Pd-1 binding molecule and application thereof

Abstract

Provided by the present invention is a PD-1 binding molecule, which contains an anti-PD-1 single-domain antibody. The complementarity-determining region (CDR) of the single-domain antibody comprises CDR1 shown in SEQ ID NO:1, CDR2 shown in SEQ ID NO:2, and CDR3 shown in SEQ ID NO:3.

Description

PD-1 binding molecules and their applications Technical Field

[0001] The present invention relates to the field of biomedicine or biopharmaceutical technology, and more specifically to a PD-1 binding molecule and applications thereof. Background Art

[0002] Programmed death receptor-1 protein, also known as PD-1 (programmed death 1), is a transmembrane protein expressed on the surface of T cells and plays an immunosuppressive role. PD-1 has two ligand molecules, PD-L1 and PD-L2, which are expressed at high levels on antigen-presenting cells. When PD-L1 and PD-L2 bind to PD-1, they negatively regulate the functional activity of T cells. Tumor cells are usually able to highly express PD-L1 or PD-L2 to achieve "immune escape" (Lee L et al., J Clin Pharmacol. 2016 Feb; 56(2): 157-69). Therefore, PD-1 drugs kill tumors by positively regulating the immune system. Now, PD-1 is also synonymous with immune checkpoint inhibitor therapy.

[0003] Thanks to their outstanding efficacy in the treatment of melanoma, the FDA approved two PD-1 monoclonal antibodies, Pembrolizumab (Keytruda) and Nivolumab (Opdivo), in 2014 and 2015, respectively. Their current indications cover nearly 20 types of solid tumors (Prasad V et al., Semin Oncol. 2017 Apr; 44(2): 132-135.). Currently, there are four PD-1 monoclonal antibody drugs on the market in China, namely Hengrui's Camrelizumab, BeiGene's Tislelizumab, Innovent's Sintilimab, and Junshi's Toripalimab.

[0004] Studies have found that traditional scFv antibodies have low expression levels in T cells and are difficult to fully exert the effect of PD-1 inhibitors. This is mainly due to the properties of scFv antibodies themselves, such as easy aggregation, easy folding mismatch, and low thermal stability (Martin N et al., Macromol Biosci. 2017 Feb; 17(2)). Nanobodies, on the other hand, have natural advantages such as easy expression, high stability, and high affinity. Based on the advantages of nanobodies themselves and the biological mechanism of PD-1, the development of PD-1 nanoantibodies has very broad application prospects. The development of a new anti-PD-1 single-domain antibody with good specificity, blocking activity, clinical efficacy, simple production, low cost, and reduced medication burden has become an urgent problem to be solved.

[0005] Summary of the Invention

[0006] The purpose of the present invention is to provide a novel anti-PD-1 binding molecule and its application.

[0007] In a first aspect, the present invention provides a PD-1 binding molecule comprising an anti-PD-1 single domain antibody, wherein the complementarity determining region (CDR) of the single domain antibody comprises CDR1, CDR2, and CDR3, wherein CDR1 comprises the sequence shown in SEQ ID NO: 1, CDR2 comprises the sequence shown in SEQ ID NO: 2, and CDR3 comprises the sequence shown in SEQ ID NO: 3.

[0008] In one or more embodiments, SEQ ID NO: 1 is GX1X2X3X4X5X6X7, wherein X1 is D, F, G, H, L, or R, X2 is P, S, or T, X3 is A, F, I, L, N, R, S, or V, X4 is D, F, G, L, M, N, or S, X5 is A, D, F, G, I, N, R, S, or T, X6 is D, F, H, I, L, S, V, W, or Y, and X7 is A, D, E, G, N, P, S, or T. Exemplarily, CDR1 comprises the sequence shown in any one of SEQ ID NOs: 4-39, 320.

[0009] Preferably, SEQ ID NO: 1 is GX1X2X3X4X5X6X7, wherein X1 is D, F, G, H, L or R, X2 is P, S or T, X3 is F or S, X4 is F or S, X5 is G, I or T, X6 is S or Y, and X7 is A or D. Exemplarily, CDR1 comprises the sequence shown in any one of SEQ ID NOs: 16, 19, 36-39, and 320.

[0010] More preferably, SEQ ID NO: 1 is GX1X2X3X4IX6X7, wherein X1 is D or R, X2 is P or T, X3 is S or F, X4 is F or S, X6 is S or Y, and X7 is A or D. Exemplarily, CDR1 comprises the sequence shown in SEQ ID NO: 16 or 19.

[0011] Or more preferably, SEQ ID NO: 1 is GX1X2FSX5YX7, wherein X1 is G, F, H, L or R, X2 is P, S or T, X5 is G, I or T, and X7 is A or D. Exemplarily, CDR1 comprises the sequence shown in any one of SEQ ID NOs: 19, 36-39, and 320.

[0012] In one or more embodiments, SEQ ID NO: 2 is XXXXXXXXXXXXXXXXXXXXX, wherein X1 is I, L, S, T, or V, X2 is A, N, S, or T, X3 is F, G, I, K, L, M, N, Q, R, S, T, W, or Y, X4 is A, D, G, H, N, R, S, or T, X5 is A, D, G, N, R, S, or none, X6 is G, R, S, or T, X7 is D, E, I, L, M, N, R, S, T, or V, X8 is A, K, M, Q, or T, and X9 is A or none. Exemplarily, CDR2 comprises the sequence shown in any one of SEQ ID NOs: 40-75.

[0013] Preferably, SEQ ID NO: 2 is X1X2X3X4X5GX7TX9, wherein X1 is I or V, X2 is N, S or T, X3 is F, L or N, X4 is A, G, S or T, X5 is R or none, X7 is D, N, I or T, and X9 is none. Exemplarily, CDR2 comprises the sequence shown in any one of SEQ ID NOs: 52, 53, 55, 72-75.

[0014] More preferably, SEQ ID NO: 2 is IX2X3X4X5GX7TX9, X2 is N, S or T, X3 is L or N, X4 is A, S or T, X5 is R or none, X7 is D, I or N, and X9 is none. Exemplarily, CDR2 comprises the sequence shown in any one of SEQ ID NO: 52, 53, 55, 72, and 73.

[0015] Alternatively, more preferably, SEQ ID NO: 2 is XXRGXTX, wherein X is I or V, X is N, S, or T, X is F or L, X is A, G, or S, X is D, N, or T, and X is absent. Alternatively, CDR2 comprises SEQ ID NO: 55 or a variant thereof comprising one or more amino acid changes selected from the group consisting of: X1 I to V, X2 N to S or T, X3 L to F, X4 S to A or G, and X7 D to N or T. Exemplarily, CDR2 comprises the sequence shown in any one of SEQ ID NOs: 53, 55, and 72-75.

[0016] In one or more embodiments, SEQ ID NO: 3 is X1X2X3X4X5X6X7X8X9X 10 X 11 X 12 X 13 X 14 X 15 X 16 X 17 X 18 X 19 X 20 X 21 X 22 , wherein X1 is A, E, G, N, R, S, T, or V, X2 is A, G, I, K, L, P, R, T, or V, X3 is A, D, E, G, K, N, P, R, S, V, or Y, X4 is A, C, D, E, G, I, K, L, R, S, T, V, or Y, and X5 is A, C, D, F, G, H, I, K, L, N, P, Q, R, S , W or Y, X6 is A, C, D, E, G, I, K, L, M, P, Q, R, S or Y, X7 is A, C, D, F, G, H, I, N, P, R, S, T, V or Y, X8 is A, C, D, E, G, I, R, S, T, V, W, Y or none, X9 is A, D, E, F, G, I, L, P, R, S, V, W, Y or none, X 10 is C, D, F, G, K, L, N, P, R, S, T, V, W, Y or none, X 11 is D, F, G, H, I, K, L, N, P, S, T, V, Y or none, X 12 A, D, G, H, I, L, M, P, R, S, T, V, Y or none, X 13 Is C, D, E, H, P, R, S, T, V, Y or none, X 14 A, D, E, F, H, I, L, P, R, T, Y or none, X 15 A, D, E, G, N, Q, R, S, T, V, Y or none, X 16A, D, E, F, G, H, M, P, S, V, Y or none, X 17 A, D, E, H, N, Q, R, T, Y or none, X 18 Is D, E, R, S, Y or none, X 19 Is N, S, Y or None, X 20 Is D, E, Y or none, X 21 Is E, N, Y or None, X 22 Is Y or None. Exemplarily, CDR3 comprises the sequence shown in any one of SEQ ID NOs: 76-183.

[0017] Preferably, SEQ ID NO: 3 is X1X2X3X4X5X6X7X8X9X 10 X 11 X 12 X 13 X 14 X 15 X 16 X 17 X 18 X 19 X 20 X 21 X 22 , wherein X1 is E, G, N or V, X2 is A, G, I, L or V, X3 is A, D, E, G, N, V ​​or Y, X4 is A, G, I, K, R or S, X5 is C, I, L, P, Q, R or W, X6 is E, K, P, Q or R, X7 is C, D, H, N, P or Y, X8 is E, G, R, V or W, X9 is F, G, L, S, V or W, X 10 is C, D, G, L, R, S or V, X 11 is F, G, I, L, N, S, T, or V, X 12 Is H, L, P, R, S, T or Y, X 13 is D, H, P, S, T or V, X 14 is E, F, H, I, L, P or R, X 15 A, S or V, X 16 is A, D, E, G, H or V, X 17 is H, N, Q, R or Y, X 18 -X 22 Exemplarily, the CDR3 comprises a sequence shown in any one of SEQ ID NOs: 76, 87, 108-183.

[0018] More preferably, SEQ ID NO: 3 is X1X2X3X4X5X6X7X8X9X 10 X 11 X 12 X 13 X14 X 15 X 16 X 17 X 18 X 19 X 20 X 21 X 22 , wherein X1 is E, G or V, X2 is A, G, I, L or V, X3 is A, D, E, G, N, V ​​or Y, X4 is G, I, K, R or S, X5 is C, I, L, Q, R or W, X6 is E, K, P, Q or R, X7 is C, D, H, N or Y, X8 is E, G, R, V or W, X9 is F, L, S, V or W, X 10 is C, D, G, R, S or V, X 11 is F, I, L, N, S, T or V, X 12 is H, L, P, R, S or T, X 13 is H, P, S, T or V, X 14 is F, H, I, L, P or R, X 15 A, S or V, X 16 is A, D, E, G, H or V, X 17 is H, N, Q, R or Y, X 18 -X 22 Alternatively, the CDR3 comprises the sequence shown in SEQ ID NO: 87 or a variant thereof, wherein the variant comprises one or more amino acid changes selected from the group consisting of: G of X1 is mutated to E, G or V, V of X2 is mutated to A, G, I or V, D of X3 is mutated to A, E, G, N, V ​​or Y, R of X4 is mutated to G, I, K or S, R of X5 is mutated to C, I, L, Q or W, Q of X6 is mutated to E, K, P or R, Y of X7 is mutated to C, D, H or N, G of X8 is mutated to E, R, V or W, L of X9 is mutated to F, S, V or W, and 10 G mutates to C, D, R, S or V, X 11 I mutated to F, L, N, S, T or V, X 12 P mutates to H, L, R, S or T, X 13 P mutates to H, S, T or V, X 14 L mutates to F, H, I, P or R, X 15 A mutated to S or V, X 16 D mutates to A, E, G, H or V, X 17 The H of CDR3 is mutated to N, Q, R or Y. Exemplarily, CDR3 comprises the sequence shown in any one of SEQ ID NOs: 87, 108-183.

[0019] In one or more embodiments, CDR1 comprises the sequence shown in any one of SEQ ID NOs: 4-39, 320, CDR2 comprises the sequence shown in any one of SEQ ID NOs: 40-75, and CDR3 comprises the sequence shown in any one of SEQ ID NOs: 76-183.

[0020] In one or more embodiments, CDR1 comprises the sequence shown in any one of SEQ ID NOs: 16, 19, 36-39, 320, CDR2 comprises the sequence shown in any one of SEQ ID NOs: 52, 53, 55, 72-75, and CDR3 comprises the sequence shown in any one of SEQ ID NOs: 76, 87, 108-183.

[0021] In one or more embodiments, CDR1 comprises the sequence shown in SEQ ID NO: 16 or 19, CDR2 comprises the sequence shown in any one of SEQ ID NO: 52, 53, 55, 72, 73, and CDR3 comprises the sequence shown in any one of SEQ ID NO: 87, 108-111, 113-134, 136-146, 148-154, 156-163, 165-168, 172, 173, 177-183.

[0022] In one or more embodiments, CDR1 comprises the sequence shown in any one of SEQ ID NOs: 19, 36-39, 320, CDR2 comprises the sequence shown in any one of SEQ ID NOs: 53, 55, 72-75, and CDR3 comprises the sequence shown in any one of SEQ ID NOs: 87, 108-183.

[0023] In one or more embodiments, CDR1 comprises the sequence shown in any one of SEQ ID NOs: 5, 7, 10, 14-16, 19, 26, 27, 29, 30, 33, CDR2 comprises the sequence shown in any one of SEQ ID NOs: 41, 47, 50-52, 55, 56, 61-66, and CDR3 comprises the sequence shown in any one of SEQ ID NOs: 76, 77, 85-87, 93, 94, 97, 99-101, 104.

[0024] In one or more embodiments, the single-domain antibody comprises CDR1, CDR2, and CDR3 shown in any one of the following groups a1 to a136:

[0025] CDR1 CDR2 CDR3 group 44076a154177a264278a374376a484479a594580a6104681a7114782a8124883a9134984a10105085a11144776a12155186a13165276a14175387a15185488a16195587a17205682a18215789a19225890a20235991a21144776a22246092a23254076a24266193a25276294a26246095a27284196a28106397a2954198a30296499a31765100a323066101a333167102a34

[0026] 3268103a353356104a363469105a373570106a38771107a39165276a40165276a41165276a42165276a43165276a44197287a45197287a46197287a47197387a48195387a49195387a501953108a511953109a521953110a531953111a543674112a551953113a561953114a571953115a581953116a591953117a601953118a611953119a621953120a631953121a641953122a651953123a661953124a671953125a681953126a691953127a701953128a711953129a721953130a731953131a741953132a751953133a761953134a773775135a781953136a791953137a80

[0027] 1953138a811953139a821953140a831953141a841953142a851953143a86 1953144a871953145a881953146a893853147a901953148a911953149a921 953150a931953151a941953152a951953153a961953154a973953155a9819 53156a991953157a1001953158a1011953159a1021953160a1031953161a1 041953162a1051953163a1063753164a1071953165a1081953166a1091953 167a1101953168a1113674169a1123853170a1133753171a1141953172a11 51953173a1163853174a1173853175a1183674176a1191953177a12019531 78a1211953179a1221953180a1231953181a1241953182a1251953183a126

[0028] 3775135a1273775135a1283775135a1293775135a1303775135a1313775135a1323775135a1333775135a13432075135a1353775135a136

[0029] In one or more embodiments, the FR1 of the single-domain antibody VHH can be selected from the FR1 of the VHH of each antibody number in Table 1, the FR2 of the VHH can be selected from the FR2 of the VHH of each antibody number in Table 1, the FR3 of the VHH can be selected from the FR3 of the VHH of each antibody number in Table 1, and the FR4 of the VHH can be selected from the FR4 of the VHH of each antibody number in Table 1.

[0030] In one or more embodiments, the FR region of the single-domain antibody is the FR region of any one VHH selected from SEQ ID NOs: 184-319.

[0031] In one or more embodiments, the single-domain antibody VHH is shown in any one of SEQ ID NOs: 184 to 319. Preferably, the single-domain antibody is shown in any one of SEQ ID NOs: 197, 200, 223 to 319.

[0032] In one or more embodiments, the PD-1 binding molecule is a monovalent or multivalent single-domain antibody, a multispecific single-domain antibody, a heavy chain antibody or an antigen-binding fragment thereof, or an antibody or an antigen-binding fragment thereof comprising one, two, or more anti-PD-1 single-domain antibodies described herein.

[0033] In one or more embodiments, the multivalent single-domain antibody or multispecific single-domain antibody connects multiple single-domain antibodies via a linker, wherein the linker consists of 1-15 amino acids selected from G and S.

[0034] In one or more embodiments, the antigen-binding fragment of the heavy chain antibody is a single-chain heavy chain antibody.

[0035] In one or more embodiments, the heavy chain antibody is a camelid heavy chain antibody or a cartilaginous fish heavy chain antibody.

[0036] In one or more embodiments, the heavy chain antibody further comprises a heavy chain constant region.

[0037] In one or more embodiments, the heavy chain constant region is a constant region of a camel heavy chain antibody, comprising CH2 and CH3. In one or more embodiments, the CH2 and CH3 are CH2 and CH3 of a human IgG Fc, such as CH2 and CH3 of IgG4. Preferably, the heavy chain constant region is as shown in SEQ ID NO: 321.

[0038] In one or more embodiments, the heavy chain constant region is a constant region of a cartilaginous fish heavy chain antibody, comprising CH1, CH2, CH3, CH4 and CH5.

[0039] In one or more embodiments, the antibody is an antibody comprising the anti-PD-1 single domain antibody as a heavy chain variable domain.

[0040] In one or more embodiments, the antibody further comprises a light chain variable domain, a heavy chain constant domain, and a light chain constant domain.

[0041] In one or more embodiments, the antigen-binding fragment of an antibody is selected from the group consisting of Fab, F(ab')2, Fv, scFv.

[0042] In one or more embodiments, the binding molecule according to any embodiment of the present invention is a chimeric antibody or a fully human antibody; preferably a fully human antibody.

[0043] The present invention also provides a polynucleotide selected from:

[0044] (1) the coding sequence of the single domain antibody described in any embodiment herein or the antibody or antigen-binding fragment thereof described herein;

[0045] (2) The complementary sequence of (1);

[0046] (3) A 5-50 bp fragment of any of the sequences in (1) or (2).

[0047] In one or more embodiments, the fragment is a primer.

[0048] In one or more embodiments, the sequence of the polynucleotide is shown as SEQ ID NO: 322 or 323.

[0049] The present invention also provides a nucleic acid construct comprising the polynucleotide described herein.

[0050] In one or more embodiments, the nucleic acid construct is a recombinant vector or an expression vector.

[0051] The present invention also provides a phage comprising the PD-1 binding molecule described in any embodiment herein.

[0052] In one or more embodiments, the PD-1 binding molecule is displayed on the surface of the bacteriophage.

[0053] The present invention also provides a host cell selected from:

[0054] (1) expressing and / or secreting the PD-1 binding molecule described in any embodiment of the present invention;

[0055] (2) comprising a polynucleotide as described herein; and / or

[0056] (3) comprising a nucleic acid construct as described herein.

[0057] The present invention also provides a method for producing a PD-1 binding molecule, comprising: culturing the host cell described herein under conditions suitable for producing a PD-1 binding molecule (e.g., a monovalent or multivalent single domain antibody, a multispecific single domain antibody, a heavy chain antibody, an antibody or an antigen-binding fragment thereof), and optionally purifying the PD-1 binding molecule from the culture.

[0058] The present invention also provides a pharmaceutical composition comprising the PD-1 binding molecule, polynucleotide, nucleic acid construct, phage or host cell described in any embodiment herein, and a pharmaceutically acceptable excipient.

[0059] In one or more embodiments, the pharmaceutical composition is used to treat cancer.

[0060] In one or more embodiments, the cancer is a PD-1-related cancer. Preferably, the cancer is selected from the group consisting of melanoma, lung cancer, head and neck cancer, renal cell carcinoma, urothelial carcinoma, non-Hodgkin's lymphoma, and the like.

[0061] The present invention also provides use of the PD-1 binding molecule described in any embodiment herein in the preparation of a medicament for preventing or treating cancer.

[0062] In one or more embodiments, the cancer is a PD-1-related cancer. Preferably, the cancer is selected from the group consisting of melanoma, lung cancer, head and neck cancer, renal cell carcinoma, urothelial carcinoma, non-Hodgkin's lymphoma, and the like.

[0063] The present invention also provides a method for treating or preventing cancer, comprising administering to a patient in need thereof a therapeutically effective amount of the PD-1 binding molecule according to any embodiment of the present invention, or a pharmaceutical composition containing the PD-1 binding molecule according to any embodiment of the present invention.

[0064] In one or more embodiments, the cancer is a PD-1-related cancer. Preferably, the cancer is selected from the group consisting of melanoma, lung cancer, head and neck cancer, renal cell carcinoma, urothelial carcinoma, non-Hodgkin's lymphoma, and the like.

[0065] The present invention also provides a kit for detecting PD-1, which is used to evaluate the efficacy of drug treatment or diagnose cancer, wherein the kit comprises the PD-1 binding molecule, polynucleotide, nucleic acid construct, phage or host cell described in any embodiment of the present invention.

[0066] In one or more embodiments, the kit further comprises a reagent for detecting the binding of PD-1 to the single domain antibody, antibody or antigen-binding fragment thereof, for example, by enzyme-linked immunosorbent assay (ELISA).

[0067] In one or more embodiments, the binding detection reagent is a detectable label that can be linked to the PD-1 binding molecule, such as biotin. The detectable label is linked to the PD-1 binding molecule or is separately present in the kit.

[0068] The present invention also provides a non-diagnostic method for detecting the presence of PD-1 in a sample, comprising: incubating the sample with a PD-1 binding molecule described in any embodiment herein, and detecting binding of PD-1 to a single domain antibody, antibody, or antigen-binding fragment thereof, thereby determining the presence of PD-1 in the sample. The detection is performed by enzyme-linked immunosorbent assay (ELISA).

[0069] The present invention also provides use of the PD-1 binding molecule described in any embodiment herein in preparing a kit for detecting PD-1 in a sample, evaluating the effect of drug treatment, or diagnosing cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0070] Figure 1 shows the titer detection of alpaca antiserum against PD-1 protein.

[0071] Figure 2 shows the titer detection of alpaca antiserum against PD-1 overexpressing cell lines.

[0072] Figure 3. Effect of anti-PD-1 antibodies on luciferase reporter gene activation. The amino acid sequence of the isotype control (negative control) is shown in SEQ ID NO.: 2 in CN106046152A.

[0073] Figure 4 Effect of PD-1 antibody on IFN-γ secretion in mixed lymphocyte reaction (MLR). Isotype control is the same as Figure 3.

[0074] Figure 5. Effect of PD-1 antibody on IL-2 secretion in mixed lymphocyte reaction (MLR). Isotype control is the same as Figure 3.

[0075] FIG6 shows the cross-reaction results of NB182 antibody with 5300 membrane proteins.

[0076] FIG7 shows the cross-reaction results of NB194 antibody with 5300 membrane proteins.

[0077] Figure 8 shows that the affinity and functional activity of the NB194 mutants were also improved. EC50 is in nM. DETAILED DESCRIPTION

[0078] After extensive and in-depth research and extensive screening, the inventors have discovered a class of PD-1 binding molecules comprising anti-PD-1 single-domain antibodies. Experimental results demonstrate that the binding molecules of the present invention can specifically recognize PD-1, bind to PD-1 with high affinity, exhibit good functional activity, promote T cell cytokine secretion, and exhibit no tissue cross-reactivity. The single-domain antibodies of the present invention are simple to produce.

[0079] Specifically, the present invention uses human PD-1 protein to immunize alpacas to obtain a high-quality immune single-domain antibody gene library. The PD-1 protein is then coupled to an ELISA plate, and the immune single-domain antibody gene library is screened using phage display technology to obtain PD-1-specific single-domain antibody genes. This gene is then transferred into mammalian cells to obtain a single-domain antibody strain that can be efficiently expressed in mammalian cells and has high specificity. Single-domain antibodies with high affinity, high specificity, high functional activity, and low tissue cross-reactivity are then identified through methods such as ELISA, flow cytometry, membrane protein cross-reactivity, and epitope competition assays.

[0080] Antibody

[0081] As used herein, a "PD-1 binding molecule" is a protein that specifically binds to PD-1, including but not limited to antibodies, antigen-binding fragments of antibodies, heavy chain antibodies, nanobodies, minibodies, affibodies, target binding regions of receptors, cell adhesion molecules, ligands, enzymes, cytokines, and chemokines.

[0082] As used herein, the term "antibody" includes monoclonal antibodies (including full-length antibodies having an immunoglobulin Fc region), antibody compositions with multiple epitope specificities, multispecific antibodies (e.g., bispecific antibodies), diabodies and single-chain molecules, as well as antibody fragments, particularly antigen-binding fragments, e.g., Fab, F(ab')2 and Fv. As used herein, the terms "immunoglobulin" (Ig) and "antibody" are used interchangeably.

[0083] The basic 4-chain antibody unit is a heterotetrameric glycoprotein composed of two identical light (L) chains and two identical heavy (H) chains. IgM antibodies are composed of five basic heterotetrameric units and an additional polypeptide called the J chain, containing 10 antigen-binding sites; whereas IgA antibodies contain 2-5 basic 4-chain units, which can be polymerized in combination with the J chain to form multivalent assemblies. In the case of IgG, the 4-chain unit is typically approximately 150,000 daltons. Each light chain is linked to a heavy chain by a single covalent disulfide bond, while the two heavy chains are linked to each other by one or more disulfide bonds, the number of which depends on the heavy chain isotype. Each heavy and light chain also has regularly spaced intrachain disulfide bridges. Each heavy chain has a variable domain (VH) at the N-terminus, followed by three (CH1, CH2, and CH3 for each of the α and γ chains) and four (CH1, CH2, CH3, and CH4 for the μ and ε isotypes) constant domains (CH), and a hinge region located between the CH1 and CH2 domains. Each light chain has a variable domain (VL) at the N-terminus, followed by a constant domain (CL) at its other end. The VL is aligned with the VH, while the CL is aligned with the first constant domain (CH1) of the heavy chain. Specific amino acid residues are believed to form an interface between the light and heavy chain variable domains. The paired VH and VL together form an antigen-binding site. For the structure and properties of different classes of antibodies, see, e.g., Basic and Clinical Immunology, 8th edition, Daniel P. Sties, Abba I. Terr and Tristram G. Parsolw, eds., Appleton & Lange, Norwalk, CT, 1994, p. 71 and Chapter 6. Light chains from any vertebrate species can be assigned to one of two distinct types, called kappa and lambda, based on the amino acid sequence of their constant domains. Immunoglobulins can be assigned to different classes or isotypes based on the amino acid sequence of their heavy chain constant domains (CH). There are five classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, with heavy chains designated α, δ, ε, γ, and μ, respectively. Based on relatively minor differences in CH sequence and function, the γ and α classes can be further divided into subclasses, for example, humans express the following subclasses: IgG1, IgG2A, IgG2B, IgG3, IgG4, IgA1, and IgA2.

[0084] The "heavy chain antibodies" described herein are antibodies derived from camelids or cartilaginous fish. Compared to the above-mentioned four-chain antibodies, heavy chain antibodies lack light chains and heavy chain constant region 1 (CH1), and only contain two heavy chains composed of variable regions (VHH) and other constant regions. The variable regions are connected to the constant regions by a hinge-like structure. Each heavy chain of the camelid heavy chain antibody contains one variable region (VHH) and two constant regions (CH2 and CH3), and each heavy chain of the cartilaginous fish heavy chain antibody contains one variable region and five constant regions (CH1-CH5). The antigen-binding fragments of heavy chain antibodies include VHH and single-chain heavy chain antibodies. By fusing with the constant region of human IgG Fc, heavy chain antibodies can have the CH2 and CH3 of human IgG Fc.

[0085] As used herein, the terms "single domain antibody", "anti-PD-1 single domain antibody", "heavy chain variable region domain of heavy chain antibody", "VHH", and "nanoantibody" are used interchangeably and all refer to single domain antibodies that specifically recognize and bind to PD-1. A single domain antibody is the variable region of a heavy chain antibody. Typically, a single domain antibody contains three CDRs and four FRs. Preferably, the single domain antibody of the present invention has a CDR1 as shown in SEQ ID NO: 1, a CDR2 as shown in SEQ ID NO: 2, and a CDR3 as shown in SEQ ID NO: 3. A single domain antibody is the smallest functional antigen-binding fragment. Typically, an antibody naturally lacking the light chain and heavy chain constant region 1 (CH1) is first obtained, and then the variable region of the antibody heavy chain is cloned to construct a single domain antibody consisting of only one heavy chain variable region.

[0086] Binding molecules comprising two or more single-domain antibodies are multivalent single-domain antibodies; binding molecules comprising two or more single-domain antibodies with different specificities are multispecific single-domain antibodies. Multivalent single-domain antibodies or multispecific single-domain antibodies connect multiple single-domain antibodies via a linker. The linker is typically composed of 1-15 amino acids selected from G and S.

[0087] In this article, the terms heavy chain antibody and antibody are used to distinguish different combinations of antibodies. Due to the structural similarities between the two, the following description of the structure of antibodies, except for the light chain, also applies to heavy chain antibodies.

[0088] The "variable region" or "variable domain" of an antibody refers to the amino-terminal domain of the heavy or light chain of an antibody. The variable domains of the heavy and light chains may be referred to as "VH" and "VL," respectively. These domains are generally the most variable parts of an antibody (relative to other antibodies of the same type) and contain the antigen-binding site.

[0089] The term "variable" refers to the situation where certain segments in the variable domain vary widely in antibody sequence. The variable domain mediates antigen binding and defines the specificity of a particular antibody for its specific antigen. However, variability is not evenly distributed across all amino acids spanning the variable domain. Instead, it is concentrated in three segments called hypervariable regions (HVRs) (found in both the light and heavy chain variable domains), namely the HCDR1, HCDR2, and HCDR3 of the heavy chain variable domain (which can be abbreviated as CDR1, CDR2, and CDR3 in heavy chain antibodies) and the LCDR1, LCDR2, and LCDR3 of the light chain variable domain. The more highly conserved parts of the variable domain are called framework regions (FRs). The variable domains of native heavy and light chains each contain four FR regions (FR1, FR2, FR3, and FR4), most of which adopt a β-sheet conformation and are connected by three HVRs that form loops connecting and, in some cases, forming part of the β-sheet structure. The HVRs in each chain are held together in close proximity by the FR regions and, together with the HVRs of the other chain, contribute to the formation of the antibody's antigen-binding site. Typically, the structure of the light chain variable region is FR1-LCDR1-FR2-LCDR2-FR3-LCDR3-FR4, and the structure of the heavy chain variable region is FR1-HCDR1-FR2-HCDR2-FR3-HCDR3-FR4. The constant domains do not directly participate in the binding of antibodies to antigens, but exhibit various effector functions, such as the participation of antibodies in antibody-dependent cell-mediated cytotoxicity.

[0090] "Fc region" (fragment crystallizable region) or "Fc domain" or "Fc" refers to the C-terminal region of an antibody heavy chain that mediates the binding of the immunoglobulin to host tissues or factors, including binding to Fc receptors located on various cells of the immune system (e.g., effector cells), or binding to the first component (C1q) of the classical complement system. In IgG, IgA, and IgD antibody isotypes, the Fc region is composed of two identical protein fragments, the CH2 domain and the CH3 domain, from the two heavy chains of the antibody; the Fc region of IgM and IgE contains three heavy chain constant domains (CH domains 2-4) in each polypeptide chain. Although the boundaries of the Fc region of an immunoglobulin heavy chain can vary, the human IgG heavy chain Fc region is generally defined as the sequence segment from the amino acid residue at heavy chain position C226 or P230 to the carboxyl terminus, where the numbering is according to the EU index, as in Kabat. As used herein, the Fc region can be a native sequence Fc or a variant Fc.

[0091] "Antibody fragments" comprise a portion of an intact antibody, preferably the antigen-binding and / or variable region of an intact antibody. Antibody fragments are preferably antigen-binding fragments of an antibody. Examples of antibody fragments include Fab, Fab', F(ab')2, and Fv fragments; diabodies; linear antibodies; single-chain antibody molecules; scFv-Fc fragments; multispecific antibodies formed from antibody fragments; and any fragment whose half-life can be increased by chemical modification or incorporation into liposomes. Papain digestion of antibodies produces two identical antigen-binding fragments, called "Fab" fragments, and a residual "Fc" fragment, the name reflecting its ability to crystallize readily. Fab fragments are composed of an intact light chain and heavy chain variable domain (VH) and one heavy chain first constant domain (CH1). Each Fab fragment is monovalent with respect to antigen binding, i.e., it has a single antigen-binding site. Pepsin treatment of an antibody produces a larger F(ab')2 fragment, which is roughly equivalent to two disulfide-linked Fab fragments, with different antigen-binding activities and still capable of cross-linking antigen. Fab' fragments differ from Fab fragments by the addition of a few additional residues at the carboxyl terminus of the CH1 domain, including one or more cysteines from the antibody hinge region. F(ab')2 antibody fragments were originally produced as pairs of Fab' fragments with hinge cysteines between them. Other chemical couplings of antibody fragments are also known. The Fc fragment contains the carboxyl terminal portions of two heavy chains held together by disulfide bonds. The effector functions of antibodies are determined by sequences in the Fc region, which is also the region recognized by Fc receptors (FcR) found on certain cell types.

[0092] "Fv" is the smallest antibody fragment that contains a complete antigen recognition and binding site. This fragment consists of a dimer of one heavy-chain variable domain and one light-chain variable domain in tight, non-covalent association. From the folding of these two domains protrude six hypervariable loops (three loops each from the heavy and light chains), which contribute the amino acid residues for antigen binding and confer antigen-binding specificity to the antibody. However, even a single variable domain (or half an Fv containing only three HVRs specific for an antigen) has the ability to recognize and bind antigen, albeit with lower affinity than the complete binding site. "Single-chain Fv," also abbreviated as "sFv" or "scFv," is an antibody fragment comprising the VH and VL domains of an antibody, linked into a single polypeptide chain. Preferably, the sFv polypeptide further comprises a polypeptide linker between the VH and VL domains, allowing the sFv to form the desired antigen-binding structure.

[0093] Herein, the term "monoclonal antibody" refers to an antibody obtained from a group of substantially homogeneous antibodies, i.e., except for possible natural mutations and / or post-translational modifications (e.g., isomerization, amidation) that may exist in small quantities, the individual antibodies constituting the group are identical. Monoclonal antibodies are highly specific, directed against a single antigenic site. Compared with polyclonal antibody preparations (which typically include different antibodies directed against different determinants (epitopes)), each monoclonal antibody is directed against a single determinant on the antigen. Except for their specificity, the advantage of monoclonal antibodies is that they are synthesized by hybridoma culture and are not subject to the contamination of other immunoglobulins. The modifier "monoclonal" indicates that the antibody is obtained from a substantially homogeneous antibody group and should not be construed as requiring production of antibodies by any ad hoc method. For example, the monoclonal antibody used according to the present invention can be generated by various techniques, including, for example, hybridoma method, phage display method, recombinant DNA method, and technology, single cell sequencing method for generating human or human-like antibodies from animals with part or all of the human immunoglobulin locus or the gene encoding human immunoglobulin sequence.

[0094] Monoclonal antibodies herein also include "chimeric" antibodies in which a portion of the heavy and / or light chain is identical or homologous to the corresponding sequence in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain is identical or homologous to the corresponding sequence in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity.

[0095] The "humanized" form of a non-human (e.g., mouse) antibody refers to a chimeric antibody that minimally contains sequences derived from non-human immunoglobulins. Therefore, a "humanized antibody" generally refers to a non-human antibody in which the variable domain framework region is exchanged with sequences found in human antibodies. Typically, in a humanized antibody, the entire antibody (except the CDRs) is encoded by a polynucleotide of human origin or is identical to such an antibody (except the CDRs). The CDRs (some or all of which are encoded by nucleic acids derived from non-human organisms) are transplanted into the β-pleated skeleton of the human antibody variable region to produce an antibody, the specificity of which is determined by the transplanted CDRs. Methods for producing such antibodies are well known in the art, for example, using mice with genetically engineered immune systems. In the present invention, antibodies, single domain antibodies, heavy chain antibodies, etc. all include humanized variants of each of the antibodies.

[0096] A "human antibody" refers to an antibody that has an amino acid sequence corresponding to the amino acid sequence of an antibody produced by a human and / or is produced using any of the techniques disclosed herein for producing human antibodies. This definition of a human antibody specifically excludes humanized antibodies comprising non-human antigen-binding residues. Human antibodies can be produced using a variety of techniques known in the art, including phage display libraries.

[0097] In some embodiments, the present invention also provides single domain antibodies, heavy chain antibodies, antibodies or antigen-binding fragments thereof that bind to the same epitope on human PD-1 as any anti-PD-1 single domain antibody of the present invention, that is, single domain antibodies, heavy chain antibodies, antibodies or antigen-binding fragments thereof that can cross-compete with any single domain antibody of the present invention for binding to PD-1.

[0098] In the present invention, the CDR1 of the anti-PD-1 single domain antibody comprises the sequence shown in SEQ ID NO: 1, SEQ ID NO: 1 is GX1X2X3X4X5X6X7, wherein X1 is D, F, G, H, L or R, X2 is P, S or T, X3 is A, F, I, L, N, R, S or V, X4 is D, F, G, L, M, N or S, X5 is A, D, F, G, I, N, R, S or T, X6 is D, F, H, I, L, S, V, W or Y, and X7 is A, D, E, G, N, P, S or T. Exemplarily, CDR1 comprises the sequence shown in any one of SEQ ID NOs: 4-39, 320.

[0099] The CDR2 of the anti-PD-1 single domain antibody comprises the sequence shown in SEQ ID NO: 2, SEQ ID NO: 2 is X1X2X3X4X5X6X7X8X9, wherein X1 is I, L, S, T or V, X2 is A, N, S or T, X3 is F, G, I, K, L, M, N, Q, R, S, T, W or Y, X4 is A, D, G, H, N, R, S or T, X5 is A, D, G, N, R, S or none, X6 is G or R, S or T, X7 is D, E, I, L, M, N, R, S, T or V, X8 is A, K, M, Q or T, and X9 is A or none. Exemplarily, the CDR2 comprises the sequence shown in any one of SEQ ID NOs: 40-75.

[0100] The CDR3 of the anti-PD-1 single domain antibody includes the sequence shown in SEQ ID NO: 3, SEQ ID NO: 3 is X1X2X3X4X5X6X7X8X9X 10 X 11 X 12 X 13 X 14 X 15 X 16 X 17 X 18 X 19 X 20 X 21 X 22, wherein X1 is A, E, G, N, R, S, T or V, X2 is A, G, I, K, L, P, R, T or V, X3 is A, D, E, G, K, N, P, R, S, V or Y, X4 is A, C, D, E, G, I, K, L, R, S, T, V or Y, X5 is A, C, D, F, G, H, I, K, L, N, P, Q, R, S, W or Y, X6 is A, C, D, E, G, I, K, L, M, P, Q, R, S, or Y, X7 is A, C, D, F, G, H, I, N, P, R, S, T, V, or Y, X8 is A, C, D, E, G, I, R, S, T, V, W, Y, or none, X9 is A, D, E, F, G, I, L, P, R, S, V, W, Y, or none, X 10 is C, D, F, G, K, L, N, P, R, S, T, V, W, Y or none, X 11 is D, F, G, H, I, K, L, N, P, S, T, V, Y or none, X 12 A, D, G, H, I, L, M, P, R, S, T, V, Y or none, X 13 Is C, D, E, H, P, R, S, T, V, Y or none, X 14 A, D, E, F, H, I, L, P, R, T, Y or none, X 15 A, D, E, G, N, Q, R, S, T, V, Y or none, X 16 A, D, E, F, G, H, M, P, S, V, Y or none, X 17 A, D, E, H, N, Q, R, T, Y or none, X 18 Is D, E, R, S, Y or none, X 19 Is N, S, Y or None, X 20 Is D, E, Y or none, X 21 Is E, N, Y or None, X 22 Is Y or None. Exemplarily, CDR3 comprises the sequence shown in any one of SEQ ID NOs: 76-183.

[0101] In one or more embodiments, the single-domain antibody is NB182, NB194, or a variant thereof, wherein CDR1 comprises the sequence shown in any one of SEQ ID NOs: 16, 19, 36-39, and 320, CDR2 comprises the sequence shown in SEQ ID NOs: 52, 53, 55, 72-75, and CDR3 comprises the sequence shown in any one of SEQ ID NOs: 76, 87, and 108-183. Alternatively, CDR1 comprises the sequence shown in SEQ ID NOs: 16 or 19, CDR2 comprises the sequence shown in SEQ ID NOs: 52, 53, 55, 72, and 73, and CDR3 comprises the sequence shown in any one of SEQ ID NOs: 87, 108-111, 113-134, 136-146, 148-154, 156-163, 165-168, 172, 173, and 177-183. Or CDR1 includes the sequence shown in any one of SEQ ID NOs: 19, 36-39, 320, CDR2 includes the sequence shown in any one of SEQ ID NOs: 53, 55, 72-75, and CDR3 includes the sequence shown in any one of SEQ ID NOs: 87, 108-183.

[0102] In one or more embodiments, the single-domain antibody comprises CDR1, CDR2, and CDR3 shown in any one of Group a1 to Group a136 in Table 1:

[0103] Table 1

[0104] Antibody name CDR1CDR2CDR3VHH group NB13944076184a1NB14754177185a2NB14864278186a3NB15374376187a4NB15484479188a5NB15994580189a6NB164104681190a7NB166114782191a8NB169124883192a9NB170134984193a10NB171105085194a11NB172144776195a12NB173155186196a13NB182165276197a14

[0105] <h2 style=";text-align:left;direction:ltr">NB189175387198a15NB192185488199a16NB194195587200a17NB195205682201a18NB196215789202a19NB197225890203a20NB200235991204a21NB202144776205a22NB205246092206a23NB209254076207a24NB211266193208a25NB215276294209a26NB21624609521 0a27NB218284196211a28NB220106397212a29NB22154198213a30NB222296499214a31NB223765100215a32NB5323066101216a33NB5483167102217a34NB7333268103218a35NB7343356104219a36NB7353469105220a37NB7543570106221a38NB755771107222a39NB182 ‐z1165276223a40NB182‐z2165276224a41NB182‐z3165276225a42NB182‐z4165276226a43NB182‐z5165276227a44NB194‐z1197287228a45NB194‐z2197287229a46NB194‐z3197287230a47NB194‐z4197387231a48NB194‐z5195387232a49NB194‐P01195387233a50NB 194‐P021953108234a51NB194‐P031953109235a52NB194‐P041953110236a53NB194‐P051953111237a54NB194‐P063674112238a55N B194‐P071953113239a56NB194‐P081953114240a57NB194‐P091953115241a58NB194‐P101953116242a59NB194‐P111953117243a60<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0106]

[0107] NB194‐P583753164290a107NB194‐P591953165291a108NB194‐P601953166292a109NB194‐P611953167293a1 10NB194‐P621953168294a111NB194‐P633674169295a112NB194‐P643853170296a113NB194‐P653753171297 a114NB194‐P661953172298a115NB194‐P671953173299a116NB194‐P683853174300a117NB194‐P6938531753 01a118NB194‐P703674176302a119NB194‐P711953177303a120NB194‐P721953178304a121NB194‐P731953179 305a122NB194‐P741953180306a123NB194‐P751953181307a124NB194‐P761953182308a125NB194‐P7719531 83309a126NB194‐P29‐z13775135310a127NB194‐P29‐z23775135311a128NB194‐P29‐z33775135312a129NB1 94‐P29‐z43775135313a130NB194‐P29‐z53775135314a131NB194‐P29‐z63775135315a132NB194‐P29‐z7377 5135316a133NB194‐P29‐z83775135317a134NB194‐P29‐z932075135318a135NB194‐P29‐z103775135319a136

[0108] It preferably contains CDR1, CDR2 and CDR3 selected from any one of the following groups: a14, a17, a40-a136, or preferably contains CDR1, CDR2 and CDR3 selected from any one of the following groups: a14, a40-a44, or preferably contains CDR1, CDR2 and CDR3 selected from any one of the following groups: a17, a45-a136.

[0109] In one or more embodiments, the FR1 of the single-domain antibody VHH can be selected from the FR1 of the VHH of each antibody number in Table 1, the FR2 of the VHH can be selected from the FR2 of the VHH of each antibody number in Table 1, the FR3 of the VHH can be selected from the FR3 of the VHH of each antibody number in Table 1, and the FR4 of the VHH can be selected from the FR4 of the VHH of each antibody number in Table 1.

[0110] In a preferred embodiment, the FR region of the single-domain antibody is selected from the FR region of any VHH of SEQ ID NOs: 184-319. Further preferably, the CDR of such an antibody is selected from the CDRs shown in any of the aforementioned groups a1 to a136. In one or more embodiments, the single-domain antibody VHH is shown in any of SEQ ID NOs: 184-319. Preferably, the single-domain antibody is shown in any of SEQ ID NOs: 197, 200, 223-319.

[0111] The PD-1 binding molecules described herein can be monovalent or multivalent single-domain antibodies, multispecific single-domain antibodies, heavy chain antibodies or antigen-binding fragments thereof, or antibodies or antigen-binding fragments thereof, comprising one, two, or more anti-PD-1 single-domain antibodies described herein. The heavy chain antibody further comprises a heavy chain constant region, such as a constant region of a camelid heavy chain antibody or a cartilaginous fish heavy chain antibody. Preferably, the heavy chain constant region is as set forth in SEQ ID NO: 321.

[0112] The present invention also includes derivatives and analogs of the antibodies. "Derivatives" and "analogs" refer to polypeptides that substantially retain the same biological function or activity as the antibodies of the present invention. The derivatives or analogs of the present invention can be (i) polypeptides having a substitution group in one or more amino acid residues, or (ii) polypeptides formed by fusion of a mature polypeptide with another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol), or (iii) polypeptides formed by fusion of an additional amino acid sequence to this polypeptide sequence (such as a leader sequence or secretory sequence or a sequence or protein sequence used to purify the polypeptide, or a fusion protein formed with a 6His tag). According to the teachings herein, these derivatives and analogs are within the scope known to those skilled in the art.

[0113] Without materially affecting the activity of the antibody, those skilled in the art may modify one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more) amino acids in the sequences of the present invention to obtain variants of the antibody or its functional fragment sequence. These variants include (but are not limited to): deletion, insertion, and / or substitution of one or more (generally 1-50, preferably 1-30, more preferably 1-20, and most preferably 1-10) amino acids, as well as addition of one or more (generally within 20, preferably within 10, and more preferably within 5) amino acids to the C-terminus and / or N-terminus. In the art, conservative substitution with amino acids having similar or similar properties generally does not alter protein function. For example, amino acids with similar properties may be substituted in the FR and / or CDR regions of the variable region. Amino acid residues that can be conservatively substituted are well known in the art. Such substituted amino acid residues may or may not be encoded by the genetic code. For another example, adding one or more amino acids to the C-terminus and / or N-terminus generally does not change the function of the protein and is considered to be included in the scope of protection of the present invention.

[0114] Variant forms of the antibodies described herein include: homologous sequences, conservative variants, allelic variants, natural mutants, induced mutants, proteins encoded by DNA that can hybridize with the DNA encoding the antibodies of the present invention under high or low stringency conditions, and polypeptides or proteins obtained using antisera against the antibodies of the present invention.

[0115] In some embodiments, the sequence of the variants of the present invention may be at least 95%, 96%, 97%, 98% or 99% identical to the sequence from which it is derived. The sequence identity of the present invention can be measured using sequence analysis software. For example, the computer program BLAST, particularly BLASTP or TBLASTN, is used with default parameters. The present invention also includes molecules having antibody heavy chain variable regions with CDRs, as long as their CDRs have greater than 90% (preferably greater than 95%, and most preferably greater than 98%) homology to the CDRs identified herein.

[0116] The antibodies of the present invention can be prepared by conventional methods in the art, such as hybridoma technology well known in the art. The heavy chain antibodies of the present invention can be prepared by conventional methods in the art, such as phage display technology well known in the art. Alternatively, the antibodies or heavy chain antibodies of the present invention can be expressed in other cell lines. Suitable mammalian host cells can be transformed with sequences encoding the antibodies of the present invention. Transformation can be carried out by any known method, for example, including packaging the polynucleotide in a virus (or viral vector) and transducing the host cell with the virus (or vector). The transformation procedure used depends on the host to be transformed. Methods for introducing heterologous polynucleotides into mammalian cells are well known in the art, including dextran-mediated transfection, calcium phosphate precipitation, polybrene-mediated transfection, protoplast fusion, electroporation, encapsulating the polynucleotide in liposomes, and directly microinjecting DNA into the nucleus. Mammalian cell lines that can be used as hosts for expression are well known in the art and include, but are not limited to, various immortalized cell lines available from the American Type Culture Collection (ATCC), including, but not limited to, Chinese hamster ovary (CHO) cells, HeLa cells, baby hamster kidney (BHK) cells, monkey kidney cells (COS), human hepatocellular carcinoma cells (e.g., HepG2), etc. Particularly preferred cell lines are selected by determining which cell lines have high expression levels and produce antibodies with essential PD-1 binding properties.

[0117] Nucleic Acids

[0118] The present invention also provides polynucleotides encoding the above-mentioned antibodies or fragments thereof. Provided herein are polynucleotides encoding the heavy chain variable region, light chain variable region, heavy chain, light chain, and each CDR. The polynucleotides of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. The DNA may be single-stranded or double-stranded. The DNA may be a coding strand or a non-coding strand.

[0119] As will be appreciated by those skilled in the art, due to the degeneracy of the genetic code, a vast number of nucleic acids can be produced that all encode the antibodies or antigen-binding fragments thereof of the present invention. Thus, once a specific amino acid sequence has been identified, one skilled in the art can produce any number of different nucleic acids by simply modifying the sequence of one or more codons in a manner that does not alter the amino acid sequence of the encoded protein. Therefore, the present invention also relates to polynucleotides that hybridize to the polynucleotide sequences described above and that have at least 50%, preferably at least 70%, and more preferably at least 80% identity between the two sequences. The present invention particularly relates to polynucleotides that hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "stringent conditions" refer to: (1) hybridization and elution at relatively low ionic strength and relatively high temperature, such as 0.2×SSC, 0.1% SDS, 60°C; or (2) the addition of a denaturing agent during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42°C, etc.; or (3) hybridization occurs only when the identity between the two sequences is at least 90%, preferably at least 95%. Furthermore, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide.

[0120] The full-length nucleotide sequence of the antibody of the present invention or its fragments can generally be obtained by PCR amplification, recombinant methods, or artificial synthesis methods. One feasible method is to synthesize the relevant sequence by artificial synthesis, especially when the fragment length is relatively short. Generally, by first synthesizing multiple small fragments and then ligating them, very long fragments of sequence can be obtained. In addition, the coding sequence of the heavy chain can be fused with an expression tag (such as 6His) to form a fusion protein.

[0121] Once the relevant sequence is obtained, it can be obtained in large quantities using recombinant methods. This is usually done by cloning it into a vector, then transferring it into cells, and then isolating the relevant sequence from the propagated host cells by conventional methods. The biomolecules (nucleic acids, proteins, etc.) involved in the present invention include biomolecules in isolated form. Currently, DNA sequences encoding proteins of the present invention (or fragments thereof, or derivatives thereof) can be obtained entirely through chemical synthesis. This DNA sequence can then be introduced into various existing DNA molecules (or vectors) and cells known in the art. In addition, mutations can also be introduced into the protein sequences of the present invention through chemical synthesis.

[0122] Therefore, the present invention further relates to nucleic acid constructs comprising the above-mentioned appropriate dna sequence and appropriate promoter or control sequence, such as expression vectors and recombinant vectors. These vectors can be used to transform appropriate host cells so that they can express proteins. Vectors generally contain sequences for plasmid maintenance and for cloning and expressing exogenous nucleotide sequences. The sequences (generally referred to as "flanking sequences" in certain embodiments) generally include one or more following nucleotide sequences: promoter, one or more enhancer sequences, replication origin, transcription termination sequence, complete intron sequence containing donor and acceptor splice sites, sequence encoding the leader sequence for polypeptide secretion, ribosome binding site, polyadenylation sequence, multiple linker regions and selectable marker elements for inserting the nucleic acid encoding the antibody to be expressed. Exemplary vectors can be found in CN105154473A and CN111206043A, which are incorporated herein by reference in their entirety.

[0123] Host cells can be prokaryotic cells, such as bacterial cells; lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples include: Escherichia coli, Streptomyces; bacterial cells of Salmonella typhimurium; fungal cells, such as yeast; insect cells such as Drosophila S2 or Sf9; and animal cells such as CHO, COS7, and 293 cells.

[0124] In certain embodiments, the host cell can be various functional cells known in the art, such as various killer cells, including but not limited to cytokine-induced killer cells (CIK), cytokine-induced killer cells stimulated by dendritic cells (DC-CIK), cytotoxic T lymphocytes (CTL), γδT cells, natural killer cells (NK), tumor infiltrating lymphocytes (TIL), lymphokine-activated killer cells (LAK), CD3AK cells (killer cells of anti-CD3 monoclonal antibodies) and CAR-T / TCR-T cells. In certain embodiments, the killer cells are T cells or NK cells. Exemplary NK cells include but are not limited to primary NK cells, NK cell lines (such as NK92) and NKT cells. In certain embodiments, the NK cells are primary NK cells. Exemplary T cells include but are not limited to peripheral blood T lymphocytes, cytotoxic killer T cells (CTL), helper T cells, suppressor / regulatory T cells, γδT cells and cytokine-induced killer cells (CIK), tumor infiltrating lymphocytes (TIL) and other mixed cell populations of T cells. In certain embodiments, the T cells are peripheral blood T lymphocytes and TIL-derived T cells.

[0125] In certain embodiments, the host cell contains coding sequences for and / or expresses a chimeric antigen receptor (CAR).

[0126] Transformation of host cells with recombinant DNA can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryotic organism such as Escherichia coli, competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with CaCl2, using procedures well known in the art. Another method is to use MgCl2. If desired, transformation can also be performed using electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate coprecipitation, conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.

[0127] The obtained transformants can be cultured using conventional methods to express the polypeptide encoded by the gene of the present invention. Depending on the host cell used, the culture medium used can be selected from various conventional culture media. Culture is carried out under conditions suitable for the growth of the host cells. After the host cells grow to an appropriate cell density, the selected promoter is induced using a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

[0128] The polypeptide in the above method can be expressed intracellularly, on the cell membrane, or secreted extracellularly. If necessary, the recombinant protein can be separated and purified by various separation methods using its physical, chemical, and other properties. These methods are well known to those skilled in the art. Examples of these methods include, but are not limited to, conventional renaturation treatment, treatment with a protein precipitant (salting out method), centrifugation, osmotic sterilization, ultrafiltration, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC), and various other liquid chromatography techniques and combinations of these methods.

[0129] Therapeutic uses and pharmaceutical compositions

[0130] By constructing a nanobody library, the inventors discovered, expressed, and purified 126 nanobodies and their variants that bind to PD-1. The antibodies' antigen- and cell-binding abilities and safety profiles were validated through protein- and cell-level affinity assays, tumor cell PD-1 binding assays, epitope competition experiments, and tissue cross-reactivity.

[0131] All aspects of the antibodies described herein can be used to prepare medicaments for preventing or treating various conditions and diseases described herein, particularly diseases or conditions associated with cells expressing PD-1. In some embodiments, the conditions and diseases are cancers, including but not limited to melanoma, lung cancer, head and neck cancer, renal cell carcinoma, urothelial carcinoma, non-Hodgkin's lymphoma, and the like.

[0132] The pharmaceutical compositions herein contain the binding molecules described herein, and pharmaceutically acceptable excipients, including but not limited to diluents, carriers, solubilizers, emulsifiers, preservatives and / or adjuvants. Excipients are preferably non-toxic to the recipient at the dosage and concentration employed. Such excipients include (but are not limited to): saline, buffer, glucose, water, glycerol, ethanol, and combinations thereof. In certain embodiments, the pharmaceutical composition may contain substances for improving, maintaining or retaining, for example, the pH, permeability, viscosity, clarity, color, isotonicity, odor, sterility, stability, dissolution or release rate, absorption or penetration of the composition. These substances are known in the prior art. The optimal pharmaceutical composition can be determined based on the intended route of administration, delivery method, and desired dosage.

[0133] Pharmaceutical compositions for in vivo administration are typically provided as sterile formulations. Sterilization is achieved by filtration through a sterile filtration membrane. When the composition is lyophilized, this method can be used for sterilization before or after lyophilization and rehydration. The pharmaceutical compositions of the present invention can be selected for parenteral delivery. Compositions for parenteral administration can be stored in lyophilized form or in solution. For example, they can be prepared by conventional methods using physiological saline or an aqueous solution containing glucose and other adjuvants. Parenteral compositions are typically placed in a container with a sterile access port, such as an intravenous solution strip or vial with a stopper pierceable by a hypodermic needle. Alternatively, the composition can be selected for inhalation or delivery through the digestive tract (such as orally). The preparation of such pharmaceutically acceptable compositions is within the skill of the art. Other pharmaceutical compositions will be apparent to those skilled in the art, including formulations containing antibodies in sustained or controlled release delivery formulations. Techniques for formulating a variety of other sustained or controlled delivery methods (such as liposomal carriers, bioerodible microparticles or porous beads, and depot injections) are also known to those skilled in the art.

[0134] Once the pharmaceutical composition is formulated, it is stored in a sterile vial in the form of a solution, suspension, gel, emulsion, solid, crystal or in the form of a dehydrated or lyophilized powder. The formulation can be stored in a ready-to-use form or in the form of rehydration before administration (e.g., lyophilization). The present invention also provides a test kit for producing a single-dose administration unit. The test kit of the present invention can each contain a first container with a dried protein and a second container with an aqueous formulation. In certain embodiments of the present invention, a test kit containing a single-chamber and multi-chamber prefilled syringe (e.g., a liquid syringe and a lyophilizing syringe) is provided.

[0135] The present invention also provides a method for treating a patient (especially a patient's PD-1 related disease) by administering a binding molecule or pharmaceutical composition thereof according to any embodiment of the present invention. As used herein, the terms "patient," "subject," "individual," and "object" are used interchangeably herein and include any organism, preferably an animal, more preferably a mammal (e.g., rat, mouse, dog, cat, rabbit, etc.), and most preferably a human. "Treatment" refers to the subject adopting a treatment regimen described herein to achieve at least one positive therapeutic effect (e.g., a decrease in the number of cancer cells, a decrease in tumor volume, a decrease in the rate of cancer cell infiltration into peripheral organs, or a decrease in the rate of tumor metastasis or tumor growth). The treatment regimen that effectively treats a patient can vary according to a variety of factors (such as the patient's disease state, age, weight, and the ability of the therapy to stimulate an anti-cancer response in the subject).

[0136] The therapeutically effective amount of the pharmaceutical composition containing the binding molecule of the present invention that will be adopted will depend on, for example, treatment degree and target.It will be appreciated by those skilled in the art that the appropriate dosage level for the treatment of will depend in part on the size (body weight, body surface or organ size) and / or condition (age and general health) of the molecule, indication, route of administration and the patient that are delivered and change.In certain embodiments, the clinician can titrate the dosage and change the route of administration to obtain best therapeutic effect.For example, about 10 micrograms / kg body weight-about 50 milligrams / kg body weight every day.

[0137] The frequency of administration will depend on the pharmacokinetic parameters of the binding molecule in the formulation used. The clinician typically administers the composition until a dose is achieved that achieves the desired effect. The composition can thus be administered as a single dose, or as two or more doses (which may or may not contain the same amount of the desired molecule) over time, or as a continuous infusion via an implantable device or catheter.

[0138] The pharmaceutical composition is administered orally, by injection via the intravenous, intraperitoneal, intracerebral (intracerebral), intracerebroventricular, intramuscular, intraocular, intraarterial, portal vein or intralesional routes; by sustained release systems or by implantation devices.

[0139] Diagnostics, Tests, and Kits

[0140] Due to their high affinity for PD-1, the binding molecules of the present invention can be used in assays, such as binding assays, to detect and / or quantify PD-1 expressed in tissues or cells. Binding molecules, such as single-domain antibodies, can be used in studies to further investigate the role of PD-1 in disease. Methods for detecting PD-1 are generally as follows: obtaining a cell and / or tissue sample; and detecting the level of PD-1 in the sample.

[0141] The PD-1 binding molecules of the present invention can be used for diagnostic purposes to detect, diagnose, or monitor diseases and / or conditions associated with PD-1. The present invention provides methods for detecting the presence of PD-1 in a sample using classical immunohistological methods known to those skilled in the art. Detection of PD-1 can be performed in vivo or in vitro. Examples of methods suitable for detecting the presence of PD-1 include ELISA, FACS, RIA, and the like.

[0142] For diagnostic applications, binding molecules such as single domain antibodies are typically labeled with a detectable labeling group. Suitable labeling groups include, but are not limited to, radioisotopes or radionuclides (e.g., 3H, 14C, 15N, 35S, 90Y, 99Tc, 111In, 125I, 131I), fluorescent groups (e.g., FITC, rhodamine, lanthanide phosphors), enzymatic groups (e.g., horseradish peroxidase, β-galactosidase, luciferase, alkaline phosphatase), chemiluminescent groups, biotinyl groups, or predetermined polypeptide epitopes recognized by secondary reporters (e.g., leucine zipper pair sequences, binding sites for secondary antibodies, metal binding domains, epitope tags), MRI (magnetic resonance imaging) or CT (computed tomography) contrast agents. Various methods for labeling proteins are known in the art and can be used to perform the present invention.

[0143] Another aspect of the present invention provides a method for detecting the presence of a test molecule that competes with the antibodies of the present invention for binding to PD-1. One example of such an assay involves measuring the amount of free antibody in a solution containing a certain amount of PD-1 in the presence or absence of a test molecule. An increase in the amount of free antibody (i.e., antibody that is not bound to PD-1) will indicate that the test molecule is able to compete with the antibody for binding to PD-1. In one embodiment, the antibody is labeled with a labeling group. Alternatively, the test molecule is labeled and the amount of free test molecule is monitored in the presence or absence of the antibody.

[0144] The present invention also provides a detection kit for detecting PD-1 levels, which includes an antibody that recognizes the PD-1 protein, a lysis medium for dissolving the sample, and common reagents and buffers required for detection, such as various buffers, detection labels, and detection substrates. The detection kit can be an in vitro diagnostic device.

[0145] The present invention specifically includes the following embodiments:

[0146] 1. A PD-1 binding molecule comprising an anti-PD-1 single domain antibody, wherein the complementarity determining region (CDR) of the single domain antibody comprises CDR1, CDR2, and CDR3, wherein CDR1 comprises the sequence shown in SEQ ID NO: 1, CDR2 comprises the sequence shown in SEQ ID NO: 2, and CDR3 comprises the sequence shown in SEQ ID NO: 3, wherein:

[0147] SEQ ID NO: 1 is GX1X2X3X4X5X6X7, wherein X1 is D, F, G, H, L or R, X2 is P, S or T, X3 is A, F, I, L, N, R, S or V, X4 is D, F, G, L, M, N or S, X5 is A, D, F, G, I, N, R, S or T, X6 is D, F, H, I, L, S, V, W or Y, and X7 is A, D, E, G, N, P, S or T; preferably, SEQ ID NO: 1 is GX1X2X3X4X5X6X7, wherein X1 is D, F, G, H, L or R, X2 is P, S or T, X3 is F or S, X4 is F or S, X5 is G, I or T, X6 is S or Y, and X7 is A or D,

[0148] SEQ ID NO: 2 is X1X2X3X4X5X6X7X8X9, wherein X1 is I, L, S, T or V, X2 is A, N, S or T, X3 is F, G, I, K, L, M, N, Q, R, S, T, W or Y, X4 is A, D, G, H, N, R, S or T, X5 is A, D, G, N, R, S or none, X6 is G or R, S or T, X7 is D, E, I, L, M, N, R, S, T or V, X8 is A, K, M, Q or T, and X9 is A or none; preferably, SEQ ID NO: 2 is X1X2X3X4X5X6X7X8X9, wherein X1 is I, L, S, T or V, X2 is A, N, S or T, X3 is F, G, I, K, L, M, N, Q, R, S, T, W or Y, X4 is A, D, G, H, N, R, S or T, X5 is A, D, G, N, R, S or none, X6 is G or R, S or T, X7 is D, E, I, L, M, N, R, S, T or V, X8 is A, K, M, Q or T, and X9 is A or none; preferably, NO:2 is X1X2X3X4X5GX7TX9, wherein X1 is I or V, X2 is N, S or T, X3 is F, L or N, X4 is A, G, S or T, X5 is R or none, X7 is D, N, I or T, and X9 is none.

[0149] SEQ ID NO: 3 is X1X2X3X4X5X6X7X8X9X 10 X 11 X 12 X 13 X 14 X 15 X 16 X 17 X 18 X 19 X 20 X 21 X 22, wherein X1 is A, E, G, N, R, S, T, or V, X2 is A, G, I, K, L, P, R, T, or V, X3 is A, D, E, G, K, N, P, R, S, V, or Y, X4 is A, C, D, E, G, I, K, L, R, S, T, V, or Y, and X5 is A, C, D, F, G, H, I, K, L, N, P, Q, R, S , W or Y, X6 is A, C, D, E, G, I, K, L, M, P, Q, R, S or Y, X7 is A, C, D, F, G, H, I, N, P, R, S, T, V or Y, X8 is A, C, D, E, G, I, R, S, T, V, W, Y or none, X9 is A, D, E, F, G, I, L, P, R, S, V, W, Y or none, X 10 is C, D, F, G, K, L, N, P, R, S, T, V, W, Y or none, X 11 is D, F, G, H, I, K, L, N, P, S, T, V, Y or none, X 12 A, D, G, H, I, L, M, P, R, S, T, V, Y or none, X 13 Is C, D, E, H, P, R, S, T, V, Y or none, X 14 A, D, E, F, H, I, L, P, R, T, Y or none, X 15 A, D, E, G, N, Q, R, S, T, V, Y or none, X 16 A, D, E, F, G, H, M, P, S, V, Y or none, X 17 A, D, E, H, N, Q, R, T, Y or none, X 18 Is D, E, R, S, Y or none, X 19 Is N, S, Y or None, X 20 Is D, E, Y or none, X 21 Is E, N, Y or None, X 22 Y or none; preferably, SEQ ID NO: 3 is X1X2X3X4X5X6X7X8X9X 10 X 11 X 12 X 13 X 14 X 15 X 16 X 17 X 18 X 19 X 20 X 21 X 22, wherein X1 is E, G, N or V, X2 is A, G, I, L or V, X3 is A, D, E, G, N, V ​​or Y, X4 is A, G, I, K, R or S, X5 is C, I, L, P, Q, R or W, X6 is E, K, P, Q or R, X7 is C, D, H, N, P or Y, X8 is E, G, R, V or W, X9 is F, G, L, S, V or W, X 10 is C, D, G, L, R, S or V, X 11 is F, G, I, L, N, S, T, or V, X 12 Is H, L, P, R, S, T or Y, X 13 is D, H, P, S, T or V, X 14 is E, F, H, I, L, P or R, X 15 A, S or V, X 16 is A, D, E, G, H or V, X 17 is H, N, Q, R or Y, X 18 -X 22 It is nothing.

[0150] 2. The PD-1 binding molecule according to item 1, wherein the CDR1 of the single-domain antibody comprises the sequence shown in any one of SEQ ID NOs: 4-39, 320, the CDR2 comprises the sequence shown in any one of SEQ ID NOs: 40-75, and the CDR3 comprises the sequence shown in any one of SEQ ID NOs: 76-183,

[0151] Preferably, the single-domain antibody comprises CDR1, CDR2 and CDR3 shown in any one of Group a1 to Group a136 in Table 1.

[0152] 3. The PD-1 binding molecule according to item 1 or 2, characterized in that

[0153] The FR region of the single-domain antibody comprises the FR region of any one VHH selected from SEQ ID NO: 184-319, and / or

[0154] The single-domain antibody VHH is shown in any one of SEQ ID NOs: 184-319, and / or

[0155] The PD-1 binding molecule is a monovalent or multivalent single-domain antibody, a multispecific single-domain antibody, a heavy chain antibody or an antigen-binding fragment thereof, or an antibody or an antigen-binding fragment thereof comprising one, two or more of the single-domain antibodies.

[0156] 4. The PD-1 binding molecule according to item 3, wherein the PD-1 binding molecule is a heavy chain antibody, and the heavy chain antibody further comprises a heavy chain constant region.

[0157] Preferably, the heavy chain constant region comprises the sequence shown in SEQ ID NO: 321.

[0158] 5. A polynucleotide, characterized in that the polynucleotide is selected from:

[0159] (1) The coding sequence of the PD-1 binding molecule described in any one of items 1 to 4;

[0160] (2) The complementary sequence of (1);

[0161] (3) A 5-50 bp fragment of any of the sequences in (1) or (2).

[0162] 6. A nucleic acid construct, characterized in that the nucleic acid construct comprises the polynucleotide according to item 5,

[0163] Preferably, the nucleic acid construct is a recombinant vector or an expression vector.

[0164] 7. A phage comprising the PD-1 binding molecule according to any one of items 1 to 4,

[0165] Preferably, the PD-1 binding molecule is displayed on the surface of the bacteriophage.

[0166] 8. A host cell, characterized in that:

[0167] (1) expressing and / or secreting the PD-1 binding molecule described in any one of items 1 to 4; and / or

[0168] (2) comprising the polynucleotide according to item 5; and / or

[0169] (3) Comprising the nucleic acid construct according to item 6.

[0170] 9. A method for producing a PD-1 binding molecule, comprising: culturing the host cell of item 8 under conditions suitable for producing the PD-1 binding molecule, and optionally purifying the PD-1 binding molecule from the culture.

[0171] 10. A pharmaceutical composition comprising the PD-1 binding molecule of any one of items 1 to 4, the polynucleotide of item 5, the nucleic acid construct of item 6, the phage of item 7, or the host cell of item 8, and a pharmaceutically acceptable excipient.

[0172] Preferably, the pharmaceutical composition is used to treat cancer.

[0173] 11. Use of the PD-1 binding molecule described in any one of items 1 to 4 in the preparation of a medicament for preventing or treating cancer.

[0174] 12. A kit for detecting PD-1 for evaluating drug treatment efficacy or diagnosing cancer, the kit comprising the PD-1 binding molecule described in any one of items 1 to 4, the polynucleotide described in item 5, the nucleic acid construct described in item 6, the bacteriophage described in item 7, or the host cell described in item 8.

[0175] Preferably, the kit further comprises a reagent for detecting the binding of PD-1 to a single domain antibody, an antibody or an antigen-binding fragment thereof,

[0176] More preferably, the reagent is a reagent for detecting the binding by enzyme-linked immunosorbent assay.

[0177] 13. A non-diagnostic method for detecting the presence of PD-1 in a sample, the method comprising: incubating the sample with the PD-1 binding molecule described in any one of items 1-4, and detecting the binding of PD-1 to a single domain antibody, an antibody, or an antigen-binding fragment thereof, thereby determining the presence of PD-1 in the sample.

[0178] 14. Use of the PD-1 binding molecule described in any one of items 1 to 4 in the preparation of a kit for detecting PD-1 in a sample, evaluating the efficacy of drug treatment, or diagnosing cancer.

[0179] The present invention will be described below by way of specific examples. It should be understood that these examples are merely illustrative and are not intended to limit the scope of the present invention. The methods and materials used in the examples are, unless otherwise stated, conventional materials and methods in the art.

[0180] Example

[0181] Example 1, Alpaca Immunization

[0182] 1.1 Immunogen Preparation:

[0183] According to the PD-1 protein sequence searched on NCBI, it was fused with the human IgG Fc fragment sequence and commissioned Nanjing GenScript to synthesize and construct the eukaryotic expression vector of the pCDNA3.4 (Thermo) plasmid. The synthesized plasmid was cloned and cloned into EXpiCHO TM The protein was expressed using the Thermo Fisher expression system and then subjected to one-step affinity purification using a 5 mL Protein A prepacked column (GE). The purified sample was replaced with PBS buffer and the purity was determined by SDS-PAGE electrophoresis gel and HPLC. The activity was determined by ELISA and then aliquoted and frozen at -80°C for subsequent immunization.

[0184] 1.2 Alpaca Immunity:

[0185] For the first immunization, 400 μg of the antigen (PD-1.hFc) was mixed with an adjuvant (GERBU FAMA) and injected subcutaneously at four sites on the alpaca's back, with a 1 mL dose per site. For the second to seventh immunizations, 200 μg of the antigen was injected subcutaneously at four sites on the alpaca's back, with a 1 mL dose per site. Each immunization was separated by one week.

[0186] 1.3 Immune serum titer detection:

[0187] 1.3.1 Protein level titer detection

[0188] The plates were coated with PD-1.His antigen overnight at 4°C. After blocking and washing, serially diluted serum was added to the ELISA plate and incubated with anti-llama IgG HRP (Abcam). After washing, TMB colorimetric buffer was added for color development. The reaction was terminated with 2M HCl, and the absorbance at OD450 nm was measured using a microplate reader. The results are shown in Figure 1. After seven immunizations, the alpaca titer reached a high level (>81,000).

[0189] 1.3.2 Cell-level titer detection

[0190] PD-1 transfected CHO-K1 cells were plated in 96-well plates at a cell volume of 3×10 5 cells / well. The cells were then incubated with serum diluted threefold. After incubation and washing, anti-llama IgG PE (Jackson) was added. After washing, the cells were resuspended in PBS and the fluorescence intensity (MFI) was measured using a flow cytometer (Beckman). After seven immunizations, the alpaca titer reached 9000 at the cellular level. The results are shown in Figure 2.

[0191] Example 2: Construction and screening of a nanobody immune library targeting PD-1

[0192] (1) After 7 immunizations, 100 mL of peripheral blood lymphocytes were collected from the camels and total RNA was extracted. RNA extraction was performed according to the instructions for the RNAiso reagent from TAKARA.

[0193] (2) Using RNA as template and oligo dT as primer, synthesize the first strand of cDNA according to the instructions of TAKARA reverse transcriptase.

[0194] (3) Using PrimeSTAR high-fidelity DNA polymerase, nested PCR was performed to obtain the variable region encoding gene of the heavy chain antibody. Nested PCR was used to amplify the variable region fragment of the heavy chain antibody:

[0195] First round of PCR:

[0196] Upstream primer: GTCCTGGCTGCTCTTCTACAAGGC

[0197] Downstream primer: GGTACGTGCTGTTGAACTGTTCC

[0198] The fragment between the heavy chain antibody guide peptide and antibody CH2 was amplified, annealed at 55°C for 30 cycles; a DNA fragment of approximately 600 bp was recovered and used as a template for the second round of PCR.

[0199] Second round of PCR:

[0200] Upstream primer: GATGTGCAGCTGCAGGAGTCTGGRGGAGG

[0201] Downstream primer: GGACTAGTGCGGCCGCTGGAGACGGTGACCTGGGT

[0202] The fragments between the heavy chain antibody FR1 region and the long and short hinge regions (long fragments and short fragments) were amplified, annealed at 55°C for 30 cycles, and the target fragment was recovered. The results showed that the size of the fragment was approximately 500 bp, that is, the electrophoresis band of the nanobody gene was approximately 500 bp.

[0203] (4) Phagemid pME207 and the PCR amplification product were double-digested with Sfi I and Not I (NEB), respectively. After recovery and quantification, the two fragments were ligated with T4 DNA ligase (TaKaRa) at a molar ratio of 1:3 at 16°C overnight.

[0204] (5) After ethanol precipitation, the ligation product was dissolved in 100 μL sterile water and electroporated into Escherichia coli TG1 ten times. Take 100 μL of the bacterial solution after electroporation and culture, dilute it in multiple proportions, spread it on the ampicillin LB culture plate, calculate the storage capacity, and spread the rest on the ampicillin 2×YT culture plate, and culture it upside down at 37°C for 13 to 16 hours. Use 10 mL of 2×YT culture medium to scrape the bacterial moss on the culture plate, add glycerol to a final concentration of 25%, divide it into aliquots, and store it at -80°C for later use. The storage capacity is 4.3×10 9 To detect the insertion rate of the library, 48 clones were randomly selected for colony PCR, and the results showed that the insertion rate had reached more than 90%.

[0205] (6) Based on the calculated reservoir capacity, 10 times the reservoir capacity of live cells was inoculated into 200 mL of 2×YT (containing 2% glucose and 100 μg / mL ampicillin) and cultured at 37°C, 200 rpm until the OD600 reached 0.5. Helper phage was added at a multiplicity of infection of 20:1. The cells were allowed to stand at 37°C for 30 min and then incubated at 37°C, 200 rpm for 30 min. The culture was centrifuged and the pellet was resuspended in 200 mL of 2×YT (containing 100 μg / mL ampicillin and 50 μg / mL kanamycin). After overnight incubation at 37°C and 250 r / min, the supernatant was centrifuged at 8000 rpm, 5×PEG / NaCl solution was added, the culture was placed on ice for 60 min, and the supernatant was centrifuged at 8000 rpm for 30 min. The pellet was resuspended in 5 mL of PBS to obtain an anti-PD-1 single domain heavy chain antibody (VHH) immune library. 10 μL was taken for titer determination, and the rest was aliquoted and stored at -80°C for later use.

[0206] (7) PD-1 protein was coated on the enzyme labeling plate at 5 μg / mL, 100 μL per well, and placed at 4°C overnight. A negative control was also set up. The next day, 200 μL of 3% BSA was added to each of the five wells and blocked at room temperature for 2 hours. After 2 hours, the plate was washed three times with PBST (PBS containing 0.05% Tween 20). After washing the plate, 100 μL of phage (2-3×10 11 The cells were then screened using a tfu-immunized camel nanobody phage display gene library (using a phage display library containing TFU-immunized camels) for 1.5 hours at room temperature. The supernatant after negative screening was then transferred to the target antigen-coated wells and incubated at room temperature for 1.5 hours. Unbound phage were washed 12 times with PBST (PBS containing 0.05% Tween 20) to remove unbound phage. Phage specifically bound to PD-1 were dissociated with Glycine (SIGMA). The eluted phage were neutralized with Tris (Invitrogen, 1M, pH 8.0) and infected with TG1 cells in the logarithmic phase. After propagation and amplification, the next round of "adsorption-elution" was performed. Finally, the eluted phage were infected with TG1 cells, which were then induced to express the nanobody using IPTG (Thermo). The supernatant of the TG1 expression was used for ELISA binding assay and PD-L1.hFc blocking assay. The secondary antibody used for ELISA binding detection was anti-c-myc Antibody HRP (Bethyl), and the secondary antibody used for blocking PD-L1 binding detection was Goat anti-Human IgG-Fc Fragment Antibody HRP (Bethyl).

[0207] (8) After sequence analysis, a total of 39 nanobodies that can bind to PD-1 protein were obtained, as shown in the following table.

[0208]

[0209]

[0210] Example 3, Expression and purification of candidate antibodies

[0211] The nanobody was constructed into the pCDNA3.4-IgG4 vector and then TM The protein was expressed using the Thermo Fisher expression system. After one week of expression, the supernatant was collected and purified using Protein A (GE). Protein quality was then measured using Nanodrop and purity was determined by HPLC. The resulting protein purity and yield met the requirements of subsequent experiments. IgG4 antibodies for Keytruda and Opdivo were prepared using sequences provided at https: / / www.drugbank.ca / .

[0212] Example 4, Characterization of Candidate Antibodies

[0213] Protein-level affinity testing: Surface plasmon resonance (SPR) was used to measure the binding kinetics and affinity of the antibody for the human PD-1.Fc antigen. The purified antibody was passed through a sensor chip pre-immobilized with protein A, where it was captured by protein A. Five different concentrations of PD-1.Fc protein were then used as the mobile phase, with association and dissociation times of 30 and 60 minutes, respectively. Biacore Evaluation Software 2.0 (GE) was used to analyze the association rate (ka), dissociation rate (kd), and equilibrium constant (KD). The marketed PD-1 antibody drugs Keytruda and Opdivo were used as controls. The results are shown in the table below.

[0214]

[0215]

[0216] Example 5: PD-1 binding in different species

[0217] ELISA plates were coated with PD-1 proteins (ACROBiosystems) from different species (human, cynomolgus macaque, and murine) at a concentration of 1 μg / ml and incubated overnight at 4°C. After blocking and washing, the diluted antibodies were added to the plates and incubated at room temperature for 2 hours. After washing, Goat anti-Human IgG-Fc Fragment Antibody HRP (Bethyl) secondary antibody was added and incubated at room temperature for 1 hour. After washing, TMB colorimetric solution was added, and the reaction was terminated with 2M HCl. The OD450 value was read using a microplate reader.

[0218] The experimental results are shown in the table below. The candidate antibodies, Keytruda and Opdivo all bind to human and crab-eating macaque PD-1, but do not bind to murine PD-1 protein.

[0219]

[0220] Example 6: CD28 family protein binding test

[0221] ELISA plates were coated with CD28 family proteins (CD28, CTLA-4, ICOS, and PD-1) (ACROBiosystems) at a concentration of 1 μg / ml and incubated overnight at 4°C. After blocking and washing, the diluted antibodies were added to the plates and incubated at room temperature for 2 hours. After washing, a goat anti-human IgG-Fc fragment HRP (Bethyl) secondary antibody was added and incubated at room temperature for 1 hour. After washing, TMB colorimetric solution was added, and the reaction was terminated with 2M HCl. The OD450 value was read using a microplate reader.

[0222] The experimental results are shown in the table below. The candidate antibodies, Keytruda, and Opdivo only bind to the PD-1 protein and do not bind to other proteins in the CD28 family.

[0223]

[0224] Example 7: Epitope competition experiment

[0225] A Biacore T200 (GE) instrument was used, with a detection temperature of 25°C and a flow rate of 30 μl / min using 1× HBS-EP+ buffer (10 mM HEPES, 150 mM NaCl, 3 mM EDTA, and 0.05% v / v Surfactant P20, GE). PD-1-His was dissolved in acetate buffer, pH 4.0 (Biacore Amine Coupling Kit, GE) to a final concentration of 10 μg / ml. PD-1-His was immobilized on channel 2 (FC-2) of a CM5 chip (GE) according to the amino coupling kit instructions, at approximately 21 RU. Channel 1 (FC-1) served as a blank control. Antibodies were diluted to the target concentration in 1× HBS-EP+. Chips FC-1 and FC-2, where PD-1 was immobilized, were injected with one antibody to saturation, followed by the other antibody to saturation to evaluate competition between the two antibodies. After the second antibody injection, the complex was allowed to dissociate for 400 s. Finally, the chip surface was regenerated by injecting 50 mM NaOH for 15 seconds. Data were processed using Biacore Evaluation Software 2.0 (GE), and the sensorgrams were double-referenced and subtracted to record the FC2-1 signal.

[0226] The experimental results are shown in the table below. NB194 and NB182 antibodies bind to epitopes that partially overlap with those of Keytruda and Opdivo. Results for the remaining antibodies were similar to those of NB194 and NB182, with all antibodies partially competing with the epitopes of Keytruda and Opdivo.

[0227]

[0228]

[0229] Example 8: Antibody functional activity test

[0230] 1) Reporter gene experiment. First, adjust the density of GS / C2-PDL1 (GenScript) target cells to 5*10 in antibiotic-free culture medium. 5 20 μL of the solution was plated per well in a 384-well plate and incubated for 16-20 hours. Antibodies were serially diluted with RMPI1640+10% FBS buffer, and the density of GS-J2 / PD1 (GenScript) effector cells was adjusted to 2*10 using antibiotic-free culture medium. 6The remaining medium in the 384-well plate was removed, and 20 μL of antibody and 20 μL of GS-J2 / PD1 effector cells were added to each well and incubated for 6 hours. Finally, 40 μL of One-Glo substrate was added to each well and incubated for 10 minutes before detection on a microplate reader. As shown in Figure 3, the antibodies demonstrated good functional activity in the Reporter Gene Assay, with EC50 values ​​of 16.3 nM and 7.0 nM for NB182 and NB194, and 3.3 nM and 7.3 nM for Keytruda and Opdivo, respectively. The EC50 values ​​for the remaining antibodies ranged from 1.7 to 75 nM.

[0231] 2) Mixed Lymphocyte Reaction. 100 ml of peripheral blood was drawn from a healthy individual for PBMC isolation. The monocytes from the PBMCs were then isolated and induced to mature dendritic cells (DCs) over nine days. On the ninth day, the DCs were quality-tested by flow cytometry. If they met the criteria for induction and maturation, another 100 ml of human peripheral blood was obtained for PBMC isolation. CD4+ T cells from the PBMCs were then isolated and incubated with effector and stimulator cells at an E:T ratio of 5:1. The test sample was then added to the cells at 8 concentrations in three replicates, with a 10-fold dilution factor and an initial concentration of 10-50 μg / ml. The cells were incubated for three days. The cell culture supernatant was collected and assayed for IL-2 and IFN-γ release.

[0232] The test results are shown in Figures 4 and 5. Within a certain range, NB182 and NB194 can promote T cell secretion of IL-2 and IFN-γ in a dose-dependent manner, and exhibit functional effects comparable to those of Keytruda and Opdivo. The results for the remaining antibodies are similar to those of NB182 and NB194, all of which can promote T cell secretion of IL-2 and IFN-γ in a dose-dependent manner: IL-2 EC50 ranges from 0.115nM to 3.278nM, and IFN-γ EC50 ranges from 0.078nM to 1.102nM.

[0233] Example 9: Antibody specificity verification

[0234] 1) Membrane protein cross-reactivity

[0235] Membrane protein cross-reactivity was assessed using the Membrane Proteome Array (MPA) screening platform developed by Integral Molecular. HEK293 cells were transfected with 5,300 different human membrane proteins for display on their cell surface. FACS was used to detect antibody binding signals to these proteins, thereby evaluating the specificity of the antibodies tested. The MPA screening results (Figures 6 and 7) showed that NB182 and NB194 antibodies bound exclusively to the human PD-1 protein and did not bind to over 5,000 other proteins. With the exception of NB171, all other antibodies also bound exclusively to the human PD-1 protein.

[0236] 2) Tissue cross-reactivity

[0237] Frozen sections of 34 tissues were prepared, air-dried at room temperature, and fixed with acetone. Blocking was performed using Reagents A and B of the Endogenous Biotin Blocking Kit (Sanggong, E674001). Biotin-labeled antibody samples were incubated for 30 minutes, washed, and then incubated with horseradish peroxidase-labeled streptavidin (Abcam, ab7403) for 15 minutes. DAB was used for color development and hematoxylin counterstained, then the sections were mounted in neutral plastic and air-dried for microscopic examination. The positive control was an anti-PD-1 antibody (Abcam), and the negative control was an IgG4 isotype control.

[0238] NB182 and NB194 antibodies specifically bind to normal human lymphocytes, including those in the lymph nodes, spleen, and thymus. Except for NB171, the remaining antibodies also specifically bind only to normal human lymphocytes.

[0239]

[0240]

[0241] Example 10: Antibody Humanization

[0242] NB182 and NB194 were humanized using CDR region grafting, following the humanization method for nanobodies (J. Biol. Chem. 2009; 284: 3273-3284). Germline templates with high homology to NB182 and NB194 were screened using the IgBLAST database (http: / / www.ncbi.nlm.nih.gov / igblast / ). Affinity tests were performed on the humanized antibodies before and after humanization using Biacore. Purified antibodies were passed through a sensor chip pre-immobilized with protein A, where they were captured by protein A. Five different concentrations of PD-1.His protein were used as the mobile phase, with association and dissociation times of 30 and 60 minutes, respectively. Biacore Evaluation Software 2.0 (GE) was used to analyze the association rate (ka), dissociation rate (kd), and equilibrium constant (KD). The humanized molecules NB182-z1 and NB182-z2 had the same affinity as NB182, while NB182-z3, NB182-z4, and NB182-z5 had similar affinity to NB182. The humanized molecules NB194-z4 and NB194-z5 had the same affinity as NB194, while NB194-z1, NB194-z2, and NB194-z3 had similar affinity to NB194.

[0243] Sample ka(1 / Ms)kd(1 / s)KD(M)NB1827.38E+036.40E-058.67E-09NB182-z19.22E+037.61E-058.25E-09NB182-z25.60E+034.59E-058.20E-09NB182-z36.00E+037.11E-051.18E-08NB182-z46.48E+039.73E-051.50E-08NB182-z56.46E+039.07E -051.40E-08NB1942.12E+051.05E-044.94E-10NB194-z11.28E+051.07E-048.37E-10NB194-z29.76E+049.88E-051.01 E-09NB194-z31.41E+051.39E-049.87E-09NB194-z41.33E+057.79E-055.86E-10NB194-z51.33E+057.92E-055.98E-10

[0244] Example 11: Mutant Antibodies

[0245] The NB194 antibody was subjected to random point-wise mutagenesis using the GeneMorph II kit (Agilent, 200550). Phage antibody libraries were then constructed and screened, yielding 77 mutant antibodies (NB194-P1 to NB194-P77). These antibodies demonstrated similar affinity and functional activity to NB194. As shown in the table below and Figure 8, the NB194-P29 mutation exhibited the highest affinity, a five-fold increase compared to NB194, and also exhibited improved functional activity.

[0246] Sample ka(1 / Ms)kd(1 / s)KD(M)NB1941.39E+057.36E-055.31E-10NB194-P292.43E+052.86E-051.18E-10

[0247] Example 12: Humanization of NB194-P29

[0248] The NB194-P29 antibody was humanized using the humanization approach described in Example 10, and 10 humanized molecules were obtained. The affinities of all the molecules were similar to that of NB194-P29.

[0249] Sample ka(1 / Ms)kd(1 / s)KD(M)NB194-P292.90E+054.37E-051.51E-10NB194-P29-z11.17E+053.06E-052.63E-10NB194-P29-z21 .29E+051.66E-051.29E-10NB194-P29-z31.86E+053.75E-052.02E-10NB194-P29-z41.17E+052.61E-052.22E-10NB194-P29 -z51.21E+052.43E-052.00E-10NB194-P29-z61.13E+053.02E-052.68E-10NB194-P29-z71.45E+052.18E-051.50E-10NB194 -P29-z81.08E+052.54E-052.35E-10NB194-P29-z91.24E+055.03E-054.06E-10NB194-P29-z109.68E+041.74E-051.79E-10

Claims

1. A PD-1 binding molecule comprising an anti-PD-1 single domain antibody, wherein the complementarity determining region (CDR) of the single domain antibody comprises CDR1, CDR2 and CDR3, wherein CDR1 comprises the sequence shown in SEQ ID NO: 1, CDR2 comprises the sequence shown in SEQ ID NO: 2, and CDR3 comprises the sequence shown in SEQ ID NO: 3, in, SEQ ID NO: 1 is GX 1 X 2 X 3 X 4 X 5 X 6 X 7 , where X 1 D, F, G, H, L or R, X 2 P, S or T, X 3 A, F, I, L, N, R, S or V, X 4 D, F, G, L, M, N or S, X 5 A, D, F, G, I, N, R, S or T, X 6 D, F, H, I, L, S, V, W or Y, X 7 A, D, E, G, N, P, S or T; preferably, SEQ ID NO: 1 is GX 1 X 2 X 3 X 4 X 5 X 6 X 7 , where X 1 D, F, G, H, L or R, X 2 P, S or T, X 3 F or S, X 4 F or S, X 5 is G, I or T, X 6 S or Y, X 7 is A or D, SEQ ID NO: 2 is X 1 X 2 X 3 X 4 X 5 X 6 X 7 X 8 X 9 , where X 1 I, L, S, T or V, X 2 A, N, S or T, X 3 is F, G, I, K, L, M, N, Q, R, S, T, W or Y, X 4 A, D, G, H, N, R, S or T, X 5 A, D, G, N, R, S or none, X 6 G or R, S or T, X 7 D, E, I, L, M, N, R, S, T or V, X 8 is A, K, M, Q or T, X 9 A or none; preferably, SEQ ID NO: 2 is X 1 X 2 X 3 X 4 X 5 GX 7 TX 9 , where X 1 I or V, X 2 N, S or T, X 3 F, L or N, X 4 A, G, S or T, X 5 R or None, X 7 is D, N, I or T, X 9 For nothing, SEQ ID NO:3 is X 1 X 2 X 3 X 4 X 5 X 6 X 7 X 8 X 9 X 10 X 11 X 12 X 13 X 14 X 15 X 16 X 17 X 18 X 19 X 20 X 21 X 22 , where X 1 is A, E, G, N, R, S, T, or V, X 2 is A, G, I, K, L, P, R, T, or V, X 3 is A, D, E, G, K, N, P, R, S, V or Y, X 4 is A, C, D, E, G, I, K, L, R, S, T, V or Y, X 5 is A, C, D, F, G, H, I, K, L, N, P, Q, R, S, W or Y, X 6 is A, C, D, E, G, I, K, L, M, P, Q, R, S or Y, X 7 is A, C, D, F, G, H, I, N, P, R, S, T, V or Y, X 8 A, C, D, E, G, I, R, S, T, V, W, Y or None, X 9 A, D, E, F, G, I, L, P, R, S, V, W, Y or None, X 10 is C, D, F, G, K, L, N, P, R, S, T, V, W, Y or None, X 11 is D, F, G, H, I, K, L, N, P, S, T, V, Y or None, X 12 A, D, G, H, I, L, M, P, R, S, T, V, Y or None, X 13 is C, D, E, H, P, R, S, T, V, Y or None, X 14 A, D, E, F, H, I, L, P, R, T, Y or None, X 15 A, D, E, G, N, Q, R, S, T, V, Y or None, X 16 A, D, E, F, G, H, M, P, S, V, Y or None, X 17 A, D, E, H, N, Q, R, T, Y or None, X 18 is D, E, R, S, Y or none, X 19 is N, S, Y or None, X 20 is D, E, Y or None, X 21 is E, N, Y or None, X 22 is Y or none; preferably, SEQ ID NO: 3 is X 1 X 2 X 3 X 4 X 5 X 6 X 7 X 8 X 9 X 10 X 11 X 12 X 13 X 14 X 15 X 16 X 17 X 18 X 19 X 20 X 21 X 22 , where X 1 is E, G, N or V, X 2 is A, G, I, L or V, X 3 is A, D, E, G, N, V ​​or Y, X 4 is A, G, I, K, R or S, X 5 is C, I, L, P, Q, R or W, X 6 is E, K, P, Q or R, X 7 is C, D, H, N, P or Y, X 8 is E, G, R, V or W, X 9 is F, G, L, S, V or W, X 10 is C, D, G, L, R, S or V, X 11 is F, G, I, L, N, S, T, or V, X 12 is H, L, P, R, S, T or Y, X 13 is D, H, P, S, T or V, X 14 is E, F, H, I, L, P or R, X 15 A, S or V, X 16 is A, D, E, G, H or V, X 17 is H, N, Q, R or Y, X 18 -X 22 Yes.

2. The PD-1 binding molecule according to claim 1, It is characterized in that The CDR1 of the single-domain antibody comprises a sequence shown in any one of SEQ ID NOs: 4-39, 320, the CDR2 comprises a sequence shown in any one of SEQ ID NOs: 40-75, and the CDR3 comprises a sequence shown in any one of SEQ ID NOs: 76-183, Preferably, the single domain antibody contains CDR1, CDR2 and CDR3 shown in any one of the following groups a1 to a136: CDR1CDR2CDR3 group44076a154177a264278a374376a484479a594580a6104681a7114782a8124883a9134984a10105085a11144776a12155186a13165276a1417538 7a15185488a16195587a17205682a18215789a19225890a20235991a21144776a 22246092a23254076a24266193a25276294a26246095a27284196a28106397a29 <h2 style=";text-align:left;direction:ltr">54198a30296499a31765100a323066101a333167102a343268103a353356104a363469105a373570106a38771107a39165276a40165276a41165276a42165276a43165276a44197287a45197287a46197287a47197387a48195387a49195387a501953108a511953109a521953110a 531953111a543674112a551953113a561953114a571953115a581953116a591953117a601953118a611953119a621953120a631953121a641953122a651953123a661953124a671953125a681953126a691953127a701953128a711953129a721953130a731953131a741953132a75 <h2 style=";text-align:left;direction:ltr"> 1953133a761953134a773775135a781953136a791953137a801953138a811953139a821953140a831953141a841953142a851953143a861953144a871953145a881953146a893853147a901953148a911953149a921953150a931953151a941953152a951953153a961953154a973953155a981953156a991 953157a1001953158a1011953159a1021953160a1031953161a1041953162a1051953163a1063753164a1071953165a1081953166a1091953167a1101953168a1113674169a1123853170a1133753171a1141953172a1151953173a1163853174a1173853175a1183674176a1191953177a1201953178a121 1953179a1221953180a1231953181a1241953182a1251953183a1263775135a1273775135a128377513 5a1293775135a1303775135a1313775135a1323775135a1333775135a13432075135a1353775135a136.

3. The PD-1 binding molecule according to claim 1 or 2, It is characterized in that The FR region of the single-domain antibody comprises the FR region of any VHH selected from SEQ ID NO: 184-319, and / or The single domain antibody VHH is as shown in any one of SEQ ID NOs: 184-319, and / or The PD-1 binding molecule is a monovalent or multivalent single-domain antibody, a multispecific single-domain antibody, a heavy chain antibody or an antigen-binding fragment thereof, an antibody or an antigen-binding fragment thereof comprising one, two or more of the single-domain antibodies.

4. The PD-1 binding molecule according to claim 3, It is characterized in that The PD-1 binding molecule is a heavy chain antibody, and the heavy chain antibody further comprises a heavy chain constant region, Preferably, the heavy chain constant region comprises the sequence shown in SEQ ID NO:

321.

5. A polynucleotide, It is characterized in that The polynucleotide is selected from: (1) The coding sequence of the PD-1 binding molecule according to any one of claims 1 to 4; (2) the complementary sequence of (1); (3) A 5-50 bp fragment of any of the sequences in (1) or (2).

6. A nucleic acid construct, It is characterized in that The nucleic acid construct comprises the polynucleotide according to claim 5, Preferably, the nucleic acid construct is a recombinant vector or an expression vector.

7. A bacteriophage comprising the PD-1 binding molecule according to any one of claims 1 to 4, Preferably, the PD-1 binding molecule is displayed on the surface of the bacteriophage.

8. A host cell, It is characterized in that The host cell: (1) expressing and / or secreting the PD-1 binding molecule of any one of claims 1 to 4; and / or (2) comprising the polynucleotide according to claim 5; and / or (3) comprising the nucleic acid construct according to claim 6.

9. A method for producing a PD-1 binding molecule, include: Cultivating the host cell of claim 8 under conditions suitable for producing the PD-1 binding molecule, and optionally purifying the PD-1 binding molecule from the culture.

10. A pharmaceutical composition comprising the PD-1 binding molecule of any one of claims 1 to 4, the polynucleotide of claim 5, the nucleic acid construct of claim 6, the bacteriophage of claim 7 or the host cell of claim 8, and a pharmaceutically acceptable excipient, Preferably, the pharmaceutical composition is used to treat cancer.

11. Use of the PD-1 binding molecule according to any one of claims 1 to 4 in the preparation of a medicament for preventing or treating cancer.

12. A kit for detecting PD-1 for evaluating drug treatment effects or diagnosing cancer, the kit comprising the PD-1 binding molecule according to any one of claims 1 to 4, the polynucleotide according to claim 5, the nucleic acid construct according to claim 6, the bacteriophage according to claim 7, or the host cell according to claim 8, Preferably, the kit further comprises a reagent for detecting the binding of PD-1 to a single domain antibody, an antibody or an antigen-binding fragment thereof, More preferably, the reagent is a reagent for detecting the binding by enzyme-linked immunosorbent assay.

13. A non-diagnostic method for detecting the presence of PD-1 in a sample, the method include: The PD-1 binding molecule of any one of claims 1 to 4 is incubated with the sample, and the binding of PD-1 to the single domain antibody, antibody or antigen binding fragment thereof is detected to determine the presence of PD-1 in the sample.

14. Use of the PD-1 binding molecule according to any one of claims 1 to 4 in the preparation of a kit for detecting PD-1 in a sample, evaluating the effect of drug treatment or diagnosing cancer.

Images