Peptide having antidiabetic activity, peptide complex, and use thereof

Abstract

The present invention relates to a peptide complex having an antidiabetic activity and to a use thereof. The peptide complex of the present invention promotes uptake of glucose into cells, suppresses insulin resistance signals, promotes insulin sensitivity signals, and suppresses the death of pancreatic beta cells, which are insulin-producing cells, thereby exhibiting an effect of lowering blood glucose levels. In addition, the present invention relates to a peptide having an antidiabetic activity and an antiobesity activity and to a use thereof. The peptide of the present invention has an activity of suppressing insulin resistance signals, promoting insulin sensitive signals, and promoting fat decomposition in adipocytes.

Description

Peptides, peptide complexes and uses thereof having antidiabetic activity

[0001] The present invention relates to a peptide complex having antidiabetic activity and its use. The present invention also relates to a peptide having anti-obesity and antidiabetic activity and its use.

[0002] Diabetes mellitus is a metabolic disease characterized by insufficient insulin secretion or abnormal insulin function. It is characterized by hyperglycemia, which is an increase in blood glucose concentration. This hyperglycemia causes various symptoms and signs and causes glucose to be excreted in the urine. Recently, the incidence of diabetes has been explosively increasing due to the increase in obesity, especially abdominal obesity. Diabetes can be broadly divided into type 1 diabetes, which is insulin-dependent diabetes, and type 2 diabetes, which is non-insulin-dependent diabetes. Type 2 diabetes is characterized by hyperglycemia, insulin resistance, and relative insulin secretion impairment.

[0003] When you eat food, glucose is absorbed from the digestive tract, stimulating insulin secretion from the beta cells of the pancreas. This insulin then promotes glucose uptake into the muscles. While insulin also plays a role in hepatic glucose uptake, it primarily inhibits hepatic glucose production. Insulin lowers blood glucose levels by inhibiting hepatic glucose production and promoting glucose uptake into peripheral tissues, including muscles. Insulin resistance refers to a condition in which blood glucose levels are lower than normal in response to insulin under given insulin concentrations. Insulin regulates blood glucose levels by promoting glucose uptake into muscles or suppressing glucose production in the liver. Insulin resistance refers to a condition in which this insulin action is reduced even in the absence of insulin deficiency. Insulin receptors on the cell membrane are involved in the process of glucose uptake into cells in peripheral tissues. Insulin resistance occurs when the number of insulin receptors decreases or intracellular defects occur after receptor binding. Although insulin receptor defects are found in type 2 diabetes, post-receptor intracellular defects, namely insulin-regulated phosphorylation / dephosphorylation disorders, are known to play a far greater role. Among these mechanisms, impaired PI3K (Phosphoinositide 3-kinase) signaling is known to reduce the translocation of the glucose transporter type 4 (GLUT-4) to the cell membrane.

[0004] Current methods for controlling blood sugar include lifestyle modifications (diet and exercise) and medication. However, these methods are difficult to strictly manage and implement, and their effectiveness is limited. Therefore, most diabetic patients rely on lifestyle modifications and medications such as insulin, insulin secretagogues, insulin sensitizers, and hypoglycemic agents to control their blood sugar.

[0005] Obesity is a condition in which excess energy is stored as body fat, resulting in excessive adipose tissue in the body when the energy intake and expenditure are not balanced. According to the World Health Organization (WHO), more than 1 billion adults worldwide are overweight, and at least 3 million of them are clinically obese, with the number increasing significantly in the United States and Europe. Overweight and obesity increase blood pressure and cholesterol levels, which can lead to various diseases such as heart disease, diabetes, and arthritis, and increase the incidence of various adult diseases. Furthermore, overweight and obesity are factors that increase the incidence of various adult diseases such as arteriosclerosis, hypertension, hyperlipidemia, and heart disease not only in adults but also in children and adolescents.

[0006] Currently, the representative obesity treatment drugs that are widely prescribed and approved by the US FDA include a group of drugs that act on the central nervous system and act as appetite suppressants, and orlistat (Xenical), an inhibitor of the digestive enzyme lipase secreted by the pancreas. Many drugs that act on the central nervous system, such as sibutramine, have had their approval revoked due to cardiovascular and psychiatric side effects, and orlistat has the limitation of having variable drug effects depending on fat intake in addition to various side effects. Meanwhile, liraglutide, a glucagon-like peptide-1 (GLP-1) receptor agonist, has been approved and used as an endocrine peptide targeting drug, but the risk of thyroid cancer is emerging.

[0007] [Prior Art Literature]

[0008] [Patent Document]

[0009] WO2016-175362

[0010] WO2018-074682

[0011] The present inventors have conducted research efforts to find an active substance with improved efficacy and guaranteed safety for treating diabetes or obesity in terms of promoting glucose uptake by suppressing insulin resistance and increasing insulin sensitivity, protecting pancreatic beta cells from free fatty acids, and promoting lipolysis in adipocytes. As a result, they experimentally confirmed that a complex of two peptides and a peptide having a novel amino acid sequence satisfy the above requirements, thereby completing the present invention.

[0012] Accordingly, the purpose of the present invention is to provide a peptide complex having antidiabetic activity.

[0013] Another object of the present invention is to provide a pharmaceutical composition for preventing or treating diabetes, which comprises a peptide complex having the above-described activity as an active ingredient.

[0014] Another object of the present invention is to provide a functional food composition for controlling blood sugar levels, which comprises a peptide complex having the above-described activity as an active ingredient.

[0015] Another object of the present invention is to provide a novel peptide having anti-diabetic activity and anti-obesity activity.

[0016] Another object of the present invention is to provide a pharmaceutical composition and a functional food composition for preventing, treating, or improving diabetes, which contain a novel peptide having the above-described activity as an active ingredient.

[0017] Another object of the present invention is to provide a pharmaceutical composition and a functional food composition for preventing, treating, or improving obesity, which contain a peptide having the above-described activity as an active ingredient.

[0018] To achieve the above purpose,

[0019] One aspect of the present invention provides a peptide complex comprising: (i) a peptide comprising the amino acid sequence of SEQ ID NO: 1; and (ii) a peptide comprising the amino acid sequence of SEQ ID NO: 2.

[0020] In addition, another aspect of the present invention provides a pharmaceutical composition for preventing or treating diabetes comprising the peptide complex as an active ingredient.

[0021] In addition, another aspect of the present invention provides a functional food composition for preventing or improving diabetes, comprising the peptide complex as an active ingredient.

[0022] In addition, another aspect of the present invention provides a peptide comprising the amino acid sequence of SEQ ID NO: 2.

[0023] In addition, another aspect of the present invention provides a pharmaceutical composition for preventing or treating diabetes comprising the peptide as an active ingredient.

[0024] In addition, another aspect of the present invention provides a pharmaceutical composition for preventing or treating obesity comprising the peptide as an active ingredient.

[0025] In addition, another aspect of the present invention provides a functional food composition for controlling blood sugar levels, comprising the peptide as an active ingredient.

[0026] In addition, another aspect of the present invention provides a functional food composition for preventing or improving obesity, comprising the peptide as an active ingredient.

[0027] The present invention is described in detail below.

[0028] 1. Peptides, peptide complexes and their activities

[0029] According to one aspect of the present invention, a peptide complex is provided, comprising: (i) a peptide comprising the amino acid sequence disclosed in SEQ ID NO: 1; and (ii) a peptide comprising the amino acid sequence disclosed in SEQ ID NO: 2.

[0030] According to another aspect of the present invention, a peptide comprising an amino acid sequence disclosed in SEQ ID NO: 2 is provided.

[0031] The term "peptide" as used herein means a linear molecule formed by amino acid residues being linked to each other by peptide bonds.

[0032] The peptide comprising the amino acid sequence of SEQ ID NO: 1 of the present invention or the peptide comprising the amino acid sequence of SEQ ID NO: 2 may be used without modification, but a variant or fragment of an amino acid having a different sequence by deletion, insertion, substitution, or a combination thereof of amino acid residues may be used within a range that does not affect the original activity of the peptide, for example, anti-diabetic activity.

[0033] The peptide of the present invention can be modified by phosphorylation, sulfation, acrylation, glycosylation, methylation, farnesylation, etc., within a range that does not change its activity.

[0034] The peptide of the present invention includes a peptide comprising an amino acid sequence substantially identical to a peptide comprising an amino acid sequence of SEQ ID NO: 1 or a peptide comprising an amino acid sequence of SEQ ID NO: 2, and a variant or active fragment thereof. The substantially identical amino acid sequence refers to an amino acid sequence having a sequence identity of 75% or more, for example, 80% or more, 85% or more, 90% or more, 95% or more, or 97% or more, with the amino acid sequence of SEQ ID NO: 1 or the amino acid sequence of SEQ ID NO: 2, respectively. In addition, the peptide may additionally include a targeting sequence, a tag, a labeled residue, an amino acid sequence manufactured for a specific purpose to increase half-life or peptide stability.

[0035] The peptide of the present invention may be modified at the N-terminus and / or C-terminus to select a portion of the amino acid sequence and increase its activity. Such N-terminus and / or C-terminus modifications can significantly improve the stability of the peptide of the present invention, for example, increasing the half-life of the peptide when administered in vivo. The term "stability" encompasses not only in vivo stability, which protects the peptide of the present invention from attack by in vivo protein-cleaving enzymes, but also storage stability (e.g., room temperature storage stability).

[0036] The above N-terminal modification may be a modification in which a protecting group selected from the group consisting of an acetyl group, a fluoreonylmethoxycarbonyl group, a formyl group, a palmitoyl group, a myristyl group, a stearyl group, and polyethylene glycol (PEG) is bonded to the N-terminus of the peptide. The above C-terminal modification may be a modification in which a hydroxyl group (-OH), an amino group (-NH2), an azide (-NHNH2), or the like is bonded to the C-terminus of the peptide, but is not limited thereto.

[0037] The peptide of the present invention can be prepared by various methods widely known in the art to which the present invention pertains. For example, the peptide of the present invention can be prepared by chemical synthesis methods known in the art, particularly solid-phase synthesis techniques (Merrifield, J. Amer. Chem. Soc. 85:2149-54 (1963); Stewart, et al., Solid Phase Peptide Synthesis, 2nd ed., Pierce Chem. Co.: Rockford, 111 (1984)) or liquid-phase synthesis techniques (US Patent No. 5,516,891).

[0038] The peptide complex of the present invention comprises a peptide comprising an amino acid sequence of SEQ ID NO: 1 and a peptide comprising an amino acid sequence of SEQ ID NO: 2.

[0039] The peptide complex of the present invention may mean a mixture of a peptide including the amino acid sequence of SEQ ID NO: 1 and a peptide including the amino acid sequence of SEQ ID NO: 2.

[0040] In the peptide complex of the present invention, the ratio of the peptide including the amino acid sequence of SEQ ID NO. 1 and the peptide including the amino acid sequence of SEQ ID NO. 2 is not limited to a specific range, and for example, the ratio may be used by selecting an appropriate range within the range of 1: 0.1-100 in weight ratio.

[0041] The peptide complex of the present invention has antidiabetic activity.

[0042] The peptide complex of the present invention has the activity of promoting glucose uptake into cells. The cells may be adipocytes, myocytes, or hepatocytes.

[0043] The peptide complex of the present invention has an activity of promoting the expression of one or more genes selected from the group consisting of Leptin, Adiponectin, IRS-1 (Insulin receptor substrate 1), GLUT4 (Glucose transporter type 4), PGC-1α (Peroxisome proliferator-activated receptor-gamma coactivator-1 alpha), ACOX-1 (Acyl-CoA Oxidase 1), PPAR-α (Peroxisome proliferator-activated receptor-alpha), and CPT-1α (Carnitine palmitoyltransferase 1 alpha) in a cell.

[0044] The peptide complex of the present invention has an activity of inhibiting insulin resistance signaling.

[0045] The peptide complex of the present invention has an activity of inhibiting phosphorylation of Ser302 of IRS (Insulin receptor kinase) or phosphorylation of JNK (c-Jun N-terminal kinase).

[0046] The peptide complex of the present invention has an activity of inhibiting the expression of the TNF-α gene, the mTOR (mammalian Target of Rapamycin) gene, or the p70S6K gene under an environment that induces insulin resistance.

[0047] The peptide complex of the present invention has an activity that promotes insulin sensitivity signaling.

[0048] The peptide complex of the present invention has an activity of increasing phosphorylation of IRS (Insulin Receptor Substrate) Tyr632, promoting activation of PI3K (Phosphoinositide 3-kinase), activation of ATK, or activation of AMPK (AMP-activated protein kinase).

[0049] The peptide complex of the present invention has an activity of inhibiting the production of reactive oxygen species (ROS) induced by free fatty acids, the expression of the gene for TNF-α, the expression of the TNF-α protein, or the expression of the IL-1β protein.

[0050] The peptide complex of the present invention has an activity of inhibiting pancreatic beta cell death induced by free fatty acids.

[0051] The peptide complex of the present invention described above can exhibit excellent efficacy in the treatment of diabetes by having the above-described activity.

[0052] A peptide comprising the amino acid sequence of sequence number 2 of the present invention has antidiabetic activity.

[0053] A peptide comprising the amino acid sequence of sequence number 2 of the present invention has an activity of inhibiting insulin resistance signaling or promoting insulin sensitivity signaling.

[0054] Specifically, the peptide comprising the amino acid sequence of SEQ ID NO: 2 of the present invention can promote insulin sensitivity signaling through phosphorylation promotion activity of Tyr632 of IRS (Insulin receptor substrate), activation promotion activity of phospho-AKT, or phosphorylation promotion activity of AMPK, and the peptide of the present invention can suppress insulin resistance signaling through phosphorylation inhibition activity of Sre302 of IRS under an environment inducing insulin resistance.

[0055] A peptide comprising the amino acid sequence of sequence number 2 of the present invention has anti-obesity activity.

[0056] The peptide comprising the amino acid sequence of sequence number 2 of the present invention has the activity of promoting the decomposition of fat in adipocytes.

[0057] Specifically, a peptide comprising the amino acid sequence of SEQ ID NO: 2 of the present invention can increase the expression of ATGL (Adipose triglyceride lipase), pHSL (phosphorylated Hormone-Sensitive Lipase), or PLIN (Perilipin, lipid droplet-associated protein), which are lipolytic enzyme proteins, in adipocytes.

[0058] The peptide comprising the amino acid sequence of sequence number 2 of the present invention described above can exhibit excellent efficacy in treating, preventing or improving diabetes and obesity by having the above-described activity.

[0059] 2. Composition for preventing, treating or improving diabetes and obesity

[0060] pharmaceutical composition

[0061] According to another aspect of the present invention, a pharmaceutical composition for preventing or treating diabetes is provided, which comprises a peptide complex comprising (i) a peptide comprising the amino acid sequence of SEQ ID NO: 1; and (ii) a peptide comprising the amino acid sequence of SEQ ID NO: 2; as an active ingredient.

[0062] As described above, the peptide complex of the present invention has glucose absorption promoting activity, insulin resistance suppressing activity, insulin sensitivity promoting activity, and pancreatic beta cell protecting activity, and therefore has excellent diabetes treatment or prevention activity.

[0063] In the present invention, the diabetes may be type 1 diabetes or type 2 diabetes, and specifically, type 2 diabetes.

[0064] In the pharmaceutical composition for preventing or treating diabetes, the peptide complex can promote the absorption of glucose.

[0065] In the pharmaceutical composition for preventing or treating diabetes, the peptide complex can suppress insulin resistance signaling or promote insulin sensitivity signaling.

[0066] In the pharmaceutical composition for preventing or treating diabetes, the peptide complex can inhibit phosphorylation of Ser302 of IRS (Insulin receptor kinase) or phosphorylation of JNK (c-Jun N-terminal kinase).

[0067] In the pharmaceutical composition for preventing or treating diabetes, the peptide complex can inhibit the expression of the TNF-α gene, the mTOR (mammalian Target Of Rapamycin) gene, or the p70S6K gene under an environment that induces insulin resistance.

[0068] In the pharmaceutical composition for preventing or treating diabetes, the peptide complex can increase phosphorylation of IRS (Insulin Receptor Substrate) Tyr632, or promote activation of PI3K (Phosphoinositide 3-kinase), activation of ATK, or activation of AMPK (AMP-activated protein kinase).

[0069] In the pharmaceutical composition for preventing or treating diabetes, the peptide complex can promote the expression of one or more genes selected from the group consisting of Leptin, Adiponectin, IRS-1 (Insulin receptor substrate 1), GLUT4 (Glucose transporter type 4), PGC-1α, ACOX-1, PPAR-α, and CPT-1α.

[0070] In the pharmaceutical composition for preventing or treating diabetes, the peptide complex can inhibit the production of reactive oxygen species (ROS) induced by free fatty acids, the expression of the gene for TNF-α, the expression of TNF-α protein, or the expression of IL-1β protein, or the death of pancreatic beta cells induced by free fatty acids.

[0071]

[0072] According to another aspect of the present invention, a pharmaceutical composition for preventing or treating diabetes is provided, comprising a peptide having an amino acid sequence of SEQ ID NO: 2 as an active ingredient.

[0073] As described above, the peptide of the present invention has insulin resistance signal suppression activity and insulin sensitivity promotion activity, and therefore has excellent diabetes treatment or prevention activity.

[0074] In the present invention, the diabetes may be type 1 diabetes or type 2 diabetes, and specifically, type 2 diabetes.

[0075] In the pharmaceutical composition for preventing or treating diabetes, the peptide can suppress insulin resistance signals or promote insulin sensitivity signals.

[0076] In the pharmaceutical composition for preventing or treating diabetes, the peptide can promote phosphorylation of Tyr632 of IRS (Insulin receptor substrate), promote activation of phospho-AKT, or promote phosphorylation of AMPK.

[0077] In the pharmaceutical composition for preventing or treating diabetes, the peptide can inhibit phosphorylation of Sre302 of IRS under an environment inducing insulin resistance.

[0078] According to another aspect of the present invention, a pharmaceutical composition for preventing or treating obesity is provided, which comprises a peptide having an amino acid sequence of sequence number 1 as an active ingredient.

[0079] In the pharmaceutical composition for preventing or treating obesity, the peptide can promote the decomposition of fat in fat cells.

[0080] In the pharmaceutical composition for preventing or treating obesity, the peptide can increase the expression of ATGL (Adipose triglyceride lipase), pHSL (phosphorylated Hormone-Sensitive Lipase), or PLIN (Perilipin, lipid droplet-associated protein), which are lipolytic enzyme proteins, in adipocytes.

[0081] The pharmaceutical composition of the present invention may comprise a therapeutically effective amount of the peptide complex or peptide and a pharmaceutically acceptable carrier.

[0082] The term "therapeutically effective amount" above means an amount sufficient for the peptide complex, which is an active ingredient of the pharmaceutical composition of the present invention, to achieve its activity or efficacy, for example, an amount sufficient to achieve efficacy in treating or preventing diabetes or obesity.

[0083] The pharmaceutically acceptable carriers mentioned above are those commonly used in formulations, and include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil.

[0084] The pharmaceutical composition of the present invention may additionally include, in addition to the above ingredients, a lubricant, a wetting agent, a sweetener, a flavoring agent, an emulsifier, a suspending agent, a preservative, etc., but is not limited thereto.

[0085] Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington: The Science and Practice of Pharmacy, (19th ed., 1995, Williams & Wilkins).

[0086] The pharmaceutical composition of the present invention can be administered by any suitable route for treating diabetes or obesity, for example, it can be administered orally or parenterally, and in the case of parenteral administration, it can be administered by intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, topical administration, transdermal administration, etc.

[0087] The dosage of the pharmaceutical composition may be, but is not limited to, 0.0001 μg to 100 mg, 0.001 μg to 100 mg, 0.01 μg to 100 mg, 0.1 μg to 100 mg, or 1.0 μg to 1000 mg per day, and may be prescribed in various ways depending on factors such as the formulation method, administration method, patient's age, weight, sex, pathological condition, food, administration time, administration route, excretion rate, and reaction sensitivity.

[0088] The pharmaceutical composition of the present invention can be manufactured in a unit dose form or can be manufactured by inserting it into a multi-dose container by formulating it using a pharmaceutically acceptable carrier and / or excipient according to a method that can be easily performed by a person having ordinary skill in the art to which the present invention pertains, and the method can be performed. In this case, the formulation may be in the form of a solution, suspension or emulsion in an oil or aqueous medium, or in the form of an extract, powder, granules, tablet or capsule, and may additionally include a dispersing agent or stabilizer.

[0089] food composition

[0090] According to another aspect of the present invention, a functional food composition for controlling blood sugar levels is provided, comprising a peptide complex as an active ingredient, comprising (i) a peptide comprising an amino acid sequence of SEQ ID NO: 1; and (ii) a peptide comprising an amino acid sequence of SEQ ID NO: 2.

[0091] In the functional food composition of the present invention, the control of blood sugar level may be the control of blood sugar level of a diabetic patient or a high-risk patient in the pre-diabetic stage.

[0092] In the functional food composition of the present invention, the diabetes may be type 1 diabetes or type 2 diabetes, and specifically, type 2 diabetes.

[0093] In the functional food composition of the present invention, the control of blood sugar level may be a lowering of blood sugar level.

[0094] In the functional food composition of the present invention, the peptide complex may be included in an appropriate amount selected within the range of 0.0001 wt% to 10 wt% based on the total composition weight.

[0095] According to another aspect of the present invention, a functional food composition for controlling blood sugar levels is provided, which comprises a peptide having an amino acid sequence of sequence number 2 as an active ingredient.

[0096] In the functional food composition of the present invention, the control of blood sugar level may be the control of blood sugar level of a diabetic patient or a high-risk patient in the pre-diabetic stage.

[0097] In the functional food composition of the present invention, the diabetes may be type 1 diabetes or type 2 diabetes, and specifically, type 2 diabetes.

[0098] In the functional food composition of the present invention, the control of blood sugar level may be a lowering of blood sugar level.

[0099] In the functional food composition for controlling the blood sugar level, the peptide can suppress insulin resistance signaling or promote insulin sensitivity signaling.

[0100] In the functional food composition for controlling blood sugar levels, the peptide can promote phosphorylation of Tyr632 of IRS (Insulin receptor substrate), promote activation of phospho-AKT, or promote phosphorylation of AMPK.

[0101] In the functional food composition for controlling the blood sugar level, the peptide can inhibit phosphorylation of Sre302 of IRS under an environment that induces insulin resistance.

[0102] According to another aspect of the present invention, a functional food composition for preventing or improving obesity is provided, which comprises a peptide having an amino acid sequence of sequence number 2 as an active ingredient.

[0103] In the functional food composition for preventing or improving obesity, the peptide can promote the decomposition of fat in fat cells.

[0104] In the functional food composition for preventing or improving obesity, the peptide can increase the expression of ATGL (Adipose triglyceride lipase), pHSL (phosphorylated Hormone-Sensitive Lipase), or PLIN (Perilipin, lipid droplet-associated protein), which are lipolytic enzyme proteins, in adipocytes.

[0105] In the functional food composition of the present invention, the peptide may be included in an appropriate amount selected within the range of 0.0001 wt% to 10 wt% based on the total composition weight.

[0106] In one embodiment, the functional food composition of the present invention may comprise a food-effective amount of the peptide complex or peptide and a food-acceptable carrier.

[0107] The food composition of the present invention comprises not only the peptide complex or peptide as the effective ingredient, but also components commonly added during food manufacturing, such as proteins, carbohydrates, fats, nutrients, seasonings, and flavoring agents. Examples of the carbohydrates mentioned above include monosaccharides such as glucose, fructose, etc.; disaccharides such as maltose, sucrose, oligosaccharides, etc.; and polysaccharides such as dextrin, cyclodextrin, etc., and sugar alcohols such as xylitol, sorbitol, and erythritol. Natural flavoring agents, thaumatin, stevia extracts (e.g., rebaudioside A, glycyrrhizin, etc.), and synthetic flavoring agents (saccharin, aspartame, etc.) can be used. The ratio of the above carbohydrates may generally be about 1 to 20 g, preferably about 5 to 12 g, per 100 g of the food composition of the present invention, but is not limited thereto.

[0108] In addition to the above-described ingredients, the functional food composition of the present invention may contain various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents and thickening agents (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. In addition, it may contain fruit pulp for the production of natural fruit juice, fruit juice drinks, and vegetable drinks.

[0109] For example, when the functional food composition of the present invention is manufactured as a drink, in addition to the peptide complex, which is the effective ingredient of the present invention, citric acid, liquid fructose, sugar, glucose, acetic acid, malic acid, juice, Eucommia extract, jujube extract, licorice extract, etc. may be additionally included.

[0110] In another aspect of the present invention, the present invention provides a method for treating diabetes, comprising administering to a diabetic patient a therapeutically effective amount of a peptide complex comprising (i) a peptide comprising the amino acid sequence of SEQ ID NO: 1; and (ii) a peptide comprising the amino acid sequence of SEQ ID NO: 2.

[0111] In another aspect of the present invention, the present invention provides a method for controlling blood sugar, comprising administering to a subject in need of blood sugar control a therapeutically effective amount of a peptide complex comprising (i) a peptide comprising the amino acid sequence of SEQ ID NO: 1; and (ii) a peptide comprising the amino acid sequence of SEQ ID NO: 2.

[0112] In another aspect of the present invention, a method for treating, preventing, or improving diabetes is provided, comprising administering to a diabetic patient a therapeutically effective amount of a peptide comprising the amino acid sequence of SEQ ID NO: 2 described above.

[0113] In another aspect of the present invention, a method for controlling blood sugar levels is provided, comprising administering a therapeutically effective amount of a peptide comprising the amino acid sequence of SEQ ID NO: 2 described above to a subject in need of blood sugar level control.

[0114] In another aspect of the present invention, a method for treating, improving, or preventing obesity is provided, comprising administering to a subject in need of treatment for obesity a therapeutically effective amount of a peptide comprising the amino acid sequence of SEQ ID NO: 2 described above.

[0115] The peptide complex or peptide of the present invention can exhibit blood sugar level lowering efficacy by promoting glucose uptake into cells, suppressing insulin resistance signals, promoting insulin sensitivity signals, and inhibiting the death of pancreatic beta cells, which are insulin-producing cells. In addition, the peptide of the present invention exhibits efficacy in promoting fat breakdown in adipocytes. Therefore, the peptide complex or peptide of the present invention can be used for the treatment, prevention, and improvement of diabetes or obesity, and can be useful for lowering blood sugar levels in diabetic patients or high-risk patients with pre-diabetes, and can be used for the treatment, prevention, and improvement of obesity.

[0116] However, the effects of the present invention are not limited to the effects mentioned above, and other effects not mentioned will be clearly understood by those skilled in the art from the description below.

[0117] Figures 1a and 1b are experimental results showing that the peptide complex of the present invention promotes the absorption of glucose into fat cells.

[0118] Figures 2a and 2b are experimental results showing that the peptide complex of the present invention promotes the uptake of glucose into myoblasts.

[0119] Figures 3a and 3b are experimental results showing that the peptide complex of the present invention has the effect of promoting the activity of Phospho-AMPK and Phospho-ACC, which are insulin sensitivity promoting factors.

[0120] Figures 4a and 4b are experimental results showing that the peptide complex of the present invention has the effect of inhibiting Serin302 phosphorylation of IRSdml and phosphorylation of JNK, which are insulin resistance signaling factors.

[0121] Figures 5a and 5b are experimental results showing that the peptide complex of the present invention again reduces the increase in the expression of TNF-α, an insulin resistance-inducing cytokine, and mTOR and p70S6K, which are insulin resistance-promoting signaling factors, induced by rhTNF-α treatment.

[0122] Figures 6a and 6b are experimental results showing that when the peptide complex of the present invention is treated on fat cells in which insulin resistance is induced by rhTNF-α treatment, phosphorylation of IRS Tyrosin632, an insulin sensitivity promoting factor, is increased, and activation of PI3K, ATK, and AMPK is also promoted.

[0123] Figures 7a and 7b are experimental results showing that the expression of glucose uptake-related genes Leptin, Adiponectin, IRS-1, and GLUT4, which was reduced by rhTNF-α treatment in adipocytes, was increased by treatment with the peptide complex of the present invention.

[0124] Figures 8a and 8b are experimental results showing that reactive oxygen species (ROS) induced by palmitate are reduced by the peptide complex of the present invention.

[0125] Figures 9a and 9b are experimental results showing that the gene expression of TNF-α, an inflammatory protein induced by palmitate, is significantly reduced by treatment with the peptide complex of the present invention.

[0126] Figures 10a and 10b are experimental results showing that the expression levels of TNF-α and IL-1β proteins, which were increased by palmitate treatment in INS-1 (Rat pancreatic beta cell) cells, were significantly reduced again by treatment with the peptide complex of the present invention.

[0127] Figure 11 is an experimental result showing that the increase in INS-1 cell death induced by palmitate treatment is reduced again by treatment with the peptide complex of the present invention, thereby increasing cell survival rate.

[0128] Figures 12a and 12b are experimental results showing that the expression of PGC-1α, ACOX-1, PPAR-α, or CPT-1α genes, which are FFA beta oxidation-related genes, is promoted by the peptide complex of the present invention in HepG2 cells.

[0129] Figures 13a and 13b show that the peptide of the present invention has the activity of increasing the expression of ATGL (Adipose triglyceride lipase), pHSL (phosphorylated Hormone-Sensitive Lipase), and PLIN (Perilipin, lipid droplet-associated protein), which are lipolytic enzyme proteins, in adipocytes.

[0130] Figure 14 shows that when the peptide of the present invention is treated on fat cells, the amount of glycerol, a fat breakdown product, released increases in a concentration-dependent manner of the treated peptide.

[0131] Figures 15a and 15b show that when the peptide of the present invention is applied to adipocytes, phosphorylation of IRS (Insulin Receptor Substrate) Tyr632, an insulin sensitivity promoting factor, and activation of phosphorylation-AKT are promoted, and phosphorylation of AMPK, a signaling protein, is increased. On the other hand, it shows that phosphorylation of IRS (Insulin Receptor Substrate) Ser302 is reduced under an environment that induces insulin resistance.

[0132] Hereinafter, the present invention will be described in detail by way of examples. However, the following examples specifically illustrate the present invention, and the content of the present invention is not limited by the following examples.

[0133] Example

[0134] Manufacturing Example 1: Manufacturing of peptides and peptide complexes

[0135] Peptides having amino acid sequences of SEQ ID NO: 1 and SEQ ID NO: 2 as shown in Table 1 below were synthesized using an automatic peptide synthesizer (Milligen 9050, Millipore, USA), and these synthesized peptides were purified using C18 reverse-phase high-performance liquid chromatography (HPLC) (Waters Associates, USA). The column used was ACQUITY UPLC BEH300 C18 (2.1 mm Х 100 mm, 1.7 μm, Waters Co, USA).

[0136] Amino acid sequence of the peptide sequence number 1LKTRN2KGSATGWMA

[0137] A peptide complex was prepared by mixing equal amounts of the peptide of sequence number 1 and the peptide of sequence number 2 manufactured above, and its efficacy was evaluated. In addition, the efficacy of the peptide of sequence number 2 manufactured above was also evaluated.

[0138] Experimental Example 1: Promotion of glucose uptake into adipocytes

[0139] An experiment was conducted to determine whether the peptide complex manufactured in Manufacturing Example 1 using adipocytes promotes the uptake of glucose into cells.

[0140] When 3T3-L1 preadipocytes reached 80% confluence, 5 x 10 3Cells were seeded per well and used in the experiment. Two days after reaching confluence, the medium was replaced with a differentiation induction medium to induce differentiation into adipocytes. Two days after induction, the medium was cultured for two days in a medium containing 10% FBS and 10 μg / mL insulin, and then the medium was replaced with a medium containing 10% FBS every two days until differentiation into adipocytes. Once differentiation was complete, the medium was replaced with a glucose-free medium and cultured for 16 hours, and then starvation was induced by culture for 40 minutes in 100 μL KRPH buffer containing 2% BSA. Samples were prepared by treating with rhTNF-α (2 nM), insulin (10 μg / ml), and peptide complexes (2, 20 μg / ml) and incubating for 1 hour, then treating with 80 μM 2-NBDG and incubating for 1 hour. Glucose uptake was measured using a Glucose uptake assay kit (Abcam, Cambridge, UK), and glucose uptake into cells was photographed using a fluorescence microscope (ECLIPSE 80i, Nikon, Japan).

[0141] As shown in Fig. 1a and Fig. 1b, the experimental results confirmed that the intracellular glucose uptake inhibited by TNF-α was increased by the peptide complex treatment. In addition, this effect was confirmed to occur through the AMPK (AMP-activated protein kinase) and ACC (Acetyl-CoA carboxylase) signaling pathways in Experimental Example 3 described below. Through these experimental results, it was confirmed that the peptide complex significantly increases the inhibition of glucose uptake into cells induced by inflammation.

[0142] Experimental Example 2: Promotion of glucose uptake into myocytes

[0143] An experiment was conducted using myoblasts to determine whether the peptide complex prepared in Manufacturing Example 1 promotes the uptake of glucose into cells.

[0144] C2C12 myoblasts were seeded at 5 x 10 in a 96-well plate. 3 Cells were seeded in wells and cultured in DMEM containing 10% FBS for 2 days. After replacing the DMEM medium containing 2% horse serum, C2C12 myoblasts were cultured for 6 days to induce differentiation into myotubes. The cultured myotubes were treated with rhTNF-α (2 nM), insulin (10 μg / ml), and peptide complexes (2, 20 μg / ml) for 1 hour, and then treated with 80 μM 2-NBDG for 1 hour to prepare samples. Glucose uptake was measured using a "Glucose uptake assay kit" (Abcam, Cambridge, UK), and glucose uptake by cells was photographed using a fluorescence microscope (ECLIPSE 80i, Nikon, Japan). As shown in Figs. 2a and 2b, the experimental results confirmed that the uptake of glucose into myoblasts, which was inhibited by rhTNF-α treatment, was increased by the peptide complex of the present invention.

[0145] Experimental Example 3: Signaling pathway of peptide complex in promoting glucose absorption

[0146] It was confirmed through protein expression analysis (western blot analysis) whether the peptide complex of Manufacturing Example 1 had an effect of promoting the activity of an insulin sensitivity promoting factor.

[0147] When 3T3-L1 preadipocytes reached 80% confluence, 5 x 10 3Cells were seeded per well and used in the experiment. Two days after reaching confluence, the medium was replaced with a differentiation induction medium to induce differentiation into adipocytes. Two days after induction, the medium was cultured for two days in a medium containing 10% FBS and 10 μg / mL insulin, and then the medium was replaced with 10% FBS every two days until differentiation into adipocytes. Once differentiation was complete, the medium was replaced with a serum-free medium and cultured for 4 hours to induce starvation. Here, the peptide complex of Preparation Example 1 (0.2, 2, 20 μg / ml) was treated and cultured for 30 minutes. After adding a dissolution buffer to dissolve the mixture, the protein obtained by centrifugation at 4°C, 12,000 rpm for 30 minutes was quantified using a BCA kit. Proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDD-PAGE) and then electrotransferred to a membrane. The membrane with attached proteins was blocked with 5% skim milk, and then incubated with primary antibodies overnight at 4°C. After washing with phosphate-buffered saline (PBS-T), the membrane was incubated with secondary antibodies for 1 hour at room temperature, washed again with PBS-T, and visualized using Gel Doc (Bio-Rad, Hercules, CA, USA) and Western detection reagent (Elpis Biotech, Daejeon, Korea). The antibodies used in the experiment were as follows: anti-Phospho-AMPK antibody (Cell signaling technology (CST), USA), anti-Phospho-ACC antibody (Cell signaling technology (CST), USA), and anti-α-tubulin antibody (Santa Cruz Biotechnology).As a result of the experiment, as shown in FIGS. 3a and 3b, it was confirmed that the peptide complex of the present invention has the effect of promoting the activity of Phospho-AMPK and Phospho-ACC, which are insulin sensitivity promoting factors.

[0148] Experimental Example 4: Inhibition of Insulin Resistance Signaling by Peptide Complexes

[0149] It was confirmed through protein expression analysis (western blot analysis) whether the peptide complex manufactured in Manufacturing Example 1 had an effect of suppressing insulin resistance signaling.

[0150] When 3T3-L1 preadipocytes reached 80% confluence, 5 x 10 5Cells were seeded per well and used in the experiment. Two days after reaching confluence, the medium was replaced with differentiation induction medium to induce differentiation into adipocytes. Two days after induction, the cells were cultured for two days in a medium containing 10% FBS and 10 μg / mL insulin, and then the medium was replaced with 10% FBS every two days until differentiation into adipocytes. Once differentiation was complete, the medium was replaced with serum-free medium and cultured for 4 hours to induce starvation. After treating with rhTNF-α (2 nM), insulin (1 μg / ml), and peptide complexes (0.2, 2, 20 μg / ml), the cells were cultured for 30 minutes, and then the cells in each treatment group were lysed by adding lysis buffer, and the proteins obtained by centrifugation at 4℃, 12,000 rpm for 30 minutes were quantified using a BCA kit. Proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and then electrotransferred onto a membrane. The membrane with protein attached was blocked with 5% skim milk, and then incubated with primary antibodies overnight at 4°C. After washing with phosphate-buffered saline (PBS-T), the membrane was incubated with secondary antibodies for 1 hour at room temperature, washed again with PBS-T, and visualized using Gel Doc (Bio-Rad, Hercules, CA, USA) and a Western detection reagent (Elpis Biotech, Daejeon, Korea). The antibodies used in the experiment were as follows: anti-Phospho-IRS (Ser302) antibody (Cell signaling technology (CST), USA), anti-Phospho-JNK antibody (Santa Cruz Biotechnology, USA), and anti-α-tubulin antibody (Santa Cruz Biotechnology, USA).As a result of the experiment, as shown in FIGS. 4a and 4b, it was confirmed that the peptide complex of the present invention has the effect of inhibiting the phosphorylation of Serin302 of IRS (Insulin receptor kinase), an insulin resistance signaling factor induced by TNF-α treatment, and the phosphorylation of JNK (c-Jun N-terminal kinase).

[0151] Experimental Example 5: Inhibition of Insulin Resistance-Inducing Gene Expression by Peptide Complexes

[0152] We tested whether the peptide complex manufactured in Manufacturing Example 1 suppresses the expression of genes that induce insulin resistance. After inducing insulin resistance by treating adipocytes with rhTNF-α, the mTOR and p70S6K gene expression levels were measured after treatment with the peptide complex.

[0153] When 3T3-L1 preadipocytes reached 80% confluence, 5 x 10 5Cells were seeded per well and used in the experiment. Two days after reaching confluence, differentiation into adipocytes was induced by replacing the differentiation induction medium. Two days after induction, the cells were cultured for 2 days in a medium containing 10% FBS and 10 μg / mL insulin, and then the medium was replaced with 10% FBS every 2 days until differentiation into adipocytes. Once differentiation was complete, the medium was replaced with serum-free medium and cultured for 4 hours to induce starvation. The untreated control group, as well as those treated with rhTNF-α (2 nM), insulin (1 μg / ml), and peptide complexes (0.2, 2, 20 μg / ml), were treated, and RNA was extracted after 24 hours and RT-PCR was performed. RNA was extracted from 3T3-L1 cells using the easy-BLUE™Total RNA extraction kit (Qiagen, Germany). The extracted RNA was converted to cDNA using RT-PCR premix (iNtRON Biotechnology, Seongnam, Korea). A reaction mixture was prepared with PCR premix (iNtRON Biotechnology, Seongnam, Korea) and primers for the TNF-α, mTOR (mammalian Target of Rapamycin), p70S6K, or GAPDH genes, and PCR was performed using a PCR machine (Eppendorf, Germany). Subsequently, mRNA expression patterns were determined by agarose gel electrophoresis. The base sequences of the primers used in the experiment are shown in Table 2.

[0154] Gene primer sequence (5' -> 3') SEQ ID NO: TNF-αFCGT CAG CCG ATT TGC TAT CT3RCGG ACT CCG CAA AGT CTA AG4mTORFTTG AGG TCG CTA TGA CCA GAG AGA A5RTTA CCA GAA GGG ACA CCA GCC AAT G6p70S6KFGGA GCC TGG GAG CCC TGA TGT7RGAA GCC CTC TTT GAT GCT GTC C8GAPDHFGTG ATG GCA TGG ACT GTG GT9RGGA GCC AAA AGG GTC ATC AT10

[0155] As shown in Fig. 5a and Fig. 5b, the experimental results showed that when rhTNF-α was treated, the expression of the TNF-α gene, an inflammatory cytokine that induces insulin resistance, and the mTOR and p70S6K genes, which are signaling factors that promote insulin resistance, increased, but when the peptide complex was treated, the expression of the above genes decreased again.

[0156] Experimental Example 6: Stimulation of Insulin Sensitivity Signaling by Peptide Complexes

[0157] An experiment was conducted to determine whether the peptide complex prepared in Manufacturing Example 1 promotes insulin sensitivity signaling.

[0158] When 3T3-L1 preadipocytes reached 80% confluence, 5 x 10 5Cells / well were seeded and used in the experiment. Two days after reaching confluence, the medium was replaced with differentiation induction medium to induce differentiation into adipocytes. Two days after induction, the cells were cultured for two days in a medium containing 10% FBS and 10 μg / mL insulin, and then the medium was replaced with 10% FBS every two days until differentiation into adipocytes. Once differentiation was complete, the medium was replaced with serum-free medium and cultured for 4 hours to induce starvation. After treatment with rhTNF-α (2 nM), insulin (1 μg / ml), and peptide complexes (0.2, 2, 20 μg / ml), the cells were cultured for 30 minutes, and the lysis buffer was added to the cells of each treatment group to lyse them. The cells were centrifuged at 4°C and 12,000 rpm for 30 minutes, and the proteins obtained were quantified using a BCA kit. Proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and then electrotransferred onto membranes. The membranes with protein attachment were blocked with 5% skim milk and then incubated with primary antibodies overnight at 4°C. After washing with PBS-T, the membranes were incubated with secondary antibodies for 1 hour at room temperature, washed again with PBS-T, and visualized using Gel Doc (Bio-Rad, Hercules, CA, USA) and a Western detection reagent (Elpis Biotech, Daejeon, Korea).The antibodies used in the experiment were as follows: anti-Phospho-IRS (Tyr632) antibody (Cell signaling technology (CST), USA), anti-Phospho-PI3K antibody (Cell signaling technology (CST), USA), anti-Phospho-AKT antibody (Cell signaling technology (CST), USA), anti-Phospho-AMPK antibody (Cell signaling technology (CST), USA), anti-α-tubulin antibody (Santa Cruz Biotechnology, USA). As shown in Fig. 6a and Fig. 6b, in the adipocytes in which insulin resistance was induced by rhTNF-α treatment, treatment with the peptide complex increased the phosphorylation of IRS (Insulin Receptor Substrate) Tyrosin632, which is an insulin sensitivity promoting factor, and thereby promoted the activation of PI3K (Phosphoinositide 3-kinase), ATK, and AMPK (AMP-activated protein kinase).

[0159] Experimental Example 7: Promotion of Gene Expression Related to Glucose Uptake

[0160] Whether the peptide complex manufactured in Manufacturing Example 1 promotes the expression of genes related to glucose absorption was confirmed through expression analysis of Leptin, Adiponectin, IRS-1 (Insulin receptor substrate 1), and GLUT4 (Glucose transporter type 4) genes.

[0161] When 3T3-L1 preadipocytes reached 80% confluence, 5 x 10 5Cells were seeded in wells and used in the experiment. Two days after reaching confluence, the medium was replaced with differentiation induction medium to induce adipocyte differentiation. Two days after induction, the cells were cultured for two days in medium containing 10% FBS and 10 μg / mL insulin, and then the medium was replaced with 10% FBS every two days until differentiation into adipocytes. Once differentiation was complete, the medium was replaced with serum-free medium and cultured for 4 hours to induce starvation. The untreated control group, as well as those treated with rhTNF-α (2 nM), insulin (1 μg / ml), and peptide complexes (0.2, 2, 20 μg / ml), were treated, and RNA was extracted after 24 hours and RT-PCR was performed. RNA was extracted from 3T3-L1 cells using the easy-BLUE™Total RNA extraction kit (Qiagen, Germany). Extracted RNA was converted to cDNA using RT-PCR premix (iNtRON Biotechnology, Seongnam, Korea). Reaction mixtures were prepared with PCR premix (iNtRON Biotechnology, Seongnam, Korea) and primers for each gene, and PCR was performed using a PCR machine (Eppendorf, Germany). Subsequently, mRNA expression patterns were determined by agarose gel electrophoresis. The base sequences of the primers used in the experiment are shown in Table 3.

[0162] Gene primer sequence (5' -> 3') Sequence number LeptinFGGA TCA GGT TTT GTG GTG CT11RTTG TGG CCC ATA AAG TCC TC12AdiponectinFTCC TGC TTT GGT CCC TCC AC13RTCT CCA GCC CCA CAC TGA AC14IRS-1FGCC AAT CTT CAT CCA GTT GC15RCAT CGT GAA GAA GGC ATA GG16GAPDHFGTG ATG GCA TGG ACT GTG GT9RGGA GCC AAA AGG GTC ATC AT10GLUT4FACT AAG AGC ACC GAG ACC AA27RCTG CCC GAA AGA GTC TAA AG28

[0163] As shown in Figs. 7a and 7b, the experimental results confirmed that the expression of glucose uptake-related genes Leptin, Adiponectin, IRS-1, and GLUT4, which was reduced by rhTNF-α treatment in adipocytes, was increased by peptide complex treatment.

[0164] Experimental Example 8: Inhibition of ROS production induced by palmitate

[0165] It was confirmed through intracellular ROS detection analysis (FACS) whether the peptide complex manufactured in Manufacturing Example 1 inhibits the production of reactive oxygen species (ROS) caused by palmitate, a type of free fatty acid.

[0166] When 3T3-L1 preadipocytes reached 80% confluence, 5 x 10 5Cells were seeded per well and used in the experiment. Two days after reaching confluence, the medium was replaced with differentiation induction medium to induce differentiation into adipocytes. Two days after induction, the medium was cultured for two days in a medium containing 10% FBS and 10 μg / mL insulin, and then the medium was replaced with 10% FBS every two days until differentiation into adipocytes. Once differentiation was complete, the medium was replaced with serum-free medium and cultured for 4 hours to induce starvation. The untreated control group, as well as those treated with rhTNF-α (2 nM), insulin (1 μg / ml), and peptide complex (2 μg / ml), were cultured for 24 hours, and the oxidative activity was measured by the degree of fluorescence using FACS (Becton Dickinson & Company (BD), USA) 30 minutes after treatment with DCF-DH. As shown in the graphs of Figures 8a and 8b, the measurement results confirmed that reactive oxygen species (ROS) induced by palmitate were reduced by the peptide complex.

[0167] Experimental Example 9: Inhibition of TNF-α gene expression induced by palmitate

[0168] It was confirmed through gene expression analysis (RT-PCR) whether the peptide complex manufactured in Manufacturing Example 1 suppresses inflammation induced by palmitate, a type of free fatty acid.

[0169] INS-1 cells were starved in serum-free media (RPMI 1640) (Gibco, New York, USA), pretreated with 25 μM palmitate for 2 h, and then treated with peptide complexes (0.2, 2, and 20 μg / ml). After 24 h, RNA was extracted using the easy-BLUE™ Total RNA extraction kit (Qiagen, Germany). The extracted RNA was converted to cDNA using RT-PCR premix (iNtRON Biotechnology, Seongnam, Korea). A reaction mixture was prepared with PCR premix (iNtRON Biotechnology, Seongnam, Korea) and primers for the TNF-α and GAPDH genes, and PCR was performed using a PCR machine (Eppendorf, Germany). Subsequently, the mRNA expression pattern was determined by agarose gel electrophoresis. The base sequences of the primers used in the experiment are shown in Table 4.

[0170] Gene primer sequence (5' -> 3') Sequence number TNF-α FATG AGC ACG GAA AGC ATG AT17RCTC TTG ATG GCA GAG AGG AG18GAPDHFGTG ATG GCA TGG ACT GTG GT9RGGA GCC AAA AGG GTC ATC AT10

[0171] As shown in Figs. 9a and 9b, the experimental results confirmed that the gene expression of TNF-α, an inflammatory protein induced by palmitate, was significantly reduced by peptide complex treatment.

[0172] Experimental Example 10: Inhibition of the expression of inflammatory cytokines induced by palmitate.

[0173] It was confirmed through protein expression analysis (western blot analysis) whether the peptide complex manufactured in Manufacturing Example 1 inhibits the expression of inflammatory cytokines induced by palmitate, a type of free fatty acid.

[0174] INS-1 cells (Rat pancreatic beta cells) were starved in serum-free media (RPMI 1640) (Gibco, New York, USA), pretreated with 25 μM palmitate for 2 h, and then treated with peptide complexes (0.2, 2, and 20 μg / ml). After 24 h, the cells were washed once with PBS, and lysis buffer containing 10 mM Tris (pH 7.5), 100 mM NaCl, 1% NP-40, and protease inhibitors (Millipore, Darmstadt, Germany) was added, and the cells were lysed on ice for 30 min. The cells were centrifuged at 4°C and 13,000 rpm for 10 min, and the proteins obtained were quantified using a BCA kit (Thermo Fisher Scientific, Waltham, USA). Equal amounts of proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and electrotransferred onto polyvinylidene difluoride membranes. To block nonspecific binding of antibodies, the membranes with protein attachment were blocked with 5% skim milk (BD, New Jersey, USA) for 1 hour, and then incubated with primary antibodies overnight at 4°C. After washing with PBS-T, the membranes were incubated with secondary antibodies for 1–2 hours at room temperature, washed again with PBS-T, and then visualized on X-ray films using enhanced chemiluminescence (ECL) (Thermo Fisher Scientific, Waltham, USA).The antibodies used in the experiment were as follows: anti-TNF-α antibody (Cell signaling technology (CST), USA), anti-IL-1β antibody (Cell signaling technology (CST), USA), anti-Actin antibody (Santa Cruz Biotechnology, USA). As shown in Figures 10a and 10b, in INS-1 (Rat pancreatic beta cell) cells, the protein expression levels of TNF-α and IL-1β, which were increased by palmitate treatment, were significantly reduced again by peptide complex treatment.

[0175] Experimental Example 11: Inhibition of pancreatic beta cell death induced by palmitate.

[0176] It was confirmed through a cell cytotoxicity assay whether the peptide complex manufactured in Manufacturing Example 1 inhibits the death of pancreatic beta cells induced by palmitate, a type of free fatty acid.

[0177] INS-1 cells (Rat pancreatic beta cells) were starved in serum-free media (RPMI 1640) (Gibco, New York, USA), pretreated with 25 μM palmitate for 2 h, and then treated with peptide complexes (0.2, 2, 20 μg / ml). After 24 h, CCK-8 solution (Dojindo, Kumamoto, Japan) was added to 1 / 10 of the culture volume, and the absorbance was measured every 30 min or 1 h. The experiment was terminated when the average absorbance value of the control group reached 1.0. The absorbance of the reaction product was measured at a wavelength of 450 nm using a microplate reader. As shown in Fig. 11, the experimental results confirmed that the increase in INS-1 cell death induced by palmitate treatment was reduced again by treatment with the peptide complex, thereby increasing cell survival rate.

[0178] Experimental Example 12: Promotion of Expression of Glucose Uptake-Related Genes

[0179] It was confirmed through gene expression analysis (RT-PCR) whether the peptide complex manufactured in Manufacturing Example 1 promotes the expression of glucose absorption-related genes, PGC-1α (Peroxisome proliferator-activated receptor-gamma coactivator-1 alpha), ACOX-1 (Acyl-CoA Oxidase 1), PPAR-α (Peroxisome proliferator-activated receptor-alpha), or CPT-1α (Carnitine palmitoyltransferase 1 alpha) genes.

[0180] When HepG2 liver cancer cells reached 80% confluence, 2 x 10 5Cells were seeded in wells and used for the experiment. The following day, the medium was replaced with serum-free medium to induce starvation for 4 hours. After 4 hours, the untreated control and the peptide complexes (0.2, 2, and 20 μg / ml) were treated, and RNA was extracted 24 hours later and RT-PCR was performed. RNA was extracted using the easy-BLUE™ Total RNA extraction kit (Qiagen, Germany). The extracted RNA was converted to cDNA using the RT-PCR premix (iNtRON Biotechnology, Seongnam, Korea). A reaction mixture was prepared with the PCR premix (iNtRON Biotechnology, Seongnam, Korea) and primers for the PGC-1α, ACOX-1, PPAR-α, or CPT-1α genes, and PCR was performed using a PCR machine (Eppendorf, Germany). Subsequently, the mRNA expression pattern was determined by agarose gel electrophoresis. The base sequences of the primers used in the experiment are shown in Table 5 below.

[0181] Gene primer sequence (5' -> 3') Sequence number PGC-1αFAGTCTGTATGGAGTGACATCGAG19RGGCAATCCGTCTTCATCCAC20ACOX-1FCCGCCGAGAGATCGAGAAC21RCAGTTGCCTGGTGAAGCAAG22PPAR-αFAAGGGCTTCTTTCGGCGAAC23RTGACCTTGTTCATGTTGAAGTTCTTCA24CPT-1αFCCTCCAGTTGGCTTATCGTG25RTTCTTCGTCTGGCTGGACAT26GAPDHFGTG ATG GCA TGG ACT GTG GT9RGGA GCC AAA AGG GTC ATC AT10

[0182] As shown in Figs. 12a and 12b, the experimental results confirmed that the expression of PGC-1α, ACOX-1, PPAR-α, or CPT-1α genes, which are FFA beta oxidation-related genes, was promoted by the peptide complex in HepG2 cells.

[0183] Experimental Example 13: Promotion of lipolytic enzyme protein expression in adipocytes

[0184] A protein expression analysis (western blot analysis) was performed to determine whether the peptide having the amino acid sequence of sequence number 2 manufactured in Manufacturing Example 1 promotes the expression of lipolytic enzyme protein in adipocytes.

[0185] When 3T3-L1 preadipocytes reached 80% confluence, 5 x 10 5Cells were seeded per well and used in the experiment. Two days after reaching confluence, the medium was replaced with differentiation induction medium [DMEM medium containing 10% FBS, 1 μg / ml insulin, 0.5 mM isobutylmethylxanthine (IBMX) (Sigma, USA), and 1 μM dexamethasone (Sigma, USA)] to induce differentiation into adipocytes. Two days after induction, the medium was replaced with medium containing 10% FBS and 10 μg / mL insulin for 2 days, and then the medium was replaced with medium containing 10% FBS every 2 days until differentiation into adipocytes. Upon completion of differentiation, the medium was replaced with serum-free medium and cultured for 4 hours to induce starvation. The cells were divided into a group treated with nothing (negative control group), a group treated with the peptide of Preparation Example 1 (2, 20 μg / ml), and a group treated with TNFα (20 nM) (positive control group). The cells were treated with the above substances at the specified concentrations and incubated for 1 hour. Then, the cells of each treatment group were lysed by adding lysis buffer. After lysis, the cells were centrifuged at 4°C and 12,000 rpm for 30 minutes, and the obtained proteins were quantified using a BCA kit. The proteins were subjected to SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) and then electrotransferred to a membrane. The membrane with the protein attached was blocked by treating it with 5% skim milk, and then the primary antibody was reacted overnight at 4°C. After washing with PBS-T, the secondary antibody was reacted for 1 hour at room temperature, washed again with PBS-T, and visualized using a western detection reagent (Elpis Biotech, Daejeon, Korea) using Gel Doc (Bio-Rad, Hercules, CA, USA).The antibodies used in the experiment are as follows: anti-ATGL antibody (Cell signaling technology (CST), USA), anti-pHSL antibody (Cell signaling technology (CST), USA), anti-PLIN antibody (Cell signaling technology (CST), USA), anti-α-tubulin antibody (Santa Cruz Biotechnology, USA). As a result of the experiment, as shown in Figures 13a and 13b, when the peptide of the present invention was treated, it was confirmed that the expression of ATGL (Adipose triglyceride lipase), pHSL (phosphorylated Hormone-Sensitive Lipase), and PLIN (Perilipin, lipid droplet-associated protein), which are lipolytic enzyme proteins, increased in adipocytes.

[0186] Experimental Example 14: Promotion of lipolysis in adipocytes

[0187] The amount of glycerol released as a lipolysis product was analyzed to determine whether the peptide having the amino acid sequence of sequence number 2 manufactured in Manufacturing Example 1 promotes lipolysis in adipocytes.

[0188] When 3T3-L1 preadipocytes reached 80% confluence, 5 x 10 5Cells were seeded per well and used in the experiment. Two days after reaching confluence, the medium was replaced with differentiation induction medium [DMEM medium containing 10% FBS, 1 μg / ml insulin, 0.5 mM isobutylmethylxanthine (IBMX) (Sigma, USA), and 1 μM dexamethasone (Sigma, USA)] to induce differentiation into adipocytes. Two days after induction, the medium was replaced with medium containing 10% FBS and 10 μg / mL insulin for 2 days, and then the medium was replaced with medium containing 10% FBS every 2 days until differentiation into adipocytes. Upon completion of differentiation, the medium was replaced with serum-free medium and cultured for 4 hours to induce starvation. The cells were divided into a group treated with nothing (negative control group), a group treated with the peptide of Preparation Example 1 (2, 20 μg / ml), and a group treated with TNF-α (20 nM) (positive control group). The cells were treated with the substances at the given concentrations, cultured for 48 hours, and the supernatant was obtained. A glycerol release assay was performed on the obtained supernatant using a "Glycerol Colormetric assay kit" (Cayman chemical, USA) to compare the amount of released glycerol. As a result of the glycerol release assay, as shown in Fig. 14, when the peptide of the present invention was treated, it was confirmed that the amount of glycerol released from adipocytes increased in a concentration-dependent manner depending on the treated peptide.

[0189] Experimental Example 15: Inhibition of insulin resistance signaling and promotion of insulin sensitivity signaling

[0190] It was tested through protein expression analysis whether the peptide having the amino acid sequence of sequence number 2 manufactured in Manufacturing Example 1 suppresses insulin resistance and promotes insulin sensitivity signal transduction in adipocytes.

[0191] When 3T3-L1 preadipocytes reached 80% confluence, 5 x 10 5Cells were seeded per well and used in the experiment. Two days after reaching confluence, the medium was replaced with differentiation induction medium [DMEM medium containing 10% FBS, 1 μg / ml insulin, 0.5 mM isobutylmethylxanthine (IBMX) (Sigma, USA), and 1 μM dexamethasone (Sigma, USA)] to induce differentiation into adipocytes. Two days after induction, the medium was replaced with medium containing 10% FBS and 10 μg / mL insulin for 2 days, and then the medium was replaced with medium containing 10% FBS every 2 days until differentiation into adipocytes. Upon completion of differentiation, the medium was replaced with serum-free medium and cultured for 4 hours to induce starvation. Here, rhTNF-α (2 nM), insulin (1 μg / ml), and the peptide of Preparation Example 1 (2, 20 μg / ml) were treated respectively and incubated for 1 hour. After 30 minutes of incubation, the cells of each treatment group were lysed by adding lysis buffer, and the obtained proteins were quantified using a BCA kit by centrifugation at 4°C and 12,000 rpm for 30 minutes. The proteins were subjected to SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) and then electrotransferred to a membrane. The membrane with the protein attached was blocked by treating it with 5% skim milk, and then the primary antibody was reacted overnight at 4°C. After washing with PBS-T, the secondary antibody was reacted for 1 hour at room temperature, washed again with PBS-T, and visualized using a western detection reagent (Elpis Biotech, Daejeon, Korea) using Gel Doc (Bio-Rad, Hercules, CA, USA).The antibodies used in the experiment were as follows: anti-Phospho-IRS (Ser302) antibody (Cell signaling technology (CST), USA), anti-Phospho-IRS (Tyr632) antibody (Cell signaling technology (CST), USA), anti-Phospho-AKT antibody (Cell signaling technology (CST), USA), anti-Phospho-AMPK antibody (Cell signaling technology (CST), USA), anti-α-tubulin antibody (Santa Cruz Biotechnology, USA). As a result of the experiment, as shown in Figures 15a and 15b, when the peptide of the present invention was treated, it was confirmed that phosphorylation of IRS (Insulin Receptor Substrate) Tyr632, which is an insulin sensitivity promoting factor, and activation of phosphorylation-AKT were promoted. In addition, an increase in phosphorylation of AMPK, which is a signaling protein that increases insulin sensitivity, was confirmed. On the other hand, it was confirmed that insulin resistance was suppressed by reducing phosphorylation of IRS (Insulin Receptor Substrate) Ser302 under an environment that induces insulin resistance.

[0192] Manufacturing Example 2: Manufacturing of a pharmaceutical composition

[0193] 2-1. Manufacturing of Sanje

[0194] 2 g of the peptide complex of the present invention or the peptide of the present invention

[0195] 1 g lactose

[0196] The above ingredients were mixed and filled into a sealed bag to prepare a powder.

[0197] 2-2. Manufacturing of tablets

[0198] 100 mg of the peptide complex of the present invention or the peptide of the present invention

[0199] 100 mg of corn starch

[0200] 100 mg of lactose

[0201] Magnesium stearate 2 mg

[0202] After mixing the above ingredients, tablets were manufactured by pressing them according to a conventional tablet manufacturing method.

[0203] 2-3. Manufacturing of capsules

[0204] 100 mg of the peptide complex of the present invention or the peptide of the present invention

[0205] 100 mg of corn starch

[0206] 100 mg of lactose

[0207] Magnesium stearate 2 mg

[0208] After mixing the above ingredients, the mixture was filled into a gelatin capsule according to a conventional capsule manufacturing method to produce a capsule.

[0209] 2-4. Manufacturing of rings

[0210] 1 g of the peptide complex of the present invention or the peptide of the present invention

[0211] 1.5 g of lactose

[0212] 1 g of glycerin

[0213] 0.5 g of xylitol

[0214] After mixing the above ingredients, it was manufactured to have 4g per pill according to the usual method.

[0215] 2-5. Preparation of granules

[0216] 150 mg of the peptide complex of the present invention or the peptide of the present invention

[0217] 50 mg of soybean extract

[0218] 200 mg of glucose

[0219] 600 mg of starch

[0220] After mixing the above ingredients, 100 mg of 30% ethanol was added, dried at 60°C to form granules, and then filled into a bag.

[0221] Manufacturing Example 3: Manufacturing of a functional food composition

[0222] 3-1. Manufacturing of health foods

[0223] 500 μg of the peptide complex of the present invention or the peptide of the present invention

[0224] Vitamin mixture appropriate amount

[0225] Vitamin A acetate 70 mg

[0226] Vitamin E 1.0 mg

[0227] Vitamin D 0.13 mg

[0228] Vitamin B2 0.15 mg

[0229] Vitamin B6 0.5 mg

[0230] Vitamin B12 0.2 mg

[0231] 10 mg of vitamin C

[0232] 10 mg of biotin

[0233] 1.7 mg of nicotinamide

[0234] 50 mg of folic acid

[0235] Calcium pantothenate 0.5 mg

[0236] Appropriate amount of mineral mixture

[0237] 1.75 mg of ferrous sulfate

[0238] 0.82 mg of zinc oxide

[0239] Magnesium carbonate 25.3 mg

[0240] 15 mg of monobasic potassium phosphate

[0241] 55 mg of dibasic calcium phosphate

[0242] 90 mg of potassium citrate

[0243] 100mg of calcium carbonate

[0244] Magnesium chloride 24.8 mg

[0245] The composition ratio of the above vitamin and mineral mixture is a preferred example of a mixture of ingredients suitable for relatively healthy foods, but the mixing ratio may be arbitrarily modified, and the above ingredients may be mixed according to a conventional health food manufacturing method, granules may be manufactured, and used to manufacture a health food composition according to a conventional method.

[0246] 3-2. Manufacturing of health drinks

[0247] 500 μg of the peptide complex of the present invention or the peptide of the present invention

[0248] 1000mg of citric acid

[0249] 100g of oligosaccharide

[0250] 2g plum concentrate

[0251] 1g of taurine

[0252] Add purified water to make a total of 900ml

[0253] The above ingredients were mixed according to the conventional health beverage manufacturing method, then stirred and heated at 85℃ for about 1 hour, the resulting solution was filtered, placed in a sterilized container, sealed and sterilized, and then stored in a refrigerator before being used to manufacture a health beverage composition. The above composition ratio is a preferred example of a mixture of ingredients relatively suitable for a preferred beverage, but the mixing ratio can be arbitrarily modified according to regional and ethnic preferences such as the demand class, demand country, and intended use.

[0254] Although representative embodiments of the present application have been described above as examples, the scope of the present application is not limited to the specific embodiments described above, and a person with ordinary knowledge in the relevant field will be able to make appropriate changes within the scope described in the claims of the present application.

Claims

1. A peptide complex comprising: (i) a peptide comprising the amino acid sequence of SEQ ID NO: 1; and (ii) a peptide comprising the amino acid sequence of SEQ ID NO:

2.

2. A peptide complex according to claim 1, wherein the peptide complex has antidiabetic activity.

3. A pharmaceutical composition for preventing or treating diabetes, comprising the peptide complex of claim 1 as an active ingredient.

4. In claim 3, A pharmaceutical composition for preventing or treating diabetes, wherein the peptide complex promotes the absorption of glucose.

5. In claim 3, A pharmaceutical composition for preventing or treating diabetes, wherein the peptide complex suppresses insulin resistance signals or promotes insulin sensitivity signals.

6. In claim 3, A pharmaceutical composition for preventing or treating diabetes, wherein the above peptide complex inhibits phosphorylation of Ser302 of IRS (Insulin receptor kinase) or phosphorylation of JNK (c-Jun N-terminal kinase).

7. In claim 3, A pharmaceutical composition for preventing or treating diabetes, wherein the peptide complex inhibits the expression of the TNF-α gene, the mTOR (mammalian Target Of Rapamycin) gene, or the p70S6K gene under an environment that induces insulin resistance.

8. In claim 3, A pharmaceutical composition for preventing or treating diabetes, wherein the peptide complex increases phosphorylation of IRS (Insulin Receptor Substrate) Tyr632, promotes activation of PI3K (Phosphoinositide 3-kinase), activation of ATK, or activation of AMPK (AMP-activated protein kinase).

9. In claim 3, A pharmaceutical composition for preventing or treating diabetes, wherein the peptide complex promotes the expression of one or more genes selected from the group consisting of Leptin, Adiponectin, IRS-1 (Insulin receptor substrate 1), GLUT4 (Glucose transporter type 4), PGC-1α, ACOX-1, PPAR-α, and CPT-1α.

10. In claim 3, A pharmaceutical composition for preventing or treating diabetes, wherein the peptide complex inhibits the production of reactive oxygen species (ROS) induced by free fatty acids, the expression of the gene for TNF-α, the expression of the TNF-α protein, or the expression of the IL-1β protein, or the death of pancreatic beta cells induced by free fatty acids.

11. A functional food composition for controlling blood sugar levels, comprising the peptide complex of claim 1 as an active ingredient.

12. In claim 11, A functional food composition for regulating blood sugar levels, wherein the above peptide complex promotes the absorption of glucose.

13. In claim 11, A functional food composition for controlling blood sugar levels, wherein the peptide complex suppresses insulin resistance signals or promotes insulin sensitivity signals.

14. A peptide comprising the amino acid sequence of sequence number 2.

15. A peptide according to claim 14, wherein the peptide has anti-diabetic activity or anti-obesity activity.

16. A pharmaceutical composition for preventing or treating diabetes, comprising the peptide of claim 14 as an active ingredient.

17. In claim 16, A pharmaceutical composition for preventing or treating diabetes, wherein the peptide inhibits insulin resistance signaling or promotes insulin sensitivity signaling.

18. In claim 16, The above peptide has an activity of promoting phosphorylation of Ty632 of IRS (Insulin receptor substrate), promoting activation of phospho-AKT, or promoting phosphorylation of AMPK; Alternatively, a pharmaceutical composition for preventing or treating diabetes, which has an activity of inhibiting phosphorylation of Sre302 of IRS under an environment inducing insulin resistance.

19. A pharmaceutical composition for preventing or treating obesity, comprising the peptide of claim 14 as an active ingredient.

20. In claim 19, The above peptide is a pharmaceutical composition for preventing or treating obesity that promotes the decomposition of fat in fat cells.

21. In claim 19, A pharmaceutical composition for preventing or treating obesity, wherein the above peptide increases the expression of ATGL (Adipose triglyceride lipase), pHSL (phosphorylated Hormone-Sensitive Lipase), or PLIN (Perilipin, lipid droplet-associated protein), which are lipolytic enzyme proteins in adipocytes.

22. A functional food composition for controlling blood sugar levels, comprising the peptide of claim 14 as an active ingredient.

23. In claim 22, A functional food composition for controlling blood sugar levels, wherein the peptide suppresses insulin resistance signals or promotes insulin sensitivity signals.

24. A functional food composition for preventing or improving obesity, comprising the peptide of claim 14 as an active ingredient.

25. In claim 24, The above peptide is a functional food composition for preventing or improving obesity that promotes the decomposition of fat in fat cells.

Images