgGfgGfcsusu 787 164AM04875-AS cPrpusCfsgUfa Ufaacaa Ufa AfgGfgGfcsusu 788 164AM04876-AS usCfsgUf a Ufaacaa UfaAfgGfgGfcsusg 789 188AM04877-AS usCfsgUf a Ufaacaa UfaAfgGfgGfcsUfsg 790 188AM04878-AS cPrpusCfsgUfa Ufaacaa Ufa AfgGfgGfcUfgCfsusu 791 162AM04879-AS usGfsaGfaAfuGfaGfcCfuCfgAfuAfaCfucsusuAu 792 153AM04880-AS cPrpusGfsaGfaAfuGfaGfcCfuCfgAfuAfaCfucsusuAu 793 153AM04969-AS cPrpTMsGfsaGfaAfuGfaGfcCfuCfgAfuAfaCfucsusuAu 794 109AM04970-AS cPrpTMsCfsgUfa UfaacaaUfaAfgGfgGfcUfgCfscsuAu 795 111AM04971-AS cPrpTMsCfsgUfa Ufaacaa UfaAfgGfgGfcsusu 796 178AM04972-AS cPrpTMsCfsgUfa UfaacaaUfaAfgGfgGfcUfgCfsusu 797 189AM04979-AS usCfsgsUfa UfaAfcAfa UfaAfgGfgGfcusu 798 1641532-AS01 usgsagaaugaGfccuCfgAfuAfaCfuCfsusuAu 799 1531532-AS02 usgsagaauGfagccuCfgAfuAfaCfuCfsusuAu 800 1531532-AS03 usgsagaAfugagccuCfgAfuAfaCfuCfsusuAu 801 1531532-AS04 usgsaGfaaugagccuCfgAfuAfaCfuCfsusuAu 802 1531532-AS05 usGfsagaaugagccuCfgAfuAfaCfuCfsusuAu 803 1531532-AS06 dTsgsagaaugagccuCfgAfuAfaCfuCfsusuAu 804 1091532-AS07 dTsGfsaGfaAfugagccuCfgAfuAfaCfuCfsusuAu 805 1091532-AS08 dTsGfsaGfaAfugaGfccuCfgauAfaCfuCfsusuAu 806 1091532-AS09 dTsGfsaGfaAfuGfagccuCfgauAfaCfuCfsusuAu 807 1091532-AS10 dTsGfsaGfaAfugagccuCfgauAfaCfuCfsusuAu 808 1091532-AS11 dTsGfsaGfaAfugagccuCfgAfuaaCfuCfsusuAu 809 1091532-AS12 dTsGfsaGfaAfugaGfccuCfgauaaCfuCfsusuAu 810 1091532-AS13 dTsGfsaGfaAfuGfagccuCfgauaaCfuCfsusuAu 811 1091532-AS15 dTsgsagaaugaGfccuCfgAfuAfaCfuCfsusuAu 812 1091532-AS16 dTsgsagaauGfagccuCfgAfuAfaCfuCfsusuAu 813 1091532-AS17 dTsgsagaAfugagccuCfgAfuAfaCfuCfsusuAu 814 1091532-AS18 dTsgsaGfaaugagccuCfgAfuAfaCfuCfsusuAu 815 1091532-AS19 dTsGfsagaaugagccuCfgAfuAfaCfuCfsusuAu 816 1091532-AS20 usgsagaaugagccuCfgAfuAfaCfuCfsusuAu 817 1531532-AS21 usGfsaGfaAfugagccuCfgAfuAfaCfuCfsusuAu 818 1531532-AS22 usGfsaGfaAfugaGfccuCfgauAfaCfuCfsusuAu 819 1531532-AS23 usGfsaGfaAfuGfagccuCfgauAfaCfuCfsusuAu 820 1531532-AS24 usGfsaGfaAfugagccuCfgauAfaCfuCfsusuAu 821 1531532-AS25 usGfsaGfaAfugagccuCfgAfuaaCfuCfsusuAu 822 1531532-AS27 usGfsaGfaAfuGfagccuCfgauaaCfuCfsusuAu 823 1531533-AS01 usgsaCfaCfcugAfuucUfgUfu UfcUfgAfsgsuAu 824 1541533-AS02 usgsaCfaCfcUfgauucUfgUfuUfcUfgAfsgsuAu 825 1541533-AS04 dTsgsaCfaCfcugauucUfgUfuUfcUfgAfsgsuAu 826 1101533-AS05 dTsGfsaCfaCfcugAfuucUfguuUfcUfgAfsgsuAu 827 1101533-AS06 dTsGfsaCfaCfcUfgauucUfguuUfcUfgAfsgsuAu 828 1101533-AS07 dTsGfsaCfaCfcUfgauucUfgUfuucUfgAfsgsuAu 829 1101533-AS08 dTsGfsaCfaCfcUfgAfuucUfguuucUfgAfsgsuAu 830 1101533-AS09 dTsGfsaCfaCfcUfgAfuucUfguu UfcugAfsgsuAu 831 1101533-AS10 dTsGfsaCfaCfcUfgAfuucUfgUfuucugAfsgsuAu 832 1101533-AS11 dTsGfsaCfaCfcUfgAfuucUfguuucugAfsgsuAu 833 1101533-AS12 dTsGfsaCfaCfcUfgAfuucUfguuucUfgasgsuAu 834 1101533-AS13 dTsGfsaCfaCfcUfgAfuucUfguu UfcugasgsuAu 835 1101533-AS16 dTsgsaCfaCfcugAfuucUfgUfu UfcUfgAfsgsuAu 836 1101533-AS17 dTsgsaCfaCfcUfgauucUfgUfuUfcUfgAfsgsuAu 837 1101533-AS19 usgsaCfaCfcugauucUfgUfu UfcUfgAfsgsuAu 838 1541533-AS20 usGfsaCfaCfcugAfuucUfguu UfcUfgAfsgsuAu 839 1541533-AS21 usGfsaCfaCfcUfgauucUfguuUfcUfgAfsgsuAu 840 1541533-AS22 usGfsaCfaCfcUfgauucUfgUfuucUfgAfsgsuAu 841 1541533-AS23 usGfsaCfaCfcUfgAfuucUfguuucUfgAfsgsuAu 842 1541533-AS24 usGfsaCfaCfcUfgAfuucUfguu UfcugAfsgsuAu 843 1541533-AS25 usGfsaCfaCfcUfgAfuucUfgUfuucugAfsgsuAu 844 1541533-AS26 usGfsaCfaCfcUfgAfuucUfguuucugAfsgsuAu 845 1541533-AS27 usGfsaCfaCfcUfgAfuucUfguuucUfgasgsuAu 846 1541533-AS28 usGfsaCfaCfcUfgAfuucUfguu UfcugasgsuAu 847 1541533-CfinAS dTsGfsacaccUfgAfuucUfgUfu UfcUfgAfsgsuAu 848 110AM05490-AS usGfsasGfaAfuGfaGfcCfuCfgAfuAfausu 1262 177AM05492-AS cPrpTMsCfsgsUfa UfaAfCfAfaUfaAfgGfgGfcusu 1263 178AM05493-AS cPrpTMsCfsgsUfa UfaAfcAfa UfaAfgGfgGfcusu 1264 178AM05495-AS usCfsguauaaCfaa UfaAfgggGfcugCfscsuAu 1265 156AM05496-AS usCfsgua UfaaCfaaUfaAfgggGfcugCfscsuAu 1266 156AM05497-AS usCfsgUfaUfaacaa UfaAfgGfgGfcsUfsu 1267 164AM05498-AS usCfsgsUfa UfaAfCfAfa UfaAfgGfgGfcusu 1268 164Table 2B. LPA RNAi agent sense strands having modified nucleotides.Sense SEQ SEQSS Sequence 5'→ 3'Strand ID ID NO. ID NO.AM01173-SS Af cGf cAfgAf a GfgGf a Cf uGf cCfgAf ( i n vdT) 849 190AM01174-SS GfgGfgUfgCfaGfgAfgUfgCfuAfcAf(invdT) 850 191AM01175-SS CfuGfuGfgCfaGfcCfcCfu Ufa UfuAf(invdT) 851 192AM01176-SS GfgCfaGfcCfcCfu UfaUfuGfu UfaAf(invdT) 852 193AM01177-SS AfgCfcCfcUfuAfu UfgUfuAfuAfcAf(invdT) 853 194AM01178-SS GfcCfcCfuUfaUfuGfu Ufa UfaCfgAf(invdT) 854 195 AM01179-SS UfgAfcAfcAfa UfgCfuCfaGfaCfgAf(invdT) 855 196AM01180-SS Gf a Cf a Cf a Af uGf c Uf cAfgAf cGf cAf ( i n vdT) 856 197AM01181-SS Af cAf cAf a U f gCf u Cf a Gf a Cf gCf a Af ( i n vdT) 857 198AM01182-SS AfcAfa UfgCfuCfaGfaCfgCfaGfaAf(invdT) 858 199AM01183-SS Cf u Gf cCfgAf a Af u Cf cAfgAf u Cf cAf ( i n vdT) 859 200AM01184-SS Gf cCfgAf a Af u Cf cAfgAf u Cf c UfgAf ( i n vdT) 860 201AM01185-SS UfgAfcAfcGfaUfgCfuCfaGfaUfgAf(invdT) 861 202AM01186-SS Gf a Cf a Cf gAf u Gf c U f cAf g Af u G f cAf ( i n vdT) 862 203AM01187-SS AfcAfcGfaUfgCfuCfaGfa UfgCfaAf(invdT) 863 204AM01188-SS AfcGfaUfgCfuCfaGfa UfgCfaGfaAf(invdT) 864 205AM01189-SS UfcCfaAfgCfcUfaGfaGfgCfu UfuAf(invdT) 865 206AM01190-SS AfgGfaAfaCfcCfcCfgGfgGfuAfcAf(invdT) 866 207AM01191-SS GfgAfaAfcCfcCfcGfgGfgUfaCfaAf(invdT) 867 208AM01192-SS GfaAfaCfcCfcCfgGfgGfuAfcAfgAf(invdT) 868 209AM01193-SS UfgCfuAfcUfaCfcAfuUfa UfgGfaAf(invdT) 869 210AM01194-SS GfcUfaCfuAfcCfaUfuAfuGfgAfcAf(invdT) 870 211AM01195-SS CfuAfcCfa UfuAfuGfgAfcAfgAfgAf(invdT) 871 212AM01196-SS Af cCf a Cf a Cf c Af gCf a U f a Gf u Cf gAf ( i n vdT) 872 213AM01197-SS CfcAfcAfcCfaGfcAfuAfgUfcGfgAf(invdT) 873 214AM01198-SS Cf aCf a Cf cAfgCf a Uf aGf u CfgGf a Af ( i n vdT) 874 215AM01199-SS CfaCfcAfgCfa UfaGfuCfgGfaCfcAf(invdT) 875 216AM01200-SS AfuAfgUfcGfgAfcCfcCfaGfaAfaAf(invdT) 876 217AM01201-SS Uf a Gf u CfgGf a Cf cCf cAfgAf a Af a Af ( i n vdT) 877 218AM01202-SS CfcAfgAfuGfcUfgAfgAfu UfcGfcAf(invdT) 878 219AM01203-SS GfcUfgAfgAfu UfcGfcCfcUfuGfgAf(invdT) 879 220AM01204-SS CfuGfaGfa UfuCfgCfcCfuUfgGfuAf(invdT) 880 221AM01205-SS UfgAfgAf u Uf cGfcCfc Ufu Gfg UfgAf ( i n vdT) 881 222AM01206-SS GfaGfa UfuCfgCfcCfu UfgGfuGfuAf(invdT) 882 223AM01207-SS AfuGfgAfuCfcCfaGfuGfuCfaGfgAf(invdT) 883 224AM01208-SS GfaAfuCfaAfgUfgUfcCfu UfgCfaAf(invdT) 884 225AM01209-SS AfaUfcAfaGfuGfuCfcUfuGfcAfaAf(invdT) 885 226AM01210-SS GfaAfgCfaCfcAfaCfgGfaGfcAfaAf(invdT) 886 227AM01211-SS GfaGfu UfaUfcGfaGfgCfuCfaUfuAf(invdT) 887 228AM01212-SS AfgUfuAfuCfgAfgGfcUfcAfu UfcAf(invdT) 888 229AM01213-SS GfaCfaAfcAfgAfaUfaUfuAfuCfcAf(invdT) 889 230AM01214-SS Cf u UfgGf u Gf u Uf a Uf aCf cAf u GfgAf ( i n vdT) 890 231AM01215-SS GfgUfgUfuAfuAfcCfa UfgGfa UfcAf(invdT) 891 232AM01216-SS Ufa UfaCfcAfu GfgAf u Cf cCf a Af u Af ( i n vdT) 892 233AM01217-SS AfuAfcCfa UfgGf a UfcCfcAfa UfgAf (invdT) 893 234AM01218-SS UfaCfcAfuGfgAfuCfcCfaAfuGfuAf(invdT) 894 235AM01219-SS AfcCfa UfgGf a UfcCfcAfa UfgUfcAf (invdT) 895 236AM01220-SS GfcAfaCfcUfgAfcAfcAfa UfgUfcAf(invdT) 896 237AM01221-SS CfuGfaCfaCfaAfuGfuCfcAfgUfgAf(invdT) 897 238AM01222-SS CfcAfgUfgAfcAfgAfa UfcAfaGfuAf(invdT) 898 239AM01223-SS UfuAfuCfgAfgGfcUfcAfu UfcUfcAf(invdT) 899 240AM01224-SS AfgAfa UfaCfuAfcCfcAfaAfuGfgAf(invdT) 900 241AM01225-SS AfaUfaCfuAfcCfcAfaAfuGfgUfgAf(invdT) 901 242AM01226-SS Af u Af c Uf a Cf cCf a Af a UfgGf u GfgAf ( i n vdT) 902 243AM01227-SS AfuUfcGfcCfcUfuGfgUfgUfuAfuAf(invdT) 903 244AM01228-SS Uf a U f a Cf c Af u GfgAf u Cf cCf a Gf u Af ( i n vdT) 904 245AM01229-SS Af uAfcCfa UfgGfa UfcCf cAfgUfgAf ( in vdT) 905 246AM01230-SS CfaCfaAfcUfcCfcAfcGfgUfgGfuAf(invdT) 906 247AM01231-SS Af aGf a Af cAf u Gf u Cf a Gf u Cf u UfgAf ( i n vdT) 907 248AM01232-SS AfgUfgUfcCfuCfaCfaAfcUfcCfcAf(invdT) 908 249AM01233-SS AfaCfaAfgCfaCfcAfcCfuGfaGfaAf(invdT) 909 250AM01234-SS CfcUfgAfgAfaAfaGfcCfcUfgUfgAf(invdT) 910 251AM01235-SS UfgAf u Af cCf a Cf a Cf uGf gCf a Uf cAf ( i n vdT) 911 252AM01236-SS GfaUfaCfcAfcAfcUfgGfcAfuCfaAf(invdT) 912 253AM01237-SS GfaAfaCfaGfaAfuCfaGfgUfgUfcAf(invdT) 913 254AM01238-SS AfaAfcAfgAfa UfcAfgGfuGfuCfcAf(invdT) 914 255AM01239-SS CfaGfaAfuCfaGfgUfgUfcCfuAfgAf(invdT) 915 256AM01795-SS CfcUfgUfgGfcAfgCfcCfcUfuAfuAf(invdT) 916 257AM01797-SS UfgGfcAfgCfcCfcUfuAfu UfgUfuAf(invdT) 917 258AM01799-SS AfcAfcCfaGfcAfuAfgUfcGfgAfcAf(invdT) 918 259AM01801-SS GfgAfaUfcCfaGfaUfgCfuGfaGfaAf(invdT) 919 260AM01803-SS UfcCfaGfa UfgCfuGfaGfaUfuCfgAf(invdT) 920 261AM01805-SS AfuGfcUfgAfgAfu UfcGfcCfcUfuAf(invdT) 921 262AM01807-SS CfcAfuGfgAfuCfcCfaGfuGfuCfaAf(invdT) 922 263AM01809-SS CfuGfaAfgAfaGfcAfcCfaAfcGfgAf(invdT) 923 264AM01811-SS UfcCfaGfuGfaCfaGfaAfuCfaAfgAf(invdT) 924 265AM01813-SS CfuCfaCfaAfcUfcCfcAfcGfgUfgAf(invdT) 925 266AM01815-SS AfgAfa UfcAfgGfuGfuCfcUfaGfaAf(invdT) 926 267AM01817-SS UfcAfgGfuGfuCfcUfaGfaGfaCfuAf(invdT) 927 268AM02006-SS (Chol-TEG)uAuAfgCfcCfcUfUfAfuUfgUfuAfuAfcAf(invdT) 928 269AM02010-SS (Chol-TEG)uAuGfcCfcCfu UfAfUfuGfu Ufa UfaCfgAf(invdT) 929 270AM02014-SS (Chol-TEG)uAuGfaCfaCfaAfUfGfcUfcAfgAfcGfcAf(invdT) 930 271AM02018-SS (Chol-TEG)uAuAfcAfcAfaUfGfCfuCfaGfaCfgCfaAf(invdT) 931 272AM02022-SS (Chol-TEG)uAu UfuAfuCfgAfGfGfcUfcAfuUfcUfcAf(invdT) 932 273AM02026-SS (Chol-TEG)uAuGfaAfaCfaGfAfAfuCfaGfgUfgUfcAf(invdT) 933 274AM02030-SS (Chol-TEG)uAuAfcAfcCfaGfCfAfuAfgUfcGfgAfcAf(invdT) 934 275AM02034-SS (Chol-TEG)uAuUfcCfaGfaUfGfCfuGfaGfaUfuCfgAf(invdT) 935 276AM02038-SS (Chol-TEG)uAuAfuGfcUfgAfgAfu UfcGfcCfcUfuAf(invdT) 936 277AM02042-SS (Chol-TEG)uAuCfcAfuGfgAfUfCfcCfaGfuGfuCfaAf(invdT) 937 278AM02211-SS UfgUfgGfcAfGfCfcCfcUfuAfu UfgAf(invdT) 938 279AM02212-SS CfaCfaAfuGfCfUfcAfgAfcGfcAfgAf(invdT) 939 280AM02213-SS CfcGfaAfa UfCfCfaGfa UfcCfuGfuAf(invdT) 940 281AM02214-SS GfaCfuGfaGfGfAfaAfcCfcCfcGfgAf(invdT) 941 282AM02215-SS CfuAfcUfaCfCfAfuUfa UfgGfaCfaAf(invdT) 942 283AM02216-SS AfcUfaCfcAfUfUfaUfgGfaCfaGfaAf(invdT) 943 284AM02217-SS UfaCfcAfu UfAfUfgGfaCfaGfaGfuAf(invdT) 944 285AM02218-SS AfcCfaUfuAfUfGfgAfcAfgAfgUfuAf(invdT) 945 286AM02219-SS AfgAfuGfcUfGfAfgAfu UfcGfcCfcAf(invdT) 946 287AM02220-SS Gfa UfgCfuGfAfGfaUfuCfgCfcCfuAf(invdT) 947 288AM02221-SS AfgAfu UfcGfCfCfcUfuGfgUfgUfuAf(invdT) 948 289AM02222-SS GfaCfaGfaAfUfCfaAfgUfgUfcCfuAf(invdT) 949 290AM02223-SS AfcAfuGfuCfAfGfuCfuUfgGfuCfcAf(invdT) 950 291AM02224-SS CfcAfaAfuGfGfUfgGfcCfuGfaCfcAf(invdT) 951 292AM02225-SS Uf gGf u Gf u Uf Af Uf a Cf cAf u Gf gAf u Af ( i n vdT) 952 293AM02226-SS UfgUfuAfuAfCfCfaUfgGfaUfcCfcAf(invdT) 953 294AM02227-SS AfaCfcUfgAfCfAfcAfaUfgUfcCfaAf(invdT) 954 295AM02228-SS AfaUfgUfcCfAfGfuGfaCfaGfaAfuAf(invdT) 955 296AM02229-SS UfgUfuUfcUfGfAfaCfaAfgCfaCfcAf(invdT) 956 297AM02230-SS UfaUfcGfaGfGfCfuCfaUfuCfuCfcAf(invdT) 957 298AM02231-SS Uf cGf aGfgCf Uf Cf a Uf u Cf u Cf cAf cAf ( i n vdT) 958 299AM02232-SS UfcCfuCfaCfAfAfcUfcCfcAfcGfgAf(invdT) 959 300AM02233-SS CfaAfcUfcCfCfAfcGfgUfgGfuCfcAf(invdT) 960 301AM02234-SS GfcUfcCfu UfCfUfgAfaCfaAfgCfaAf(invdT) 961 302AM02235-SS AfuAfcCfaCfAfCfuGfgCfaUfcAfgAf(invdT) 962 303AM02236-SS AfcAfgAfaUfCfAfgGfuGfuCfcUfaAf(invdT) 963 304AM02237-SS GfaAfuCfaGfGfUfgUfcCfuAfgAfgAf(invdT) 964 305AM02238-SS AfaUfcAfgGfUfGfuCfcUfaGfaGfaAf(invdT) 965 306AM02239-SS AfuCfaGfgUfGfUfcCfuAfgAfgAfcAf(invdT) 966 307AM02441-SS uAuAusAfsgUfuAfuCfgAfgGfcUfcAfu UfcUfcAf(C6-SS-Alk-Me) 967 308AM02442-SS uAuAusAfsgUfuAfuCfgaGfGfcUfcAfu UfcUfcAf(C6-SS-Alk-Me) 968 308AM02443-SS uAuAusAfsgUfuAfuCfGfaGfGfcUfcAfu UfcUfcAf(C6-SS-Alk-Me) 969 308AM02444-SS uAuAusasGfu UfaUfcGfaGfGfcUfcAfuUfcUfcAf(C6-SS-Alk-Me) 970 308AM02445-SS uAuAusCfsaGfaAfaCfaGfaAfuCfaGfgUfgUfcAf(C6-SS-Alk-Me) 971 309AM02446-SS uAuAusCfsaGfaAfaCfagAfAfuCfaGfgUfgUfcAf(C6-SS-Alk-Me) 972 309AM02447-SS uAuAusCfsaGfaAfaCfAfgAfAfuCfaGfgUfgUfcAf(C6-SS-Alk-Me) 973 309AM02448-SS uAuAuscsAfgAfaAfcAfgAfAfuCfaGfgUfgUfcAf(C6-SS-Alk-Me) 974 309AM02537-SS uAuAusCfsaGfcCfcCfu UfAfUfuGfuUfa UfaCfgAf(Cll-PEG3-NAG3) 975 310AM02538-SS uAuAusCfsuGfaCfaCfaAfUfGfcUfcAfgAfcGfcAf(Cll-PEG3-NAG3) 976 311AM02539-SS uAuAusUfsgAfcAfcAfa UfGfCfuCfaGfaCfgCfaAf(Cll-PEG3-NAG3) 977 312AM02540-SS uAuAusAfsgUfuAfuCfgAfGfGfcUfcAfu UfcUfcAf(Cll-PEG3-NAG3) 978 308AM02541-SS uAuAusCfsaGfaAfaCfaGfAfAfuCfaGfgUfgUfcAf(Cll-PEG3-NAG3) 979 309AM02542-SS uAuAusAfsgAfuGfcUfgAfGfAfuUfcGfcCfcUfuAf(Cll-PEG3-NAG3) 980 313AM02793-SS gsCfsaGfcCfcCfu Ufa UfuGfuUfa(invdA) 981 314AM02794-SS gsCfscCfcUfuAfu UfgUfuAfuAfc(invdA) 982 315AM02795-SS csCfscCfu UfaUfuGfuUfa UfaCfg(invdA) 983 316AM02796-SS asCfsaCfaAfuGfcUfcAfgAfcGfc(invdA) 984 317AM02797-SS cs Af sc Af a U f gCf u Cf a Gf a Cf gCf a (invdA) 985 318AM02798-SS csCfsgAfaAfuCfcAfgAfuCfcUfg(invdA) 986 319AM02799-SS csAfscGfa UfgCfuCfaGfa UfgCfa(invdA) 987 320AM02800-SS csCfsaCfaCfcAfgCfa UfaGfuCfg(invdA) 988 321AM02801-SS usAfsgUfcGfgAfcCfcCfaGfaAfa(invdA) 989 322AM02802-SS csAfsgAfuGfcUfgAfgAfuUfcGfc(invdA) 990 323AM02803-SS asAfsuCfaAfgUfgUfcCfuUfgCfa(invdA) 991 324AM02804-SS asGfsu UfaUfcGfaGfgCfuCfaUfu(invdA) 992 325AM02805-SS gsUfsuAfuCfgAfgGfcUfcAfuUfc(invdA) 993 326AM02806-SS csAfsaCfcUfgAfcAfcAfaUfgUfc(invdA) 994 327AM02807-SS usAfsuCfgAfgGfcUfcAfu UfcUfc(invdA) 995 328AM02808-SS gsAfsaUfaCfuAfcCfcAfaAfuGfg(invdA) 996 329AM02809-SS asUfsaCfuAfcCfcAfaAfuGfgUfg(invdA) 997 330AM02810-SS asAfsaCfaGfaAfuCfaGfgUfgUfc(invdA) 998 331AM02811-SS asAfscAfgAfaUfcAfgGfuGfuCfc(invdA) 999 332AM02812-SS CfsasGfcCfcCfu UfaUfuGfu Ufa(invdA) 1000 333AM02813-SS CfscsCfcUfuAfuUfgUfuAfuAfc(invdA) 1001 334AM02814-SS CfscsCfu UfaUfuGfu Ufa UfaCfg(invdA) 1002 335AM02815-SS CfsasCfaAfuGfcUfcAfgAfcGfc(invdA) 1003 336AM02816-SS Af scsAf a UfgCf u Cf a Gf a CfgCf a (invdA) 1004 337AM02817-SS CfsgsAfaAfuCfcAfgAfuCfcUfg(invdA) 1005 338AM02818-SS AfscsGfaUfgCfuCfaGfaUfgCfa(invdA) 1006 339AM02819-SS CfsasCfaCfcAfgCfaUfaGfuCfg(invdA) 1007 340AM02820-SS AfsgsUfcGfgAfcCfcCfaGfaAfa(invdA) 1008 341AM02821-SS AfsgsAfuGfcUfgAfgAfu UfcGfc(invdA) 1009 342AM02822-SS AfsusCfaAfgUfgUfcCfu UfgCfa(invdA) 1010 343AM02823-SS GfsusUfa UfcGfaGfgCfuCfa Ufu(invdA) 1011 344AM02824-SS UfsusAfuCfgAfgGfcUfcAfu Ufc(invdA) 1012 345AM02825-SS AfsasCfcUfgAfcAfcAfa UfgUfc(invdA) 1013 346AM02826-SS AfsusCfgAfgGfcUfcAfu UfcUfc(invdA) 1014 347AM02827-SS AfsasUfaCfuAfcCfcAfaAfuGfg(invdA) 1015 348AM02828-SS UfsasCfuAfcCfcAfaAfuGfgUfg(invdA) 1016 349AM02829-SS AfsasCfaGfaAfuCfaGfgUfgUfc(invdA) 1017 350AM02830-SS Af scsAfgAf a Uf cAfgGf u Gf u Cf c( i n vd A) 1018 351AM02861-SS uAuAusAfsgUfuauCfgAfGfGfcUfcAfuUfcUfcAf(Cll-PEG3-NAG3) 1019 308AM02941-SS uAuAusasguuaucgAfgGfcucauucuca(Cll-PEG3-NAG3) 1020 308AM02942-SS uAuAusasguuaucgaGfGfcucauucuca(Cll-PEG3-NAG3) 1021 308AM02946-SS uAuAuscsagaaaCfagAfAfuCfagguguca(Cll-PEG3-NAG3) 1022 309AM02947-SS uAuAuscsagaaaCfaGfaAfuCfagguguca(Cll-PEG3-NAG3) 1023 309AM02948-SS uAuAuscsagaaacaGfaAfucagguguca(Cll-PEG3-NAG3) 1024 309AM02949-SS uAuAuscsagaaacagAfAfucagguguca(Cll-PEG3-NAG3) 1025 309AM03030-SS (Stearyl)uAuAusCfsaGfaAfaCfaGfAfAfuCfaGfgUfgUfcAf(Cll-PEG3-NAG3) 1026 309AM03036-SS uAuAusCfsagaAfaCfaGfAfAfuCfaGfgUfgUfcAf(Cll-PEG3-NAG3) 1027 309AM03037-SS uAuAusCfsagaaaCfaGfAfAfuCfaGfgUfgUfcAf(Cll-PEG3-NAG3) 1028 309AM03038-SS uAuAusCfsagaaaCfagaAfuCfaggUfgUfcAf(Cll-PEG3-NAG3) 1029 309AM03039-SS uAuAusCfsaGfaAfaCfaGfAfAfuCfagGfuGfucAf(Cll-PEG3-NAG3) 1030 309AM03042-SS uAuAusCfsaGfaAfaCfaGfAfAfucagguguca(Cll-PEG3-NAG3) 1031 309AM03060-SS uAuAusCfsaGfaAfaCfaGfAfAfuCfaggugUfca(Cll-PEG3-NAG3) 1032 309AM03061-SS uAuAusCfsaGfaAfaCfaGfAfAfuCfagguguca(Cll-PEG3-NAG3) 1033 309AM03062-SS uAuAusCfsagaaaCfaGfAfAfuCfaggugUfca(Cll-PEG3-NAG3) 1034 309AM03064-SS uAuAusCfsaGfaAfaCfaGfaAfuCfaGfgugucAf(Cll-PEG3-NAG3) 1035 309AM03122-SS uAuAusAfsgUfuAfuCfgAfGfGfcUfcAfuUfcUfCMAM(Cll-PEG3-NAG3) 1036 308AM03123-SS uAuAUuNAAfsgsUfuAfuCfgAfGfGfcUfcAfuUfcUfcAf(Cll-PEG3-NAG3) 1037 308AM03124-SS uAuAuAfsgsUfuAfuCfgAfGfGfcUfcAfuUfcUfcAf(Cll-PEG3-NAG3) 1038 308AM03125-SS uAuAusCfsaGfcCfcCfu UfAfUfuGfu Ufa UfaCfga(Cll-PEG3-NAG3) 1039 310AM03426-SS (Chol-TEG)uAuAusAfgUfuAfuCfgAfGfGfcUfcAfuUfcUfc(invdA) 1084 308AM03457-SS CfscsCfcUfuAfuUfgUfuAfuAfca(NAG13) 1085 334AM03458-SS CfscsCfu UfaUfuGfuUfaUfaCfga(NAG13) 1086 335AM03459-SS AfsgsAfuGfcUfgAfgAfu UfcGfca(NAG13) 1087 342AM03460-SS GfsusUfa UfcGfaGfgCfuCfa Ufua(NAG13) 1088 344AM03461-SS AfsusCfgAfgGfcUfcAfu UfcUfca(NAG13) 1089 347AM03462-SS AfsasCfaGfaAfuCfaGfgUfgUfca( NAG 13) 1090 350AM03489-SS uAuAusasguuaucgaGfGfcucauucuca(NAG13) 1091 308AM03492-SS uAuAusCfsaGfcCfcCfu UfAfUfuGfu UfaUfaCfga(NAG13) 1092 310AM03544-SS uAuAuscsagcccCfuL)faUfuguuauacga(NAG13) 1093 310AM03545-SS uAuAuscsagccccuuAfL)fuGfuuauacga(NAG13) 1094 310AM03546-SS uAuAuscsagccccuL)fAfUfuguuauacga(NAG13) 1095 310AM03547-SS uAuAusAfsgUfuAfuCfgAfGfGfcUfcAfu UfcUfcAf(NAG 13) 1096 308AM03650-SS uAuAusasguuaucgAfGfGfcucauucuca(NAG13) 1097 308AM03651-SS uAuAuscsaGfcCfcCfu UfAfUfuGfuUfaUfaCfga(NAG13) 1098 310AM03670-SS uAuAuscsagcgccuL)fAfUfuguuauacga(NAG13) 1099 352AM03683-SS uAuAuscsaGfcCfcCfu UfAfUfuGfu UfaUfaCfga 1100 310AM03741-SS cscsccL)fUfAfuuguuauaca(NAG13) 1101 334AM03742-SS cscsccUfUfAfuuguuauaCMAM(NAG13) 1102 334AM03743-SS CMsCMsccUfUfAfuuguuauaCMAM(NAG 13) 1103 334AM03746-SS cscscu L)fAfUfuguuauacga(NAG13) 1104 335AM03747-SS cscscu UfAfUfuguuauacG MAM(NAG13) 1105 335AM03748-SS CMsCMscu UfAfUfuguuauacGMAM(NAG 13) 1106 335AM03751-SS asuscgAfGfGfcucauucuca(NAG13) 1107 347AM03752-SS asuscgAfGfGfcucauucuCMAM(NAG13) 1108 347AM03753-SS AMsTMscgAfGfGfcucauucuCMAM(NAG13) 1109 353AM03757-SS asascaGfAfAfucagguguca( NAG13) 1110 350AM03758-SS asascaGfAfAfucagguguCMAM( NAG13) 1111 350AM03759-SS AMsAMscaGfAfAfucagguguCMAM(NAG13) 1112 350AM03859-SS (NAG18)uauausasguuaucgAfGfGfcucauucuc(invdA) 1113 308AM03861-SS (NAG18)uauauscsaGfcCfcCfu UfAfUfuGfuUfaUfaCfg(invdA) 1114 310AM03879-SS (NAG4)uscaGfcCfcCfu UfAfUfuGfu UfaUfaCfgausu(invAb) 1115 354AM03880-SS (NAG4)uscaGfcCfcCfu UfAfUfuGfu UfaUfaCfgsa(invAb) 1116 355AM03881-SS (NAG24)uscaGfcCfcCfu UfAfUfuGfuUfa UfaCfgausu(invAb) 1117 354AM03882-SS (NAG4)usaguuaucgAfGfGfcucauucucausu(invAb) 1118 356AM03928-SS uAuAuscsagcccCfu L)fAfUfuguuauacga(NAG13) 1119 310AM03931-SS uAuAusasguuauCfgAfGfGfcucauucuca(NAG13) 1120 308AM03968-SS (NAG4)uauauscaGfcCfcCfu UfAfUfuGfu Ufa UfaCfgs(invdA) 1121 310AM03970-SS (NAG4)(invAb)GfcCfcCfuUfAfUfuGfu Ufa UfaCfgausu(invAb) 1122 357AM04138-SS (NAG25)uauausasguuaucgAfGfGfcucauucuc(invdA) 1123 308AM04152-SS (Alk-PEG5-C6)uauausasguuaucgAfGfGfcucauucuCM(invdA) 1124 308AM04214-SS (Alk-SM PT-C6)uauausasguuaucgAfGfGfcucauucuCM(in dA) 1125 308AM04233-SS (NAG26)uauausasguuaucgAfGfGfcucauucuCM(invdA) 1126 308AM04372-SS (NAG27)uauausasguuaucgAfGfGfcucauucuCM(invdA) 1127 308AM04381-SS (NAG25)auauscsagccccu L)fAfUfuguuauacga(invdT) 1128 358AM04382-SS (NAG25)uauscsagccccu L)fAfUfuguuauacgau(in dT) 1129 359AM04391-SS (NAG25 auausasguuaucgAfGfGfcucauucuca(invdT) 1130 360AM04392-SS (NAG25 uausasguuaucgAfGfGfcucauucucau(invdT) 1131 361AM04412-SS (NAG25 uauauscsagccccuL)fAfUfuguuauacg(invdA) 1132 310AM04414-SS (NAG25 (invAb)gccccu L)fAfUfuguuauacgauus(in Ab) 1133 357AM04416-SS (NAG25 (invAb)uuaucgAfGfGfcucauucucausu(in Ab) 1134 362AM04496-SS (NAG25 (invAb)GfcCfcCfu UfAfUfuGfu UfaUfaCfgausu(invAb) 1135 357AM04497-SS (NAG29 uauausasguuaucgAfGfGfcucauucuc(invdA) 1136 308AM04499-SS (NAG28 (invAb)GfcCfcCfu UfAfUfuGfu UfaUfaCfgausu(invAb) 1137 357AM04498-SS (NAG29 uauauaasuuaucgaGfGfcucauucucsa(invAb) 1138 363AM04500-SS (NAG30 (invAb)GfcCfcCfu UfAfUfuGfu UfaUfaCfgausu(invAb) 1139 357AM04502-SS (NAG25 uauauaasuuaucgaGfGfcucauucucsa(invAb) 1140 363AM04535-SS (NAG25 uauaucsasgccccuL)fAfUfuguuauacg(invdA) 1141 310AM04536-SS (NAG25 uauaucasgccccuL)fAfUfuguuauacg(invdA) 1142 310AM04537-SS (NAG25 uauauasgsuuaucgAfGfGfcucauucuc(invdA) 1143 308AM04538-SS (NAG25 uauauagsuuaucgAfGfGfcucauucuc(invdA) 1144 308AM04543-SS (NAG30 u scaGf cCf cCf u Uf Af Uf u Gf u Ufa Ufa Cfgsa ( i n vAb) 1145 355AM04578-SS (NAG25 ggcsagccccu UfAfUfuguuauacgAMs(invdT)dT 1146 364AM04588-SS (NAG25 ggcsagccccu UfAfUfuguuauacgAMsuu(in dT) 1147 365AM04579-SS (NAG25 GuNAgcsagccccuUfAfUfuguuauacgAMs(in dT)dT 1148 364AM04580-SS (NAG25 ggcs(invdA)gccccu UfAfUfuguuauacgAMs(invdT)dT 1149 364AM04581-SS (NAG25 csagccccuUfAfUfuguuauacgAMs(invdT)dTdTdT 1150 366AM04611-SS (NAG31 (invAb)GfcCfcCfu UfAfUfuGfu UfaUfaCfgausu(invAb) 1151 357AM04612-SS (NAG32 (invAb)GfcCfcCfu UfAfUfuGfu UfaUfaCfgausu(invAb) 1152 357AM04669-SS (NAG25 uauauagsusuaucgAfGfGfcucauucuc(invdA) 1153 308AM04670-SS (NAG25 uauauagususaucgAfGfGfcucauucuc(invdA) 1154 308AM04671-SS (NAG25 gcgausasguuaucgAfGfGfcucauucuc(invdA) 1155 367AM04672-SS (NAG25 ugaausasguuaucgAfGfGfcucauucuc(invdA) 1156 368AM04673-SS (NAG25 aucgusasguuaucgAfGfGfcucauucuc(invdA) 1157 369AM04674-SS (NAG25 u(invdA)uausasguuaucgAfGfGfcucauucuc(invdA) 1158 308AM04675-SS (NAG25 uaua(invdA)sasguuaucgAfGfGfcucauucuc(in dA) 1159 370AM04676-SS (NAG25 uauaus(invdA)sguuaucgAfGfGfcucauucuc(invdA) 1160 308AM04726-SS (NAG30 aGfcCfcCfuUfAfUfuGfuUfa UfaCfgsa(invAb) 1161 371AM04727-SS (NAG30 aaGfcCfcCfu UfAfUfuGfu UfaUfaCfgsa(invAb) 1162 372AM04728-SS (NAG30 sasGfcCfcCfu UfAfUfuGfu UfaUfaCfgas(invAb) 1163 371AM04729-SS (NAG30 gscaGfcCfcCfuUfAfUfuGfuUfa UfaCfgsa(invAb) 1164 373AM04737-SS (NAG25 uauauagsuuaucgaGfGfcucauucucsa(in Ab) 1165 374AM04741-SS (NAG30 sgscaGfcCfcCfuUfAfUfuGfuUfa UfaCfgsa(invAb) 1166 373AM04742-SS (NAG33 (invAb)GfcCfcCfu UfAfUfuGfu UfaUfaCfgausu(invAb) 1167 357AM04743-SS (NAG34 (invAb)GfcCfcCfu UfAfUfuGfu UfaUfaCfgausu(invAb) 1168 357AM04744-SS (NAG35 (invAb)GfcCfcCfu UfAfUfuGfu UfaUfaCfgausu(invAb) 1169 357AM04803-SS (NAG30 acGfcCfcCfuUfAfUfuGfu Ufa UfaCfgsa(invAb) 1170 375AM04804-SS (NAG30 sasaGfcCfcCfu UfAfUfuGfu Ufa UfaCfgas(invAb) 1171 372AM04807-SS (NAG30 sascGfcCfcCfu UfAfUfuGfu UfaUfaCfgas(invAb) 1172 375AM04806-SS (NAG30 sgscaGfcCfcCfu UfAfUfuGfu Ufa UfaCfgas(invAb) 1173 373AM04808-SS (NAG31 sGfcCfcCfuUfAfUfuGfuUfa UfaCfgausu(invAb) 1174 376AM04809-SS (NAG31 saGfcCfcCfu UfAfUfuGfuUfa UfaCfgausu(invAb) 1175 377AM04810-SS (NAG31)sasaGfcCfcCfu UfAfUfuGfu Ufa UfaCfgas(invAb) 1176 372AM04811-SS (NAG31)sasaGfcCfcCfu UfAfUfuGfu Ufa UfaCfgausu(invAb) 1177 378AM04812-SS (NAG31)sasaGfcCfcCfuUfAfUfuGfu Ufa UfaCfg(invdA)usu(invAb) 1178 378AM04813-SS (NAG31)uauausasguuaucgAfGfGfcucauucuc(invdA) 1179 308AM04816-SS (NAG31)uauscsagccccu L)fAfUfuguuauacgs(invdA) 1180 379AM04817-SS (NAG31)uagscsagccccu L)fAfUfuguuauacgs(invdA) 1181 380AM04835-SS (NAG31)uaucagccccu L)fAfUfuguuauacgs(invdA) 1182 379AM04819-SS (NAG31)sgscagccccu L)fAfUfuguuauacgs(invdA) 1183 381AM04820-SS (NAG31)sgscagccccu L)fAfUfuguuauacgsa(invAb) 1184 373AM04862-SS (NAG25)auaagasguuaucgAfGfGfcucauucuc(invdA) 1185 382AM04863-SS (NAG25)auaagsasguuaucgAfGfGfcucauucuc(invdA) 1186 382AM04864-SS (NAG25)auaggcsagccccu L)fAfUfuguuauacg(invdA) 1187 383AM04865-SS (NAG25)auaggscsagccccu L)fAfUfuguuauacg(invdA) 1188 383AM04866-SS (NAG25)scsagccccuL)fAfUfuguuauacgs(invdA) 1189 384AM04867-SS (NAG31)scsagccccuL)fAfUfuguuauacgs(invdA) 1190 384AM04868-SS (NAG25)sgsccccuL)fAfUfuguuauacgauus(invAb) 1191 376AM04869-SS (NAG31)sgsccccuL)fAfUfuguuauacgauus(invAb) 1192 376AM04870-SS (NAG25)sGfsccccu L)fAfUfuguuauacgauus(invAb) 1193 376AM04978-SS (NAG31)sGfscCfcCfu UfAfUfuGfuUfa UfaCfgauus(invAb) 1194 376AM05070-SS (NAG25)uauauscsagcccc(NOTA-dT)L)fAfUfuguuauacg(invdA) 1195 385AM05072-SS (NAG25)(invAb)GfcCfcCf(NOTA-dT)UfAfUfuGfu UfaUfaCfgausu(invAb) 1196 12411532-SS02 uAuAusAfsgUfuAfuCfgAfGfGfcucAfuucuca 1197 3081532-SS03 uAuAusAfsgUfuAfuCfgAfGfGfcucau Ufcuca 1198 3081532-SS04 uAuAusAfsgUfuAfuCfgAfGfGfcucauucUfca 1199 3081532-SS05 uAuAusAfsgUfuAfuCfgAfGfGfcucauucucAf 1200 3081532-SS06 uAuAusAfsgUfuAfuCfgAfgGfcUfcauucucAf 1201 3081532-SS07 uAuAusAfsgUfuAfuCfgAfgGfcucAfuucucAf 1202 3081532-SS08 uAuAusAfsgUfuAfuCfgAfgGfcucau UfcucAf 1203 3081532-SS09 uAuAusAfsgUfuAfuCfgAfgGfcucauucUfcAf 1204 3081532-SS10 uAuAusAfsgUfuAfuCfgAfgGfcucauucucAf 1205 3081532-SS11 uAuAusAfsgUfuAfuCfgaGfGfcucauucucAf 1206 3081532-SS12 uAuAusAfsgUfuAfuCfgagGfcUfcauucucAf 1207 3081532-SS13 uAuAusAfsgUfuAfuCfgagGfcucAfuucucAf 1208 3081532-SS14 uAuAusAfsgUfuAfuCfgagGfcucau UfcucAf 1209 3081532-SS15 uAuAusAfsgUfuAfuCfgagGfcucauucUfcAf 1210 3081532-SS16 uAuAusAfsgUfuAfuCfgagGfcucau UfcUfcAf 1211 3081532-SS17 uAuAusAfsgUfuauCfgAfgGfcucau UfcUfcAf 1212 3081532-SS18 uAuAusAfsgUfuauCfgaGfGfcucauUfcUfcAf 1213 3081532-SS19 uAuAusAfsgUfuauCfgagGfcUfcauUfcUfcAf 1214 3081532-SS20 uAuAusAfsgUfuauCfgagGfcucAfu UfcUfcAf 1215 3081532-SS21 uAuAusAfsgUfuauCfgagGfcUfcAfuUfcUfcAf 1216 3081532-SS22 uAuAusAfsguuAfuCfgagGfcUfcAfuUfcUfcAf 1217 3081532-SS23 uAuAusAfsguuauCfgAfgGfcUfcAfu UfcUfcAf 1218 3081532-SS24 uAuAusAfsguuauCfgaGfGfcUfcAfu UfcUfcAf 1219 3081533-CfinSS uAuAuscsaGfaAfacaGfAfAfucaGfgUfgUfcAf 1220 3091533-SS00 uAuAusCfsaGfaAfaCfaGfAfAfuCfaGfgUfgUfcAf 1221 309A sense strand containing a sequence listed in Table 2B can be hybridized to any antisense strand containing a sequence listed in Table 2A provided the two sequences have a region of at least 90% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence. Representative LPA RNAi agents are represented by the Duplex ID Nos. shown in Tables 3A and 3B.In some embodiments an LPA RNAi agent comprises of any of the Duplex ID Nos. presented herein. In some embodiments an LPA RNAi agent consists of any of the Duplex ID Nos. presented herein. In some embodiments, an LPA RNAi agent comprises the sense strand andantisense strand nucleotide sequences of any of the Duplex ID Nos. presented herein. In some embodiments, an LPA RNAi agent comprises the sense strand and antisense strand nucleotide sequences of any of the Duplex ID Nos. presented herein and a targeting group and / or linking group wherein the targeting group and / or linking group is covalently linked (i.e. conjugated) to the sense strand or the antisense strand. In some embodiments, an LPA RNAi agent comprises the sense strand and antisense strand modified nucleotide sequences of any of the Duplex ID Nos. presented herein. In some embodiments, an LPA RNAi agent comprises the sense strand and antisense strand modified nucleotide sequences of any of the Duplex ID Nos. presented herein and a targeting group and / or linking group wherein the targeting group and / or linking group is covalently linked to the sense strand or the antisense strand.Table 3A. LP A RNAi agent duplexes with Du pi ex ID numbers.Antisense Sense Stra nd Antisense Sense Strand Antisense Sense Stra ndDuplex I D Duplex I D Du plex I DStra nd ID I D Strand I D I D Strand I D I DAD00571 AM01240-AS AM01173-SS AD02120 AM03257-AS AM03229-SS AD02500 AM03107-AS AM03295-SSAD00572 AM01241-AS AM01174-SS AD02121 AM03257-AS AM03230-SS AD02501 AM03279-AS AM03295-SSAD00573 AM01242-AS AM01175-SS AD02122 AM03257-AS AM03231-SS AD02502 AM03280-AS AM03295-SSAD00574 AM01243-AS AM01176-SS AD02123 AM03257-AS AM03232-SS AD02503 AM03281-AS AM03295-SSAD00575 AM01244-AS AM01177-SS AD02124 AM03257-AS AM03233-SS AD02504 AM03282-AS AM03295-SSAD00576 AM01245-AS AM01178-SS AD02125 AM03257-AS AM03234-SS AD02505 AM03283-AS AM03295-SSAD00577 AM01246-AS AM01179-SS AD02126 AM03257-AS AM03235-SS AD02506 AM03284-AS AM03295-SSAD00578 AM01247-AS AM01180-SS AD02127 AM03257-AS AM03236-SS AD02507 AM03300-AS AM03295-SSAD00579 AM01248-AS AM01181-SS AD02128 AM03257-AS AM03237-SS AD02508 AM03301-AS AM03295-SSAD00580 AM01249-AS AM01182-SS AD02129 AM03258-AS AM03220-SS AD02509 AM03107-AS AM03296-SSAD00581 AM01250-AS AM01183-SS AD02130 AM03258-AS AM03221-SS AD02510 AM03279-AS AM03296-SSAD00582 AM01251-AS AM01184-SS AD02131 AM03258-AS AM03222-SS AD02511 AM03280-AS AM03296-SSAD00583 AM01252-AS AM01185-SS AD02132 AM03258-AS AM03223-SS AD02512 AM03281-AS AM03296-SSAD00584 AM01253-AS AM01186-SS AD02133 AM03258-AS AM03224-SS AD02513 AM03282-AS AM03296-SSAD00585 AM01254-AS AM01187-SS AD02134 AM03258-AS AM03225-SS AD02514 AM03283-AS AM03296-SSAD00586 AM01255-AS AM01188-SS AD02135 AM03258-AS AM03226-SS AD02515 AM03284-AS AM03296-SSAD00587 AM01256-AS AM01189-SS AD02136 AM03258-AS AM03227-SS AD02516 AM03300-AS AM03296-SSAD00588 AM01257-AS AM01190-SS AD02137 AM03258-AS AM03228-SS AD02517 AM03301-AS AM03296-SSAD00589 AM01258-AS AM01191-SS AD02138 AM03258-AS AM03229-SS AD02518 AM03107-AS AM03297-SSAD00590 AM01259-AS AM01192-SS AD02139 AM03258-AS AM03230-SS AD02519 AM03279-AS AM03297-SSAD00591 AM01260-AS AM01193-SS AD02140 AM03258-AS AM03231-SS AD02520 AM03280-AS AM03297-SSAD00592 AM01261-AS AM01194-SS AD02141 AM03258-AS AM03232-SS AD02521 AM03281-AS AM03297-SSAD00593 AM01262-AS AM01195-SS AD02142 AM03258-AS AM03233-SS AD02522 AM03282-AS AM03297-SSAD00594 AM01263-AS AM01196-SS AD02143 AM03258-AS AM03234-SS AD02523 AM03283-AS AM03297-SSAD00595 AM01264-AS AM01197-SS AD02144 AM03258-AS AM03235-SS AD02524 AM03284-AS AM03297-SSAD00596 AM01265-AS AM01198-SS AD02145 AM03258-AS AM03236-SS AD02525 AM03300-AS AM03297-SSTable 3B. LPA RNAi agent duplexes with Duplex ID numbers.SD0228 1533-CfinAS 1533-SS17 SD0467 1532-AS03 1532-SS08 SD0706 1532-AS18 1532-SS00SD0229 1533-CfinAS 1533-SS18 SD0468 1532-AS04 1532-SS08 SD0707 1532-AS19 1532-SS00SD0230 1533-CfinAS 1533-SS19 SD0469 1532-AS05 1532-SS08 SD0708 1532-AS20 1532-SS00SD0231 1533-CfinAS 1533-SS20 SD0470 1532-AS06 1532-SS08 SD0709 1532-AS21 1532-SS00SD0232 1533-AS00 1533-SS12 SD0471 1532-AS07 1532-SS08 SD0710 1532-AS22 1532-SS00SD0233 1533-AS01 1533-SS12 SD0472 1532-AS08 1532-SS08 SD0711 1532-AS23 1532-SS00SD0234 1533-AS02 1533-SS12 SD0473 1532-AS09 1532-SS08 SD0712 1532-AS24 1532-SS00SD0235 1533-AS03 1533-SS12 SD0474 1532-AS10 1532-SS08 SD0713 1532-AS25 1532-SS00SD0236 1533-AS04 1533-SS12 SD0475 1532-AS11 1532-SS08 SD0714 1532-AS26 1532-SS00SD0237 1533-AS05 1533-SS12 SD0476 1532-AS12 1532-SS08 SD0715 1532-AS27 1532-SS00SD0238 1533-AS06 1533-SS12 SD0477 1532-AS13 1532-SS08SD0239 1533-AS07 1533-SS12 SD0478 1532-AS00 1532-SS09In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO: 1242 (TCGUAUAACAAUAAGGGGC). In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO: 1244 (UCGUAUAACAAUAAGGGG). In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO: 1246 (UCGUAUAACAAUAAGGG). In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO: 1248 (TGAGAAUGAGCCUCGAUAA). In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO: 1250 (UGAGAAUGAGCCUCGAUA). In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO: 1252 (UGAGAAUGAGCCUCGAU). In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO: 1254 (UGUAUAACAAUAAGGGG). In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO: 1280 (CGUAUAACAAUAAGGGGC). In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO: 1281 (GAGAAUGAGCCUCGAUAA). In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO: 1282 (UC GU AU AAC AAU AAGGGGC) . In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO: 1283 (UGAGAAUGAGCCUCGAU AA). In some embodiments, one or more of the nucleotides is modified. In some embodiments, an LPA RNAi agent comprises a sense strand comprising the nucleotide sequence of SEQ ID NO: 1243 (GCCCCUUAUUGUUAUACGA). In some embodiments, an LPA RNAi agent comprises a sense strand comprising the nucleotide sequence of SEQ ID NO: 1245 (CCCCUUAUUGUUAUACGA). In some embodiments, an LPA RNAi agent comprises a sense strand comprising the nucleotide sequence of SEQ ID NO: 1247 (CCCUUAUUGUUAUACGA). In some embodiments, an LPA RNAi agent comprises a sense strand comprising the nucleotide sequence of SEQ ID NO: 1249 (UUAUCGAGGCUCAUUCUCA). In some embodiments, an LPA RNAi agent comprises a sense strand comprising the nucleotide sequence of SEQ ID NO: 1251 (UAUCGAGGCUCAUUCUCA). In some embodiments, an LPA RNAi agent comprises asense strand comprising the nucleotide sequence of SEQ ID NO: 1253 (AUCGAGGCUCAUUCUCA). In some embodiments, an LPA RNAi agent comprises a sense strand comprising the nucleotide sequence of SEQ ID NO: 1255 (CCCCUUAUUGUUAUACA). In some embodiments, an LPA RNAi agent comprises a sense strand comprising the nucleotide sequence of SEQ ID NO: 1284 (GCCCCUUAUUGUUAUACG). In some embodiments, an LPA RNAi agent comprises a sense strand comprising the nucleotide sequence of SEQ ID NO: 1285 (UUAUCGAGGCUCAUUCUC). In some embodiments, one or more of the nucleotides is modified.In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO: 1242 and a sense strand comprising the nucleotide sequence of SEQ ID NO: 1243. In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO: 1244 and a sense strand comprising the nucleotide sequence of SEQ ID NO: 1245. In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO: 1246 and a sense strand comprising the nucleotide sequence of SEQ ID NO: 1247. In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO: 1248 and a sense strand comprising the nucleotide sequence of SEQ ID NO: 1249. In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO: 1250 and a sense strand comprising the nucleotide sequence of SEQ ID NO: 1251. In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO: 1252 and a sense strand comprising the nucleotide sequence of SEQ ID NO: 1253. In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO: 1254 and sense strand comprising the nucleotide sequence of SEQ ID NO: 1255. In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO: 1280 and a sense strand comprising the nucleotide sequence of SEQ ID NO: 1284. In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO: 1281 and a sense strand comprising the nucleotide sequence of SEQ ID NO: 1285. In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO: 1282 and a sense strand comprising the nucleotide sequence of SEQ ID NO: 1259. In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotidesequence of SEQ ID NO: 1283 and a sense strand comprising the nucleotide sequence of SEQ ID NO: 1249. In some embodiments, one or more of the nucleotides is modified.In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO. 156, 164, or 188. In some embodiments, an LPA RNAi agent comprises a sense strand comprising the nucleotide sequence of SEQ ID NO. 310, 357, 384, or 376. In some embodiments, an LPA RNAi agent comprises an antisense strand and a sense strand comprising the nucleotide sequences of SEQ ID NOs: 156 / 310, SEQ ID NOs: 164 / 357, SEQ ID NOs: 188 / 384, SEQ ID NOs: 164 / 376, or SEQ ID NOs: 164 / 384. In some embodiments, one or more of the nucleotides is modified.In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO. 637, 709, 790, 787, or 788. In some embodiments, an LPA RNAi agent comprises a sense strand comprising the nucleotide sequence of SEQ ID NO: 1132, 1135, 1189, 1191, or 1186. In some embodiments, an LPA RNAi agent comprises an antisense strand and a sense strand comprising the nucleotide sequences of SEQ ID NOs:637 / l 132, SEQ ID NOs:709 / 1135, SEQ ID NOs:790 / 1189, SEQ ID NOs:787 / 1191, or SEQ ID NOs:788 / 1186.In some embodiments, an LPA RNAi agent comprises SEQ ID NO. 637, 709, 790, 787, or 788. In some embodiments, an LPA RNAi agent comprises SEQ ID NO: 1132, 1135, 1189, 1191, or 1186. In some embodiments, an LPA RNAi agent comprises SEQ ID NOs:637 / 1132, SEQ ID NOs:709 / l 135, SEQ ID NOs:790 / l 189, SEQ ID NOs:787 / l 191, or SEQ ID NOs:788 / l 186.In some embodiments, an LPA RNAi agent consists of SEQ ID NO. 637, 709, 790, 787, or 788. In some embodiments, an LPA RNAi agent consists of SEQ ID NO: 1132, 1135, 1189, 1191, or 1186. In some embodiments, an LPA RNAi agent consists of SEQ ID NOs:637 / 1132, SEQ ID NOs:709 / 1135, SEQ ID NOs:790 / 1189, SEQ ID NOs:787 / 1191, or SEQ ID NOs:788 / 1186. In some embodiments, an LPA RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand / sense strand duplexes of Table 3A or 3B.In some embodiments, an LPA RNAi agent comprises an antisense strand and a sense strandhaving the nucleotide sequences of any of the antisense strand / sense strand duplexes of Table 3A or 3B, and further comprises an asialoglycoprotein receptor ligand targeting group.In some embodiments, an LPA RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand / sense strand duplexes of Table 3A or 3B, and further comprises a targeting group selected from the group consisting of (C11-PEG3-NAG3), (C11-PEG3-NAG3), (C6-PEG4-NAG3), (NAG 3), (NAG4), (NAG3-AA2), (NAG3-Palm), (NAG13), (NAG18), (NAG24), (NAG25), (NAG25)s, (NAG26), (NAG27), (NAG28), (NAG29), (NAG30), (NAG30)s, (NAG31), (NAG13), (NAG31s), (NAG32), (NAG33), (NAG34), (NAG35), (NAG36), and (NAG37).In some embodiments, an LPA RNAi agent comprises an antisense strand and a sense strand having the modified nucleotide sequences of any of the antisense strand / sense strand duplexes of Table 3 A or 3B.In some embodiments, an LPA RNAi agent comprises an antisense strand and a sense strand having the modified nucleotide sequences of any of the antisense strand / sense strand duplexes of Table 3A or 3B, and further comprises an asialoglycoprotein receptor ligand targeting group. In some embodiments, an LPA RNAi agent comprises an antisense strand and a sense strand having the modified nucleotide sequences of any of the antisense strand / sense strand duplexes of Table 3 A or 3B, and further comprises a targeting group selected from the group consisting of (C11-PEG3-NAG3), (C 11 -PEG3-NAG3), (C6-PEG4-NAG3), (NAG 3), (NAG4), (NAG3-AA2), (NAG3-Palm), (NAG13), (NAG18), (NAG24), (NAG25), (NAG25)s, (NAG26), (NAG27), (NAG28), (NAG29), (NAG30), (NAG30)s, (NAG31), (NAG13), (NAG31s), (NAG32), (NAG33), (NAG34), (NAG35), (NAG36), and (NAG37).In some embodiments, an LPA RNAi agent comprises any of the duplexes of Table 3 A or 3B. In some embodiments, an LPA RNAi agent consists of any of the duplexes of Table 3A or 3B.In some embodiments, an LPA RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences AD03460, AD03536, AD03581, AD03583, AD3847, or AD04110.In some embodiments, an LPA RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences AD03460, AD03536, AD03581, AD03583, AD3847, or AD04110, and further comprises an asialoglycoprotein receptor ligand targeting group.In some embodiments, an LPA RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences AD03460, AD03536, AD03581, AD03583, AD3847, or AD04110, and further comprises a targeting group selected from the group consisting of (C 11 -PEG3-NAG3), (C11-PEG3-NAG3), (C6-PEG4-NAG3), (NAG 3), (NAG4), (NAG3-AA2), (NAG3-Palm), (NAG13), (NAG18), (NAG24), (NAG25), (NAG25)s, (NAG26), (NAG27), (NAG28), (NAG29), (NAG30), (NAG30)s, (NAG31), (NAG13), (NAG31s), (NAG32), (NAG33), (NAG34), (NAG35), (NAG36), and (NAG37).In some embodiments, an LPA RNAi agent comprises an antisense strand and a sense strand having the modified nucleotide sequences AD03460, AD03536, AD03581, AD03583, AD3847, or AD04110.In some embodiments, an LPA RNAi agent comprises an antisense strand and a sense strand having the modified nucleotide sequences AD03460, AD03536, AD03581, AD03583, AD3847, or AD04110, and further comprises an asialoglycoprotein receptor ligand targeting group.In some embodiments, an LPA RNAi agent comprises an antisense strand and a sense strand having the modified nucleotide sequences AD03460, AD03536, AD03581, AD03583, AD3847, or AD04110, and further comprises a targeting group selected from the group consisting of (CI 1-PEG3-NAG3), (CI 1-PEG3-NAG3), (C6-PEG4-NAG3), (NAG3), (NAG4), (NAG3-AA2), (NAG3-Palm), (NAG13), (NAG18), (NAG24), (NAG25), (NAG25)s, (NAG26), (NAG27), (NAG28), (NAG29), (NAG30), (NAG30)s, (NAG31), (NAG13), (NAG31s), (NAG32), (NAG33), (NAG34), (NAG35), (NAG36), and (NAG37).In some embodiments, an LPA RNAi agent comprises AD03460, AD03536, AD03581, AD03583, AD3847, or AD04110.In some embodiments, an LPA RNAi agent consists of AD03460, AD03536, AD03581, AD03583, AD3847, or AD041 10.Non-nucleotide GroupIn some embodiments, an LPA RNAi agent contains or is conjugated to one or more non- nucleotide groups including, but not limited to a targeting group, linking group, delivery polymer, or a delivery vehicle. The non-nucleotide group can enhance targeting, delivery or attachment of the RNAi agent. Examples of targeting groups and linking groups are provided in Table 4. The non-nucleotide group can be covalently linked to the 3' and / or 5' end of either the sense strand and / or the antisense strand. In some embodiments, an LPA RNAi agent contains a non-nucleotide group linked to the 3' and / or 5' end of the sense strand. In some embodiments a non-nucleotide group is linked to the 5' end of an LPA RNAi agent sense strand. A non-nucleotide group may linked directly or indirectly to the RNAi agent via a linker / linking group. In some embodiments a non-nucleotide group is linked to the RNAi agent via a labile, cleavable, or reversible bond or linker.In some embodiments, a non-nucleotide group enhances the pharmacokinetic or biodistribution properties of an RNAi agent or conjugate to which it is attached to improve cell- or tissue- specific distribution and cell-specific uptake of the conjugate. In some embodiments, a non- nucleotide group enhances endocytosis of the RNAi agent.Targeting GroupA targeting group can be monovalent, divalent, trivalent, tetravalent, or have higher valency. Representative targeting groups include, without limitation, compounds with affinity to cell surface molecule, cell receptor ligands, hapten, antibodies, monoclonal antibodies, antibody fragments, and antibody mimics with affinity to cell surface molecules. In some embodiments, a targeting group is linked to an RNAi agent using a linker, such as a PEG linker or one, two, or three abasic and / or ribitol groups. In some embodiments, a targeting group comprises a galactose cluster.The LPA RNAi agents described herein may be synthesized having a reactive group, such as an amine group, at the 5 '-terminus. The reactive group may be used to subsequently attach a targeting moiety using methods typical in the art.In some embodiments, a targeting group comprises an asialoglycoprotein receptor ligand. In some embodiments, an asialoglycoprotein receptor ligand includes or consists of one or more galactose derivatives or galactose clusters. As used herein, the term galactose derivative includes both galactose and derivatives of galactose having affinity for the asialoglycoprotein receptor that is equal to or greater than that of galactose. Galactose derivatives include, but are not limited to: galactose, galactosamine, N-formylgalactosamine, N-acetyl-galactosamine, N-propionyl-galactosamine, N-n-butanoyl-galactosamine, and N-iso-butanoylgalactos-amine (see for example: Iobst, S T. and Drickamer, K. J. B. C. 1996, 271, 6686). Galactose derivatives and galactose clusters that are useful for in vivo targeting of oligonucleotides and other molecules to the liver are known in the art (see, for example, Baenziger and Fiete, 1980, Cell, 22, 611-620; Connolly et al, 1982, J. Biol. Chem., 257, 939-945). Galactose derivatives have been used to target molecules to hepatocytes in vivo through their binding to the asialoglycoprotein receptor (ASGPr) expressed on the surface of hepatocytes. Binding of ASGPr ligands to the ASGPr(s) facilitates cell-specific targeting to hepatocytes and endocytosis of the molecule into hepatocytes. The galactose cluster may be attached to the 3' or 5' end of the RNAi polynucleotide using methods known in the art.As used herein, a galactose cluster comprises a molecule having two to four terminal galactose derivatives. A terminal galactose derivative is attached to a molecule through its C-1 carbon. In some embodiments, the galactose cluster is a galactose derivative trimer, tri-antennary galactose derivative, or tri-valent galactose derivative. In some embodiments, the galactose cluster is comprises N-acetylgalactosamines (GalNAc). In some embodiments, the galactose cluster comprises a tri-valent N-acetyl-galactosamine. In some embodiments, the galactose cluster is a galactose derivative tetramer, tetra-antennary galactose derivative, or tetra-valent galactose derivative. In some embodiments, the galactose cluster comprises a tetra-valent N- acetyl-galactosamine.As used herein, a galactose trimer contains three galactose derivatives, each linked to a central branch point. As used herein, a galactose derivative tetramer contains four galactose derivatives, each linked to a central branch point. The galactose derivatives can be attached to the central branch point through the C-1 carbons of the saccharides. In some embodiments, the galactose derivatives are linked to the branch point via linkers or spacers. In some embodiments, the linker or spacer is a flexible hydrophilic spacer, such as a PEG group (see, for example, U.S. Patent No. 5885968; Biessen et al. J. Med. Chem. 1995 Vol. 39 p. 1538-1546). In some embodiments, the PEG spacer is a PEG3 spacer. The branch point can be any small molecule which permits attachment of the three galactose derivatives and further permits attachment of the branch point to the RNAi agent. An example of branch point group is a di- lysine or di-glutamate. Attachment of the branch point to the RNAi agent can occur through a linker or spacer. In some embodiments, the linker or spacer comprises a flexible hydrophilic spacer, such as, but not limited to: a PEG spacer. In some embodiments, a PEG spacer is a PEG3 spacer (three ethylene units). In other embodiments, the PEG spacer has 1 to 20 ethylene units (PEGi to PEG20). In some embodiments, a galactose derivative comprises an N- acetylgalactosamine (GalNAc or NAG). In some embodiments, the galactose cluster is comprised of a galactose derivative tetramer, which can be, for example, an N-acetyl- galactosamine tetramer.In some embodiments, pharmaceutical compositions for delivering an LPA RNAi agent to a liver cell in vivo are described. Such pharmaceutical compositions can include, for example, an LPA RNAi agent conjugated to a galactose cluster. In some embodiments, the galactose cluster is comprised of a galactose derivative trimer, which can be, for example, an N-acetyl- galactosamine trimer, or galactose derivative tetramer, which can be, for example, an N-acetyl- galactosamine tetramer. Targeting groups include, but are not limited to, (Chol-TEG), (TEG-Chol), (CI 1-PEG3-NAG3), (Cm-PEGn-NAG3), (Cx-PEGz-NAG3), (NAG 3), (NAG4), (NAG3-AA2), (NAG3-Palm), (NAG13), (NAG18), (NAG24), (NAG25), (NAG25)s, (NAG26), (NAG27), (NAG28), (NAG29), (NAG30), (NAG30)s, (NAG31), (NAG13), (NAG31s), (NAG32), (NAG33), (NAG34), (NAG35), (NAG36), and (NAG37).Linking GroupIn some embodiments, a linking group is conjugated to the RNAi agent. The linking group facilitates covalent linkage of the agent to a targeting group or delivery polymer or delivery vehicle. The linking group can be linked to the 3' or the 5' end of the RNAi agent sense strand or antisense strand. In some embodiments, the linking group is linked to the RNAi agent sense strand. In some embodiments, the linking group is conjugated to the 5' or 3' end of an RNAi agent sense strand. In some embodiments a linking group is conjugated to the 5' end of an RNAi agent sense strand. Examples of linking groups, include, but are not limited to: Alk- SMPT-C6, Alk-SS-C6, DBCO-TEG, Me-Alk-SS-C6, and C6-SS-Alk-Me, reactive groupssuch a primary amines and alkynes, alkyl groups, abasic ribose, ribitol, and / or PEG groups.A linker or linking group is a connection between two atoms that links one chemical group (such as an RNAi agent) or segment of interest to another chemical group (such as a targeting group or delivery polymer) or segment of interest via one or more covalent bonds. A labile linkage contains a labile bond. A linkage may optionally include a spacer that increases the distance between the two joined atoms. A spacer may further add flexibility and / or length to the linkage. Spacers may include, but are not be limited to, alkyl groups, alkenyl groups, alkynyl groups, aryl groups, aralkyl groups, aralkenyl groups, and aralkynyl groups; each of which can contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and saccharides. Spacer groups are well known in the art and the preceding list is not meant to limit the scope of the description.Linking groups include, but are not limited to, Alkyl, PEG, (C6-PEGn-Alk), (Cn-SMPT-Alk),Any of the LP A RNAi agents listed in Tables 2 A and 2B which contains a 3' or 5' targeting group or linking group, may alternatively contain no 3' or 5' targeting group or linking group, or may contain a different 3' or 5' targeting group or linking group including, but not limited to, those depicted in Table 4. Any of the LPA RNAi agent nucleotide sequences listed in Tables 1, 2A and 2B, whether modified or unmodified, may contain 3 Or 5' targeting group or linking group, including, but not limited to, those depicted in Table 4. Any of the LPA RNAi agent duplexes listed in Tables 3A and 3B, whether modified or unmodified, may further comprise a targeting group or linking group, including, but not limited to, those depicted in Table 4, and the targeting group or linking group may be attached to the 3' or 5' terminus of either the sense strand or the antisense strand of the LPA RNAi agent duplex.Table 4. Structures representing various modified nucleotides, targeting groups, and linking76In each of the above stmctures, NAG comprises an N-Acetyl-Galactosamine or another ASGPR ligand. Each (NAGx) may be attached to an LPA RNAi agent via a phosphate group (as in (NAG25), (NAG30), and (NAG31)). or a phosphorothioate group, (as is (NAG25)s, (NAG30)s, and (NAG31)s), or another linking group. Alternatively, other linking groups known in the art may be used.Phosphate group phosphorothioate group N- Acetyl galactosamineDelivery VehiclesIn some embodiments, a delivery vehicle may be used to deliver an RNAi agent to a cell or tissue. A delivery vehicle is a compound that improves delivery of the RNAi agent to a cell or tissue. A delivery vehicle can include, or consist of, but is not limited to: a polymer, such as an amphipathic polymer, a membrane active polymer, a peptide, a melittin peptide, a melittin-like peptide (MLP), a lipid, a reversibly modified polymer or peptide, or a reversibly modified membrane active poly amine.In some embodiments, the RNAi agents can be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs or other delivery systems available in the art. The RNAi agents can also be chemically conjugated to targeting groups, lipids (including, but not limited to cholesterol and cholesteryl derivatives), nanoparticles, polymers, liposomes, micelles, DPCs (see, for example WO 2000 / 053722, WO 2008 / 0022309, WO 2011 / 104169, and WO 2012 / 083185, WO 2013 / 032829, WO 2013 / 158141, each of which is incorporated herein by reference), or other delivery systems available in the art. Pharmaceutical CompositionsDescribed herein are methods for delivering LPA RNAi agents to liver cells in a mammal in vivo. In some embodiments, a delivery vehicle may be used. A delivery vehicle is a compound which improves delivery of the RNAi agent to the cell. A delivery vehicle can be, but is not limited to: a polymer, such as an amphipathic polymer, membrane active polymer, a peptide, such as a melittin or melittin-like peptide, a reversibly modified polymer or peptide, or a lipid. In some embodiments, an LPA RNAi agent is linked to a targeting ligand that comprises an asialoglycoprotein ligand. In some embodiments, an LPA RNAi agent is linked to a targeting ligand that comprises or consists of a galactose cluster. An LPA RNAi agent can be used to inhibit expression of LPA in a cell, group of cells, or atissue, e.g., in a subj ect. In some embodiments, an LPA RNAi agent is used to formulate a composition, i.e. a pharmaceutical composition or medicament, for administering to a subject. As used herein, a pharmaceutical composition or medicament comprises a pharmacologically effective amount of at least one of the described LPA RNAi agents and one or more pharmaceutically acceptable excipients. Pharmaceutically acceptable excipients (excipients) are substances other than the Active Pharmaceutical ingredient (API, therapeutic product, e.g., LPA RNAi agent) that have been appropriately evaluated for safety and are intentionally included in the drug delivery system. Excipients do not exert or are not intended to exert a therapeutic effect at the intended dosage. Excipients may act to a) aid in processing of the drug delivery system during manufacture, b) protect, support or enhance stability, bioavailability or patient acceptability of the API, c) assist in product identification, and / or d) enhance any other attribute of the overall safety, effectiveness, of delivery of the API during storage or use. A pharmaceutically acceptable excipient may or may not be an inert substance. Excipients include, but are not limited to: absorption enhancers, anti-adherents, anti-foaming agents, anti-oxidants, binders, binders, buffering agents, carriers, coating agents, colors, delivery enhancers, delivery polymers, dextran, dextrose, diluents, disintegrants, emulsifiers, extenders, fillers, flavors, glidants, humectants, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, suspending agents, sustained release matrices, sweeteners, thickening agents, tonicity agents, vehicles, water-repelling agents, and wetting agents.A pharmaceutical composition can contain other additional components commonly found in pharmaceutical compositions. Such additional components include, but are not limited to: antipruritics, astringents, local anesthetics, or anti -inflammatory agents (e.g., antihistamine, diphenhydramine, etc.). It is also envisioned that cells, tissues or isolated organs that express or comprise the herein defined RNAi agents may be used as "pharmaceutical compositions". As used herein, "pharmacologically effective amount," "therapeutically effective amount," or simply "effective amount" refers to that amount of an RNAi agent to produce the intended pharmacological, therapeutic or preventive result.In some embodiments, a described LPA RNAi agent is combined one or more additional therapeutics or treatments including, but not limited to: a second LPA RNAi agent or other RNAi agent, a small molecule drug, an antibody, an antibody fragment, and / or a vaccine. Examples of additional therapeutics include, but are not limited to, HMg Co-A reductaseinhibitors (statins), ezetimibe, PCSK-9 inhibitors, CTEP inhibitors, therapies targeting ANGPTL3, therapies targeting APOC3, and niacin.The described RNAi agents and pharmaceutical compositions comprising LPA RNAi agents disclosed herein may be packaged or included in a kit, container, pack, or dispenser. The LPA RNAi agents and pharmaceutical compositions comprising said LPA RNAi agents may be packaged in pre-filled syringes or vials.In some embodiments, pharmaceutical compositions comprising at least one of the described LPA RNAi agents are contemplated. These pharmaceutical compositions are useful in the inhibition of the expression of the LPA gene in a cell, a tissue, or an organism. In some embodiments, the described pharmaceutical compositions are used to treat a subject having a disease, condition, or disorder that would benefit from reduction or inhibition in LPA expression. In some embodiments, the described pharmaceutical compositions are used to treat a subject at risk of developing a disease, condition, or disorder that would benefit from reduction or inhibition in LPA expression. Diseases, conditions, or disorders that would benefit from reduction or inhibition in LPA expression include, but are not limited to: Berger's disease, peripheral artery disease, coronary artery disease, metabolic syndrome, acute coronary syndrome, aortic valve stenosis, aortic valve regurgitation, aortic dissection, retinal artery occlusion, cerebrovascular disease, mesenteric ischemia, superior mesenteric artery occlusion, renal artery stenosis, stable / unstable angina, acute coronary syndrome, heterozygous or homozygous familial hypercholesterolemia, hyperapobetalipoproteinemia, cerebrovascular atherosclerosis, cerebrovascular disease, and venous thrombosis. In some embodiments, the subject is a mammal, including, but not limited to, a human patient.Cells, tissues, and non-human organisms that include at least one of the LPA RNAi agents described herein is contemplated. The cell, tissue, or non-human organism is made by delivering the RNAi agent to the cell, tissue, or non-human organism by any means available in the art. In some embodiments, the cell is a mammalian cell, including, but not limited to, a human cell. The cell, tissue, or non-human organisms are useful for research or as research tools (e.g., drug testing or diagnoses).Method of TreatmentIn some embodiments, the LPA RNAi agents described herein are used to treat a subject having a disease, condition, or disorder or at risk of having a disease, condition, or disorder that would benefit from reduction or inhibition in LPA expression. Treatment of a subject that would benefit from a reduction and / or inhibition of LPA gene expression includes therapeutic and / or prophylactic treatment. Examples of diseases, conditions, or disorders, include, but not limited to: Berger's disease, peripheral artery disease, coronary artery disease, metabolic syndrome, acute coronary syndrome, aortic valve stenosis, aortic valve regurgitation, aortic dissection, retinal artery occlusion, cerebrovascular disease, mesenteric ischemia, superior mesenteric artery occlusion, renal artery stenosis, stable / unstable angina, acute coronary syndrome, heterozygous or homozygous familial hypercholesterolemia, hyperapobetalipoproteinemia, cerebrovascular atherosclerosis, cerebrovascular disease, and venous thrombosis. In some embodiments, the method comprises administering a composition, such as a pharmaceutical composition, comprising an LPA RNAi agent described herein to a mammal to be treated.In some embodiments, a therapeutically effective amount of one or more of the described LPA RNAi agents is administered to a subject, thereby inhibiting expression of LPA in the subject (e.g., an amount effective to inhibit expression of LPA in the subject). In some embodiments, one or more of the LPA RNAi agents described herein are used to treat a subject having a disease or disorder that would benefit from reduction or inhibition in LPA expression. In some embodiments, the described LPA RNAi agents are used to treat or prevent at least one symptom in a subject having a disease or disorder that would benefit from reduction or inhibition in LPA expression. The subject is administered a therapeutically effective amount of any one or more of the described RNAi agents thereby treating the symptom. In some embodiments, the subject is administered a prophylactically effective amount of any one or more of the described RNAi agents thereby preventing the at least one symptom.In some embodiments, an LPA RNAi agent is used to treat or manage a clinical presentation wherein a subject in need of such treatment, prevention, or management is administered a therapeutically or prophylactically effective amount of one or more of the LPA RNAi agents or LPA RNAi agent-containing compositions described herein. In some embodiments, the method comprises administering a composition comprising an LPA RNAi agent described herein to a mammal to be treated.In some embodiments, the methods further comprise the step of administering a second therapeutic or treatment. In some embodiments, the second therapeutic is another LPA RNAi agent (e.g., a LPA RNAi agent which targets a different sequence within the LPA target). In other embodiments, the second therapeutic can be selected from the group comprising: small molecule drug, antibody, antibody fragment, and vaccine.The route of administration is the path by which an RNAi agent is brought into contact with the body. In general, methods of administering drugs and nucleic acids for treatment of a subject are well known in the art and can be applied to administration of the compositions described herein. The compounds described herein can be administered via any suitable route in a preparation appropriately tailored to the particular route. Thus, the compounds described herein can be administered by injection, for example, intravenously, intramuscularly, intracutaneously, subcutaneously, or intraperitoneally. In some embodiments, the LPA RNAi agents or compositions described herein can be delivered to a cell, group of cells, tissue, or subject using oligonucleotide delivery technologies known in the art. In general, any suitable method recognized in the art for delivering a nucleic acid molecule (in vitro or in vivo) can be adapted for use with an LPA RNAi agent described herein. For example, delivery can be by local administration, (e.g., direct injection, implantation, or topical administering), systemic administration, or subcutaneous, intravenous, oral, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal and intrathecal), intramuscular, transdermal, airway (aerosol), nasal, rectal, or topical (including buccal and sublingual) administration, In certain embodiments, the compositions are administered by subcutaneous or intravenous infusion or injection.In some embodiments, the RNAi agents can be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs or other delivery systems available in the art. The RNAi agents can also be chemically conjugated to targeting groups, lipids (including, but not limited to cholesterol and cholesteryl derivatives), nanoparticles, polymers, liposomes, micelles, DPCs (se e.g., WO 2000 / 053722, WO 2008 / 0022309, WO 2011 / 104169, and WO 2012 / 083185, each of which is incorporated herein by reference), or other delivery systems available in the art. An LPA RNAi agent can be conjugated to a delivery polymer. In some embodiments, the delivery polymer is a reversibly masked / modified amphipathic membrane active polyamine.Inhibition of expressionAs used herein, the terms "silence," "reduce," "inhibit," "down-regulate," or "knockdown gene expression," when referring to an LPA gene, mean that the expression of the gene, as measured by the level of RNA transcribed from the gene or the level of polypeptide, protein, or protein subunit translated from the mRNA in a cell, group of cells, or tissue, in which the LPA gene is transcribed, is reduced when the cell, group of cells, or tissue, is treated with the described LPA RNAi agents as compared to a second cell, group of cells, or tissue that has or has not been so treated or compared to the same cell, group of cells, or tissue, prior to administration of the LPA RNAi agent.In some embodiments, the gene expression level and / or mRNA level of LPA in a subject to whom a described LPA RNAi agent is administered is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% relative to the subject prior to being administered the LPA RNAi agent or to a subject not receiving the LPA RNAi agent. The gene expression level and / or mRNA level in the subj ect may be reduced in a cell, group of cells, and / or tissue of the subject. In some embodiments, the protein level of LPA in a subject to whom a described LPA RNAi agent has been administered is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% relative to the subject prior to being administered the LPA RNAi agent or to a subject not receiving the LPA RNAi agent. The protein level in the subject may be reduced in a cell, group of cells, tissue, blood, and / or other fluid of the subject. A reduction in gene expression, mRNA, or protein levels can be assessed by any methods known in the art. Reduction or decrease in LPA mRNA level and / or protein level are collectively referred to herein as a reduction or decrease in LPA or inhibiting or reducing the expression of LPA.Introducing into a cell, when referring to an RNAi agent, means functionally delivering the RNAi agent into the cell. By functional delivery, it is meant that the RNAi agent is delivered to the cell and has the expected biological activity, (e.g., sequence-specific inhibition of gene expression).Cells and Tissues and non-Human organismsCells, tissues, and non-human organisms that include at least one of the LPA RNAi agents described herein is contemplated. The cell, tissue, or non-human organism is made bydelivering the RNAi agent to the cell, tissue, or non-human organism.The above provided embodiments and items are now illustrated with the following, non- limiting examples.EXAMPLESExample 1. RNAi agent synthesis.A) Synthesis. LPA RNAi agents were synthesized according to phosphoramidite technology on solid phase used in oligonucleotide synthesis. Depending on the scale either a MerMade96E (Bioautomation) or a MerMadel2 (Bioautomation) was used. Syntheses were performed on a solid support made of controlled pore glass (CPG, 500 A or 600A, obtained from Prime Synthesis, Aston, PA, USA). All DNA, 2'-modified RNA, and UNA phosphoramidites were purchased from Thermo Fisher Scientific (Milwaukee, WI, USA). Specifically, the following 2'-0-Methyl phosphoramidites were used: (5'-0-dimethoxytrityl-N6-(benzoyl)-2'-0-methyl- adenosine-3'-0-(2-cyanoethyl-N,N-diisopropy-lamino) phosphoramidite, 5'-0-dimethoxy-trityl- N4-(acetyl)-2'-0-methyl-cytidine-3'-0-(2-cyanoethyl-N,N-diisopropyl-amino)phosphoramidite, (5'-0-dimethoxytrityl-N2-(isobutyryl)-2'-0-methyl-guanosine-3'-0-(2- cyano-ethyl-N,N-diisopropylamino)phosphorarnidite, and 5'-0-dimethoxy-trityl-2'-0- methyl-uridine-3'-0-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite. The 2'-Deoxy-2'- fluoro-phosphor-amidites carried the same protecting groups as the 2'-0-methyl RNA amidites. The following UNA phosphoramidites were used: 5'-(4,4'-Dimethoxytrityl)-N-benzoyl-2',3'- seco-adenosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphor-amidite, 5'-(4,4'-Dimethoxytrityl)-N-acetyl-2',3'-seco-cytosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N- diiso-propyl)] -phosphoramidite, 5'-(4,4'-Dimethoxytrityl)-N-isobutyryl-2',3'-seco-guanosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, and 5'-(4,4'-Dimethoxy- trityl)-2',3'-seco-uridine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N- diiso-propyl)] -phosphoramidite. All amidites were dissolved in anhydrous acetonitrile (50 mM) and molecular sieves (3 A) were added. In order to introduce the TEG-Cholesterol at the 5 '-end of the oligomers, the l-Dimethoxytrityloxy-3-0-(N-cholesteiyl-3-aminopropyl)-triethyleneglycol-glyceryl-2-0-(2- cyanoethyl)-(N,N,-diisopropyl)-phosphorarnidite from Glen Research (Sterling, VA, USA) was employed. The 5 '-modifications were introduced without any modification of the synthesis cycle. 5-Benzylthio-lH-tetrazole (BTT, 250 mM in acetonitrile) was used as activator solution. Coupling times were 10 min (RNA), 180 sec (Cholesterol), 90 sec (2'OMe and UNA), and 60 sec (2'F and DNA). In order to introduce phosphorothioate linkages, a 100 mM solution of3-phenyl l,2,4-dithiazoline-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous Acetonitrile was employed. See Tables 1, 2A, and 2B for specific sequences.B. Cleavage and deprotection of support bound oligomer. After finalization of the solid phase synthesis, the dried solid support was treated with a 1 :1 volume solution of 40 wt. % methylamine in water and 28% ammonium hydroxide solution (Aldrich) for two hours at 30°C. The solution was evaporated and the solid residue was reconstituted in water (see below).C. Purification. Crude Cholesterol containing oligomers were purified by reverse phase HPLC using a Waters XBridge BEH300 C4 5u Prep column and a Shimadzu LC-8 system. Buffer A was 100 mM TEAA, pH 7.5 and contained 5% Acetonitrile and buffer B was 100 mM TEAA and contained 95% Acetonitrile. UV traces at 260 nm were recorded. Appropriate fractions were then run on size exclusion HPLC using a GE Healthcare XK 16 / 40 column packed with Sephadex G-25 medium with a running buffer of lOOmM ammonium bicarbonate, pH 6.7 and 20% Acetonitrile. Other crude oligomers were purified by anionic exchange HPLC using a TKSgel SuperQ-5PW 13u column and Shimadzu LC-8 system. Buffer A was 20 mM Tris, 5 mM EDTA, pH 9.0 and contained 20% Acetonitrile and buffer B was the same as buffer A with the addition of 1.5 M sodium chloride. UV traces at 260 nm were recorded. Appropriate fractions were pooled then run on size exclusion HPLC as described for cholesterol containing oligomers.D. Annealing. Complementary strands were mixed by combining equimolar solutions (sense and antisense) in 0.2* PBS (Phosphate-Buffered Saline, l x, Corning, Cellgro) to form the RNAi agents. This solution was placed into a thermomixer at 70°C, heated to 95°C, held at 95°C for 5 min, and cooled to room temperature slowly. Some RNAi agents were lyophilized and stored at -15 to -25°C. Duplex concentration was determined by measuring the solution absorbance on a UV-Vis spectrometer in 0.2* PBS. The solution absorbance at 260 nm was then multiplied by a conversion factor and the dilution factor to determine the duplex concentration. Unless otherwise stated, all conversion factor was 0.037 mg / (mL-cm). For some experiments, a conversion factor was calculated from an experimentally determined extinction coefficient.Example 2. Primary in vitro analysis of LP A RNAi agents. Candidate sequences identified as human and non-human primate cross-reactive by in silico analysis were screened. 108 in silico-identified potential LPA RNAi agents were synthesized and screened for efficacy in vitro in three groups. For screening purposes, the human LPA cDNA sequence (accession # NM_005577.1) was sub-cloned from a commercially available mammalian expression vector (Origene, Rockville, MD) into a commercially-available, reporter-based screening plasmid, psiCHECK2 (Promega, Madison, WI) which generated a Renilla luciferase / LPA fusion mRNA. For LPA RNAi agent efficacy in the human background, Hep3B cells, a human hepatocellular carcinoma line, were plated at -10,000 cells per well in 96-well format. Each of the 108 LPA RNAi agents was co-transfected at two or three concentrations (1 nM and 0.1 nM, or 0.02, 0.2 and 2 nM) with 50-100 ng LPA-psiCHECK2 plasmid DNA per well and 0.2 LipoFectamine 2000 per well. Gene knockdown was determined by measuring Renilla luciferase levels normalized to the levels of constitutively-expressed firefly luciferase, also present on the psiCHECK2 plasmid, using the Dual Luciferase Reporter Assay (Promega, Madison, WI) (Tables 5A and 5B). Table 5 A. In vitro analyses of LPA RNAi agents, inhibition of LPA expression.AD00594 0.645 0.056 0.567 0.008 AD00628 0.765 0.069 0.995 0.090AD00595 0.812 0.132 1.076 0.285 AD00629 1.001 0.184 1.199 0.064AD00596 0.658 0.116 0.787 0.153 AD00630 0.963 0.149 1.154 0.141AD00597 0.999 0.120 1.083 0.143 AD00631 0.979 0.084 1.038 0.088AD00598 0.501 0.067 0.631 0.036 AD00632 0.781 0.048 0.858 0.101AD00599 0.890 0.098 0.871 0.143 AD00633 0.817 0.072 1.027 0.143AD00600 0.393 0.018 0.729 0.172 AD00634 0.807 0.087 0.978 0.256AD00601 0.896 0.180 1.142 0.140 AD00635 0.496 0.073 0.377 0.023AD00602 0.653 0.134 0.955 0.062 AD00636 0.615 0.102 0.748 0.072AD00603 0.730 0.118 0.799 0.187 AD00637 0.792 0.056 1.070 0.048AD00604 0.892 0.058 0.956 0.107Table 5B. In vitro analyses of LPA RNAi agents, inhibition of LPA expression.AD01348 1.022 0.068 1.228 0.244 1.097 0.049AD01349 0.934 0.151 1.217 0.080 1.068 0.149AD01350 0.871 0.295 1.318 0.225 0.942 0.395AD01351 1.414 0.065 1.121 0.180 1.029 0.049AD01352 0.868 0.088 1.024 0.385 1.049 0.176AD01353 1.150 0.478 1.164 0.276 0.898 0.175AD01354 0.999 0.119 1.378 0.292 1.507 0.289AD01355 0.943 0.092 1.066 0.268 1.411 0.113AD01356 1.116 0.351 1.072 0.196 1.000 0.145Table 5C. In vitro analyses of 10 mM LPA RNAi agents, inhibition of LPA expression.AD01747 0.23 ±0.03 AD02075 0.38 ±0.01 AD02535 0.70 ±0.10AD01752 0.24 ±0.03 AD02135 0.38 ±0.03 AD02376 0.71 ±0.04AD01736 0.24 ±0.02 AD02114 0.38 ±0.04 AD01743 0.71 ±0.02AD02311 0.25 ±0.05 AD02188 0.38 ±0.04 AD02289 0.71 ±0.04AD02201 0.25 ±0.03 AD02318 0.38 ±0.02 AD02530 0.71 ±0.06AD01750 0.25 ±0.00 AD02388 0.38 ±0.02 AD01709 0.71 ±0.12AD01756 0.25 ±0.01 AD02115 0.38 ±0.04 AD02249 0.71 ±0.06AD02291 0.25 ±0.03 AD02133 0.38 ±0.00 AD02534 0.71 ±0.03AD02292 0.26 ±0.01 AD02183 0.38 ±0.04 AD02213 0.71 ±0.02AD02266 0.26 ±0.02 AD02116 0.38 ±0.02 AD02529 0.71 ±0.03AD01763 0.26 ±0.01 AD02132 0.39 ±0.03 AD01711 0.71 ±0.06AD02259 0.26 ±0.03 AD02400 0.39 ±0.02 AD02341 0.72 ±0.06AD02327 0.26 ±0.02 AD02338 0.39 ±0.04 AD02233 0.72 ±0.06AD02274 0.27 ±0.03 AD02112 0.39 ±0.01 AD02342 0.73 ± 0.04AD02297 0.27 ±0.02 AD02354 0.39 ±0.05 AD02395 0.73 ±0.06AD02147 0.27 ±0.03 AD01749 0.40 ± 0.06 AD02306 0.73 ±0.09AD02365 0.27 ±0.04 AD02312 0.40 ± 0.02 AD02344 0.73 ± 0.04AD02260 0.27 ±0.03 AD02240 0.40 ± 0.00 AD02145 0.74 ± 0.09AD02368 0.27 ±0.01 AD02313 0.40 ± 0.03 AD02326 0.74 ± 0.06AD02265 0.28 ±0.03 AD01710 0.40 ± 0.05 AD02414 0.74 ± 0.04AD02293 0.28 ±0.04 AD02301 0.40 ± 0.05 AD02379 0.74 ± 0.06AD02350 0.28 ±0.02 AD02425 0.40 ± 0.04 AD02532 0.75 ± 0.04AD02202 0.28 ±0.03 AD02099 0.41 ± 0.04 AD02178 0.75 ±0.11AD02203 0.28 ±0.03 AD01723 0.41 ± 0.04 AD02195 0.75 ±0.05AD02258 0.28 ±0.05 AD02391 0.41 ±0.03 AD02123 0.76 ±0.07AD02295 0.28 ±0.03 AD02392 0.41 ±0.05 AD02164 0.77 ±0.09AD02363 0.28 ±0.04 AD02083 0.41 ±0.01 AD01726 0.77 ±0.01AD02273 0.28 ±0.02 AD02155 0.41 ±0.02 AD02231 0.77 ±0.05AD02386 0.28 ±0.02 AD02082 0.41 ±0.01 AD02180 0.77 ± 0.04AD02309 0.28 ±0.03 AD02336 0.41 ±0.01 AD02412 0.77 ±0.05AD02382 0.29 ±0.01 AD02101 0.41 ±0.02 AD02251 0.77 ±0.02AD02256 0.29 ±0.02 AD01728 0.42 ±0.01 AD02396 0.78 ±0.13AD02367 0.29 ±0.03 AD02424 0.42 ± 0.04 AD02160 0.78 ± 0.04AD02275 0.29 ±0.04 AD02175 0.42 ± 0.02 AD02533 0.78 ±0.05AD02206 0.29 ±0.01 AD02225 0.42 ± 0.05 AD02290 0.78 ±0.03AD02332 0.29 ±0.02 AD02086 0.43 ± 0.02 AD02378 0.78 ±0.07AD01717 0.29 ±0.03 AD01725 0.43 ± 0.06 AD02394 0.79 ± 0.04AD02296 0.29 ±0.01 AD02374 0.43 ± 0.03 AD02415 0.79 ±0.05AD02264 0.29 ±0.03 AD02390 0.43 ± 0.04 AD02181 0.79 ±0.08AD02278 0.29 ±0.03 AD02227 0.43 ± 0.02 AD02492 0.79 ±0.06AD02385 0.29 ±0.00 AD02137 0.43 ± 0.06 AD02397 0.79 ±0.05AD02205 0.29 ±0.04 AD02085 0.43 ±0.01 AD02398 0.79 ±0.09AD02149 0.29 ±0.02 AD02407 0.43 ± 0.03 AD02416 0.79 ± 0.04AD02239 0.30 ±0.05 AD02100 0.44 ± 0.04 AD02144 0.79 ±0.09AD01748 0.30 ±0.02 AD02406 0.44 ± 0.04 AD02531 0.79 ±0.06AD02404 0.30 ±0.01 AD02136 0.44 ± 0.02 AD02489 0.80 ± 0.04AD01721 0.30 ±0.03 AD02209 0.44 ± 0.03 AD02307 0.80 ±0.10AD02277 0.30 ±0.05 AD02154 0.44 ± 0.02 AD02308 0.80 ±0.11AD02152 0.30 ±0.01 AD02171 0.44 ± 0.01 AD02182 0.80 ±0.08AD02237 0.30 ±0.02 AD02261 0.45 ± 0.02 AD02198 0.80 ±0.11AD02098 0.30 ±0.03 AD02271 0.45 ± 0.00 AD02199 0.80 ±0.10AD02381 0.30 ±0.02 AD02371 0.45 ± 0.03 AD02200 0.80 ±0.06AD02315 0.30 ±0.02 AD02173 0.45 ± 0.07 AD02125 0.81 ±0.06AD02366 0.30 ±0.01 AD02319 0.45 ±0.01 AD02141 0.81 ±0.01AD02242 0.31 ±0.03 AD02176 0.46 ±0.01 AD02516 0.81 ±0.06AD02294 0.31 ±0.02 AD02428 0.46 ± 0.02 AD02127 0.81 ±0.06AD02346 0.31 ±0.04 AD02410 0.46 ±0.01 AD02380 0.81 ±0.03AD02329 0.31 ±0.02 AD01746 0.46 ± 0.05 AD02124 0.81 ±0.05AD02348 0.31 ±0.01 AD01732 0.46 ± 0.02 AD02197 0.81 ±0.02AD01714 0.31 ±0.05 AD02157 0.47 ± 0.02 AD02159 0.81 ±0.09AD01724 0.31 ±0.01 AD02372 0.47 ± 0.03 AD02485 0.82 ± 0.04AD02170 0.31 ±0.02 AD02427 0.47 ± 0.02 AD02142 0.82 ±0.08AD02352 0.31 ±0.02 AD02370 0.47 ±0.01 AD02126 0.82 ±0.08AD02093 0.31 ±0.01 AD02172 0.47 ± 0.04 AD02254 0.82 ±0.10AD02383 0.31 ±0.02 AD02158 0.47 ± 0.02 AD02232 0.82 ± 0.04AD02284 0.31 ±0.04 AD02270 0.48 ± 0.04 AD02146 0.82 ± 0.04AD02219 0.31 ±0.04 AD02426 0.48 ± 0.04 AD02490 0.82 ±0.03AD02279 0.31 ±0.03 AD02361 0.48 ± 0.04 AD01745 0.82 ±0.09AD02299 0.31 ±0.05 AD02245 0.48 ± 0.02 AD02162 0.83 ± 0.04AD01740 0.31 ±0.02 AD02373 0.48 ±0.01 AD02471 0.83 ±0.11AD02417 0.32 ±0.01 AD02084 0.48 ± 0.05 AD02487 0.83 ±0.09AD02364 0.32 ±0.02 AD02194 0.48 ± 0.03 AD02523 0.83 ±0.10AD02262 0.32 ±0.03 AD01753 0.48 ± 0.06 AD02483 0.83 ±0.03AD02369 0.32 ±0.01 AD02320 0.48 ± 0.03 AD02128 0.84 ± 0.09AD01731 0.32 ±0.02 AD02268 0.48 ± 0.05 AD02143 0.84 ± 0.05AD02349 0.32 ±0.01 AD02226 0.49 ±0.01 AD02214 0.84 ±0.13AD02095 0.32 ±0.02 AD02156 0.49 ±0.01 AD02217 0.84 ± 0.07AD02281 0.32 ±0.01 AD02409 0.49 ± 0.03 AD02250 0.84 ± 0.08AD02224 0.32 ±0.06 AD02244 0.49 ± 0.02 AD02163 0.85 ± 0.04AD02148 0.32 ±0.04 AD02189 0.49 ± 0.06 AD02525 0.85 ±0.06AD01718 0.33 ±0.01 AD01764 0.50 ±0.02 AD02481 0.85 ±0.03AD02333 0.33 ±0.01 AD02174 0.50 ±0.04 AD02235 0.85 ±0.03AD02403 0.33 ±0.01 AD02117 0.50 ±0.01 AD02539 0.86 ±0.05AD02317 0.33 ±0.03 AD02208 0.50 ±0.05 AD02470 0.86 ±0.07AD02399 0.33 ±0.02 AD02104 0.51 ±0.03 AD02469 0.86 ± 0.04AD02222 0.33 ±0.01 AD02408 0.51 ±0.06 AD02480 0.86 ±0.07AD02310 0.33 ±0.02 AD02272 0.51 ±0.04 AD02488 0.87 ±0.05AD01733 0.33 ±0.01 AD02122 0.51 ±0.06 AD02511 0.87 ±0.05AD02131 0.33 ±0.01 AD02140 0.51 ±0.04 AD02482 0.87 ± 0.04AD02353 0.33 ±0.03 AD02362 0.51 ±0.04 AD02519 0.87 ±0.08AD02263 0.33 ±0.03 AD01739 0.52 ±0.04 AD02491 0.88 ±0.05AD02204 0.33 ±0.01 AD02121 0.52 ±0.06 AD02216 0.88 ±0.00AD02080 0.33 ±0.00 AD02138 0.52 ±0.04 AD02215 0.88 ±0.03AD02298 0.33 ±0.03 AD02358 0.52 ±0.02 AD02468 0.88 ±0.06AD01737 0.33 ±0.01 AD01734 0.53 ±0.06 AD02526 0.88 ±0.06AD02220 0.33 ±0.04 AD01713 0.53 ±0.04 AD02234 0.88 ±0.14AD02302 0.33 ±0.00 AD02285 0.53 ±0.03 AD02518 0.89 ±0.05AD02097 0.33 ±0.00 AD02102 0.53 ±0.07 AD02218 0.89 ± 0.04AD02328 0.33 ±0.02 AD02303 0.53 ±0.03 AD02515 0.89 ±0.03AD02221 0.33 ±0.01 AD02212 0.53 ±0.01 AD02536 0.89 ±0.11AD02421 0.33 ±0.02 AD02139 0.53 ±0.03 AD02537 0.89 ± 0.04AD02420 0.33 ±0.03 AD02230 0.54 ±0.08 AD02465 0.89 ±0.07AD02347 0.33 ±0.04 AD02103 0.54 ± 0.04 AD02196 0.90 ±0.03AD02134 0.34 ±0.01 AD02191 0.54 ±0.03 AD02253 0.90 ±0.05AD02078 0.34 ±0.03 AD02429 0.54 ±0.02 AD02484 0.90 ±0.09AD02151 0.34 ±0.02 AD01716 0.54 ±0.09 AD02467 0.91 ±0.00AD02238 0.34 ±0.03 AD02360 0.54 ±0.02 AD02538 0.91 ±0.10AD02168 0.34 ±0.00 AD01762 0.54 ±0.01 AD02478 0.91 ±0.01AD02096 0.34 ±0.03 AD01735 0.55 ±0.07 AD02479 0.92 ±0.05AD01758 0.34 ±0.05 AD02248 0.55 ±0.05 AD02540 0.92 ±0.08AD02077 0.34 ±0.02 AD02193 0.55 ±0.01 AD02524 0.92 ±0.03AD02345 0.34 ±0.02 AD02119 0.55 ±0.01 AD02466 0.92 ±0.05AD02384 0.34 ±0.02 AD02287 0.55 ±0.02 AD02520 0.92 ±0.06AD02094 0.34 ±0.01 AD02357 0.56 ±0.01 AD02498 0.92 ±0.06AD02419 0.34 ± 0.04 AD01708 0.57 ±0.06 AD02472 0.92 ±0.05AD02401 0.34 ±0.02 AD02247 0.57 ±0.06 AD02106 0.93 ±0.08AD02402 0.34 ±0.03 AD02430 0.58 ±0.07 AD02486 0.93 ±0.02AD01712 0.34 ± 0.04 AD02339 0.58 ±0.03 AD02236 0.93 ± 0.04AD02276 0.34 ±0.01 AD02321 0.59 ±0.03 AD02543 0.93 ±0.12AD02150 0.34 ±0.02 AD02269 0.59 ±0.02 AD02517 0.94 ± 0.05AD02166 0.34 ±0.03 AD02210 0.59 ±0.04 AD02505 0.94 ±0.10AD02351 0.34 ±0.02 AD02211 0.60 ±0.02 AD02464 0.94 ± 0.06AD02241 0.35 ±0.04 AD02091 0.60 ±0.03 AD02499 0.94 ±0.16AD02282 0.35 ±0.01 AD02120 0.60 ±0.07 AD02500 0.94 ± 0.05AD02130 0.35 ±0.04 AD02229 0.60 ±0.03 AD02544 0.95 ±0.07AD01751 0.35 ±0.03 AD01727 0.60 ±0.02 AD02541 0.95 ±0.15AD02356 0.35 ±0.03 AD01730 0.60 ±0.02 AD02509 0.95 ±0.09AD02405 0.35 ±0.04 AD02190 0.60 ±0.07 AD02508 0.95 ±0.10AD02129 0.35 ±0.01 AD02411 0.60 ±0.06 AD02510 0.95 ±0.03AD02355 0.35 ±0.01 AD02322 0.61 ±0.03 AD02521 0.96 ±0.16AD02423 0.35 ±0.06 AD02433 0.61 ±0.02 AD02507 0.96 ±0.03AD02316 0.35 ±0.02 AD01761 0.62 ±0.05 AD02105 0.96 ±0.09AD02331 0.35 ±0.02 AD01720 0.62 ±0.02 AD02495 0.96 ±0.05AD02335 0.35 ±0.01 AD02228 0.62 ±0.06 AD02504 0.97 ± 0.04AD02187 0.35 ±0.03 AD02393 0.62 ±0.03 AD02493 0.97 ±0.06AD02314 0.36 ±0.04 AD02359 0.62 ±0.03 AD02542 0.97 ±0.06AD02300 0.36 ±0.03 AD02323 0.62 ±0.05 AD02503 0.98 ±0.05AD02387 0.36 ±0.06 AD02118 0.63 ±0.05 AD02107 0.98 ±0.05AD02337 0.36 ±0.04 AD02286 0.63 ± 0.04 AD02477 0.98 ±0.06AD01729 0.36 ±0.01 AD02087 0.63 ± 0.04 AD02501 0.98 ±0.07AD02283 0.36 ±0.02 AD01715 0.63 ±0.06 AD02497 0.98 ±0.05AD02185 0.36 ±0.01 AD02192 0.63 ±0.02 AD02494 0.98 ±0.13AD02167 0.36 ±0.01 AD02431 0.64 ± 0.06 AD02475 1.00 ±0.07AD02076 0.36 ±0.04 AD02340 0.64 ± 0.03 AD02514 1.00 ±0.00AD02418 0.36 ±0.01 AD02432 0.64 ± 0.02 AD02474 1.00 ±0.03AD02422 0.36 ±0.03 AD02089 0.65 ±0.07 AD02502 1.01 ±0.01AD02111 0.36 ±0.02 AD02267 0.65 ±0.11 AD02522 1.01 ±0.04AD02079 0.37 ±0.02 AD02246 0.65 ±0.07 AD02476 1.01 ±0.09AD01754 0.37 ±0.04 AD02325 0.65 ±0.03 AD02513 1.02 ±0.03AD02334 0.37 ±0.02 AD02343 0.66 ±0.05 AD02109 1.02 ±0.06AD02280 0.37 ± 0.05 AD02375 0.66 ± 0.04 AD02252 1.02 ± 0.08AD02113 0.37 ± 0.03 AD02288 0.66 ± 0.06 AD02496 1.04 ± 0.05AD02389 0.37 ± 0.03 AD02088 0.66 ± 0.01 AD02473 1.05 ± 0.04AD02223 0.37 ± 0.04 AD02413 0.66 ± 0.03 AD02506 1.05 ± 0.05AD02184 0.37 ± 0.02 AD02377 0.67 ± 0.05 AD01742 1.07 ± 0.24AD02153 0.37 ± 0.02 AD02528 0.67 ± 0.04 AD02110 1.08 ± 0.07AD02165 0.37 ± 0.02 AD02434 0.67 ± 0.05 AD02512 1.09 ± 0.17AD02207 0.37 ± 0.01 AD02304 0.67 ± 0.02 AD02108 1.11 ± 0.04Example 3. LPA RNAi agent EC 50 determination. Ten-point EC50 curves were generated using the same cells and transfection conditions, with LPA RNAi agent concentrations ranging from 150fM-3nM. EC50 were determined using GraphPad Prism software (Table 6).Table 6. EC50 values (nM) determined in vitro for the indicated LPA RNAi agents.Duplex ID# EC50 (nM) Duplex ID# EC50 (nM)AD00575 0.073 AD00635 0.577AD00576 0.038 ADO 1070 0.6388AD00578 0.112 ADO 1072 0.1068AD00579 0.083 ADO 1073 0.1154AD00621 0.100 ADO 1074 0.2903Example 4. In vitro analysis of Structure-Activity Relationship (SAR) designed LPA RNAi agents. LPA RNAi agent SAR sets (364 sequences based on AD01532 and 351 sequences based on AD01533) were synthesized and screened for efficacy in vitro. For screening purposes, 2756 bp of the human LPA cDNA sequence from KTV-3 to KTV-9 (accession # NM_005577.1) was synthesized and cloned (GeneWiz, South Plainfield, NJ) into a commercially-available, reporter-based screening plasmid, psiCHECK2 (Promega, Madison, WI) which generated a Renilla luciferase / LPA fusion mRNA. For LPA RNAi agent efficacy in the human background, HuH7 cells, a human hepatocellular carcinoma line, were plated at -7500 cells per well in 96-well format. Each of the LPA RNAi agents was co-transfected at two concentrations (InM and 0. InM, or lOnM and InM) with 25 ng LPA-psiCHECK2 plasmid DNA per well and 0.2μί LipoFectamine 2000 per well. Gene knockdown was determined by measuring Renilla luciferase levels normalized to the levels of constitutively-expressed firefly luciferase, also present on the psiCHECK2 plasmid, using the Dual Luciferase Reporter Assay (Promega, Madison, WI) (Tables 7A and 7B).Table 7A. Efficacy screen results of LPA RNAi agents in vitro, as determined by dual-luciferase reporter assay.Relative Riuc-LPA Relative Riuc-LPADuplex Duplexexpression expression ID No. ID No.I nM 0.1 nM I nM 0.1 nMSD0001 0.570 0.907 SD0117 0.946 1.021SD0002 0.873 1.061 SD0118 0.879 0.977SD0003 0.955 1.020 SD0119 0.963 1.016SD0004 0.845 1.007 SD0120 0.967 0.948SD0005 0.603 0.891 SD0121 0.651 0.897SD0006 0.551 0.780 SD0122 1.085 1.111SD0007 0.510 0.797 SD0123 1.153 1.052SD0008 0.544 0.892 SD0124 0.955 0.936SD0009 0.564 0.878 SD0125 0.928 0.928SD0010 0.542 1.051 SD0126 1.033 0.933SD0011 0.513 0.873 SD0127 0.637 0.717SD0012 0.533 0.963 SD0128 0.630 0.653SD0013 0.541 0.979 SD0129 1.052 1.192SD0014 0.551 0.987 SD0130 1.025 1.107SD0015 0.488 0.951 SD0131 1.280 1.059SD0016 0.588 0.868 SD0132 1.094 1.024SD0017 1.023 1.005 SD0133 1.113 1.031SD0018 0.866 0.965 SD0134 0.928 0.991SD0019 0.792 1.005 SD0135 0.804 1.023SD0020 0.633 0.860 SD0136 1.028 1.104SD0021 0.572 0.797 SD0137 0.902 1.149SD0022 0.610 0.874 SD0138 0.942 1.015SD0023 0.550 0.836 SD0139 0.984 1.068SD0024 0.597 0.859 SD0140 0.953 1.091SD0025 0.587 0.899 SD0141 0.925 1.022SD0026 0.570 0.898 SD0142 0.906 0.994SD0027 0.580 0.825 SD0143 0.898 0.990SD0028 0.612 0.885 SD0144 0.858 0.972SD0029 0.528 0.866 SD0145 0.917 0.947SD0030 0.657 0.825 SD0146 0.850 0.906SD0031 0.560 0.914 SD0147 0.933 0.995SD0032 0.664 0.976 SD0148 0.856 0.994SD0033 0.787 1.035 SD0149 0.882 0.985SD0034 0.739 1.002 SD0150 0.810 1.002SD0035 0.658 0.949 SD0151 0.813 0.909SD0036 0.554 0.896 SD0152 0.963 1.031SD0037 0.557 0.873 SD0153 1.058 0.936SD0038 0.528 0.854 SD0154 0.968 0.944SD0039 0.511 0.847 SD0155 0.969 0.940SD0040 0.554 0.976 SD0156 0.933 0.807SD0041 0.559 0.823 SD0157 0.906 0.913SD0042 0.496 0.825 SD0158 0.926 0.964SD0043 0.563 0.851 SD0159 0.805 0.850SD0044 0.476 0.861 SD0160 0.895 0.965SD0045 0.542 0.841 SD0161 0.865 1.006SD0046 0.651 0.980 SD0162 0.935 1.029SD0047 0.967 0.995 SD0163 0.928 0.985SD0048 0.694 0.936 SD0164 0.920 0.957SD0049 0.960 0.946 SD0165 1.039 1.110SD0050 0.692 0.971 SD0166 1.061 1.023SD0051 0.611 0.905 SD0167 1.020 0.982SD0052 0.657 0.849 SD0168 1.053 0.989SD0053 0.642 0.848 SD0169 1.002 1.018SD0054 0.598 0.852 SD0170 1.078 0.982SD0055 0.494 0.828 SD0171 0.838 0.923SD0056 0.524 0.885 SD0172 1.025 0.934SD0057 0.582 0.816 SD0173 0.864 0.963SD0058 0.597 0.866 SD0174 1.020 1.043SD0059 0.560 0.905 SD0175 1.128 1.046SD0060 0.594 0.849 SD0176 1.009 1.110SD0061 0.571 1.058 SD0177 0.735 0.975SD0062 0.871 1.157 SD0178 0.824 1.074SD0063 0.969 1.138 SD0179 0.690 0.895SD0064 0.555 1.019 SD0180 0.572 0.914SD0065 0.671 0.953 SD0181 0.904 1.028SD0066 0.561 0.951 SD0182 1.176 1.093SD0067 0.612 0.904 SD0183 1.247 1.090SD0068 0.573 0.938 SD0184 1.097 0.974SD0069 0.574 0.975 SD0185 1.045 0.985SD0070 0.606 1.030 SD0186 0.940 0.943SD0071 0.494 0.959 SD0187 0.883 0.994SD0072 0.557 0.892 SD0188 ND NDSD0073 0.593 0.984 SD0189 0.872 0.977SD0074 0.544 0.894 SD0190 0.861 1.166SD0075 0.552 0.937 SD0191 0.779 1.044SD0076 0.513 1.058 SD0192 0.796 1.116SD0077 0.930 1.071 SD0193 0.975 1.112SD0078 0.984 1.006 SD0194 0.876 1.058SD0079 0.853 1.031 SD0195 0.747 0.970SD0080 0.577 0.942 SD0196 0.787 1.086SD0081 0.595 1.044 SD0197 1.276 1.127SD0082 0.652 0.962 SD0198 1.144 1.140SD0083 0.583 0.928 SD0199 1.136 1.101SD0084 0.540 1.049 SD0200 0.814 0.911SD0085 0.523 0.961 SD0201 0.733 0.915SD0086 0.536 0.956 SD0202 0.576 0.933SD0087 0.586 0.987 SD0203 0.593 0.824SD0088 0.563 0.892 SD0204 0.882 1.038SD0089 0.555 0.947 SD0205 0.681 1.012SD0090 0.599 0.928 SD0206 0.600 0.927SD0091 0.665 0.854 SD0207 0.738 0.974SD0092 1.002 0.917 SD0208 0.638 0.883SD0093 1.047 0.880 SD0209 0.641 0.878SD0094 0.867 0.911 SD0210 0.544 0.886SD0095 0.919 0.868 SD0211 0.702 0.920SD0096 0.666 0.887 SD0212 0.704 0.854SD0097 0.673 0.737 SD0213 0.655 0.887SD0098 0.567 0.809 SD0214 0.629 0.860SD0099 0.604 0.909 SD0215 0.598 0.850SD0100 0.557 0.880 SD0216 0.611 0.782SD0101 0.545 0.806 SD0217 0.710 0.806SD0102 0.728 0.900 SD0218 0.738 0.758SD0103 0.719 0.928 SD0219 0.664 0.809SD0104 0.766 0.955 SD0220 1.133 0.891SD0105 0.965 0.927 SD0221 0.940 0.914SD0106 1.161 1.006 SD0222 0.853 0.882SD0107 1.048 0.966 SD0223 0.691 0.889SD0108 1.066 0.985 SD0224 0.997 1.033SD0109 1.111 0.917 SD0225 0.954 0.998SD0110 1.152 0.954 SD0226 1.202 0.997SD0111 1.045 0.944 SD0227 0.948 1.017SD0112 1.089 1.019 SD0228 0.786 0.947SD0113 0.949 0.935 SD0229 0.620 0.830SD0114 0.875 1.033 SD0230 0.840 0.972SD0115 1.022 1.077 SD0231 0.904 0.890SD0116 0.947 1.028Table 7B. Efficacy screen results of LPA RNAi agents in vitro, as determined by dual- luciferase reporter assay.SD0241 0.770 0.821 SD0483 0.805 0.986SD0242 0.626 0.719 SD0484 0.920 1.104SD0243 0.759 0.848 SD0485 0.510 0.524SD0244 0.798 0.953 SD0486 0.626 0.598SD0245 0.764 0.821 SD0487 0.628 0.640SD0246 0.812 0.690 SD0488 0.597 0.637SD0247 0.786 0.844 SD0489 0.482 0.486SD0248 1.011 1.167 SD0490 0.685 0.664SD0249 1.118 1.189 SD0491 0.650 0.662SD0250 1.021 1.239 SD0492 0.454 0.490SD0251 1.041 1.151 SD0493 1.006 1.040SD0252 1.070 1.124 SD0494 0.933 1.024SD0253 1.044 1.131 SD0495 0.927 1.016SD0254 0.861 0.948 SD0496 0.921 1.004SD0255 0.751 0.829 SD0497 0.690 0.846SD0256 0.931 1.037 SD0498 0.970 0.913SD0257 1.024 1.037 SD0499 0.448 0.399SD0258 0.935 1.030 SD0500 0.614 0.485SD0259 1.089 1.081 SD0501 0.609 0.521SD0260 0.955 1.008 SD0502 0.626 0.526SD0261 0.923 0.980 SD0503 0.493 0.410SD0262 0.908 1.107 SD0504 0.727 0.551SD0263 1.060 1.449 SD0505 0.688 0.541SD0264 1.041 1.419 SD0506 0.319 0.338SD0265 1.065 1.373 SD0507 0.927 0.897SD0266 0.950 1.376 SD0508 0.929 0.972SD0267 0.963 1.214 SD0509 0.853 0.925SD0268 1.023 1.299 SD0510 0.755 0.935SD0269 0.908 1.066 SD0511 0.480 0.559SD0270 0.963 1.081 SD0512 0.834 0.854SD0271 1.088 1.189 SD0513 0.440 0.323SD0272 0.966 1.135 SD0514 0.415 0.414SD0273 0.953 1.192 SD0515 0.442 0.343SD0274 1.049 1.217 SD0516 0.422 0.341SD0275 1.006 1.206 SD0517 0.346 0.320SD0276 0.969 1.064 SD0518 0.488 0.420SD0277 0.686 0.796 SD0519 0.435 0.390SD0278 0.985 1.305 SD0520 0.819 0.737SD0279 0.985 1.301 SD0521 1.058 0.903SD0280 0.978 1.237 SD0522 1.088 0.933SD0281 1.038 1.230 SD0523 1.075 0.948SD0282 0.933 1.191 SD0524 1.067 0.900SD0283 0.930 1.152 SD0525 0.917 0.858SD0284 0.907 1.117 SD0526 1.126 1.055SD0285 0.625 0.870 SD0527 0.832 0.776SD0286 0.984 1.056 SD0528 0.980 0.886SD0287 0.906 0.965 SD0529 1.059 0.821SD0288 1.052 1.123 SD0530 0.934 0.844SD0289 0.997 1.215 SD0531 0.832 0.883SD0290 0.892 1.197 SD0532 0.936 0.868SD0291 0.907 1.065 SD0533 0.900 0.946SD0292 0.689 0.862 SD0534 1.012 0.984SD0293 0.955 1.190 SD0535 1.041 1.095SD0294 1.095 1.157 SD0536 1.113 1.097SD0295 0.851 1.004 SD0537 1.125 0.957SD0296 1.018 1.106 SD0538 1.059 1.162SD0297 0.737 0.760 SD0539 0.901 0.963SD0298 0.790 0.828 SD0540 0.900 0.924SD0299 0.721 0.713 SD0541 1.033 0.911SD0300 0.796 0.869 SD0542 0.958 0.906SD0301 0.781 0.841 SD0543 0.870 0.816SD0302 0.621 0.720 SD0544 1.100 0.853SD0303 0.684 0.852 SD0545 0.881 0.794SD0304 0.774 0.842 SD0546 0.897 0.813SD0305 0.778 0.799 SD0547 1.005 0.785SD0306 0.718 0.793 SD0548 0.972 0.866SD0307 0.982 0.883 SD0549 1.019 1.121SD0308 1.297 1.193 SD0550 0.986 1.015SD0309 1.123 1.208 SD0551 0.966 1.033SD0310 0.961 1.073 SD0552 0.893 1.028SD0311 1.168 1.019 SD0553 0.976 0.998SD0312 0.923 0.824 SD0554 0.938 0.935SD0313 0.883 0.871 SD0555 0.886 0.875SD0314 0.670 0.650 SD0556 1.181 1.142SD0315 0.988 0.958 SD0557 1.016 0.999SD0316 0.908 0.880 SD0558 1.026 0.968SD0317 0.754 0.850 SD0559 0.928 0.844SD0318 0.963 0.944 SD0560 0.990 0.805SD0319 0.945 0.862 SD0561 0.836 0.791SD0320 0.961 0.875 SD0562 1.021 0.772SD0321 0.841 0.797 SD0563 0.886 0.946SD0322 0.546 0.521 SD0564 1.194 1.254SD0323 0.581 0.895 SD0565 1.010 1.033SD0324 0.692 0.900 SD0566 1.110 0.993SD0325 0.506 0.796 SD0567 0.995 0.895SD0326 0.634 0.709 SD0568 0.964 0.901SD0327 0.522 0.592 SD0569 0.853 0.876SD0328 0.602 0.632 SD0570 0.832 0.860SD0329 0.504 0.615 SD0571 1.036 0.959SD0330 0.445 0.601 SD0572 1.013 0.902SD0331 0.457 0.579 SD0573 0.948 0.793SD0332 0.500 0.601 SD0574 0.868 0.812SD0333 0.447 0.618 SD0575 0.946 0.712SD0334 0.490 0.528 SD0576 0.922 0.774SD0335 0.421 0.555 SD0577 0.824 0.800SD0336 0.488 0.533 SD0578 0.997 0.950SD0337 1.714 0.978 SD0579 1.048 1.143SD0338 1.262 1.350 SD0580 1.071 0.935SD0339 1.259 1.357 SD0581 0.987 0.869SD0340 0.996 1.277 SD0582 0.946 0.816SD0341 1.190 1.183 SD0583 0.932 0.789SD0342 0.818 0.923 SD0584 1.062 0.866SD0343 0.803 0.855 SD0585 1.155 0.891SD0344 0.708 0.883 SD0586 0.960 0.819SD0345 1.132 0.901 SD0587 0.934 0.832SD0346 0.847 0.890 SD0588 1.033 0.781SD0347 0.659 0.780 SD0589 0.972 0.798SD0348 0.730 0.945 SD0590 0.925 0.704SD0349 0.825 0.886 SD0591 1.061 0.915SD0350 0.826 0.897 SD0592 1.129 0.996SD0351 0.730 0.842 SD0593 0.856 0.895SD0352 0.297 0.276 SD0594 0.840 0.956SD0353 0.773 0.746 SD0595 0.882 0.857SD0354 0.663 0.722 SD0596 0.856 0.896SD0355 0.620 0.626 SD0597 0.869 0.697SD0356 0.546 0.599 SD0598 0.878 0.700SD0357 0.298 0.411 SD0599 0.808 0.857SD0358 0.313 0.318 SD0600 0.856 0.823SD0359 0.273 0.282 SD0601 0.742 0.713SD0360 0.256 0.257 SD0602 0.740 0.846SD0361 0.269 0.276 SD0603 0.808 0.816SD0362 0.270 0.276 SD0604 0.561 0.527SD0363 0.350 0.272 SD0605 0.711 0.880SD0364 0.227 0.243 SD0606 0.852 0.922SD0365 0.228 0.233 SD0607 0.695 0.887SD0366 0.264 0.241 SD0608 0.635 0.917SD0367 0.262 0.252 SD0609 0.655 0.874SD0368 0.571 0.597 SD0610 0.596 0.765SD0369 0.539 0.531 SD0611 0.482 0.508SD0370 0.521 0.545 SD0612 0.629 0.578SD0371 0.302 0.319 SD0613 0.616 0.503SD0372 0.353 0.335 SD0614 0.716 0.682SD0373 0.279 0.255 SD0615 0.570 0.491SD0374 0.266 0.194 SD0616 0.671 0.668SD0375 0.246 0.238 SD0617 0.713 0.721SD0376 0.258 0.238 SD0618 0.819 0.862SD0377 0.246 0.226 SD0619 0.925 0.968SD0378 0.237 0.226 SD0620 0.859 0.978SD0379 0.262 0.226 SD0621 0.923 1.075SD0380 0.247 0.240 SD0622 0.900 0.988SD0381 0.639 0.657 SD0623 0.908 0.969SD0382 0.267 0.517 SD0624 0.775 0.889SD0383 0.473 0.547 SD0625 0.827 0.850SD0384 0.456 0.563 SD0626 0.832 0.796SD0385 0.264 0.393 SD0627 0.916 0.796SD0386 0.329 0.325 SD0628 0.863 0.898SD0387 0.186 0.231 SD0629 0.915 0.869SD0388 0.217 0.248 SD0630 0.893 0.856SD0389 0.230 0.275 SD0631 0.940 0.848SD0390 0.210 0.270 SD0632 0.878 0.911SD0391 0.247 0.224 SD0633 0.934 1.074SD0392 0.257 0.236 SD0634 0.915 1.019SD0393 0.252 0.253 SD0635 0.911 0.912SD0394 0.267 0.251 SD0636 0.852 0.911SD0395 0.594 0.675 SD0637 0.997 0.965SD0396 0.511 0.678 SD0638 0.983 0.935SD0397 0.457 0.618 SD0639 0.806 0.823SD0398 0.516 0.601 SD0640 0.838 0.846SD0399 0.261 0.389 SD0641 0.906 0.861SD0400 0.327 0.300 SD0642 0.740 0.836SD0401 0.230 0.250 SD0643 0.739 0.725SD0402 0.231 0.260 SD0644 0.780 0.762SD0403 0.237 0.221 SD0645 0.739 0.819SD0404 0.258 0.243 SD0646 0.734 0.798SD0405 0.253 0.246 SD0647 0.789 0.913SD0406 0.228 0.230 SD0648 0.707 0.946SD0407 0.228 0.215 SD0649 0.943 1.077SD0408 0.247 0.255 SD0650 0.729 0.872SD0409 0.565 0.667 SD0651 0.666 0.879SD0410 0.796 0.863 SD0652 0.704 0.882SD0411 0.633 0.646 SD0653 0.661 0.726SD0412 0.613 0.699 SD0654 0.751 0.881SD0413 0.294 0.439 SD0655 0.727 0.822SD0414 0.416 0.310 SD0656 0.746 0.839SD0415 0.275 0.238 SD0657 0.849 0.842SD0416 0.241 0.290 SD0658 0.835 0.796SD0417 0.257 0.284 SD0659 0.972 0.830SD0418 0.267 0.306 SD0660 0.772 0.672SD0419 0.249 0.229 SD0661 0.883 0.918SD0420 0.243 0.240 SD0662 0.934 0.952SD0421 0.250 0.241 SD0663 0.974 0.891SD0422 0.230 0.237 SD0664 0.939 0.936SD0423 0.555 0.684 SD0665 1.116 0.919SD0424 0.614 0.682 SD0666 0.924 0.954SD0425 0.592 0.733 SD0667 0.780 0.744SD0426 0.604 0.699 SD0668 0.795 0.726SD0427 0.281 0.449 SD0669 0.819 0.754SD0428 0.301 0.330 SD0670 0.856 0.830SD0429 0.230 0.261 SD0671 0.844 0.758SD0430 0.241 0.273 SD0672 0.978 0.952SD0431 0.232 0.255 SD0673 0.860 0.845SD0432 0.247 0.288 SD0674 0.526 0.566SD0433 0.238 0.280 SD0675 0.661 0.961SD0434 0.224 0.293 SD0676 0.690 0.916SD0435 0.249 0.240 SD0677 0.672 0.939SD0436 0.428 0.445 SD0678 0.821 0.973SD0437 0.542 0.829 SD0679 0.943 0.952SD0438 1.106 1.048 SD0680 1.018 0.991SD0439 0.930 1.096 SD0681 0.561 0.580SD0440 1.033 1.023 SD0682 0.777 0.688SD0441 0.630 0.657 SD0683 0.654 0.639SD0442 0.912 0.913 SD0684 0.691 0.622SD0443 0.392 0.375 SD0685 0.518 0.555SD0444 0.552 0.441 SD0686 0.661 0.738SD0445 0.561 0.514 SD0687 0.722 0.644SD0446 0.550 0.442 SD0688 0.416 0.385SD0447 0.415 0.362 SD0689 0.571 0.870SD0448 0.566 0.503 SD0690 0.697 0.946SD0449 0.579 0.475 SD0691 0.616 0.840SD0450 0.463 0.424 SD0692 0.644 0.850SD0451 0.925 0.929 SD0693 0.781 0.733SD0452 0.963 0.939 SD0694 1.022 0.902SD0453 0.967 0.952 SD0695 0.458 0.448SD0454 0.948 0.883 SD0696 0.500 0.455SD0455 0.746 0.645 SD0697 0.454 0.444SD0456 0.840 0.860 SD0698 0.497 0.467SD0457 0.473 0.402 SD0699 0.369 0.416SD0458 0.555 0.514 SD0700 0.622 0.552SD0459 0.566 0.472 SD0701 0.542 0.528SD0460 0.609 0.478 SD0702 0.301 0.423SD0461 0.408 0.355 SD0703 0.376 0.367SD0462 0.630 0.532 SD0704 0.373 0.334SD0463 0.631 0.497 SD0705 0.315 0.347SD0464 0.549 0.510 SD0706 0.339 0.351SD0465 0.966 0.809 SD0707 0.245 0.263SD0466 0.910 0.841 SD0708 0.572 0.703SD0467 0.904 0.878 SD0709 0.313 0.484SD0468 0.999 1.009 SD0710 0.297 0.431SD0469 0.734 0.760 SD0711 0.284 0.397SD0470 0.925 0.806 SD0712 0.300 0.471SD0471 0.559 0.482 SD0713 0.297 0.417SD0472 0.572 0.543 SD0714 0.300 0.438SD0473 0.652 0.594 SD0715 0.280 0.430Example 5. In vivo analysis of RNAi agent efficacy in transiently transgenic and transgenic mice.A) Administration and sample collection. In order to evaluate the efficacy of LPA RNAi agents in vivo, transiently transgenic mice were used. At least 30 days prior to cholesterol-conjugated LPA RNAi agent administration, wild-type mice were injected by hydrodynamic tail vein injection with a plasmid containing the SEAP gene under the control of the mouse albumin promoter. LPA gene target sequences were cloned in the 3' UTR of the plasmid. These mice are noted as SEAP-LPA HTV mice. Cholesterol-conjugated LPA RNAi agents were administered to mice using MLP delivery polymer on day 1 (WO 2012 / 083185, incorporated herein by reference; melittin was synthesized and modified with CDM-NAG to yield MLP delivery polymer as described therein). Each mouse received an intravenous (IV) injection into the tail vein of 200-250 solution containing a dose of LPA RNAi agent + MLP delivery polymer (1 : 1 w / w RNAi agent: MLP delivery polymer in most cases). In some experiments, LPA RNAi agents were directly conjugated to a delivery polymer. Polymer conjugated LPA RNAi agents were similarly injected into tail vein. The indicated LPA RNAi agent (Table 8B) was conjugated to a polyacrylate polymer, ARF1164-106A-5, having 54.4% ethoxy ethyl amino aery late (EEAA) amine monomers and 45.6% propyl aery late propyl monomers (MW 41962 g / mol, polymer synthesized as described in WO 2013 / 158141) and masked with 3 * ACit-NAG, 6x ACit-PEG (polymer masked as described in WO 2012 / 092373 and PCT / US 16 / 34512). Control serum (pre-treatment) samples were taken from the mice pre- injection on days -4, or -1. Post injection serum samples were taken from the mice days 4, 8, 15, 22, 29, 36, and 43. For some mice, samples were collected on day 3 or day 5, instead of day 4.In additional experiments, LPA RNAi agents were evaluated in vivo using transiently transgenic mice expressing full length LPA. At least 30 days prior to cholesterol-targeted LPA RNAi agent administration, immune compromised (Nod.scid) mice were injected by hydrodynamic tail vein injection with a mini circle containing the LPA cDNA under the control of the mouse albumin promoter. These mice are noted as LPA mc HTV mice. Either cholesterol-targeted or NAG (also termed GalNAc)-conjugated LPA RNAi agents wereadministered to mice on day 1. For Cholesterol-targeted RNAi agents, each mouse received an intravenous (IV) injection into the tail vein of 200-250 solution containing a dose of RNAi agent + MLP delivery polymer (1 : 1 w / w RNAi agent:MLP delivery polymer). For NAG conjugated LPA RNAi agents, mice received a subcutaneous (SC) injection into the loose skin on the back between the shoulders of 300 μΐ solution containing a dose of the RNAi agent in buffered saline. For some sample, the LPA RNAi agent was administered either with or without MLP delivery peptide. RNAi agents delivered with MLP delivery peptide were administered by intravenous (IV) injection into the tail vein of 200-250 solution containing a dose of RNAi agent + MLP delivery polymer (1 :2 w / w RNAi agent: MLP delivery polymer in most cases). Control serum (pre-treatment) samples were taken from the mice pre-injection on days -4, or -1. Post injection serum samples were taken from the mice days 4, 8, 15, 22, 29, 36, and 43. For some mice, samples were collected on day 3 or day 5, instead of day 4.In further experiments, LPA RNAi agents were administered to apo(a) and Lp(a) transgenic mice (Frazer KA et al 1995, Nature Genetics 9:424-431). This mouse expresses human apo(a) from a YAC containing the full LPA gene (encoding apo(a) protein) with additional sequences both 5' and 3'. Lp(a) mice were bred by crossing apo(a) YAC-containing mice to human apoB- 100 expressing mice (Callow MJ et al 1994, PNAS 91 :2130-2134). Cholesterol-targeted RNAi agents and NAG conjugated RNAi agents were administered as described above. Control serum (pre-treatment) samples were taken from the mice pre-injection on day -1. Post inj ection serum samples were taken from the mice days 4, 8, 15, 22, 29, 36, 43, 50, 57 and 64.B) LPA expression knockdown analyses. For SEAP-LPA HTV mice, SEAP protein levels in serum were monitored by assaying serum from the mice using Phospha-Light™, a chemiluminescent reporter gene assay system (Life Technologies). For normalization, SEAP level for each animal at a given time point was divided by the pre-treatment level of expression in that animal to determine the ratio of expression "normalized to pre-treatment". Expression at a specific time point was then averaged amongst individuals within the group. For LPA mc HTV mice and transgenic mice, human apo(a) protein levels in serum were monitored by assaying serum from mice using an ELISA for apo(a) (Abeam). For normalization, apo(a) level for each animal at a time point was divided by the pre-treatment level of expression in that animal (in this case at day 1) to determine the ratio of expression "normalized to day 1 ". Expression at a specific time point was then normalized to the salinecontrol group by dividing the "normalized to day 1" ratio for an individual animal by the mean "normalized to day 1" ratio of all mice in the saline control group. This resulted in expression for each time point normalized to that in the control group. Lp(a) levels were determined on a Cobas Integra 400 (Roche Diagnostics) according to the manufacturer's recommendations. For normalization, apo(a) level for each animal at a time point was divided by the pre-treatment level of expression in that animal (in this case at day 1) to determine the ratio of expression "normalized to day 1 ". Expression at a specific time point was then normalized to the saline control group by dividing the "normalized to day 1" ratio for an individual animal by the mean "normalized to day 1 " ratio of all mice in the saline control group. This resulted in expression for each time point normalized to that in the control group.Table 8A. Relative LPA levels in mouse following intravenous administration of cholesterol- conjugated LP A RNAi agents + MLP delivery polymer.LPA RNAi MLPDuplex ID Relative LPAagent (mg / kg) (mg / kg)ADO 1184 2 2 0.20ADO 1187 2 2 0.18AD01190 2 2 0.17AD01193 2 2 0.22AD01196 2 2 0.02AD01197 2 2 0.065AD01198 2 2 0.051AD01199 2 2 0.070ADO 1200 2 2 0.094ADO 1201 2 2 0.029ADO 1202 8 8 0.14ADO 1205 2 2 0.21ADO 1206 2 2 0.37ADO 1207 2 2 0.19ADO 1208 2 2 0.35ADO 1209 2 2 0.16AD01210 2 2 0.18AD01211 2 2 0.38AD01212 2 2 0.26AD01213 2 2 0.30AD02662 2 2 0.0010AD02663 2 2 0.010AD02664 2 2 0.0010Table 8B. Relative LPA levels in mouse following intravenous administration of delivery polymer-conjugated LPA RNAi agents.Duplex LPA RNAi agentRelative LPAID (mg / kg)ADO 1462 0.5 0.38ADO 1463 0.5 0.41ADO 1466 0.5 0.33ADO 1467 0.5 0.46Table 8C. Relative LPA levels in mouse following subcutaneous administration of NAG- conjugated LPA RNAi agents.AD02001 10 0.021 AD03071 3 0.043AD02003 10 0.050 AD03072 3 0.031AD02004 10 0.050 AD03073 3 0.019AD02005 10 0.040 AD03074 3 0.016AD02006 10 0.11 AD03075 3 0.062AD02007 10 0.21 AD03114 1 0.33AD02008 10 0.080 AD03115 1 0.30AD02009 10 0.090 AD03116 1 0.21AD02010 10 0.16 AD03117 1 0.14AD02011 10 0.070 AD03118 1 0.30AD02435 10 0.038 AD03119 1 0.10AD02436 10 0.027 AD03120 1 0.080AD02437 10 0.052 AD03121 1 0.14AD02438 10 0.063 AD03122 1 0.14AD02439 10 0.073 AD03123 1 0.34AD02440 10 0.13 AD03156 1 0.084AD02545 10 0.079 AD03157 1 0.016AD02546 10 0.045 AD03158 1 0.037AD02547 10 0.055 AD03159 1 0.63AD02548 10 0.13 AD03272 1 0.13AD02549 10 0.071 AD03273 1 0.20AD02550 10 0.039 AD03274 1 0.21AD02551 10 0.057 AD03275 1 0.15AD02552 10 0.033 AD03276 1 0.11AD02553 10 0.14 AD03277 1 0.13AD02554 10 0.14 AD03278 1 0.13AD02555 10 0.18 AD03279 1 0.21AD02556 10 0.10 AD03341 1 0.13AD02557 10 0.10 AD03421 1 0.29AD02558 10 0.071 AD03430 1 0.12AD02559 10 0.039 AD03432 1 0.16AD02560 10 0.058 AD03434 1 0.11AD02561 10 0.12 AD03436 1 0.21AD02609 3 0.59 AD03438 1 0.25AD02610 3 0.36 AD03440 1 0.21AD02611 3 0.35 AD03460 1 0.090AD02612 3 0.37 AD03462 1 0.40AD02613 3 0.24 AD03495 1 0.28AD02614 3 0.24 AD03536 1 0.14AD02615 3 0.14 AD03538 0.5 0.26AD02616 3 0.25 AD03539 0.5 0.21AD02617 3 0.090 AD03540 1 0.15AD02618 3 0.11 AD03541 0.5 0.10AD02619 3 0.020 AD03542 1 0.94AD02620 3 0.11 AD03547 1 0.19AD02682 10 0.11 AD03548 1 0.73AD02683 10 0.14 AD03549 1 0.29AD02684 10 0.79 AD03573 1 0.15AD02685 10 0.78 AD03574 1 0.15AD02686 10 0.19 AD03575 1 0.13AD02687 10 0.27 AD03576 1 0.18AD02696 3 0.050 AD03577 0.5 0.18AD02710 3 0.040 AD03578 0.5 0.38AD02711 3 0.040 AD03579 0.5 0.53AD02712 3 0.49 AD03603 1 0.083AD02713 3 0.040 AD03604 1 0.091AD02714 3 0.040 AD03605 1 0.19AD02715 3 0.070 AD03608 1 0.18AD02716 3 0.080 AD03609 1 0.16AD02717 3 0.12 AD03610 1 0.23AD02745 3 0.25 AD03611 1 0.40AD02746 3 0.22 AD03612 1 0.21AD02747 3 0.081 AD03629 1 0.11AD02748 3 0.17 AD03668 1 0.070AD02749 3 0.17 AD03705 0.5 0.11AD02750 3 0.066 AD03707 0.5 0.11AD02751 3 0.070 AD03720 0.5 0.14AD02752 3 0.044 AD03721 0.5 0.094AD02753 3 0.071 AD03722 0.5 0.19AD02819 1 0.022 AD03723 0.5 0.10AD02820 1 0.042 AD03765 1 0.080AD02821 1 0.038 AD03771 1 0.10AD02825 3 0.050 AD03801 1 0.15AD02826 3 0.050 AD03802 1 0.18AD02827 3 0.050 AD03844 1 0.17AD02828 3 0.050 AD03845 1 0.25AD02829 3 0.040 AD03848 1 0.10AD02830 3 0.040 AD03850 1 0.052AD02831 3 0.030 AD03851 1 0.076AD02832 3 0.030 AD03852 1 0.13AD02841 3 0.061 AD03853 1 0.081AD02842 3 0.16 AD03854 1 0.21AD02843 3 0.10 AD03856 1 0.32AD02844 3 0.11 AD03859 1 0.15AD02845 3 0.22 AD03862 1 0.12AD02846 3 0.16 AD03863 1 0.12AD02847 3 0.066 AD03921 1 0.17AD02848 3 0.055 AD03922 1 0.057AD02849 3 0.083 AD03923 1 0.066AD02850 3 0.042 AD03924 1 0.14AD02851 3 0.063 AD03931 1 0.34AD02852 3 0.11 AD03932 1 0.15AD02907 10 0.10 AD03933 1 0.34AD02908 10 0.11 AD03424 1 0.15AD02909 10 0.049 AD03425 1 0.21AD02910 10 0.23 AD03426 1 0.21AD02911 10 0.20 AD03427 1 0.19AD02912 10 0.10 AD03428 1 0.18AD02913 10 0.070 AD03760 0.5 0.21AD02914 10 0.050 AD03762 0.5 0.17AD02915 10 0.10 AD03763 0.5 0.21AD02916 10 0.090 AD03764 0.5 0.28AD02917 10 0.060 AD03766 0.5 0.065AD02918 10 0.020 AD03847 1 0.15AD02919 10 0.030 AD04110 1 0.070Example 6. In vivo Screening of LPA RNAi agents and time course of SEAP knockdown. Cholesterol-conjugated LPA RNAi agents were administered to transiently transgenic mice as described above. Each mouse received a single intravenous (IV) dose of 8 mg / kg of LPA RNAi agent with 8 mg / kg of MLP delivery polymer. SEAP protein levels in serum were monitored for up to 36 days. Knockdown levels and duration of response are shown in Table 9. A decrease in SEAP serum protein level of greater than 85% was obtained following administration of all LPA RNAi agents tested; with all but two LPA RNAi agents tested showing greater than 99.4% knockdown. AD01 196 and AD01 199 showed >95% knockdown at day 36.Example 7. In vivo screening LPA RNAi agents and time course of LPA knockdown at lower LPA RNAi agent doses. Cholesterol-conjugated LPA RNAi agents were administered to transiently transgenic mice as described above. Each mouse received a single intravenous (IV) dose of 2 mg / kg of LPA RNAi agent with 2 mg / kg of MLP delivery polymer. SEAP protein levels in serum were monitored for up to 43 days (Table 10).Example 8. In vivo testing of LPA RNAi agents in apo(a) Transgenic (Tg) mice. AD01196 was administered to mice as described above. Each mouse received a single intravenous (IV) dose of either 2 mg / kg of LPA RNAi agent with 2 mg / kg of MLP delivery polymer or saline. Human apo(a) (apo(a)) levels in serum were monitored for up to 64 days (Table 1 1). At day 15, animals in the saline group received a single IV dose of 2 mg / kg of a control mouse Factor VII (F7) RNAi agent with 2 mg / kg of MLP delivery polymer. At day 22, F7 levels were measured in all animals. F7 activity was knocked down by 99% 7 days post dosing, with no effect on serum apo(a) levels. AD01196 showed >3 loglO knockdown of apo(a) levels at nadir, with >80% knockdown observed after 3 weeks (Table 1 1).I l lTable 9. Serum SEAP protein levels in SEAP-LPA HTV mice following administration of 8 mg / kg chol-RNAi agents with 8 mg / kg MLP delivery peptide. SEAP levels were normalized to day -1 and saline control.Table 10. Serum SEAP protein levels in SEAP-LPA HTV mice following administration of 2 mg / kg chol-RNAi agents with 2 mg / kg MLP delivery peptide. SEAP levels were normalized to day -1 and saline control.Table 1 1. Serum apo(a) protein levels in apo(a) Tg mice following administration of 2 mg / kg cholesterol-conjugated LPA RNAi agent with 2 mg / kg MLP delivery polymer. Apo(a) levels were normalized to day -1 and saline control.Example 9. Apolipoprotein (a) (apo(a)) knockdown in non-human primates following LPA RNAi agent delivery by MLP delivery polymer. MLP delivery polymer and LPA RNAi agent were made and combined in a pharmaceutically acceptable buffer as described above. On day 1, two cynomolgus macaque (Macaca fascicularis) primates (both male, 5.0kg and 8.15 kg, respectively) were injected with 2 mg / kg AD01 196 + 2 mg / kg MLP delivery polymer. For each injection, the LPA RNAi agent + MLP delivery polymer (2 ml / kg) was injected into the saphenous vein using a 22 to 25 gauge intravenous catheter. At the indicated time points (indicated in Table 12), blood samples were drawn and analyzed for apo(a) levels, lipid levels and toxicity markers. Blood was collected from the femoral vein and primates were fasted overnight before all blood collections. Blood tests for blood urea nitrogen (BUN), alanine transaminase (ALT), aspartate aminotransferase (AST), creatinine, total cholesterol (TC) and triglycerides (TG) were performed on an automated chemistry analyzer at Meriter laboratories. Blood tests for Lipoprotein (a) (Lp(a)) and Low density lipoprotein (LDL) were measured on an automated chemistry analyzer. Serum apo(a) levels were measured by ELISA. Significant knockdown of apo(a) was observed with an average maximum knockdown of 94.5% observed at day 22. Average maximum knockdown of Lp(a) was 91.5% observed at day 15 (FIG. 3). No dose-related toxicity was observed in treated animals.Table 12. Serum apo(a) protein, Lipoprotein(a) (mg / dL), Low density Lipoprotein (LDL), Total cholesterol, and triglyceride levels in cynomolgus macaque (Macaca fascicularis) primates following administration of 2 mg / kg AD01 196 with 2 mg / kg MLP delivery polymer. Apo(a) levels were normalized to predose.Table 13. Urea Nitrogen, Creatinine, Alanine transaminase, and Aspartate aminotransferase levels in cynomolgus macaque (Macaca fascicularis) primates following administration of 2 mg / kg ADO 1196 with 2 mg / kg MLP delivery polymer.71 14 15 0.73 0.69 36 35 29 3385 14 15 0.60 0.70 126 41 51 4099 15 18 0.66 0.68 151 40 44 37120 14 19 0.72 0.60 37 51 28 47Example 10. In vivo Screening of NAG-conjugated LPA RNAi agents and time course of knockdown. NAG-conjugated LPA RNAi agents were administered to transiently transgenic mice as described above. Each mouse received either single intravenous (IV) dose of 2 mg / kg of LPA RNAi agent with 1 mg / kg of MLP delivery polymer, or a single subcutaneous (SC) dose of 10 mg / kg of the NAG-conjugated LPA RNAi agent. SEAP protein levels in serum were monitored for up to 22 days. Knockdown levels and duration of response are shown in Tables 14-15. AD01529, AD01532 and AD01533 showed >85% knockdown of SEAP levels following IV administration with MLP deliver polymer, and >60% maximum knockdown of SEAP levels following SC administration of the NAG-conjugated LPA RNAi agent alone.Table 14. Serum SEAP protein levels in SEAP -LPA HTV mice following SC administration of 10 mg / kg NAG-conjugated LPA RNAi agents. SEAP levels were normalized to day -1 and saline control.Table 15. Serum SEAP protein levels in SEAP-LPA HTV mice following IV administration of 1 mg / kg NAG-conjugated LPA RNAi agents + 2 mg / kg MLP delivery polymer. SEAP levels were normalized to day -1 and saline control.AD01532 1.00 0.00 0.18 0.05 0.06 0.03 0.13 0.08 0.29 0.18AD01533 1.00 0.00 0.21 0.04 0.13 0.06 0.32 0.15 0.67 0.28AD01534 1.00 0.00 0.17 0.04 0.22 0.06 0.66 0.24 0.94 0.24Example I I . In vivo Screening of modified NAG-conjugated LPA RNAi agents and time course of knockdown. The indicated NAG-conjugated LPA RNAi agents were administered to SEAP- LPA HTV mice as described above. Each mouse received a single subcutaneous (SC) dose of 10 mg / kg of the NAG-conjugated LPA RNAi agent. SEAP protein levels in serum were monitored for up to 22 days. Knockdown levels and duration of response are shown in Tables 16-17. AD01765 and AD01768 showed 89% knockdown activity.Table 16. Serum SEAP protein levels in SEAP-LPA HTV mice following SC administration of 10 mg / kg NAG-conjugated LPA RNAi agent. SEAP levels were normalized to day -1 and saline control.Table 17. Serum SEAP protein levels in SEAP-LPA HTV mice following SC administration of 10 mg / kg NAG-conjugated LPA RNAi agent. SEAP levels were normalized to day -1 and saline control.Example 12. In vivo testing of NAG-conjugated LPA RNAi agents in apo(a) Tg mice. NAG- conjugated LPA RNAi agents were administered to apo(a) Tg mice as described above. Each mouse received a single subcutaneous (SC) dose of either 10 mg / kg of LPA RNAi agent or saline. Human apo(a) (apo(a)) levels in serum were monitored for up to days (Table 18). AD01765 showed the largest knockdown of apo(a) levels at day 8 with 96% knockdown, and >74% knockdown observed 3 weeks after dosing.Table 18. Serum apo(a) protein levels in apo(a) Tg mice following SC administration of 10 mg / kg NAG-conjugated LPA RNAi agent. Apo(a) levels were normalized to day -1 and saline control.Example 13. In vivo testing of N AG-conjugates LPA RNAi agents in LPA mc HTVmice. Indicated NAG-conjugated LPA RNAi agents were administered to LPA mc HTV mice as described above. Each mouse received a single subcutaneous (SC) dose of either 10 mg / kg of LPA RNAi agent or saline. Human apo(a) (apo(a)) levels in serum were analyzed at day 4 (Table 19). AD02001 , AD01765 and AD01768 showed >90% knockdown at day 4.Table 19. Serum apo(a) protein levels in LPA mc HTV mice following SC administration of 10 mg / kg NAG-conjugated LPA RNAi agent. Apo(a) levels were normalized to day -1 and saline control.Example 14. Apolipoprotein (a) (apo(a)) knockdown in non-human primates following LPA RNAi agent delivery by MLP delivery polymer. MLP delivery polymer and LPA RNAi agent were made and combined in a pharmaceutically acceptable buffer. On day 1 and day 71 , twocynomolgus macaque (Macaca fascicularis) primates were injected with either 4 mg / kg AD01 196 + 4 mg / kg MLP delivery polymer or 6 mg / kg AD01196 + 6 mg / kg MLP delivery polymer. For each injection, the LPA RNAi agent + MLP delivery polymer was injected into the saphenous vein using a 22 to 25 gauge intravenous catheter. At the indicated time points (FIG. 4), blood samples were drawn and analyzed for apo(a) levels, lipid levels and toxicity markers as previously described. Significant knockdown of apo(a) was observed after the first dose with an average maximum knockdown of 96% for 4 mg / kg dose on day 15, and 96% for 6 mg / kg dose observed at day 15. Average maximum knockdown of Lp(a) after the first dose was 98.5% for 4 mg / kg dose on day 29, and 98.5% for 6 mg / kg dose on day 22. No dose- related toxicity was observed in treated animals.Example 15. In vivo testing of NAG-conjugated LPA RNAi agents in Lp(a) Tg mice-Dose Response. NAG-conjugated LPA RNAi agents were administered to Lp(a) Tg mice as described above. Each mouse received a single subcutaneous (SC) dose of either LPA RNAi agent at 0.5 mg / kg or 2 mg / kg dose levels or saline. Lp(a) levels in serum were monitored up to day 43 (FIG. 1 , FIG. 2). All LPA RNAi agents showed dose-response with the higher doses showing greater knockdown with nadir between days 15 and 22.Example 16. Apolipoprotein (a) (apo(a)) knockdown in non-human primates following apo(a) specific LPA RNAi agent molecule delivery. LPA RNAi agent was prepared in a pharmaceutically acceptable buffer as described herein for subcutaneous (SC) injection. On days 1, 7, and 15, two cynomolgus macaque (Macaca fascicularis) primates were injected subcutaneously with 3 mg / kg of AD02713, AD02819, AD02820, or AD02821. In addition, AD02819-treated monkeys were dosed again with 3 mg / kg of AD02819 on day 57 and day 85. Blood samples were drawn and analyzed for apo(a) levels, lipid levels and toxicity markers as previously described. Significant knockdown of Lp(a) was observed with an average maximum knockdown of 89% observed at day 43 for AD02713, 87% observed on day 36 for AD02819, 79% observed on day 36 for AD02820, and 95% observed on day 29 for AD02821 (FIG. 5). No dose-related toxicity was observed in treated animals over the time of the experiment.Example 17. Apolipoprotein (a) (apo(a)) knockdown in non-human primates following LPA RNAi agent delivery. LPA RNAi agent was prepared in a pharmaceutically acceptable buffer as described herein for subcutaneous (SC) injection. On day 1 , two cynomolgus macaque (Macaca fascicularis) primates were injected subcutaneously with 3 mg / kg of AD03272,AD03462, AD03549, AD03547, AD03668, AD03460, or AD03536. In addition, AD03460 and AD03536-treated monkeys were dosed again with 1 mg / kg of the respective LPA RNAi agent on day 48. Blood samples were drawn and analyzed for apo(a) levels, lipid levels and toxicity markers as previously described. Significant knockdown of Lp(a) was observed with an average maximum knockdown of 62% for AD03272 on day 15, 28% for AD03462 on day 15, 47% for AD03549 on day 29, 44% for AD03547 on day 15, 53% for AD03668 on day 22, 79% for AD03460 on day 29, and 71% for AD03536 on day 22 (FIG. 6). No dose-related toxicity was observed in treated animals over the time of the experiment. Example 18. Apolipoprotein (a) (apo(a)) knockdown in primate following apo(a) specific LPA RNAi agent molecule delivery. LPA RNAi agent was made and combined in a pharmaceutically acceptable buffer as described above for subcutaneous (SQ) injection. On day 1, cynomolgus macaque (Macaca fascicularis) primates were injected with subcutaneously with saline or 2 mg / kg of AD03460, AD03536, AD03851, AD03853, or AD04110. Blood samples were drawn and analyzed for apo(a) levels, lipid levels and toxicity markers on days 8 and 15 as previously described. Lp(a) levels were normalized to average of three predose values.Table 20. Lipoprotein(a) levels in cynomolgus macaque primates following administration of either saline or 2 mg / kg AD03460, AD03536, AD03851, AD03853 or AD04110.

Claims

Claims:

1. An LPA RNA interference (RNAi) agent comprising a sense strand and an antisense strand, wherein said antisense strand comprises the nucleotide sequence ofa) nucleotides 2-19 of any of SEQ ID NOs: l-108, orb) any of the antisense strands of Table 1 or Table 2A.

2. The LPA RNAi agent of claim 1, wherein the sense strand comprises the nucleotide sequence ofa) nucleotides 1-19 of any of SEQ ID NOs: 190-268, orb) any of the sense strands of Table 1 or Table 2B.

3. The LPA RNAi agent of claim 1, wherein the antisense strand comprises the nucleotide sequence of any of SEQ ID NO: 1246, SEQ ID NO: 1242, SEQ ID NO: 1244, SEQ ID NO: 1248, SEQ ID NO: 1250, SEQ ID NO: 1252, or SEQ ID NO: 1254, SEQ IDNO: 1280, SEQ ID NO: 1281, SEQ ID NO: 1282, OR SEQ ID NO: 1283.

4. The LPA RNAi agent of claim 3, wherein:a) the antisense strand comprises the nucleotide sequence of SEQ ID NO: 1246 and the sense strand comprises the nucleotide sequence of SEQ ID NO: 1247;b) the antisense strand comprises the nucleotide sequence of SEQ ID NO: 1242 and the sense strand comprises the nucleotide sequence of SEQ ID NO: 1243;c) the antisense strand comprises the nucleotide sequence of SEQ ID NO: 1244 and the sense strand comprises the nucleotide sequence of SEQ ID NO: 1245;d) the antisense strand comprises the nucleotide sequence of SEQ ID NO: 1248 and the sense strand comprises the nucleotide sequence of SEQ ID NO: 1249;e) the antisense strand comprises the nucleotide sequence of SEQ ID NO: 1250 and the sense strand comprises the nucleotide sequence of SEQ ID NO: 1251 ;f) the antisense strand comprises the nucleotide sequence of SEQ ID NO: 1252 and the sense strand comprises the nucleotide sequence of SEQ ID NO: 1253; or g) the antisense strand comprises the nucleotide sequence of SEQ ID NO: 1254 and the sense strand comprises the nucleotide sequence of SEQ ID NO: 1255; or h) the antisense strand comprises the nucleotide sequence of SEQ ID NO: 1280 and the sense strand comprises the nucleotide sequence of SEQ ID NO: 1260; OR i) the antisense strand comprises the nucleotide sequence of SEQ ID NO: 1281 and the sense strand comprises the nucleotide sequence of SEQ ID NO: 1258; orj) the antisense strand comprises the nucleotide sequence of SEQ ID NO: 1280 and the sense strand comprises the nucleotide sequence of SEQ ID NO: 1284; or k) the antisense strand comprises the nucleotide sequence of SEQ ID NO: 1281 and the sense strand comprises the nucleotide sequence of SEQ ID NO: 1285; or1) the antisense strand comprises the nucleotide sequence of SEQ ID NO: 1282 and the sense strand comprises the nucleotide sequence of SEQ ID NO: 1259; or m) the antisense strand comprises the nucleotide sequence of SEQ ID NO: 1283 and the sense strand comprises the nucleotide sequence of SEQ ID NO: 1249.

5. The LPA RNAi agent of any of claims 1-4, wherein the sense strand and / or theantisense strand further comprises a 3' and / or 5' extension of 1-6 nucleotides in length.

6. The LPA RNAi agent of any of claims 1-5 wherein the antisense strand comprises a nucleotide sequence of any of SEQ ID NO: 156, SEQ ID NO: 164, or SEQ ID NO: 188.

7. The LPA RNAi agent of claim 6, wherein:a) the antisense strand comprises a nucleotide sequence of SEQ ID NO:

156. and the sense strand comprises a nucleotide sequence of SEQ ID NO: 310,b) the antisense strand comprises a nucleotide sequence of SEQ ID NO:

164. and the sense strand comprises a nucleotide sequence of SEQ ID NO:357,c) the antisense strand comprises a nucleotide sequence of SEQ ID NO: 188 and the sense strand comprises a nucleotide sequence of SEQ ID NO: 384,d) the antisense strand comprises a nucleotide sequence of SEQ ID NO: 164 and the sense strand comprises a nucleotide sequence of SEQ ID NO:376, ore) the antisense strand comprises a nucleotide sequence of SEQ ID NO: 164 and the sense strand comprises a nucleotide sequence of SEQ ID NO:384.

8. The LPA RNAi agent of any of claims 1-7, wherein the sense strand and / or antisense strand independently comprises one or more modified nucleotides.

9. The LPA RNAi agent of claim 8, wherein the one or more modified nucleotides are independently selected from the group consisting of: 2'-0-methyl modified nucleotide, nucleotide comprising a 5'-phosphorothioate group, 2'-deoxy-2'-fluoro modified nucleotide, 2'-deoxy-modified nucleotide, locked nucleotide, abasic nucleotide, deoxythymidine, inverted deoxythymidine, 2'-amino-modified nucleotide,2'-alkyl-modified nucleotide, morpholino nucleotide, and non-natural base comprising nucleotide.

10. The LPA RNAi agent of any of claims 1-9, wherein the LP A RNAi agent comprises one or more phosphorothioate internucleoside linkages.

11. The LPA RNAi agent of any of claims 1-10, wherein the LPA RNAi agent further comprises a targeting group.

12. The LPA RNAi agent of claim 11, wherein the targeting group comprises anasialoglycoprotein receptor ligand.

13. The LPA RNAi agent of claim 12, wherein the asialoglycoprotein receptor ligandcomprises a galactose cluster.

14. The LPA RNAi agent of claim 13, wherein the galactose cluster is selected from the group consisting of: (C 11 -PEG3-NAG3), (C11-PEG3-NAG3), (C6-PEG4-NAG3), (NAG 3), (NAG4), (NAG3-AA2), (NAG3-Palm), (NAG13), (NAG18), (NAG24), (NAG25), (NAG25)s, (NAG26), (NAG27), (NAG28), (NAG29), (NAG30),(NAG30)s, (NAG31), (NAG13), (NAG31s), (NAG32), (NAG33), (NAG34), (NAG35), (NAG36), and (NAG37).

15. The LPA RNAi agent of any of claims 11-14, wherein the targeting group is conjugated to the sense strand.

16. The LPA RNAi agent of claim 15, wherein the targeting group is conjugated to the 5' end of the sense strand.

17. The LPA RNAi agent of claim 15, wherein the targeting group is conjugated to the 3' end of the sense strand.

18. The LPA RNAi agent of any of claims 1-17, wherein the LPA RNAi agent further comprises a linking group.

19. The LPA RNAi agent of any of claims 1-18, wherein the LPA RNAi agent comprises one or two overhangs.

20. The LPA RNAi agent of any of claims 1-18, wherein the LPA RNAi agent comprises one or two frayed ends.

21. The LPA RNAi agent of any of claims 1-18, wherein the LPA RNAi agent comprises one or two blunt ends.

22. The LPA RNAi agent of any of claims 1-18, wherein the LPA RNAi agent comprises any of the duplex sequences in Table 3A or Table 3B.

23. The LPA RNAi agent of any of claims 1-18, wherein the LPA RNAi agent comprises AD03460, AD03536, AD03581, AD03583, AD3847, or AD04110,24. Use of the LPA RNAi agent of any of claims 1-22, for the manufacture of amedicament.

25. The LPA RNAi agent of any of claims 1-23, further comprising one or more additional therapeutics or treatments.

26. The LPA RNAi agent of any of claims 1-23, further comprising a pharmaceutically acceptable excipient.

27. The LPA RNAi agent of any of claims 1-23, wherein said LPA RNAi agent is packaged in a kit, container, pack, dispenser, pre-filled syringes, or vials.

28. A method for inhibiting LPA expression in a cell, tissue, or subject comprising:administering to said subject a therapeutically effective amount of an LPA RNAi agent of any of claims 1-26.

29. The method of claim 27, wherein the composition is administered parenterally.

30. The method of any of claims 27-28, wherein the cell is a hepatocyte.3 1 . An LPA RNA interference ( RNAi ) agent comprising a sense sequence and an antisense sequence, wherein said antisense sequence comprises a nucleotide sequence of nucleotides 1 - 1 7. 2-18, 1-19, 2-19, 1 -2 1. 1 -23. or 1-26 of any of the antisense sequences of Table 1 or Table 2A.

Images